Sequence-based high-throughput methods for generating camelid antibodies to cover a wide range of epitopes at high resolution

Abstract

A method for generating multiple different camelid antibodies that cover a target functional epitope with high resolution. A method for generating camelid antibodies is also provided. More specifically, a method for generating camelid single heavy chain antibodies or binding portions thereof for recognizing an antigen, particularly for therapeutic applications, is provided.

Description

Background of the Invention

[0002] Treating functional epitopes against disease targets is a major challenge in current antibody technology because each target has hundreds or thousands of epitopes, only a very limited number of which are involved in biological functions. However, current technologies take measures to randomly and sporadically generate conjugates. Therefore, insufficient epitope coverage, selection redundancy, and low success rate are the existing bottlenecks.

[0003] Dromedary and Bactrian camels belong to the Old World camelids, while llamas and alpacas belong to the New World camelids. Only the camelid family (commonly known as the camel family) has a dichotomous adaptive humoral immune system with conventional antibodies and homodimeric antibodies (HcAbs). In addition, HcAbs have evolved a comprehensive antibody complementarity structure, which can serve as one of the driving factors for recognizing a very wide range of antigenic epitopes, and IgG1 antibodies complement the HcAb binding structure to obtain more diverse recognition.

[0004] The camelid has a unique humoral immune system, consisting of two types of HcAb, IgG2 and IgG3, which have hinge regions of varying lengths. Phylogenetic analysis confirmed that HcAb branched off from the conventional antibody IgG1 and is the most recent adaptive change of IgG1. It has been reported that IgG1 and IgG3 can neutralize West Nile virus, while IgG2 seems to be less effective in infected or vaccinated animals (Daley LP, Clin. Vaccine Immunol. 17:239–46, 2010). In addition, the epitope ranges of HcAb and IgG1 can overlap, but HcAb can access sites that IgG1 cannot reach. The understanding of the exact roles and functions of the various camel IgG subtypes is still in its infancy. However, the multiple antibody paratope structures of HcAb (IgG2 and IgG3), such as elongated, convex, concave, protruding, and flat surfaces, provide excellent opportunities for developing antibodies against challenging targets, especially in the areas of diagnosis and therapeutic applications. The simple structure of HcAb without light chain pairing also makes gene cloning and antibody engineering easier. In addition, since the HcAb repertoire of immunized dromedary camels or llamas exhibits a different recognition pattern from conventional IgG1 (McCoy LE, J. Exp. Med. 2012), and IgG1 has high affinity and the required functions for certain unique epitopes or drug target hotspots (Cristina Basilico, The Journal of Clinical Investigation, Volume 124 Number 7 July, 2014; Bas van der Woninga, MABS, VOL. 8, NO. 6, 1126–1135, 2016), conventional IgG1, which accounts for 25-50% of the total camelid IgG, plays an important role in expanding the antigen-binding repertoire. Camelids have two types of light chains (Vκ or Vλ) that pair with VH 1 to form conventional IgG1, and their germline organization has also recently been revealed (Laura M. Griffin, Journal of Immunological Methods Volume 405, Pages 35-46, March 2014; Alex Klarenbeek, mAbs 7:4, 693--706; 2015).

[0005] In the primary VHH B cell repertoire, the extensive somatic hypermutation and gene conversion in VHHs are significantly higher than in VHs (30% vs 1.5%), which diversifies the HcAb repertoire to compensate for the lack of light chains. Equally important, the VHH domain of HcAb expands the overall antigen-binding repertoire, for example, by creating a flat (olive-shaped) structure with a convex paratope surface, making it well-suited to insert into cavities or crevices (such as active sites and allosteric sites) on the antigen surface. In contrast, the VH-VL domains of conventional IgG contain more flat or concave paratope surfaces. The following mechanisms of B cell repertoire diversification contribute significantly to the unique binding characteristics of VHHs: (i) Most VHHs contain FR2s with hydrophilic amino acid substitutions (Val37→Phe / Tyr, Gly44→Glu, Leu45→Arg, and Trp47→Gly) compared to the conventional antibody framework region 2 (FR2), which are involved in light chain binding; (ii) According to Kabat numbering, the extended CDR1 region has extensive somatic hypermutation in residues 27-30 in immune B cells; (iii) In most VHHs, there are additional disulfide bonds between CDR1-CDR3 (camel) or FR2-CDR3 (alpaca and llama); (iv) In some parts of VHHs, there are additional disulfide bonds within CDR1 and CDR3; (v) Longer CDR3 loops have also been identified due to additional non-templated nucleotide insertions in some VHHs (Adhdi Arbabi-Ghahroudi, Frontiers in Immunology, Vol 8, 2017; Viet Khong Nguyen, The EMBO Journal Vol.19 No.5 2000; Mehdi Arbabi-Ghahroudi et al, Front. Immunol., 20 November 2017; Nguyen VK, Immunogenetics 54:39–47, 2002; Conrath KE, Dev Comp Immunol 27:87–103, 2003). Multiple sets of non-classical VHHs (lacking FR2 hydrophilic amino acids) have also been found, which are derived from the same IGHV3 or IGHV4, D, and J gene loci as conventional IgG1. These heavy chain antibodies may recognize the same or similar epitopes as IgG1 because the two classes of antibodies share the same or similar CDR3s responsible for epitope recognition (Conrath KE Dev Comp Immunol 27:87–103, 2003; Nick Deschacht, The Journal of Immunology.184(10)5696-5704, 2010). The HcAb germline organization and VHH structures are as Figure 1A shown in B.

[0006] Functional and physicochemical advantages such as high affinity, specificity, simple gene cloning, high expression yield, easy purification, high solubility, and stable single-domain folding have laid the foundation for the development of HcAb technology. In addition, an antigen-binding library expanded from conventional IgG1 can achieve a broader epitope coverage. Moreover, the close homology between VHH, VH, Vκ, and Vλ and their human counterparts provides great advantages for humanization and therapy development. By taking advantage of the unique antibody architecture of camels and the advantages of NGS technology to capture the entire B-cell antibody repertoire, the present invention discloses a new method to generate hundreds of different antibodies to cover a wide range of epitopes of the target with high resolution, thereby targeting these important functional epitopes in a systematic and desirable manner. Summary of the Invention

[0007] The present invention discloses a high-throughput method for producing camel antibodies against an antigen, comprising: a) enriching and proliferating B cells specific for the antigen from an immunized camel, b) generating an antibody next-generation sequencing (NGS) library comprising VHH 2 、VHH 3 and VHH 1 chain sequences from the antigen-specific B cells, c) grouping the sequences of VHH 2 、VHH 3 and VH 1 in the NGS library by lineage, d) ranking the lineages containing VHH heavy chains (VHH 2 、VHH 3 ) by one or more lineage preference factors, e) selecting representative sequences from the top-ranked VHH heavy-chain lineages (VHH 2 、VHH 3 ) in the NGS database, f) testing the antibodies containing the selected VHH heavy-chain sequences to determine whether the antibody binds to the antigen or a portion thereof. In one embodiment, the antigen comprises multiple epitopes.

[0008] In one embodiment, in the CDR3 group of a lineage, the minimum CDR3 distance of a specific CDR3 ≤ 1, where the minimum CDR3 distance of a specific CDR3 is the minimum Hamming distance of this CDR3 compared to other CDR3s of the same length.

[0009] In the embodiment, the lineage preference factors are selected from: lineages with sequence abundance from high to low, lineages with amplification coefficients from high to low after in vitro B-cell enrichment and proliferation, changes in lineage sequence abundance during the immune process, changes in lineage sequence abundance before and after depleting some unwanted B cells, lineages sharing a naïve B-cell origin between VHH and VH, avoiding sequences with poor developability, and combinations thereof.

[0010] In some embodiments, VHH2 and / or VHH 3 The lineage is selected from the top 100 lineages in e).

[0011] In some embodiments, the method further comprises repeating steps e)-f) to obtain camel antibodies, wherein the representative sequences are selected from the top 101-200, 201-300, 301-400, 401-500, 501-600, 601-700, 701-800, 801-900, 901-1000, 1001-1100, 1101-1200, 1201-1300, 1301-1400, 1401-1500, 1501-1600, 1601-1700, 1701-1800, 1801-1900 or 1901-2000 ranked lineages. In some embodiments, the method further comprises repeating steps e)-f) to obtain camel antibodies, wherein the representative sequences are selected from the top 2,000 to 10,000 ranked lineages.

[0012] In some embodiments, the test antibody is expressed by prokaryotic or eukaryotic cells.

[0013] In a preferred embodiment, the method further comprises monitoring the immune responses of IgG2, 3 (HcAb) and IgG1 (conventional IgG).

[0014] In some embodiments, sequences within the same lineage group of the selected IgG2 or IgG3 only heavy chain antibodies can be selected by repeating steps e)-f) of the method to optimize the antibody.

[0015] In some embodiments, the antigen or immunogen can be a cell, tissue or biological fluid.

[0016] In some embodiments, the antigen can be a complex immunogen, and the method further comprises: binding the antibody determined in step (f) to the complex immunogen, and identifying the individual antigens contained in the complex immunogen by protein array, cell / tissue antigen cDNA library or mass spectrometry-based immunoprecipitation.

[0017] In one aspect of the present invention, the method further comprises subdividing into lineage subgroups according to certain VHH characteristics selected from: i) the hydrophilic region of FR2; ii) extended CDR1; iii) additional disulfide bonds between CDR1-CDR3 or FR2-CDR3; iv) additional disulfide bonds within CDR3; v) long CDR3 (>15 aa); vi) additional disulfide bonds within CDR1; vii) non-classical VHH having the same V and J germlines as conventional IgG1; viii) non-classical VHH having certain predetermined sequence characteristics; ix) certain predetermined canonical binding loop structures; x) convergent motifs or sequence characteristics between individual animals from the same immunized group; xi) CDR2 length; xii) CDR3 length; xiii) CDR3 length and properties; xiv) the presence of three or more positive charges in the CDR3 region; xv) the number of cysteines in the amino acid sequence; and xvi) 2-4 amino acid motifs in the CDR regions. The motifs are identified from the 3D structure of the ligand / receptor complex.

[0018] In another aspect of the present invention, there is provided a method for high-throughput generation of camel antibodies against an antigen, the method comprising: a) enriching and proliferating antigen-specific B cells from immunized camels; b) generating an antibody NGS library containing VHH 2 、VHH 3 、VH 1 and VL 1 chain sequences from the antigen-specific B cells; c) grouping the VHH 2 、VHH 3 、VH 1 and VL 1 NGS sequences by lineage; d) performing VH 1 / VL 1 lineage pairing according to the anchor conjugates generated by single B cell sorting and heterologous hybridoma methods; e) ranking the lineages and lineage pairs in steps c) and d) according to lineage preference factors; f) selecting representative sequences or sequence pairs from the top-ranked VHH 2 、VHH 3 lineages and VH 1 / VL 1 lineage pairs in the NGS library; g) testing the antibodies containing the selected heavy chain / light chain sequence pairs or heavy chain VHH 2 、VHH 3 sequences to determine whether the antibody binds to the antigen or a portion thereof. In one embodiment, the antigen comprises multiple epitopes.

[0019] In one embodiment, in the CDR3 set of a lineage, the minimum CDR3 distance of a specific CDR3 ≤ 1, where the minimum CDR3 distance of the specific CDR3 is the minimum Hamming distance of this CDR3 compared to other CDR3s of the same length.

[0020] In one embodiment, the sorting of the lineage pairs in step e) is based on the VH of the lineage pairs 1 Lineage priority factors of the lineage.

[0021] In some embodiments, the lineage priority factors are selected from: lineages with sequence abundance from high to low, lineages with in vitro B cell enrichment and proliferation amplification coefficients from high to low, changes in lineage sequence abundance during the immune process, changes in lineage sequence abundance before and after depleting certain unwanted B cells, lineages sharing a naive B cell origin between VHH and VH, avoiding sequences with poor developability, and combinations thereof.

[0022] In some embodiments, the anchors for the IgG1 repertoire are generated by single B cell sorting and heterologous hybridoma methods.

[0023] In some embodiments, the test antibody is expressed by prokaryotic or eukaryotic cells.

[0024] In some embodiments, one representative VHH sequence or one representative VH 1 / VL 1 pair is selected from every 100 lineages or lineage pairs. In some embodiments, the 100 lineages / lineage pairs respectively include 95, 90, 85, 80, 75, 70, 65, 60, 55, 50, 45, 40, 35, 30, 25, 20, 15 or 10 VHH lineages and 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 or 95 VH 1 / VL 1 lineage pairs, where VL 1 includes Vκ and Vλ.

[0025] In some embodiments, the method further comprises repeating steps e)-f) to obtain camelid antibodies, wherein the representative sequences are selected from the top 101-200, 201-300, 301-400, 401-500, 501-600, 601-700, 701-800, 801-900, 901-1000, 1001-1100, 1101-1200, 1201-1300, 1301-1400, 1401-1500, 1501-1600, 1601-1700, 1701-1800, 1801-1900 or 1901-2000 sorted lineages. In some embodiments, the method further comprises repeating steps e)-f) to obtain camelid antibodies, wherein the representative sequences are selected from the top 2,000 to 10,000 sorted lineages.

[0026] In some embodiments, the criteria for lineage sorting / selection are selected from: lineages with decreasing sequence abundance from high to low, lineages with decreasing amplification coefficient from high to low, changes in lineage sequence abundance during the immunization process, changes in lineage sequence abundance before and after depletion of certain unwanted B cells, lineages sharing a naïve B cell origin between VHH and VH, avoidance of poorly developable sequences, and combinations thereof.

[0027] In some embodiments, the antigen or immunogen can be a cell or tissue, and the resulting VHH is used to identify the corresponding antigen of an individual by protein array or cell / tissue antigen cDNA library or immunoprecipitation-based mass spectrometry.

[0028] In another aspect of the present invention, a method for high-throughput generation of camelid antibodies against multiple epitopes of a specific antigen further comprises subdividing VHH lineages having characteristics selected from the following: i) hydrophilic region of FR2; ii) extended CDR1; iii) additional disulfide bond between CDR1-CDR3 or FR2-CDR3; iv) long CDR3 (≥15aa); v) sequences sharing the same naïve B cell origin between VHH 2 、VHH 3 and VH 1 ; vi) sequence-based prediction of antigen-binding loop structure; x) convergent motifs or sequence features between individual animals from the same immunized group; xi) CDR2 length; xii) CDR3 length; xiii) CDR3 length and characteristics; xiv) presence of 3 or more positive charges in the CDR3 region; xv) number of cysteines in the amino acid sequence; and xvi) CDR regions having a 2-4 amino acid motif. The motif is identified from the 3D structure of the ligand / receptor complex.

[0029] In some embodiments, sequences within the same lineage group of the antibodies tested in the first round can be selected for optimizing the antibody by repeating steps f)-g) in a second round.

[0030] In some embodiments, the method for high-throughput obtaining of camelid antibodies against an antigen further comprises applying the selected VHH sequences to direct VH 1 -VL 1 pair selection, wherein the selection criteria include 1) CDR1 and CDR2 differences; 2) differences in FR1, 2, 3, and 4.

[0031] Provided is a method for generating a humanized VHH antibody, comprising a) enriching and proliferating antigen-specific B cells from an immunized camelid; b) generating an antibody NGS library containing VHH 2 、VHH 3 and VH 1 chain sequences from the antigen-specific B cells; c) grouping the VHH 2 、VHH 3 and VH 1 NGS sequences by lineage; d) identifying replaceable positions in the parental VHH 2 、VHH 3 antibodies or VH 1 that share the same naïve B cell origin by comparing the amino acid sequences with those of a plurality of related antibodies, wherein the related antibodies each bind the same epitope as the parental antibody in the same lineage; e) replacing the amino acids at one or more replaceable positions of the parental VHH 2 or VHH 3 antibody with the amino acids at the corresponding positions in a human antibody; f) testing the antibody containing the substituted residues within the selected sequences to determine whether the antibody binds to the antigen or a portion thereof.

[0032] In one embodiment, the replacement positions of the humanized VHH antibody are in the FR region. In one embodiment, the replacement positions of the humanized VHH antibody are in the CDR region.

[0033] In one embodiment, the parental antibody is a camel antibody. In one embodiment, the parental antibody is a humanized camel antibody.

[0034] In another aspect of the present invention, there is provided an isolated camel antibody or antigen-binding portion thereof comprising an antibody sequence produced by the present invention.

[0035] In another aspect of the present invention, there is provided a pharmaceutical composition comprising a camel antibody of the present invention and a pharmaceutically acceptable carrier.

[0036] Brief Description of the Drawings

[0037] Exemplary embodiments are shown in the reference figures. The embodiments and the figures disclosed herein are illustrative and not restrictive.

[0038] Figure 1A The organization of the camelid locus encoding VHH, VH, and CH immunoglobulins is shown. Figure 1B The camelid VHH structure is shown.

[0039] Figure 2 Enrichment / proliferation of immunized and antigen-specific B cells in camelids is shown.

[0040] Figure 3 Shown are IgG isotype-specific primer sets for amplifying VHH 2 , VHH 3 , VH 1 , Vk, and Vλ.

[0041] Figure 4 Shown is the generation of VHH 2 , VHH 3 , VH 1 , Vk, and Vλ NGS libraries and lineage grouping.

[0042] Figure 5 Shown is the further grouping of VHH 2 and VHH 3 lineages based on sequence characteristics.

[0043] Figure 6 Shown is the pairing of VH-Vk or VH-Vλ lineages with anchors developed using single B cell sorting and heterologous hybridomas.

[0044] Figure 7 Shown are the sequences selected from each lineage for binder and bioactivity screening.

[0045] Figure 8 Shown is the optimization of the selected lead within the same lineage. Leads from the first round of screening are marked with @ and +.

[0046] Figure 9 Shown is the workflow for humanizing VHH and VH-VL by lineage analysis.

[0047] Figure 10 Shown is the fluorescence signal from the selected antibodies that bind to EGFR.

[0048] Figure 11Shows the ELISA analysis of antibodies secreted from selected co - cultures of anti - KLH antibody - secreting B cells and alpaca feeder cells. B cells alone without feeder cells do not grow or expand. It is used as a negative control. Immunized animal serum diluted 1:1000 with control medium is used as a positive control for ELISA.

[0049] Figure 12 Shows the expansion of B cells obtained from co - cultures of feeder cells and antibody - secreting B cells compared to the expansion of B cells alone without feeder cells.

[0050] Figure 13 Shows the ELISA assay results of the supernatants from selected clones of KLH NGS data.

[0051] Figure 14 Shows the workflow for identifying blocking antibodies based on the CDR region 2 - 4 amino acid motifs identified from the 3 - d structure of the ligand / receptor complex.

[0052] Figure 15 Shows two views of the complex formed between PD - 1 and PD - L1, highlighting two peptides of PD - 1 at the complex interface.

[0053] Figure 16 Shows the analysis of the interfacial peptide interactions in the PD - 1:PD - L1 complex.

[0054] Figure 17 Is a phylogenetic tree showing the lineage grouping of selected anti - PD - 1 VHH antibodies. The root of the phylogenetic tree is used as an anchor to define the lineage groups, which include subgroups 1, 2, and 3.

[0055] Figure 18 Is a Venn diagram showing the overlap of the amino acid sequences of the CDR3 domains in the clone libraries from immunized alpacas A1 and A2.

[0056] Figure 19A Shows a selection scheme for identifying overlapping clones from alpacas A1 and A2 with common CDR3 domain and hinge region sequences. Figure 19B The Venn diagram shows the overlap of the amino acid sequences of the hinge regions in the clone libraries from immunized alpacas A1 and A2.

[0057] Figure 20A Shows a selection scheme for identifying overlapping clones from alpacas A1 and A2 with common CDR3 domain and hinge region sequences. Figure 20B The Venn diagram shows the overlap of the amino acid sequences of the hinge regions in the clone libraries from immunized alpacas A1 and A2.

[0058] Figure 21AShows VH and VHH with common CDR3 domain sequences in the library from a single alpaca 2 and VHH 3 Venn diagram of overlapping clones of antibodies. Figure 21B Shows the common CDR3 sequence.

[0059] Figure 22 Is a Venn diagram showing the number of common CDR3 domain sequences among alpacas A1 and A2, VH, VHH 2 and VHH 3 antibodies.

[0060] Figure 23 Shows the antigen-binding affinity measured by FACS, using RPMI8226 cells to express the selected antibody clones of non-classical VHH type and classical VHH type of BCMA.

[0061] Figure 24 Shows the proportion of the respective unique FR2 domain sequences of three antibody libraries binding to three different antigens.

[0062] Figure 25 Shows the frequency of certain amino acid substitutions in the antibody FR2 domains of three antibody libraries binding to three different antigens.

[0063] Figure 26 Shows the proportion of clones with a CDR1 domain length of 11 to 15 amino acids in the respective three antibody libraries binding to three different antigens.

[0064] Figure 27 Shows the binding affinity distribution of antibodies with a "long CDR2" domain among the antibodies of three libraries targeting three different antigens as determined by ELISA.

[0065] Figure 28 Shows the proportion of clones with an additional disulfide bond within the CDR3 domain among the antibodies from three libraries targeting three different antigens.

[0066] Figure 29 and Figure 30 Shows the proportion of clones with an additional disulfide bond between the CDR1 and CDR2 domains among the antibodies from three antibodies targeting three different antigens.

[0067] Figure 31 Shows the analysis of the number of cysteine residues in the V region amino acid sequences of the antibodies from three libraries targeting three different antigens.

[0068] Figure 32 Shows the proportion of clones with an additional disulfide bond between the CDR1 and CDR3 domains among the antibodies from three libraries targeting three different antigens.

[0069] Figure 33 Shown are the proportions of clones with additional disulfide bonds between FR2 and CDR2 domains or between FR2 and CDR3 domains in antibodies from three pools targeting three different antigens

[0070] Figure 34 The correlation between the number of cysteine ​​amino acids in the VHH antibody sequence and the supernatant OD value is shown.

[0071] Figure 35 Shown are the proportions of clones with a "long CDR3" domain for each of the three antibody libraries binding to three different antigens.

[0072] Figure 36 , Figure 37 and Figure 38 Shown is the correlation between the length of the CDR3 domain and the antibody affinity of VHH anti-BCMA antibodies determined by FACS or ELISA.

[0073] Figure 39 Shown is the range of CDR3 lengths of a population of VHH antibodies that bind to nearly the same epitope or the same epitope of a specific antigen.

[0074] Figure 40 Shown are the results of experiments evaluating selected anti-PD1 clones for competition with KEYTRUDA and OPDIVO for binding to PD1.

[0075] Figure 41 The proportion of clones in which Trp118 was replaced by Arg in the VHH antibodies of each of the three antibody pools binding to three different antigens is shown.

[0076] Figure 42 A positive correlation between the length of CDR3 and the ELISA binding activity of anti-KLH VHH antibodies was shown. DETAILED DESCRIPTION

[0077] The following embodiments and other aspects are described and illustrated in conjunction with systems, compositions, and methods which are intended to be exemplary and illustrative, not limiting in scope.

[0078] the term

[0079] Herein, the term "includes" or "comprising" is used to refer to compositions, methods and their respective components useful for the embodiments, and is open to include unspecified elements (whether useful or not). In general, those skilled in the art understand that the terms used herein are generally meant to be "open" terms (e.g., the term "includes" should be interpreted as "including but not limited to", the term "having" should be interpreted as "at least having", etc.).

[0080] Unless otherwise indicated, the terms "a", "an", "the", and similar references used in the description of particular embodiments of the present application (especially in the claims) may be construed to cover both the singular and the plural. The recitation of a range of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each separate value is incorporated into the specification as if it were individually recited herein. Unless otherwise indicated herein or clearly contradicted by context, all methods described herein may be performed in any suitable order. The use of any and all examples, or exemplary language (e.g., "such as") provided herein with respect to certain embodiments is merely intended to better illuminate the present application and does not pose a limitation on the scope of the present application that is otherwise claimed. The abbreviation, "e.g.", is derived from the Latin exempli gratia and is used herein to denote non-limiting examples. Thus, the abbreviation "e.g." is synonymous with the phrase "for example". No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the application.

[0081] The term "plurality" means more than 1, such as more than 2, more than about 5, more than about 10, more than about 20, more than about 50, more than about 100, more than about 200, more than about 500, more than about 1000, more than about 2000, more than about 5000, more than about 10,000, more than about 20,000, more than about 50,000, more than about 100,000, and generally not more than about 200,000. "Group" means containing a plurality of items.

[0082] As used herein, the term "about" refers to measurable values such as amounts, durations, etc., including variations of ±20%, ±10%, ±5%, ±1%, ±0.5%, or ±0.1% from the specified value.

[0083] As used herein, the term "epitope" may include any protein determinant capable of specifically binding to an immunoglobulin or a T cell receptor. Epitope determinants are usually composed of surface groups of molecules with chemical activity, such as amino acids or sugar side chains, and usually have specific three-dimensional structural features as well as specific charge features. An antibody is said to specifically bind an antigen when the equilibrium dissociation constant ≤1 μM, preferably ≤100 nM, and most preferably ≤10 nM.

[0084] The term "K D " may refer to the equilibrium dissociation constant of a particular antibody-antigen interaction.

[0085] As used herein, the term "immune response" can refer to, for example, the action of lymphocytes, antigen-presenting cells, phagocytes, granulocytes, and soluble macromolecules produced by the above cells or the liver (including antibodies, cytokines, and complement) resulting in the selective killing, destruction, or elimination of an organism of an invading pathogen, an infected pathogen's cell or tissue, a cancer cell, or a normal biological cell or tissue in the case of autoimmunity or pathological inflammation.

[0086] As used herein, "antigen-specific T cell response" can refer to a response of T cells caused by the stimulation of T cells with a T cell-specific antigen. Non-limiting examples of the response of T cells to antigen-specific stimulation include proliferation and the production of cytokines (such as the production of IL-2).

[0087] As used herein, the term "antibody" refers to a complete immunoglobulin or monoclonal or polyclonal antigen-binding fragment that has an Fc (fragment crystallizable) region or an FcRn-binding fragment of the Fc region, herein referred to as an "Fc fragment" or "Fc region". Antigen-binding fragments can be produced by recombinant DNA technology or by enzymatic or chemical cleavage of a complete antibody. Antigen-binding fragments include, but are not limited to: Fab, Fab', F(ab')2, Fv, dAb, and complementarity-determining region (CDR) fragments, single-chain antibodies (scFv), single-domain antibodies, chimeric antibodies, diabodies, and polypeptides containing at least a portion of an immunoglobulin, the portion being sufficient to confer specific antigen-binding ability to the polypeptide. The Fc region includes the portions of the two heavy chains that constitute class two or three antibodies. The Fc region can be produced by recombinant DNA technology or by enzymatic (e.g., papain cleavage) or chemical cleavage of a complete antibody.

[0088] As used herein, the term "antibody fragment" refers to a protein fragment that contains only a portion of a full antibody, typically including the antigen-binding site of the full antibody and thus retaining the ability to bind antigen. Examples of antibody fragments covered by this definition include: (i) Fab fragments, which have VL, CL, VH, and CH1 domains; (ii) Fab' fragments, which are Fab fragments that have one or more cysteine residues at the C-terminus of the CH1 domain; (iii) Fd fragments, which have VH and CH1 domains; (iv) Fd' fragments, which have VH and CH1 domains and one or more cysteine residues at the C-terminus of the CH1 domain; (v) Fv fragments, which have the single antibody arms VL and VH domains; (vi) dAb fragments, which consist of the VH domain (Ward et al., Nature 341, 544-546 (1989)); (vii) isolated CDR regions; (viii) F(ab')2 fragments, which are bivalent fragments comprising two Fab' fragments linked by a hinge region disulfide bond; (ix) single-chain antibody molecules (e.g., single-chain Fv; scFv) (Bird et al., Science 242:423-426 (1988); and Huston et al., PNAS (USA) 85:5879-5883 (1988)); (x) "diabodies", which have two antigen-binding sites and contain heavy chain variable regions (VH) linked to light chain variable regions (VL) in the same polypeptide chain (see, e.g., EP 404,097; WO 93 / 11161; and Hollinger et al., Proc. Natl. Acad. Sci. USA, 90:6444-6448 (1993)); (xi) "linear antibodies", which contain a pair of tandem Fd segments (VH-CH1-VH-CH1) that together with complementary light chain polypeptides form a pair of antigen-binding regions (Zapata et al. Protein Eng. 8(10):1057-1062 (1995); and U.S. Pat. No. 5,641,870).

[0089] As used herein, a "single-chain variable fragment", "single-chain antibody variable fragment", or "scFv" antibody refers to an antibody form that contains only the variable regions of the heavy chain (VH) and light chain (VL) linked by a linker peptide. The scFv can be expressed as a single-chain polypeptide. The scFv retains the specificity of the full antibody from which it is derived. The light and heavy chains can be in either order, e.g., VH-linker-VL or VL-linker-VH, so long as the specificity of the scFv for the target antigen is maintained.

[0090] As used herein, an "isolated antibody" may refer to an antibody that is substantially free of other antibodies having different antigen specificities (e.g., an isolated antibody that specifically binds a TRAIL protein may be substantially free of antibodies that specifically bind antigens other than the TRAIL protein). However, an isolated antibody that specifically binds the human TRAIL protein may cross-react with other antigens (e.g., TRAIL proteins from other species). In addition, an isolated antibody is substantially free of other cellular materials and / or chemicals.

[0091] As used herein, the term "monoclonal antibody" or "monoclonal antibody composition" may refer to a preparation of antibody molecules of a single molecular composition. A monoclonal antibody composition exhibits a single binding specificity and affinity for a particular epitope.

[0092] As used herein, the term "recombinant human antibody" may refer to all human antibodies prepared, expressed, produced, or isolated by recombinant means, such as (a) antibodies isolated from transgenic or transchromosomal animals (e.g., mice) of the human immunoglobulin genes or hybridomas prepared therefrom (as described below), (b) antibodies isolated from a host cell transformed to express a human antibody (e.g., from a transfectoma), (c) antibodies isolated from a recombinant, combinatorial human antibody library, and (d) antibodies prepared, expressed, created, or isolated by any other means that involve splicing human immunoglobulin gene sequences to other DNA sequences. Such recombinant human antibodies have variable regions in which the framework and CDR regions are derived from human germline immunoglobulin sequences. However, in certain embodiments, such recombinant human antibodies may be subjected to in vitro mutagenesis (or in vivo somatic mutagenesis when using human Ig sequence transgenic animals), such that the amino acid sequences of the VH and VL regions of the recombinant antibody, although derived from and related to human germline VH and VL sequences, are not sequences that exist naturally in the human antibody germline repertoire in vivo.

[0093] The term "isotype" may refer to the class of antibody encoded by the heavy chain constant region gene (e.g., IgM or IgG1). Antibodies may be immunoglobulin G (IgG), IgM, IgE, IgA, or IgD molecules, or are derived therefrom.

[0094] The term "VHH 2 ", "VHH 3 ", and "VH 1 " represent the heavy chains of the three camelid IgG isotypes IgG2, IgG3, and IgG1, respectively. VL 1 represents the light chain of camel IgG1. Camel VL 1 includes, but is not limited to, Vκ and Vλ.

[0095] The terms "corresponding positioned amino acids" and "corresponding amino acids" are used interchangeably herein and refer to amino acid residues that are in the same position (i.e., directly opposite each other) when two or more amino acid sequences are aligned. Methods for aligning and numbering antibody sequences are described in detail in Chothia (supra), Kabat (supra), etc. As is known in the art (see, e.g., Kabat 1991 Sequences of Proteins of Immunological Interest, DHHS, Washington, DC), to accomplish the alignment, one or both of the antibody amino acids sometimes need up to one, two, three, or four residues, or up to about 15 residues (especially in light and heavy chain CDR3s) of one, two, or three gaps and / or insertions.

[0096] The term "native" antibody refers to an antibody in which the heavy and light chains of the antibody have been made and paired by the immune system of a multicellular organism. Spleen, lymph nodes, bone marrow, blood, and other lymphoid tissues contain cells that produce native antibodies. For example, antibodies produced by B cells isolated from a first animal immunized with an antigen are native antibodies. Native antibodies contain heavy and light chains that are naturally paired.

[0097] The term "naturally paired" refers to heavy and light chain sequences that are paired by the immune system of a multicellular organism.

[0098] As used herein, the term "mixture" refers to a combination of elements (such as cells) that are dispersed and without any specific order. A mixture is homogeneous and does not spatially separate into distinct components. Examples of mixtures of elements include many different cells that are present in the same aqueous solution in an undressed manner in space.

[0099] The term "evaluate" includes any form of measurement and includes determining the presence of an element. The terms "determine", "measure", "evaluate", "assess", and "assay" are used interchangeably and may include quantitative and / or qualitative determinations. An evaluation can be relative or absolute. "Evaluate the presence" includes determining the amount of something present, and / or determining whether it is present.

[0100] The term "enriched" refers to a component of a composition (such as a specific type of cell) being more concentrated (e.g., at least 2-fold, at least 5-fold, at least 10-fold, at least 50-fold, at least 100-fold, at least 500-fold, at least 1,000-fold) relative to other components in a sample (such as other cells) than before enrichment. In some cases, the enriched material may represent a large portion of the sample in which it is present (e.g., greater than 2%, greater than 5%, greater than 10%, greater than 20%, greater than 50%, or more, and typically up to about 90%-100%).

[0101] The term "enrichment" refers to any means by which antigen - specific cells can be obtained from a larger population of B cells. As described in more detail below, enrichment can be performed by panning, using magnetic beads, or cell sorting.

[0102] In the context of obtaining an element (such as a cell or a sequence), the term "obtain" is intended to include receiving the element as well as physically generating the element.

[0103] The term "peripheral blood mononuclear cell" or "PBMC" refers to blood cells that have a single, approximately round nucleus (as opposed to a lobed nucleus), including lymphocytes (T cells, B cells, and NK cells), monocytes, and macrophages. Peripheral blood mononuclear cells can be enriched from whole blood by Ficoll gradient.

[0104] The term "antigen - specific B cell" refers to memory B cells and their progenitors that have antibodies on their surface that specifically bind to an antigen.

[0105] A cell "derives from" a host if the cell or its progeny is obtained from the host. The progeny of a progenitor cell derives from the progenitor cell.

[0106] The term "support bearing an antigen" includes any type of support (e.g., solid or semi - solid supports, including plates and magnetic beads) that bears an antigen or a portion thereof immobilized thereon. The antigen can be immobilized directly or indirectly on the support, such as by a linker, biotin - streptavidin interaction, or a cell. Methods for enriching antigen - specific B cells by panning or using magnetic beads utilize such a support.

[0107] The term "panning" is used to refer to a method of applying B cells to a container (e.g., a plate) having one or more surfaces coated with an antigen or a portion thereof. Unbound cells can be removed by washing the surface after the cells are applied to the surface.

[0108] The term "bead - based enrichment" is used to refer to a method of mixing B cells with beads (e.g., magnetic beads) to which an antigen or a portion thereof is attached.

[0109] The term "cell sorting" is used to refer to a method of mixing B cells with a detectable antigen (e.g., a fluorescently detectable antigen) in solution. In a cell sorting method, cells that bind to the antigen are sorted from unbound cells. Fluorescence - activated cell sorting (FACS) is an example of a cell sorting method.

[0110] The term "complex immunogen" is intended to refer to an immunogen that contains multiple antigens. A complex immunogen can consist of multiple different antigens that are prepared separately and then mixed together, or they can be complexed naturally in an immunization (e.g., when using whole cells and tissues or portions thereof).

[0111] The term "activation" refers to the stimulation of B cells to a) proliferate, b) differentiate into plasmablasts and / or plasma cells, and c) secrete antibodies. Activation of B cells can be accomplished by contacting the B cells with antigen, T cells expressing CD40L, and cytokines, and other methods are known (e.g., Wykes, Imm. Cell. Biol. 2003 81:328-331).

[0112] The term "activated B cells" refers to a cell population containing the progeny of activated B cells. As described above, activation results in B cell proliferation, and the progeny of such cells are referred to herein as activated B cells.

[0113] The term "collection" refers to the act of separating cells in a culture medium from a matrix. For example, collection can be performed by pipetting or decanting.

[0114] The term "immunized with antigen" and its grammatical equivalents (e.g., "immunize an animal") refer to any animal (human, rabbit, mouse, rat, sheep, cow, chicken, camel) that has mounted an immune response to an antigen. For example, an animal can be exposed to a foreign antigen by contact with an infectious agent, vaccination, or by administration of an antigen and an adjuvant (e.g., by injection). The term "immunized with antigen" is also intended to include animals that have mounted an immune response to "self" antigens, i.e., animals suffering from an autoimmune disease.

[0115] The terms "sorting" and "abundance sorting" refer to the order in which sequences are arranged by abundance, i.e., the sequence with the highest abundance first, followed by the sequence with the second highest abundance, followed by the sequence with the third highest abundance, and so on. In some cases, sequences can be sorted by their frequency by performing a frequency distribution.

[0116] The term "corresponding rank" or "corresponding sort" means that two sequences have the same position in two ranks. For example, the first, second, and third positions in a first sort correspond to the first, second, and third positions in a second sort, respectively.

[0117] The term "lineage rank" refers to the order in which lineages are arranged by priority factors. Priority factors include, but are not limited to, the abundance of lineage sequences, the amplification coefficient, the dynamic changes in lineage sequences before and after removal of certain unwanted B cells, the dynamic changes in the abundance of lineage sequences during the immune process, lineages with the same naive B cell origin between VHH and VH, avoidance of poorly developable sequences, and combinations thereof.

[0118] The term "Hamming distance" refers to the number of positions at which corresponding symbols differ between two sequences of equal length.

[0119] As used herein, the terms "lineage-grouped antibody", "lineage-related antibody", and "antibody related to a lineage" and their grammatical equivalents are antibodies produced by cells having a common B cell ancestor. Lineage-related antibodies bind to the same epitope of an antigen and they are typically very similar in sequence, particularly in the light and heavy chain CDR3s. The heavy and light chain CDR3s of lineage-related antibodies can have the same length and nearly identical sequences (i.e., differing by at most 5, i.e., 0, 1, 2, 3, 4, or 5 residues). In a group of CDR3s from a lineage, the minimum CDR3 distance for a particular CDR3 is the minimum Hamming distance of that CDR3 compared to all other CDR3s of the same length. In some embodiments, the minimum CDR3 distance is equal to or less than 1. In certain cases, the B cell ancestor contains a genome with a rearranged light chain VIC region and a rearranged heavy chain VDJ region and produces antibodies that have not yet undergone affinity maturation. "Naive" or "germline state" B cells present in spleen tissue are examples of common B cell ancestors.

[0120] Related antibodies are related through a common progenitor antibody, such as an antibody produced in a naive B cell ancestor. The term "lineage-related antibody" is intended to describe a group of antibodies produced by cells from the same B cell ancestor. A "lineage group" contains a group of antibodies that are interrelated by lineage.

[0121] As used herein, the term "at least CDR3" or "at least CDR3 sequence" refers only to the CDR3 sequence, the CDR3 sequence together with the CDR1 and / or CDR2 sequences, or a sequence that includes CDR3 of at least 50 contiguous amino acids of the variable domain up to the entire length of the variable domain.

[0122] As used herein, the term "phylogenetic tree" refers to a diagram produced by phylogenetic analysis that depicts a hypothesized branching sequence of an individual species of interest. The branch points within a phylogenetic tree are called nodes.

[0123] As used herein, the term "constructing a phylogenetic tree" refers to the computational act of making a phylogenetic tree from sequences.

[0124] As used herein, the term "lineage" refers to a theoretical pedigree. "Lineage" is used interchangeably with "group", and sometimes a group of antibodies related by lineage is referred to as a "lineage group". The terms "group" or "lineage" are exclusive in that a sequence can belong to only one group or lineage.

[0125] As used herein, the term "sub - subgroup" refers to a further grouping of sequences in a lineage based on unique features or characteristics. A "sub - group" is not exclusive, meaning that a sequence can be in different sub - groups. For example, a sequence can have two, three, four, five, or six unique features simultaneously. "Sub - subgroup" applies only to VHHs. Applying VHH sequence features can help in better selection / narrowing down of the test lineage (representative sequences), which may result in better biological function / biological activity outcomes.

[0126] As used herein, the term "lineage analysis" refers to the analysis of the theoretical lineage of an antibody, which is typically done by analyzing a lineage tree.

[0127] As used herein, the term "sequence read" refers to the nucleotide sequence determined by a sequencer, for example, determined by base - calling software associated with the technology.

[0128] As used herein, the term "obtaining an amino acid sequence" refers to obtaining a file containing an amino acid sequence. As is well - known, a nucleic acid sequence can be translated into an amino acid sequence on a computer.

[0129] As used herein, the term "most abundantly expressed" refers to the most abundant protein sequence in a sample. The abundance of a protein can be determined by counting the sequence reads encoding that protein. The protein encoded by the most sequence reads is the most abundant protein.

[0130] The terms "anchor" and "anchor binder", which are used interchangeably herein, refer to conventional antibodies produced by single B - cell sorting or heterohybridomas with natural H and L pairings, whereby the heavy - chain lineage and the light - chain lineage, which consist of sequence groups obtained by clonal amplification of naive B - cell H and L sequences upon encounter with an epitope, can be "positioned / paired". Since it is known in the art that the amino acid sequences of the heavy and light chains pair with each other, the lineages can be "anchored". In these embodiments, the branches rotate around their nodes until there is a minimum number of crossovers (e.g., no crossovers) between the anchor sequences. After "aligning" the trees by tanglegram analysis, the known paired leaves can be connected by edges. If the known paired leaves are connected by an edge, the intermediate leaves can theoretically pair with each other as long as they do not cross one edge or another.

[0131] The phrases "monoclonal antibody that recognizes an antigenic epitope", "antibody that recognizes an antigen", and "antigen - specific antibody" are used interchangeably herein with the term "antibody that specifically binds to an antigen".

[0132] The term "specifically binds" refers to the ability of an antibody to preferentially bind a particular antigen present in a homogeneous mixture of different molecules. In certain embodiments, the specific binding interaction can distinguish between desired and undesired molecules in a sample, in some embodiments by greater than about 10- to 100-fold, such as greater than about 1000- or 10,000-fold.

[0133] As used herein, the term "substantially does not bind" to a protein or cell can mean that it does not bind or does not bind with high affinity to the protein or cell, i.e., with a K -6 of 2 x 10 -5 M or greater, more preferably 1 x 10 -4 M or greater, more preferably 1 x 10 -3 M or greater, even more preferably 1 x 10 -2 M or greater for binding to the protein or cell. D

[0134] "High affinity" for an IgG antibody can refer to an antibody having a K -6 of 1 x 10 -7 M or less, preferably 1 x 10 -8 M or less, more preferably 1 x 10 -9 M or less, even more preferably 1 x 10 -10 M or less, even more preferably 1 x 10 D M or less for the target antigen. However, "high affinity" binding may vary for other antibody isotypes.

[0135] The term "pharmaceutical formulation" refers to a formulation that is in a form in which the active ingredient contained therein is biologically effective and that does not contain additional ingredients that are unacceptably toxic to the subject to which the formulation is administered.

[0136] A "therapeutically effective amount" of an agent (e.g., a pharmaceutical formulation or cell) is an amount that is effective to achieve a desired therapeutic outcome (e.g., for treating a disease, disorder, or condition) and / or a pharmacokinetic or pharmacodynamic effect of treatment, in a dose and for a period of time necessary. The therapeutically effective amount can vary depending on factors such as the disease state, age, sex, and weight of the subject, and the cell population administered. In some embodiments, the methods provided include administering the cell and / or composition in an effective amount (e.g., a therapeutically effective amount).

[0137] A "CDR-grafted antibody" is an antibody that contains one or more CDRs derived from a particular species or isotype and a framework of another antibody of the same or a different species or isotype.

[0138] ​Differ from the antibody sequences derived from non-human species by one or more amino acid substitutions, deletions, and / or additions. Thus, compared with non-human antibodies, humanized antibodies are less likely to induce an immune response when administered to a subject and / or induce a less severe immune response. In one embodiment, certain amino acids in the framework and constant regions of the heavy chain and / or light chain of a non-human species antibody are mutated to produce a humanized antibody. In another embodiment, the constant region from a human antibody is fused with the variable region of a non-human species. In another embodiment, a humanized antibody is a CDR-grafted antibody that contains one or more CDRs derived from a specific species or isotype and a human antibody framework. In another embodiment, one or more amino acid residues in one or more CDR sequences of a non-human antibody are altered to reduce the possible immunogenicity when the non-human antibody is administered to a human subject, where the altered amino acid residues are not critical for the immunospecific binding of the antibody to its antigen, or the changes made to the amino acid sequence are conservative changes such that the binding of the humanized antibody to the antigen is not worse than the binding of the non-human antibody to the antigen. Examples of how to make humanized antibodies can be found in U.S. Pat. Nos. 6,054,297, 5,886,152, and 5,877,293.

[0139] The term "chimeric antibody" refers to an antibody that contains one or more regions from one antibody and one or more regions from one or more other antibodies. In one embodiment, one or more CDRs are derived from a human antibody. In another embodiment, all CDRs are derived from a human antibody. In another embodiment, CDRs from more than one human antibody are mixed and matched in the chimeric antibody. For example, a chimeric antibody can contain CDR1 from the light chain of a first human antibody, CDR2 and CDR3 from the light chain of a second human antibody, and CDRs from the heavy chain of a third antibody. Other combinations are also possible.

[0140] The term "bispecific antibody" refers to an antibody that binds to two non-overlapping epitopes of an antigen. In some embodiments, the bispecific antibody includes a VHH that contains only a heavy chain and no light chain. In some embodiments, the bispecific antibody contains a VHH of only a heavy chain and a conventional VH 1 / VL 1 Yes. In some embodiments, the bispecific antibody contains two conventional VHs 1 / VL 1 Yes. In some embodiments, the bispecific antibody has a first heavy chain and a first light chain from a monoclonal antibody targeting one epitope, and a heavy chain and a light chain of another antibody targeting another epitope. In some examples, the other light chain or heavy chain can be different from the first light chain or heavy chain.

[0141] The binding of the antibodies of the present invention to antigens can be evaluated using one or more techniques commonly used in the art. For example, in a preferred embodiment, the antibodies can be tested by ELISA assays, such as using recombinant antigen proteins. Other suitable binding assays include, but are not limited to, flow cytometry assays, in which the antibodies are reacted with cell lines expressing human antigens, such as HEK293 cells. Alternatively or additionally, the binding of the antibodies, including binding kinetics (such as K D values) etc., can be tested in BIAcore binding assays, Octet Red96 (Pall), etc.

[0142] The term "single B cell sorting" refers to the sorting of individual and isolated single B cells based on antigen specificity. Techniques for single cell isolation and sorting include, but are not limited to: FACS (fluorescence-activated cell sorting, e.g., using fluorescently labeled antigens to isolate antigen-binding cells), ISAAC (immunospot array analysis on a chip), LCM (laser capture microdissection), microengraving, and droplet microfluidics.

[0143] Provided herein is a method for generating camelid-only heavy chain antibodies or binding portions thereof for identifying antigens, particularly for therapeutic applications, the method comprising:

[0144] a) enriching and amplifying antigen-specific B cells from immunized camelids; b) generating an antibody NGS library containing VHH 2 、VHH 3 and VH 1 and VL 1 chain sequences from the antigen-specific B cells; c) dividing the VHH 2 、VHH 3 and VH 1 sequence data into phylogenetic lineage clones based on CDR3 - for example, grouping together CDR3 amino acid sequences that differ by 0 or 1 amino acid and have the same length; d) ranking the lineages containing VHH heavy chains (VHH 2 、VHH 3 ) according to lineage priority factors; e) selecting representative sequences from the top-ranked VHH 2 、VHH 3 lineages in the antibody sequence library according to lineage priority factors; f) testing the antibodies containing the selected representative sequences to determine whether the antibody binds to the antigen or a portion thereof. In one embodiment, the antigen comprises multiple epitopes.

[0145] In one embodiment, the steps f) and g) can be repeated to select and test sequences from multiple lineages. In one embodiment, f) can include 1) synthesizing DNA of the selected representative sequences, 2) constructing vectors containing the DNA sequences, 3) expressing the vectors in cells, and 4) testing the affinity and biological activity against a specific antigen. In one embodiment, b) can include 1) preparing cDNA from enriched antigen-specific B cells; 2) sequencing the cDNA to obtain multiple VHH 2 、VHH 3 、VH 1 heavy chain sequences and multiple VL 1 (Vκ and Vλ) light chain sequences to generate libraries of camel IgG2 (HcAb), IgG3 (HcAb), and IgG1 (conventional Ab). In one embodiment, the camel antibodies produced contain IgG2. In one embodiment, the camel antibodies produced contain IgG3.

[0146] Another aspect of the present invention is a method for obtaining camel antibodies or binding portions thereof for identifying antigens, particularly for therapeutic applications, the method comprising: a) enriching and amplifying antigen-specific B cells from immunized camelids; b) generating an antibody NGS library containing VHH 2 、VHH 3 、VH 1 and VL 1 chain sequences from said antigen-specific B cells; c) grouping the VHH 2 、VHH 3 、VH 1 and VL 1 sequence data into phylogenetic lineage clonotypes based on CDR3; d) performing IgG1 VH 1 / VL 1 lineage pairing according to the anchor conjugates generated by single B cell sorting and heterologous hybridoma methods; e) ranking the lineages and lineage pairs in steps c) and d) according to lineage priority factors; f) selecting representative sequences from the top-ranked VHH 2 、VHH 3 lineages and VH 1 / VL 1 lineage pairs in the NGS library; g) testing the antibodies containing the selected VH 1 / VL 1 pair sequences or VHH 2 、VHH 3 sequences to determine whether the antibody binds to the antigen or a portion thereof. In one embodiment, the VL 1 chain contains Vκ and Vλ. In one embodiment, the antigen contains multiple epitopes.

[0147] In one embodiment, sequences from multiple lineages can be selected and tested by repeating steps f) and g). In one embodiment, g) can include 1) synthesizing DNA encoding the selected representative amino acid sequences, 2) constructing a vector containing the DNA sequence, 3) expressing the vector in cells, and 4) testing the affinity and biological activity against a specific antigen. In one embodiment, b) can include 1) preparing cDNA from enriched antigen-specific B cells; 2) sequencing the cDNA to obtain multiple VHH 2 、VHH 3 、VH 1 heavy chain sequences and multiple VL 1 (Vκ and Vλ) light chain sequences, generating libraries of camel IgG2 (HcAb), IgG3 (HcAb), and IgG1 (conventional Ab). In one embodiment, the camel antibodies produced contain IgG2. In one embodiment, the camel antibodies produced contain IgG3. In one embodiment, the camel antibodies produced contain conventional IgG1. In one embodiment, the ranking of lineage pairs in step e) is based on the lineage preference factors of the VH 1 lineage of the lineage pair. In one embodiment, the ranking of lineage pairs in step e) is based on the lineage preference factors of the VL 1 lineage of the lineage pair. The method further includes testing to determine whether an antibody that binds to an antigen inhibits the binding of the antigen to another protein. For example, whether antibody binding inhibits the specific binding of a ligand to its cognate receptor.

[0148] A method for generating humanized camel antibodies targeting an antigen includes a) enriching and proliferating antigen-specific B cells from an immunized camel; b) generating an antibody NGS library containing VHH 2 、VHH 3 、VH 1 and VL 1 chain sequences from the antigen-specific B cells; c) grouping the sequences of VHH 2 、VHH 3 and VH 1 in the NGS library by lineage, d) identifying the replaceable positions of the parental VHH antibody or VH 1 that share the same naive B cell origin by comparing the amino acid sequences with the amino acid sequences of multiple related antibodies, where the related antibodies each bind the same epitope as the parental antibody in the same lineage; e) the parental VHH antibody or VH 1The amino acids at one or more replaceable positions of the antibody are replaced with the amino acids at the corresponding positions in a human antibody; f) Testing the antibody containing the substituted residue within the selected sequence to determine whether the antibody binds to the antigen or a portion thereof. In one embodiment, the antigen comprises multiple epitopes. In one embodiment, the replaceable position is in the CDRs region. In one embodiment, the replaceable position is in the FRs region.

[0149] The camel conventional IgG1 antibody produced by the present invention can be humanized by replacing the amino acids at one or more replaceable positions of the parental IgG1 antibody with the amino acids at the corresponding positions in a human antibody.

[0150] Figure 2 An embodiment of the method for immunizing camelids and isolating / proliferating antigen-specific B cells is shown; such an embodiment includes:

[0151] 1) Immunizing a camelid with DNA or a small molecule containing a carrier protein or a peptide or protein or antigen complex containing a carrier protein such as a cell or tissue; 2) Monitoring the immune responses of IgG2, IgG3, and IgG1 separately; 3) Obtaining a cell sample containing B cells from PBMCs, spleen, lymph nodes, and lymphoid tissues. B cells refer to memory cells, plasmablasts, and different stages of B cells with cell membrane IgG2 (HcAb), IG3 (HcAb), and IgG1 (conventional IgG); 4) Enriching antigen-specific B cells with cell surface antibodies by physical surface antigen panning, magnetic bead separation, or flow sorting; 5) Activating the enriched B cells in the presence of an antigen, camel CD40-L expressing cells, and growth factors for cell proliferation. The activation step allows selective stimulation of memory B cells to differentiate into plasma cells, which rapidly divide and express large amounts of antibodies. In some embodiments, the immune responses of IgG2, IgG3, and IgG1 in the antiserum are monitored by the following methods: a) Purifying IgG2, IgG3, and IgG1 with Protein-A and Protein-G columns under different pH elution conditions; b) Analyzing the immune response titers of IgG2, IgG3, and IgG1; or c) Testing the biological activities of IgG2, IgG3, and IgG1 using the required immunoassay.

[0152] The activation step of the method only proliferates B cells with surface-bound antibodies that actually bind to the antigen. The activation step has three effects: (1) The activation step only causes the proliferation of those B cells that specifically bind to the antigen, thereby increasing the relative concentration of these cells relative to the cells that non-specifically bind to the support. (2) The activation step of the method causes the induction of HcAb or conventional IgG heavy and light chain mRNAs only in B cells that specifically bind to the antigen. (3) These antigen-specific B cells expressing antibodies with high affinity or specificity or recognizing "rare" epitopes of "rare" antigens are amplified, thereby significantly improving the signal-to-noise ratio.

[0153] In some embodiments, the antigens used for enrichment include, but are not limited to:

[0154] a) Immunogens;

[0155] b) Desired domains / epitopes of the immunogen;

[0156] c) Complex immunogens: Animals can be immunized with multiple antigens or cells or tissues, or biological fluids, and antigen-specific B cells against each of the multiple antigens can be enriched either individually or as a whole. After the antigen-specific B cells are activated, they can be enriched individually or as a whole. The simplicity of VHH provides advantages for high-throughput VHH cloning and expression, and it is relatively easier to identify the corresponding antigens of VHH by deconvoluting complex immunogens. Complex immunogens can be deconvoluted by a variety of methods, including but not limited to protein arrays or immunoprecipitation-based mass spectrometry or cell, tissue antigen-cDNA library screening methods.

[0157] Sometimes it may also be necessary to deplete unwanted B cells by panning before antigen-specific panning to improve the purity of B cells.

[0158] VHH 2 、VHH 3 、VH 1 、Vκ and Vλ NGS libraries can be prepared separately from B cells expressing IgG2 (HcAb), IgG3 (HcAb), and IgG1 (conventional Ab), respectively.

[0159] IgG1 (conventional Ab), IgG2 (HcAb), and IG3 (HcAb) of camels, each having a unique gene organization, specific primer sets can be designed to amplify their cDNAs respectively (as Figure 3 shown). cDNA amplification can be completed through the following steps:

[0160] a) Total RNA extraction (TRIOL) and purification (RNeasy kit);

[0161] b) RNA quantification and optional -20 °C storage;

[0162] c) mRNA capture / RT-PCR using isotype-specific primer sets (VHH 2 、VHH 3 、VH 1 、Vκ and Vλ);

[0163] VHH 2 、VHH 3 、VH 1 、Vκ and Vλ NGS libraries can be prepared in Nextera libraries by PCR overlaying NGS adapters and library indices.

[0164] cDNA in the NGS library can be sequenced by high-throughput sequencing technology of the library, such as using the Illumina MiSeq 300x2 instrument.

[0165] Sequences can be constructed through a bioinformatics process: - Quality assessment using NGS QC Toolkit, assembly of R1 / R2 reads, translation, and then identification of CDR 1, 2, 3.

[0166] VHH 2 、VHH 3 、VH 1 、Vκ and Vλ antibodies can be grouped using NGS data such as the CDR3 amino acid sequence to construct a phylogenetic lineage clone type.

[0167] A lineage is defined by a group of sequences from the same naive B cell (same V and J assignment), and a lineage can be defined as a group whose amino acid sequences in the CDR3 region differ by no more than 1 amino acid (Hamming distance of 1 or less, or total amino acid difference within 5 aa but with the same CDR3 sequence). It is speculated that the number of lineages reflects the amount of naive B cells in the library and also the number of epitopes recognized by these antibodies. ( Figure 4 ).

[0168] Generally, lineage size is related to antibody maturation and clonal expansion. Bioinformatics methods allow for structuring and visualization of the data to select candidate antibodies in a reasonable manner. For each NGS library, sequences can be constructed through a bioinformatics process to identify up to 10,000 lineages, including: QC using NGS QC Toolkit, assembly of R1 / R2 reads, translation, identification of CDR1, 2, 3, and then lineage grouping based on CDR3 similarity.

[0169] VHH (VHH 2 , VHH 3 ) sequences can be further grouped (subdivided into subgroups) by their unique sequence characteristics.

[0170] Camels have evolved multiple mechanisms to further diversify the VHH B cell repertoire and expand antigen-binding capabilities. The sequence "signatures" generated by these mechanisms allow for further grouping of lineages. This additional criterion for further grouping lineages can reflect the subtle different recognition features of antibodies and help identify epitopes with unique VHH recognition patterns.( Figure 5 )Features of VHHs include but are not limited to:

[0171] i) Hydrophilic region of FR2: For most VHH antibodies, FR2 has unique amino acid substitutions compared to conventional IgG: 37Phe / Tyr, 44Glu, 45Arg, and 47Gly;

[0172] ii) Extended CDR1: Many VHHs have an additional hypervariable region (residues 27 - 30, numbered according to Kabat) adjacent to CDR1. VHHs use this region and the long CDR3 to increase the surface area for antigen interaction;

[0173] iii) Additional disulfide bonds between CDR1 - CDR3 or FR2 - CDR3: In camels and dromedaries, 82% of VHHs have a disulfide bond between CDR1 - CDR3, and in llamas and alpacas, 74% of VHHs have a disulfide bond between FR2 - CDR3;

[0174] iv) Long CDR3: For those VHHs with long CDR3 (≥15aa), in many cases there are additional disulfide bonds;

[0175] v) Additional disulfide bond within CDR3: Approximately 5 - 10% of VHHs have an additional disulfide bond within CDR3, which may indicate more conformational recognition patterns;

[0176] vi) Additional disulfide bond within CDR1;

[0177] vii) Non - classical VHHs with the same V and J germlines as conventional IgG: A group of VHH lineages sharing the same naive B cell origin (same V and J assignments) as conventional IgG1, indicating that VHHs and IgG1 can recognize the same or similar epitopes;

[0178] viii) Non - classical VHHs with unique sequence features: For example, the conservative Trp118 is replaced by Arg118 and / or lower hydrophobicity in FR3;

[0179] ix) Novel canonical binding loop structure: Hypermutation hotspots located at key sites are used to define the canonical loop structure, making the VHH library more diverse. Crystallographic studies have highlighted that the CDR1 and CDR2 loops of camel VHHs often deviate from the known canonical structures of conventional VHs. 1 Sequence-based prediction of novel Ag-binding loop conformations also supports further lineage grouping;

[0180] x) CDR2 length

[0181] xi) CDR3 length

[0182] xii) Presence of three or more positive charges in the CDR3 region

[0183] xiii) Number of cysteines in the amino acid sequence

[0184] xiv) 2-4 amino acid motif in the CDR region. This motif is identified from the 3-d structure of the ligand / receptor complex xv) CDR3 length and characteristics

[0185] And

[0186] xvi) Convergent motif or sequence signature among camelids in the same immunogroup.

[0187] VHH (VHH 2 、VHH 3 ), VH 1 -Vκ and VH1-Vλ humanization can be guided by lineage analysis.

[0188] The present invention provides a method for identifying positions in an antibody that can be modified without significantly reducing the binding activity of the antibody. In some embodiments, the method includes identifying replaceable positions in a parental antibody by comparing the amino acid sequence of the parental antibody with the amino acid sequences of a number of related antibodies, each of which binds the same antigen and epitope as the parental antibody in the same lineage.

[0189] In some embodiments, the amino acid at a replaceable position can be replaced with a different amino acid without significantly affecting the activity of the antibody. This method can be used to alter the amino acid sequence of the CDR without significantly reducing the affinity of the antibody.

[0190] In humanization methods or other antibody engineering methods, the present invention can be used in a variety of therapeutic and diagnostic applications.

[0191] Bispecific / bifunctional antibodies or antigen-binding fragments can be generated by a variety of methods, including fusion of hybridomas or ligation of Fab' fragments. See, e.g., Songsivilai & Lachmarm, Clin. Exp. Immunol. 79:315-321 (1990), Kostelny et al., J. Immunol. 148:1547-1553 (1992). In addition, bispecific antibodies can form "diabodies" or "bispecific single-chain molecules (Janusins)". Multiple VHH variable domains can also be coupled via linkers to form bivalent and multivalent antibodies.

[0192] VH 1 and VL 1 (Vκ or Vλ) pairing lineages can be identified by considering VH 1 -VL 1 "anchoring" amino acid sequences that pair with each other in antibodies secreted by heterologous hybridomas and / or flow-sorted single B cells (see Figure 6 ).

[0193] Identifying the original, native H and L pairs is a challenge in developing conventional camelid IgG1 using NGS technology. Typically, two methods, (1) heterologous hybridomas and (2) single B cell sorting, are used to establish the anchor H and L (κ and λ) lineages. After further grouping with these anchor pair lineages, representative sequence H / L pairs are selected from each lineage pair for DNA synthesis, binding screening, and bioactivity testing as VHH antibodies.

[0194] I. Heterologous Hybridoma Method

[0195] Isolate lymphocytes from the PBMC or spleen or lymph nodes of immunized camelids; fuse the lymphocytes with a murine myeloma fusion partner cell line such as SP / 20 to generate heterologous hybridomas; screen the supernatants of the heterologous hybridomas using ELISA and bioactivity assays; sequence VH 1 and VL 1 from the selected heterologous hybridomas; these VH and VL pairs are used as anchors to pair VH 1 and VL 1 lineages from the IgG1 NGS library.

[0196] II. Single B Cell NGS Method

[0197] a) Harvest antigen-specific B cells after panning and proliferation; b) single B cell sorting; c) VH 1 -VL 1 lineage PCR to amplify the amplicons; d) NGS and identify VH 1 -VL1 For the sequences (VH 1 -Vκ or VH 1 -Vλ) as an anchor.

[0198] This method can capture the entire antigen-specific B cell repertoire from the immune response, including HcAb and conventional IgG1 with NGS, and utilize the simplicity of HcAb:

[0199] a) IgG2 / HcAb, IgG3 / HcAb, IgG1 / κ and IgG1 / λ

[0200] b) Lineages with different CDR3_different epitopes

[0201] c) VHH lineages with sequence features_different epitopes

[0202] d) VH-Vk or VH-Vλ lineages paired with VH-VL anchors generated from heterologous hybridomas

[0203] Antibody lineages that recognize broad-spectrum antigen epitopes can be selected (as Figure 7 shown).

[0204] Each lineage or lineage pair recognizes a unique epitope, so a representative sequence (VHH) from the top 100 lineages / lineage pairs or a representative pair (VH 1 -VL 1 )(e.g., 70 sequences of VHH and 30 sequence pairs of VH 1 -Vκ or VH 1 -Vλ) are selected for gene synthesis, conjugate screening, and bioactivity testing. Lineage selection criteria (priority factors) include but are not limited to:

[0205] 1) Lineages with sequence abundance from high to low: The total number of unique cDNAs (sequence abundance) for each lineage ranges from 2 to 50,000, and the lineage with the highest sequence abundance may indicate the most extensive clonal expansion after antigen stimulation;

[0206] 2) Lineages with amplification factor from high to low, the dynamic change in sequence abundance before and after B cell enrichment / proliferation (the amplification multiple can be between 5 and 1,000);

[0207] 3) The sequence abundance of the lineage changes during the immune process, indicating antigen-specific sequence enrichment and antibody affinity maturation (the change range of sequence abundance / unique cDNA count is from 2 to 1,000);

[0208] 4) The change in lineage sequence abundance before and after depleting certain unwanted B cells (if applicable) (the change range of sequence abundance / unique cDNA count may range from 2 to 1,000);

[0209] 5) The lineage between VHH and VH 1 has the same naïve B cell origin (same V and J assignments);

[0210] 6) Avoidance of developability liability sequences: Some sequences are composed of certain amino acids that cause developability problems such as thermal stability (hydrophobic core, charge cluster residues, etc.), chemical stability (deamidation and isomerization), solubility (surface hydrophobicity, etc.), and heterogeneity (glycosylation) (Tomoyuki Igawa et al. mAbs, 2011). The selection of these lineages or lineage pairs should be avoided.

[0211] The selection criteria can also be a combination of the above preferential factors.

[0212] The selected lineage sequences or pairs are used for DNA synthesis and constructed into expression vectors such as VHH, scFv, Fab, HcAb, camelid IgG1, and human Fc chimeras.

[0213] In some cases, the selected VHH lineage and the selected VH 1 -VL 1 lineage pair can have the same naïve B cell origin.

[0214] On the other hand, more pairs in the same top-ranked lineage pairs in the first round of selection (e.g., 70 VHH sequences and 30 VH 1 -Vκ or VH 1 -Vλ sequence pairs) are selected for gene synthesis, conjugate screening, and bioactivity testing because more combinatorial tests are required for the representative sequence pairs of VH 1 -Vκ or VH 1 -Vλ to determine the best sequence pairs.

[0215] If the first 100 antibodies do not produce the desired results, more sequences and pairs in the next 100 top-ranked lineages (e.g., 70 sequences of VHH and 30 sequence pairs of VH 1 -Vκ or VH 1 -Vλ) are selected for gene synthesis, conjugate screening, and bioactivity testing.

[0216] The significance of this method lies in the ability to systematically and interrelatedly select representative sequences from each lineage for detection, covering more epitopes with high resolution. This improves the antibody discovery ability in the following situations:

[0217] a) Discovering therapeutic antibodies with the best affinity, specificity, and developability from a large number of candidates;

[0218] b) Parallel discovery of companion diagnostic antibodies and other applications;

[0219] c) Construction and development of bivalent and multivalent antibodies;

[0220] d) Discovery of antibody heavy and light chain pairs;

[0221] Antibodies that bind to the same epitope can be identified by lineage-related sequences ( Figure 8 as shown).

[0222] As is well known, the CDR3 sequence is the main determinant of epitope binding, while CDR1 and CDR2 are more or less involved in determining other binding properties. After screening for leads (e.g., Figure 8 marked with @ and + in the figure) from each lineage, more candidates with different characteristics (e.g., affinity, specificity, functionality, productivity, and developability) can be identified to test and select the most desired antibodies, since antibodies from the same lineage are able to recognize the same or similar epitopes. This step also helps to establish a large candidate library for further antibody drug development.

[0223] Approximately 10 - 20% of VHH and VH 1 may have the same naïve B cell origin. The VHH sequences selected from the first round of selection help to identify VH 1 with the same V(D)J arrangement as the VHH,

[0224] 1) CDR1 and / or CDR2 difference > 2 aa (amino acids);

[0225] 2) FR1 and / or 2 and / or 3 and / or 4 difference > 2 aa;

[0226] 3) Sequences with the same naïve B cell origin between VHH and conventional VH;

[0227] 4) VH sequences that can pair with both Vλ and Vκ;

[0228] The selected sequences or pairs are used for DNA synthesis; and constructed into expression vectors such as VHH, scFv, Fab, HcAb, camelid IgG1, and human Fc chimeras.

[0229] More sequences and pairs can be selected until the best antibody is identified, and the remaining clones are retained as a library of further candidates.

[0230] VHH (VHH 2 and VHH 3 ), VH 1 -Vκ and VH 1-Vλ is humanized by lineage analysis.

[0231] Non-classical VHH genes have the same naïve cells as conventional VH, which helps (1) to subdivide subgroups of the VHH lineage, (2) to select HcAbs and conventional IgG that recognize the same or similar epitopes, and (3) to promote the humanization of HcAbs and conventional IgG.

[0232] The VHH domain usually has a high sequence identity with the human VH domain of type 3 (VH 3 ), which may be the reason for their low immunogenicity (Cortez-Retamozo V, Int J Cancer. 98(3):456-62, 2002). In addition, the VH 1 of camels, and the Vλ and Vκ domains of conventional antibodies also show significant homology with their human counterparts in terms of sequence and structure (Alex Klarenbeek et al., mAbs 7:4, 693--706; 2015). Figure 9 , as is well known, sequences within the same lineage group share the same or similar CDR3 sequences and recognize the same epitopes. Through functional screening, we can identify these amino acids within the variable region including CDRs and FRs, which constitute the same biological function (even if these amino acids are different within the lineage), so they are also replaceable. Therefore, these tolerated positions can be replaced with human germline antibody amino acids, and the replaceable amino acids can even be within the CDR region to achieve better humanization.

[0233] In addition, as mentioned above, these non-classical VHHs (without hydrophilic amino acids in FR2) are derived from the same IGHV3 or IGHV4, D, and J gene loci as conventional VH 1 , and the lineage structure between VHH and VH 1 sequences in these groups is similar, and the humanization design of each other can be further supported by lineage analysis.

[0234] Pharmaceutical formulations

[0235] On the other hand, the present invention provides a composition, such as a pharmaceutical composition, which contains one or more monoclonal antibodies of the present invention or antigen-binding portions thereof formulated with a pharmaceutically acceptable carrier. Such compositions may include one or more (e.g., two or more different) antibodies of the present invention, or combinations of immunoconjugates or bispecific molecules. For example, the pharmaceutical composition of the present invention may contain a combination of antibodies that bind to different epitopes on a target antigen or antibodies (or immunoconjugates or bispecific antibodies) with complementary activities.

[0236] Examples

[0237] Example 1: Identification of a VHH antibody repertoire specifically binding to an antigen using B cell isolation and amplification (BIA) / NGS sequence analysis and single B cell method

[0238] 1A. BIA / NGS

[0239] Materials and methods

[0240] BIA

[0241] A1. Construction of EL4.IL-2-C expressing CD40L

[0242] The cell line TIB-181 (EL4.IL-2) was obtained from the American Type Culture Collection and stably transfected with a pCMV-6-based vector that contains the cDNA encoding human CD40L and can express human CD40L. The stable cell line was selected and treated with mitomycin as feeder cells.

[0243] A2. Alpaca conditioned medium

[0244] Spleen cells were isolated for the preparation of alpaca conditioned medium. Activation medium containing 10% FBS, phytohemagglutinin (PHA), and propylene glycol monomethyl ether acetate (PMA) was prepared. 4×10 8 spleen cells were suspended in the activation medium in a T175 flask and incubated at 37°C in 5% CO 2 for 48 h. After incubation, the filtered supernatant was collected and used as alpaca conditioned medium.

[0245] A3. Animal immunization

[0246] The antigen (e.g., 400 μg Keyhole Limpet Cyanin (“KLH”) in 0.5 mL PBS) was emulsified with 0.5 mL complete Freund's adjuvant. The emulsified antigen was injected subcutaneously along the neck and back of the alpaca. Five injections were given for a total of approximately 200 μL (or less). Three immunizations were performed every 14 days.

[0247] A4. Isolation of lymphocytes from different organs

[0248] To isolate PBMC from the blood, the EDTA blood sample from the immunized alpaca was diluted two-fold with 1x DPBS containing 2% FBS. Then the diluted blood was slowly placed on Ficoll-Paque PLUS density gradient medium for density centrifugation. The upper layer was removed, and the lymphocyte layer was transferred to a clean centrifuge tube. Then the PBMC were washed twice with 1x DPBS.

[0249] To isolate lymphocytes from the spleen, the spleens of immunized alpacas were washed with 1x DPBS and placed in a clean dish. The spleens were inflated by injecting medium until most of the lymphocytes were released. Then the spleens were crushed using the bottom of a 20cc syringe. Vigorous squeezing helped to obtain the best possible lymphocyte yield. All released cells were collected by gentle centrifugation, e.g., at 1400 rpm. The supernatant was aspirated, the supernatant was suctioned, 5x volume of red blood cell lysis buffer was added, and it was left to stand for at least 4 min. Then RPMI 1640 medium was added to terminate the lysis. Then the lymphocytes were washed twice with 1x DPBS.

[0250] To isolate lymphocytes from the lymph nodes, mesenteric lymph nodes and inguinal lymph nodes were collected from immunized alpacas. Lymphocytes were released by grinding the lymph nodes in RPMI 1640 medium. The cells were passed through a cell strainer and collected by centrifugation. 5x volume of red blood cell lysis buffer pellets were added to the sample, and the sample was left to stand for at least 4 min to remove RBC. Then RPMI 1640 was added to terminate red blood cell lysis. Then the lymphocytes were washed twice with 1x DPBS.

[0251] To isolate lymphocytes from the bone marrow, the tibia and radius of immunized alpacas were opened at both ends of the bone and the bone marrow was removed. Cells were released by grinding the bone marrow in RPMI 1640 medium. The cells were passed through a cell strainer and collected by centrifugation. 5x volume of red blood cell lysis buffer pellets were added to the sample, and the sample was left to stand for at least 4 min to remove RBC. Then RPMI 1640 was added to terminate the lysis and the lymphocytes were washed twice with 1x DPBS.

[0252] A5. Removal of non-specific cells

[0253] The collected cells were resuspended in RPMI1640 medium containing 10% FBS, 1% penicillin-streptomycin, and 0.05 μM 2-mercaptoethanol to obtain a 1M / mL cell suspension. The cells were pre-incubated in a 6-well culture plate at 37 °C for 1 h to allow macrophages and monocytes to non-specifically adhere to the plate surface. After pre-incubation, the unbound cells were collected and counted.

[0254] A6. B cell panning

[0255] The collected cells were resuspended in RPMI1640 medium containing 10% FBS and 1% penicillin-streptomycin to obtain a cell suspension of 1 million / mL. The cells were incubated at 37 °C for 1.5 h for specific B cell panning under the condition of pre-coating 5 million antigens per 10 cm culture dish. After incubation, the seeded cells were washed 2 - 10 times with RPMI1640 medium until only a few cells were in suspension. All unbound cells were collected and counted, and the count was A1.

[0256] A7. In vitro culture of B cells

[0257] Add 20 mL of B cell medium to a culture dish containing the panned and retained B cells. The B cell medium contains 10% FBS, 1% penicillin-streptomycin, 10% alpaca conditioned medium, various growth factors, such as one or more interleukins at a concentration of 1 - 50 ng / mL and feeder cells pretreated with 2.5 μM MMC (EL4.IL-2-C3, expressing alpaca CD40L). Culture dishes with only B cells and only feeder cells are also cultured as controls in the quality control test. The cells are cultured in 5% CO 2 for 8 - 10 days.

[0258] A8. Cell collection and quality control

[0259] On day 10, 50 μL of the supernatant from the B cell culture is used for ELISA to test antibody secretion. All cells in the co-culture dish are collected and counted, and this count is regarded as A2. The cells in the dish with only feeder cells are collected and counted, and this count is A3. The B cell amplification factor (BCAF) is calculated by the following formula:

[0260] BCAF = (A2 - A3) / (5M - A1)

[0261] A9. NGS library construction

[0262] Prepare template RNA from the B cells obtained from each screening for constructing an NGS cDNA library. To calculate sequence enrichment, a library is also constructed using the B cells before panning.

[0263] i. RNA isolation

[0264] Extract RNA from the co-cultured B cells using the TRIzol method.

[0265] Lyse the cultured B cells with TRIzol reagent by repeated pipetting or by syringe and needle. Use 1 mL of reagent per 0.5 - 1×10 6 cells. Add 20% chloroform and stir for about 15 s. Carefully remove the aqueous phase using a pipette. Add an equal volume of isopropanol to the aqueous phase and mix gently. Centrifuge the sample at maximum speed (12,000 rpm) for 10 minutes. Remove the isopropanol, wash the pellet with 1 ml of 75% ethanol in DEPC-treated water and mix gently. Re-centrifuge the pellet at 7,000 rpm for 1 min. Recover the RNA in approximately 70 μl of RNase-free water.

[0266] ii. Reverse transcription

[0267] In a 0.2 mL PCR mixture, 8 reactions were amplified using different primers (random hexamers, Oligo dT, and Al.CH2+Al.CH2.2) respectively. The RNA-priming mixture was heated at 65 °C for 5 min and then incubated on ice for at least 1 min. The RT reaction mixture was prepared and reverse transcription was carried out under the following conditions: 30 °C for 10 min; 42 °C for 50 min; 75 °C for 15 min.

[0268] iii. cDNA amplification by PCR

[0269] Approximately 2 μL of reverse-transcribed cDNA was used as a template for a 50 μL PCR reaction containing 25 μL of 2×Primerstar mix, 18 μL of RNase Free dH2O, 1 μL of each primer NGS-leader1_L (GCAGTGGCTGCAGGTGTCCACTCG–SEQ ID NO.63)-leader2_L (GCAGGTCCCCAAGGTGTCCTGTCC–SEQ ID NO.64), NGS-leader3_L (GGTGGTCCTGGCTGCTCT–SEQ ID NO.65), NGS-hinge1_L (TTGTGGTTTTGGTGTCTTGGG–SEQ ID NO.66) and NGS-hinge2_L (GGGGTCTTCGCTGTGGTGCGC–SEQID NO.67) and cycled as follows: 98 °C for 3 min; 20 cycles (98 °C for 15 s, 58 °C for 30 s and 72 °C for 30 s); 72 °C for 3 min. The amplicons obtained were purified using a PCR purification kit with a cut-off value ≥ 300 bp.

[0270] iv. PCR indexing

[0271] Each amplicon sample was individually barcoded in a second "tagging" 50 μL PCR reaction containing 25 μL of 2x Primer star mix, 18 μL of RNase Free dH 2 O, 1 μL of each primer pair (such as P5-seqF and P7-index1-seqR) using 100 ng of the first-round PCR as a template and cycled as follows: 98 °C for 30 s; 12 cycles (98 °C for 10 s, 65 °C for 30 s and 72 °C for 30 s); 72 °C for 5 min. The final three amplicons (from three different reverse primers) were pooled and purified from a 1.5% (w / v) agarose gel using a PCR purification kit.

[0272] A10. NGS Data Analysis

[0273] The amplified cDNA was sequenced using the MiSeq sequencing system (Illumina, Miseq, 300x2). From each sample, 1 - 3 million reads were generated. The data was quality checked using the NGS QC Toolkit and assembled using FLASH. The assembled sequences were translated into protein sequences, and the CDR1, CDR2, and CDR3 regions (based on IMGT numbering) were computationally determined. Sequences were clustered into lineages / groups based on the same CDR3 length, a CDR3 Hamming distance less than or equal to 1, and the same mapped V / J germlines, as Figure 4 shown. Based on the same CDR3 length and 80% or more CDR3 homology, sequences were further subdivided into clusters. For example, a lineage can be defined by a CDR3 length of at least 12 amino acids, a CDR3 Hamming distance of 0 or 1 (compared to a reference sequence), and clones with the same V / J region amino acid sequence. The enrichment score of a sequence or sequence group was calculated using the frequency ratio between the libraries constructed from B cells before and after panning.

[0274] Based on Figure 7 the lineage preference factors shown, representative clones (20 or more) were selected from different lineages, and the antibodies produced by them were detected by various binding assays such as ELISA and FACS. Clones selected from different lineages usually bind to different epitopes of the target protein. To optimize existing clones, other clones can be selected from the same lineage, as Figure 8 shown. Clones selected from a lineage usually bind to different parts of the same epitope.

[0275] Selection A: Pick the clone with the highest count in the cluster

[0276] As shown in Table 1 below, the frequency of the C328 cluster increased 357 - fold after enrichment. The clone NBL505 - A1L1 - P3R3_355 with the highest count in the cluster is a good choice for the next step of testing.

[0277] Table 1

[0278]

[0279] Selection B: Pick the clone with the highest enrichment score.

[0280] By comparing the sequences in the library before and after enrichment (e.g., by panning or flow sorting), the enrichment score can be calculated based on the sequence frequencies before and after enrichment. To increase the chance of picking clones that secrete functional VHHs, the enrichment score can be used to determine the priority of clone picking. In Table 2 below, the clone NBL505 - A1L2 - P3R2_5559 was selected based on the enrichment fold.

[0281] Table 2: Sequence enrichment in C473 (NBL505 - A1L2 - P3R2)

[0282] Name Count Frequency Screened Clone Select? C258 (NBL505 - A1L2) Enrichment Factor NBL505 - A1L2 - P3R2_13391 14 0.0041 No 0.02222 0.185 NBL505 - A1L2 - P3R2_5559 42 0.01229 Yes 0.00379 3.243

[0283] 1B. Single B cell

[0284] B1. Sorting of Ag - specific single B cells from immunized alpaca PBMC

[0285] Peripheral blood mononuclear cells (PBMC) were obtained from immunized alpacas by Ficoll density gradient centrifugation (GE) and divided into tubes containing 200×10 6 cells for immunostaining. The cells were incubated with 200 μL of KLH - biotin (diluted to 5 μg / mL in MACS buffer (PBS plus 2% FBS plus 2 mM EDTA)) at 4 °C for 30 min, then washed twice with 5 mL of ice - cold MACS buffer. The cells were then stained with rabbit anti - alpaca IgG (H&L), APC - streptavidin, and a live / dead dye. The stained samples were then collected on a Moflo Cell Sorter Cytometer (Beckman), and single IgG+KLH+Live+ cells were collected in separate PCR tubes containing 10 μL of buffer per well, the buffer containing 8 μL of lysis buffer (Tiandz), 1 mM dNTP (Takara), 3.75 μM random hexamer (Takara), and 1.25 μM Oligo dT primer (Takara).

[0286] B2. Single - cell RT - PCR and B - cell cloning

[0287] The collected antigen - specific alpaca B cells were lysed in the collection tubes and then heated to 65 °C for 5 min. After cooling to 4 °C, reverse transcription of the total RNA of the lysed single cells was performed in a final volume of 20 μL, containing: 4 μL of 5×PrimeScipt II buffer (Takara), 20 U of RNase inhibitor (Takara), 200 U of PrimeScript II RTase (Takara), and 4.5 μL of RNase - free water (Takara). After an initial step of 10 min at 30 °C for random hexamer hybridization, it was allowed to act at 42 °C for 50 min. The reaction was terminated by incubation at 72 °C for 15 min.

[0288] Next, the variable regions of the rearranged heavy chain (HC) locus, λ (LCλ) or κ (LCκ) light chain locus were amplified from each single-cell cDNA by two rounds of nested PCR. For each variable segment, the first-round PCR was performed on 3 μL of cDNA for 40 cycles at 98°C for 5 min, 98°C for 15 s, 55°C for 1 min for HC (62°C for LCκ, 58°C for LCλ), and 72°C for 1 min, followed by a final extension at 72°C for 7 min in a 40-μL reaction volume containing 2X PrimeStar MAX buffer (Takara) and 100 nM primers. The 4-μL first amplification product was further amplified by the second-round PCR. The second-round PCR protocol consisted of a 5-min sample denaturation step at 98°C, followed by 40 amplification cycles (98°C for 30 s, 58°C for 30 s for HC (62°C for LCκ, 58°C for LCλ), and 72°C for 1 min), and a final step of 72°C for 7 min in a 50-μL reaction volume using 2X PrimeStar MAX buffer (Takara) and 100 nM primers. The PCR products from each single cell were detected on a 1.5% agarose GelRed gel. The PCR products from each well were filtered and purified using a commercially available purification kit (Tiangen).

[0289] Ligation was performed in a total volume of 20 μL using 10 uL of Genbuilder plus cloning-Ligase (Genscript), 100 ng of digested and purified PCR product, and 100 ng of linearized vector. Electrocompetent Escherichia coli TOP10 bacteria were transformed with 20 μL of the ligation product. Colonies were screened by PCR using PET-SEQ-F (TGCTGGTCTGCTGCTCCTCGC–SEQ ID NO.68) as the forward primer and PET-SEQ-R (ACCGTCTATCAGGGCGATGG–SEQ ID NO.69) as the reverse primer. The expected insert band length was approximately 700 bp. To ensure consistent variable gene sequences, plasmid DNA was isolated and sequenced from ten colonies for each plate.

[0290] Using the above single B cell sorting method and purified epidermal growth factor receptor (EGFR) as an antigen, a set of 11 clones was identified, each expressing a VHH antibody that specifically binds to EGFR with high affinity. See Figure 10 。

[0291] Using the above-described panning B cell enrichment method and using mesothelin (MSLN) as an antigen, a set of clones was selected from NGS data using lineage and CDR3 length and feature grouping methods. Among the clones of the 12 most abundant sequences in the library, 7 clones were shown to be effective MSLN binders. (See Table 3 below.) Importantly, MSLN consists of three domains; moreover, the antibodies of 5 MSLN-binding clones specifically bind to epitopes in domain 1 of MSLN. In addition, the antibody of one of the selected clones specifically binds to domain 2, while the antibody of one of the clones only specifically binds to domain 3. Thus, through single lineage grouping and selection, clones that can recognize broad-spectrum epitopes of the full-length antigen can be identified. This will provide more opportunities for selecting clones for antigen-binding therapy in different diseases, or more options for bispecific combinations. In addition, this method can also identify those clones that act as blockers or non-blockers of the antigen-ligand complex. For example, among the 7 MSLN-binding clones, it was identified that the antibodies of 2 clones bind to domains 2 or 3 of MSLN but do not inhibit the binding of CA125 to MSLN. In contrast, the binder of epitope 1 in domain 5 prevents the binding of CA125 to MSLN. The method disclosed in the present invention can effectively and systematically and relevantly select antibodies for testing, covering a wide range of epitopes with high resolution.

[0292] Table 3: Selected MSLN-binding clones

[0293]

[0294] In another example of identifying clones that produce antigen-specific antibodies, clones that produce anti-KLH antibodies were discovered through the following procedure.

[0295] Isolation of antigen-specific B cells. In a further experiment, a commercially available KLH (Keyhole Limpet Hemocyanin) was used to immunize an alpaca numbered #009 through a standard immunization protocol. The standard immunization protocol used 200 μg of KLH in complete Freund's adjuvant once, and then 100 μg of KLH (sigma) in incomplete Freund's adjuvant every two weeks. After evaluating the antiserum for serially diluted samples by ELISA, 100 - 200 mL of blood was drawn using the Ficoll-Paque density gradient technique (GE) according to the manufacturer's instructions for the isolation of peripheral blood mononuclear cells (PBMC). The isolated PBMC (viability > 95%) was resuspended in complete RPMI1640 medium to obtain a cell suspension of 10 6 / mL. 4 mL of the PBMC suspension was added to each well of a 6-well plate and incubated for 1 h to capture non-specifically binding cells. Then the unbound cells were collected and resuspended in complete RPMI1640 medium to 10 6 / mL. Add 5 mL of cell suspension to a 10-cm high-binding culture dish pre-coated with antigen (protein binding capacity > 500 ng / cm 2 ), and gently shake at 50 rpm for 1.5 h at 37 °C. After incubation, unbound cells are washed 2 - 10 times with 1×DPBS to remove non-specifically bound cells. Resuspend mitomycin-treated EL4.IL-2-C3 feeder cells (stably expressing alpaca CD40L) in B cell medium, and then add them to the culture dish at 0.5x10 6 cells / mL for in vitro co-culture of B cells. The final volume per 10-cm culture dish is 20 mL. The B cell co-culture medium contains 10% FBS (fetal bovine serum), 1% penicillin-streptomycin, 10% alpaca conditioned medium from alpaca blank PBMC cultures, and various growth factors, such as one or more interleukins, at concentrations ranging from 1 to 50 ng / mL.

[0296] After 10 days of co-culture, 50 μL of the supernatant is used for ELISA to test antibody secretion and specificity for binding to the KLH immunogen. Meanwhile, co-cultured cells are collected and the total cell number is counted. B cell expansion after B cell isolation and expansion is calculated by subtracting the cell number of the feeder cell control from the total cell number. To compare this enriched cell number with the initial cell amount added, we can calculate the expansion of antigen-specific B cells. As Figure 11 shown, B cells from 5 different co-culture dishes showed consistent antigen-specific VHH antibody secretion. After B cell isolation and expansion (BIA), antigen-specific B cells in PBMC expanded 4 to 6-fold.

[0297] After BIA, mRNA from co-cultured cells was used to construct three NGS libraries. Oligo-dT, random hexamers, and CH2-specific primers were used for reverse transcription, respectively. (Maass DR, Sepulveda J, Pernthaner A, Shoemaker CB. Alpaca (Lama pacos) as a convenient source of recombinant camelid heavy chain antibodies (VHHs). J Immunol Methods. 2007;324(1-2):13–25.) Then, two rounds of PCR reactions were performed on these cDNAs. All three libraries were sent to Genscript in Nanjing, China, for sequencing on a MiSeq sequencing system (Illumina, Miseq, 300x2), with 30% PhiX genomic DNA added, generating 4-5 million reads per sample. The data were quality checked using the NGS QC Toolkit and assembled using FLASH. Sequences were clustered into lineages / groups based on the same CDR3 length, a CDR3 Hamming distance less than or equal to 1, and the same mapped V / J germlines, as Figure 4 shown. Sequences were further subdivided into clusters based on the same CDR3 length and 80% or more CDR3 identity. Over 800 groups were generated for each library. Several lineage preference factors were applied to screen clones from these groups: sequence abundance, classical VHHs versus non-classical VHHs, and CDR3 length. Twenty clones were selected from 20 different groups, synthesized, expressed, and purified. The bioinformatics data related to the selected clones are shown in Tables 4 to 6 below. The complete amino acid sequences of the antibodies expressed by each selected clone are represented as contiguous sequences for each domain (FR1, CDR1, etc.).

[0298] Table 4: Bioinformatics data of selected anti-KLH VHH clones

[0299]

[0300] Table 5: Bioinformatics data of selected anti-KLH clones (continued)

[0301]

[0302]

[0303] Table 6: Bioinformatics data of selected clones (continued)

[0304]

[0305]

[0306] Antigen - specific binding validation of antibodies was performed by ELISA. The antibody library was investigated based on subgroup characteristics (sequence abundance, classical VHH versus non - classical VHH, and CDR3 length). In this example, only one clone was selected per cluster. In this example, most of the selected clones produced classical VHH rather than non - classical VHH. Amino acid sequences with both long and short hinge sequences were included in the selected clones of this example, i.e., clones with an additional pair of disulfide bonds within CDR3 compared to the usual VHH sequences. With this clone - picking strategy, we achieved a 100% success rate in selecting clones with binding activity. As shown by the ELISA assay, all 20 selected clones showed specific binding activity to the KLH antigen KLH( Figure 13 ). The average binding EC of 18 of them was 0.465 nM (except for the 6th and 9th which were outliers). Three clones (No. 1, 3, and 13) were effective KLH binders with EC50 values of 67, 77, and 72 pmol / L respectively. Most of the leads showed sub - nanomolar potency. Therefore, clonal B cells secreting potent KLH - binding antibodies can be identified by BIA and NGS. To confirm the correlation between CDR3 length and binding activity, clones with different CDR3 lengths were included in the list. The shortest CDR3 length observed was 9 amino acids, while the longest was 21. The average CDR3 length of the 20 VHH antibodies was 16 amino acids. As Figure 42 shown, a positive correlation was observed between CDR3 length and clonal ELISA activity.

[0307] Table 7: Anti - KLH ELISA of selected clones

[0308]

[0309]

[0310] Example 2: Discovery of antibodies blocking the PD - 1:PD - Ll complex by epitope prediction

[0311] Overview of experimental methods

[0312] Figure 14Workflow showing the discovery of antibodies that block ligands: receptor binding (complexation). This workflow starts with the identification of the three-dimensional structures of the ligand and receptor and / or the structure of their complex by computational or crystallographic methods. The parts of the receptor and ligand that form the binding interface can be determined by examining the interface of the "docked" proteins. Amino acids that interact to form or stabilize the binding complex can be determined by examining the structure. Experimental data from altering interface amino acids and observing the effect of such changes on the binding strength of the complex helps to determine the amino acids that interact to form and stabilize the complex.

[0313] Select a short linear amino acid sequence segment of 2-4 amino acids of the ligand or receptor located at the complex interface, and then search the NGS amino acid sequence library to identify antibody cDNA clones encoding the selected short amino acid sequence in the CDR part of the sequence (preferably in the CDR3 part of the antibody sequence). Using the screening peptide sequence of 2-4 amino acid lengths as the keyword, search the CDR3 sequences in the NGS database to obtain the satisfactory VHH sequences and their abundances.

[0314] Select the sequences in the NGS library that are above the selected abundance threshold for gene synthesis and fusion expression with the human IgG4-FC tag in HEK293 cells. Purify the expressed protein and then perform functional tests, such as for antigen binding and inhibition of the formation of the PD-1:PD-L1 complex.

[0315] PD-1 / PD-Ll Structural Analysis

[0316] Download the structure of the PD-1 / PD-Ll complex from the PDB database (PDB ID: 4ZQK). PYMOL software is used for structural analysis. The structure shows that PD-L1 covers two peptide segments of PD-1 ( Figure 15 ), yellow (the loop sequence close to PD-L1) is SFVLNWYRMSPSNQTDKLAA (SEQ ID NO.138), and purple (the loop sequence close to PD-1) is YLCGAISLPAKAQIKESLR (SEQ ID NO.139). Select the region of polar contact residues observed in the PD-1 / PD-L1 crystal structure. In PYMOL, the polar contacts between PD-1 and PD-L1 are shown by using "actions - find - polarcontacts - to others excluding solvent".

[0317] Figure 15Shows the interface of the PD-1:PD-L1 complex (data for this complex is publicly available - Protein Data Bank ID number: 4ZQK), and two adjacent peptides of PD-1 that act as potential "blocking" peptides, which inhibit complex formation. Figure 16 Results of the interaction analysis between the PD-1 protein and these two adjacent peptides; the amino acids at the interface of the SFV....SLR peptide of PD-1 and the AFT...RIT peptide of PD-L1 that interact are identified by connecting lines.

[0318] Through the above analysis, the polar contact residues of PD-L1 were determined, which are F-D-Q-ADYKR (SEQ ID NO.144). Since there is a long amino acid spacer (>2 amino acids) in F-D-Q-A, only the peptide segment ADYKR (SEQ ID NO.143) is suitable for the selection strategy. Peptides of two to four amino acids were selected for VHH selection. Then the peptides ADYK (SEQ ID NO.68), DYKR (SEQ ID NO.142), ADY, DYK, YKR, AD, DY, YK, and KR were set as the screening criteria from the NGS database (Table 4).

[0319] Other structures of PD-1 complexed with multiple antibodies are also available, which can also be downloaded from the PDB database and analyzed in the same way as above. The complexes between PD-1 and multiple anti-PD-1 antibodies, as well as the short peptides identified as potential blocking peptides through the above complex interaction analysis, are listed in Table 8:

[0320] Table 8

[0321]

[0322]

[0323] Particular attention should be paid to the CDR3 sequence, because CDR3 in VHH is the main binding region to the antigen, and the CDR3 part in VHH antibodies is longer than that in conventional (VHVL) antibodies, and the longer the CDR3, the larger the binding area provided for VHH antibodies. The CDR3 sequences including the screening peptides were extracted from the NGS database, and their abundances were counted to eliminate duplicate sequences. It was found that 2 - 4 amino acids are suitable for searching in the NGS database; two amino acids may be too short (resulting in an uncontrollable number of hits), and four amino acids may overly limit the number of selections. Therefore, 3 - amino acid sequences were selected for NGS database retrieval.

[0324] Previous publications have described protocols for discovering antibodies by panning phage display libraries of VHHs on the surface. However, this method often only yields VHH clones that are highly abundant in the library, resulting in the loss of some low-abundance VHHs. Based on keyword searches using different screening peptide sequences, a series of VHH sequences with different abundances (the percentage of all clones carrying DNA encoding the selected amino acid sequences) were selected from the NGS database. The CDR3 portions of the amino acid sequences encoded in the selected clones with different abundance calibration values (tare) are given in Table 9.

[0325] Table 9: cDNA clones selected as potential blocking antibodies

[0326]

[0327]

[0328] Selection of CDR3 sequences from the NGS database

[0329] We identified a series of screening peptides with lengths of 2 - 4 amino acids. We hypothesized that the CDR3 in the VHH might contain the screening peptide that could bind to PD-1 and block PD-L1. Since the CDR3 in VHH is the main antigen-binding region, it is longer than that in conventional antibodies, and the longer CDR3 provides a large binding area for VHH. CDR3 sequences including the screening peptide were extracted from the NGS database, and the abundances were calculated to eliminate duplicate sequences. Due to the different screening peptide segments, we found that 2 - 4 amino acids were appropriate, but it should be noted that 2 AAs might be too short and 4 AAs might limit the number of selections, and the screening peptide with a length of 3 amino acids was the best choice.

[0330] Antibody expression and purification

[0331] The nucleic acid encoding the selected VHH antibody sequence was synthesized and inserted into the pCDNA 3.4 vector, which was fused with an IgG4-FC tag having a (G4S) 3 linker sequence. The recombinant plasmid was confirmed by sequencing. Then the VHH-FC construct was transfected into HEK293 cells. The transfected cells were cultured for 5 - 7 days to obtain the recombinant protein. Then the recombinant VHH antibody was purified from the filtered culture supernatant. The protein concentration of the obtained antibody was measured by UV absorbance at 280 nm. The purity of the purified recombinant antibody was evaluated by Coomassie staining of sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE) and high-performance liquid chromatography (HPLC).

[0332] ELISA binding assay

[0333] Coat a 96-well plate with 2 μg / mL of PD-1 protein overnight for ELISA binding assay. Add the recombinant VHH-FC protein into the wells and let it stand for a period of time, then add 1 μg / mL of HRP-conjugated anti-FC antibody as the detection antibody and add the assay reagent. Read the absorbance at 450 nm. The binding of nivolumab serves as a positive control, and the plate coated with BSA serves as a negative control group.

[0334] ELISA blocking assay

[0335] Each well of a 96-well microtiter plate is coated with PBS containing 2 μg / mL PD-1 protein and blocked with 1% BSA. Add the purified VHH-FC protein at a concentration of 5 μg / mL to each well.

[0336] Then add 2 μg / L of biotinylated PD-L1 protein to each well. The PD-L1 protein is detected using HRP-conjugated anti-human IgG and TMB as the substrate. Measure the color development intensity at 450 nm. The wells without added PD-1 and without added VHH-FC are used as negative and positive controls, respectively.

[0337] Select thirty clones and purify the VHH antibodies from the selected clones. Thirty clones are selected for expression and purification as described above. Nineteen clones can express the recombinant VHH antibody well.

[0338] As described above, evaluate the binding of the purified VHH antibodies from the 19 clones to PD-L1 and the inhibition of PD-1:PD-L1 complex formation by ELISA. The results are shown in Table 10 and Table 11 respectively:

[0339] Table 10: PD-L1 binding activity of VHH antibodies expressed from the selected cDNA clones

[0340]

[0341]

[0342] Table 11: Blocking activity of the selected VHH clones

[0343]

[0344]

[0345] 1194-z0-IgG4 is a positive control antibody known to have the activity of blocking the PD-1:PD-L1 complex. NBL507-BMK2-H4-IgG4 is an irrelevant antibody used as a negative control.

[0346] Seven of the selected clones produced VHH antibodies with substantial binding activity to PD-1, and the five clones with the strongest binding were selected for testing the activity of blocking the formation of the PD-1:PD-L1 complex. Clone SS5 was found to exhibit even stronger complex inhibition than the positive control 1194-z0-IgG4.

[0347] From the results obtained, the set of clones expressing antibodies containing such CDR3 sequences is very likely to include at least one clone expressing a VHH antibody that specifically binds to the antigen and hinders the complex formation of the antigen with its specific protein binding partner, and the CDR3 sequence appears at least 10 copies in all selected clones. For example, in the experiments disclosed in the present invention, 100% of the clones in which the contained CDR3 sequence appears more than 10 copies in the selected clones express VHH antibodies that bind to PD-1, and 33% of them express VHH antibodies that can block the binding of PD-1 to PD-L1. In contrast, only 25% of the clones in which the contained CDR3 sequence appears less than 10 copies in the selected clones express VHH antibodies that bind to PD-1, and none of the selected clones express VHH antibodies that can prevent the binding of PD-1 to PD-L1.

[0348] In the additional experiments conducted as above, 30 clones were selected for expression and purification as described above. 19 clones expressed recombinant VHH antibodies well. Among them, 7 showed strong binding to human PD-1. The overall success rate of clone identification - NGS-guided clone selection for secreting antigen-binding VHH antibodies was 37%.

[0349] Example 3: Development of sequence features and clone selection rules

[0350] Convergent (overlapping) sequences among BCMA-immunized animals. In this experiment, two alpacas named 507-A1 (A1) and 507-A2 (A2) were immunized with human recombinant BCMA protein. Animals A1 and A2 received equal amounts of recombinant human BCMA using the same immunization protocol. The experiment found that the 93 and 40 VHH sequences with unique CDR3 amino acid sequences could be potential promising leads for animals A1 and A2, respectively. Among the animals, clones with double-blind selection for immunization and clone identification were selected, and 20 sequences shared the CDR3 sequence between the two animals. Table 12 shows the 20 unique CDR3 sequences shared by the two animals.

[0351] Table 12: CDR3 sequences of overlapping clones

[0352] CDR3 AIGAPDPFNYSGWRRNL SEQ ID NO.99 AIGISPHYGSDWYALR SEQ ID NO.100 AIGLSPGYRDPNL SEQ ID NO.101 AIGLSPGYRDPNL SEQ ID NO.102 ALGAMREGVYSDL SEQ ID NO.103 AVGAPLVSSPYRS SEQ ID NO.104 AVGAWYEKRKKKEKGL SEQ ID NO.105 AVGIVVPYSEDAWYSTL SEQ ID NO.106 GIGRWYDQRKKEEGL SEQ ID NO.107 NAAPWGSYHPQTDIVS SEQ ID NO.108 NAAPWGSYSPGPGDIAS SEQ ID NO.109 NGAPWGDHAPVVGS SEQ ID NO.110 NGAPWGDIAPVAVS SEQ ID NO.111 NPAPWGDYTATDFHS SEQ ID NO.112 QLGIHPGAF SEQ ID NO.113 QVGRYVSGVDYQP SEQ ID NO.114 QVGRYVSGVYYQP SEQ ID NO.115 VIGRGGYAMGDRRL SEQ ID NO.116 VIGRRGYAMGDRTL SEQ ID NO.117 VVGRRGYAMGSRQL SEQ ID NO.118

[0353] Figure 18The Venn diagram in [[ ]] shows the relationship between the CDR3 sequences from animals A1 and A2.

[0354] Antibody sequences shared by VHH2 (long hinge) and VHH3 (short hinge) sequences. In alpaca A1, 6 VHH sequences with long regions or short hinge regions were found. As Figure 19A shown, a raw library of 249 sequences was found and 135 of them were found to have hinge sequences. Among them, 26 non-redundant sequences with long hinge sequences and 89 non-redundant sequences with short hinge sequences were found. Among them, 19 unique CDR3 sequences have long hinge sequences and 53 unique CDR3 sequences have short hinge sequences. Among these two groups, 6 CDR3 sequences are shared.

[0355] Similar consideration was performed on the amino acid sequences of the clones of animal A2, and it was identified that 2 sequences in the long hinge or short hinge library of animal A2 are shared, as Figure 20A and 20B shown.

[0356] There are a total of 8 sequences in animals A1 and A2 that are located in both the long hinge sequence library and the short hinge sequence library.

[0357] Convergent sequences between alpaca conventional antibodies (VH) and VHH2 / VHH3. 19 single-chain antibodies that can bind well to human BCMA were identified from 2 animals. Surprisingly, 2 VHH sequences, 1A1 and 1D2, shared by the long hinge library and the short hinge library, are also present in the leader sequences of the conventional VH library. The number of common sequences of different classes of antibodies is as Figure 21A shown. Figure 21B Shows 8 VHH CDR3 sequences shared by the long hinge or short hinge, and the highlighted sequences are shared by all VH / VHH2 and VHH3.

[0358] The shared sequences are shown to be effective BCMA binders. To test whether the overlapping sequences are preferred features, the antibodies expressed by 8 convergent VHH clones shared by VHH2 and VHH3 were purified. By ELISA or flow cytometry, it was found that these are all effective BCMA binders. Figure 21B The sequences highlighted in [[ ]] (SEQ ID NOS.117 and 118), named 1A1 and 1D2, are shared by VH and VHH antibodies. 8 convergent VHH antibodies bind to the tumor cell line RPMI8226 overexpressing BCMA, but do not bind to 293T cells with negative BCMA expression. Using His- or Fc-conjugated human BCMA as the coated antigen, ELISA showed similar results (Table 13).

[0359] Table 13: Binding of BCMA to Selected Antibodies

[0360]

[0361] NBL507-A1L1-P1R2-1A1-(1)-PME207-SEQF_A01 SEQ ID NO.131

[0362] NBL507-A1L1-P1R2-1D2-(9)-PME207-SEQF_A02 SEQ ID NO.132

[0363] NBL507-A1L1-P1R2-1E2-(10)-PME207-SEQF_B02 SEQ ID NO.133

[0364] NBL507-A1L1-P1R2-1B6-(31)-PME207-SEQF_G04 SEQ ID NO.134

[0365] NBL507-A1L1-P1R2-1B8-(44)-PME207-SEQF_D06 SEQ ID NO.135

[0366] NBL507-A1L1-P1R2-1G8-(48)-PME207-SEQf_H06 --

[0367] NBL507-A2L1-P1R2-1C1-(273)-PME207-SEQF_E11 SEQ ID NO.136

[0368] NBL507-A2L1-P1R2-1H1-(275)-PME207-SEQF_G11 SEQ ID NO.137

[0369] Overlapping sequence features. Finally, 2 sequences common to VH / VHH2 / VHH3 were also found in A1 and A2 animals (see Figure 22 ). Thus, selecting those sequences found in multiple animals / VH / VHH germlines was considered a useful feature for antibodies to exhibit strong specific binding to antigens.

[0370] Data supporting other features. The affinities of classical VHH and non-classical VHH for binding to human BCMA were examined. Classical VHH had a higher affinity than non-classical VHH. The results are as Figure 23 shown; P < 0.05.

[0371] Other feature statistics

[0372] FR2 hydrophilic region: For most VHH antibodies, compared to conventional IgG, FR2 has unique amino acid substitutions: 37Phe / Tyr, 44Glu, 45Arg, and 47Gly. Figure 24 Shown is the proportion of clones with these FR2 unique amino acids of VHH antibodies in each of three libraries, each directed against a different antigen (NBL501 (anti-MSLN), NBL504 (anti-PD1), and NBL602 (anti-KLH)). Unexpectedly, up to 8% of the clones in the full VHH clone libraries in these three libraries have this particular FR2 substitution pattern. Also detected are the individual substitution frequencies at positions 37, 44, 45, and 47 (Kabat numbering) in the FR2 unique sequences, and the data are shown in Figure 25 .

[0373] Interestingly, the unique sequence substitutions are diverse. While Glu and Arg are the major amino acids at positions 44 and 45, positions 37 and 47 are variable. In NBL501 anti-MSLN, 70% of Tyr and 10% of Phe occupy position 37. In contrast, in anti-PD1 (NBL504) and anti-KLH (NBL602), 37Phe reaches 70% and 37Tyr is about 25%. A consistently high percentage of Leu rather than glycine is observed at position 47, and a significant proportion of clones also contain Phe and Trp at this position. The characteristic amino acid Gly at this position accounts for less than 10% of the frequency. Thus, 37Phe / Tyr, 44Glu, 45Arg, and 47Gly / Leu / Phe are considered characteristic of alpaca VHH FR2.

[0374] Extended CDR1 and CDR2: VHH has an additional hypervariable region (residues 27 - 30, numbered according to Kabat) next to CDR1. VHH antibodies with this region and a long CDR3 region increase the surface area for interaction with antigens. However, antibodies with this characteristic are not common.

[0375] The length of the CDR2 domain is usually 5 - 9 amino acids. However, many clones contain a "long CDR2" with a length of 14 - 17 amino acids. Importantly, it was found that VHHs containing a long CDR2 have a higher binding affinity for their antigens than those with a shorter CDR2. Figure 27 Shown are the ELISA data of antibodies from three different libraries.

[0376] Extra disulfide bonds within CDR3: Approximately 5-10% of VHH antibodies have extra disulfide bonds within the CDR3 domain, which may indicate that the epitopes bound by these antibodies are more "conformational" recognition sites formed by the three-dimensional structure of the antigen rather than shorter linear amino acid sequences. Approximately 2-19% of CDR3s contain intra-disulfide bonds. Figure 28 The proportion of antibodies with extra disulfide bonds within the CDR3 domain in three antibody libraries is shown (extra Cys residues - i.e., 2 cysteine amino acids in CDR3). The NBL504 anti-PD1 library contains a high percentage of antibodies with long CDR3 domains and significantly more intra-CDR3 disulfide bonds than the other two libraries, with a proportion of such clones of approximately 2%.

[0377] Extra disulfide bonds between CDR1 and CDR2: Although infrequent, antibodies with extra disulfide bonds between CDR1 and CDR2 can be found, i.e., extra Cys amino acids in CDR1 or CDR2. See Figure 29 and 30 。

[0378] Extra disulfide bonds between CDR1-CDR3 or FR2-CDR3: In camels and dromedaries, 82% of VHH antibodies have a disulfide bond between CDR1 and CDR3, while in llamas and alpacas, 74% of VHH antibodies have a disulfide bond between FR2-CDR3. 70-80% of VHH antibody sequences do not contain such additional disulfide bonds. 10-25% of VHH sequences may contain one additional disulfide bond (4 cysteines in the sequence). 5-10% of VHH antibody sequences contain unpaired cysteines. It is unclear how and whether these VHH antibodies can pair with another VHH antibody by forming disulfide bonds between unpaired cysteines. Up to a total of 7 cysteines have been observed in single VHH sequences. These data suggest that the remaining unpaired cysteines can form up to 3 intra-domain disulfide bonds. Figure 31 Analysis of the number of cysteine residues in the amino acid sequences of selected VHH antibodies from three different libraries is shown.

[0379] An extra disulfide bond can be present between CDR1 and CDR3, but this is rare. See Figure 32 。

[0380] Most of the extra disulfide bonds in VHH antibodies are located between FR2 / CDR2-CDR3. Consistent with the calculation of the total number of cysteines, most of the other disulfide bonds are located between FR2 / CDR2 (depending on the IMGT or Kabat nomenclature) and CDR3. The other paired cysteines account for 2-9% of all VHH sequences in the NGS library. See Figure 33 。

[0381] The OD value of the supernatant of the clone was significantly negatively correlated with the number of cysteines in its amino acid sequence (see Figure 34 ). Therefore, when selecting clones, it is recommended to avoid an odd number of cysteines in the VHH amino acid sequence. In addition, it is preferably to avoid selecting VHH sequences containing more than 1 pair of cysteine sequences. Additional disulfide bonds may affect the expression yield of VHH or have a negative impact on the binding affinity. Therefore, additional disulfide bonds will have an adverse effect on the developability of downstream manufacturing of nanobodies.

[0382] Long CDR3: In the PD1 NGS library (NBL504), up to 86% of the VHH clones had a "long CDR3" domain with more than 15 amino acids. See Figure 35 .

[0383] Figure 36 , Figure 37 and Figure 38 showed that the length of the CDR3 domain was positively correlated with the antibody affinity. The surface binding of the VHH anti-BCMA antibody to two cell lines expressing BCMA (CHO.K1 and RPMI8226) was detected by FACS, and the supernatant was detected by ELISA method. The p-values of all correlations were less than or equal to 0.001. There was a significant correlation between the CDR3 length and the binding affinity of the antibody to its antigen. Therefore, when the number of clones that can be selected is large, it is preferred to select antibodies with a CDR3 domain length greater than 14 amino acids.

[0384] It was also observed that CDR3 variants with similar lengths may bind to similar epitopes of a single antigen. The present invention found that the CDR3 length range of the VHH antibody population that binds to almost the same epitope or the same epitope of certain antigens is narrow. See Figure 39 .

[0385] In addition, antibodies that bind to the same epitope can be identified by lineage-related sequences. For example, clones with a CDR3 length difference of 0 or 1 amino acid. Clones 1182, 1202, and 1734 were selected from the same lineage of anti-PD1 antibodies, and they all competed with Keytruda for binding to PD1 (see Figure 40 ). It can be seen that the clones selected from the related lineages with the same CDR3 length are all in the same bin region. The experiments disclosed in the present invention show that lineage-related clones with the same length CDR3 domain are more likely to bind to exactly the same epitope. When selecting clones based on NGS data, it is preferred to reduce the number of such redundant clones in the selected library.

[0386] Non-classical VHHs with the same V and J germlines as conventional IgG: Whether VHH antibodies or IgG1 antibodies, VHH lineage groups with the same naive B cell origin (same V and J assignments) as conventional IgG1 are able to recognize the same or similar epitopes. In the 507 database, 2 out of 81 sequences are shared by VHH2 / VHH3 / VH, accounting for approximately 2.5% of the clones.

[0387] Non-classical VHHs with unique sequence features—conserved Trp118 replaced by Arg118 and / or lower hydrophobicity features in FR3: Trp 118 can be found in any of the NBL501, NBL504, and NBL602 libraries, and the percentage is as high as 3%. See Figure 41 。

[0388] Overall, the above data summarizes the following clone selection rules:

[0389] 1. If immunizing a single animal, select VHH sequences shared by VHH2 and VHH3. If investigating VHVL, select sequences shared between VH and VHH.

[0390] 2. Convergent motifs or sequence characteristics: Different animals in the same experimental group can converge to produce the same motifs or sequence characteristics through the same VDJ assignments. Antibody complementarity-determining regions encoded by these motifs or sequence characteristics can target functional epitopes. If immunizing multiple animals, select convergent sequences shared among the animals.

[0391] 3. Hydrophilic region of FR2: For most VHH antibodies, FR2 has unique amino acid substitutions compared to conventional IgG: 37Phe / Tyr, 44Glu, 45Arg, and 47Gly / Leu / Phe.

[0392] 4. Non-classical VHHs with unique sequence features: Conserved Trp118 is replaced by Arg118 and / or lower hydrophobicity in FR4.

[0393] 5. Classical VHHs have higher affinity than non-classical VHHs. When selecting clones, classical VHHs should be preferred. Non-classical VHHs do not contain FR2 features.

[0394] 6. Avoid selecting clones with an odd number of cysteines in the sequence: We selected a clone with 3 cysteines for synthesis and found that it could not be expressed. Some screened clones with 3 cysteines had expression levels below the average.

[0395] 7. In conventional antibodies, it has been found that consecutive positive and negative charge residues in CDR3 can lead to folding problems. In VHHs, we selected a clone with three arginines in CDR3, and this clone failed to express. Some of the screened clones with three consecutive positive charges (lysine or arginine or a mixture of them) had expression levels below the average. Clones with three or more consecutive positive charges in CDR3 should be avoided.

[0396] 8. Avoid clones with a positively charged N-terminus. We selected two such clones, and neither of them expressed. Few of the screened clones had a positively charged N-terminus.

[0397] 9. Some alpaca VHHs have a long CDR2 (17aa instead of 8 / 9), and clones with a long CDR2 have a high binding affinity.

[0398] 10. For some projects, the CDR3 length is positively correlated with the binding affinity. Preferentially select long CDR3 clusters.

[0399] 11. For related clusters with similar CDR3 lengths, avoid selecting too many redundant candidates because we found that homologous CDR3s of similar lengths bind to similar epitopes.

[0400] 12. Convergent motifs or sequence features: Different animals in the same experimental group can generate the same motif or sequence feature in a convergent form through the same VDJ assignment. The antibody complementarity-determining regions encoded by these motifs or sequence features can target functional epitopes.

[0401] 13. New classical binding loop structures: Hypermutation hotspots located at key sites determine the classical loop structures, making the VHH library more diverse. Crystallographic studies have emphasized that the CDR1 and CDR2 loops of camel VHHs often deviate from the known classical structures of conventional VH. Sequence-based prediction of new Ag-binding loop conformations should support further grouping of lineages (Laura S. Mitchell, Lucy J. Colwell, Comparative analysis of nanobody sequence and structure data, Proteins. 2018; 86: 697 - 706).

[0402] References

[0403] Daley LP, Kutzler MA, et al., Effector functions of camelid heavy-chain antibodies in immunity to West Nile virus. Clin. Vaccine Immunol. 17: 239–46, 2010.

[0404] McCoy LE, et al., Potent and broad neutralization of HIV-1 by a llama antibody elicited by immunization. J. Exp. Med. 2012.

[0405] Cristina Basilico, et al., Four individually druggable MET hotspots mediate HGF-driven tumor progression, The Journal of Clinical Investigation, Volume 124 Number 7 July, 2014.

[0406] Bas van der Woninga, et al., DNA immunization combined with scFv phage display identifies antagonistic GCGR specific antibodies and reveals new epitopes on the small extracellular loops, MABS, VOL. 8, NO. 6, 1126–1135, 2016.

[0407] Laura M. Griffin et al., Analysis of heavy and light chain sequences of conventional camelid antibodies from Camelus dromedarius and Camelus bactrianus species, Journal of Immunological Methods Volume 405, Pages 35-46, March 2014.

[0408] Adhdi Arbabi-Ghahroudi, et al., camelid single-Domain Antibodies: Historical Perspective and Future Outlook, Frontiers in Immunology, Vol 8, 2017.

[0409] Viet Khong Nguyen, et al., Camel heavy-chain antibodies: diverse germline VHH and specific mechanism enlarge the antigen-binding repertoire The EMBO Journal Vol.19 No.5 2000

[0410] Mehdi Arbabi-Ghahroudi. Camelid Single-Domain Antibodies: Historical Perspective and Future Outlook. Front. Immunol., 20 November 2017.

[0411] Nguyen VK, et al., Heavy-chain antibodies in Camelidae; a case of evolutionary innovation. Immunogenetics 54:39–47, 2002.

[0412] Conrath KE, et al., Emergence and evolution of functional heavy-chain antibodies in Camelidae. Dev Comp Immunol 27:87–103, 2003.

[0413] Nick Deschacht, et al., A Novel Promiscuous Class of Camelid Single-Domain Antibody Contributes to the Antigen-Binding Repertoire, The Journal of Immunology.184(10)5696-5704, May 2010.

[0414] Cortez-Retamozo V, et al., Efficient tumor targeting by single-domain antibody fragments of camels. Int J Cancer.98(3):456–62, 2002.

[0415] Alex Klarenbeek, et al., Camelid Ig V genes reveal significant human homology not seen in therapeutic target genes, providing for a powerful therapeutic antibody platform, mAbs 7:4, 693--706;2015.

[0416] Tomoyuki Igawa, et al., Engineering the variable region of therapeutic IgG antibodies. mAbs 3:3, 243-252;2011.

[0417] Laura S. Mitchell, Lucy J. Colwell, Comparative analysis of nanobody sequence and structure data, Proteins. 2018;86:697-706.

[0418] Maass DR, Sepulveda J, Pernthaner A, Shoemaker CB. Alpaca (Lama pacos) as a convenient source of recombinant camelid heavy chain antibodies (VHHs). J Immunol Methods. 2007;324(1-2):13–25. Sequence Listing <110> Zhejiang Nanobody Technology Center Co., Ltd. Zhu Weimin <120> Generation of Camel Antibodies by Sequence-Based High-Throughput Methods to Cover a Wide Range of Epitopes at High Resolution <130> SH02020-P0001PC <150> US 16 / 2811302 <151> 2019-02-27 <160> 155 <170> PatentIn version 3.5 <210> 1 <211> 120 <212> PRT <213> Alpaca <400> 1 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ala Val Ser Ser Ile Asn 20 25 30 Ala Met Gly Trp Tyr Arg Gln Thr Pro Glu Lys Val Arg Lys Leu Val 35 40 45 Ala Thr Met Gly Ser Gly Gly Asn Thr Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Tyr Ala Lys Asn Thr Val Ala Leu 65 70 75 80 Gln Met Asn Asn Leu Ile Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Ala Asp Lys Phe Gly Ala Asp Ile His Glu Val Asp Tyr Trp Gly Lys 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 2 <211> 118 <212> PRT <213> Alpaca <400> 2 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Ile Ser Ile Arg Arg Ile Asn 20 25 30 Ala Met Gly Trp Tyr Arg Gln Ala Pro Gly Lys Glu Arg Glu Leu Val 35 40 45 Ala Val Ile Ser Ser Pro Asn Lys Thr Leu Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Lys Asp Asn Tyr Thr Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr Cys Ser 85 90 95 Ala Trp Arg Ile Gly Val Asp Thr Thr Asp Tyr Tyr Gly Gln Gly Thr 100 105 110 Gln Val Thr Val Ser Ser 115 <210> 3 <211> 126 <212> PRT <213> Alpaca <400> 3 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ile Thr Leu Asp Tyr Tyr 20 25 30 Ala Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val 35 40 45 Ser Cys Ile Ser Ser Ser Gly Gly Ser Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Met Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Asp Ile His Cys Ser Gly Tyr Val Leu Phe Ser Pro Ser Asp 100 105 110 Phe Gly Asn Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 4 <211> 120 <212> PRT <213> Alpaca <400> 4 Glu Val Gln Val Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Val Pro Ser Gly Ser Ile Ser Ser Ile Tyr 20 25 30 Ala Met Gly Trp Tyr Arg Gln Ala Leu Gly Pro Glu Arg Glu Leu Val 35 40 45 Ala Ala Gln Thr Leu Gly Gly Gly Thr Tyr Tyr Ala Asn Pro Val Lys 50 55 60 Gly Arg Phe Thr Ile Tyr Arg Asp Asn Asp Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Asn Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr Cys Ala 85 90 95 Thr Pro Gly Glu His Trp Gly Ser Ser Asp Val Thr Asn Trp Gly Gln 100 105 110 Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 5 <211> 119 <212> PRT <213> Alpaca <400> 5 Glu Val Gln Val Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Gly Ile Ser Gly Asp Asp 20 25 30 His Met Gly Trp Tyr Arg Gln Ala Pro Gly Lys Ala Gly Gln Glu Arg 35 40 45 Asp Leu Val Ala Ala Phe Ser Asn Val Gly Lys Ala Tyr Tyr Ala Asp 50 55 60 Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn His Asn Asn Thr 65 70 75 80 Leu Tyr Leu Gln Met Asn Ser Leu Lys Pro Asp Asp Thr Ala Met Tyr 85 90 95 Tyr Cys Ala Ala Trp Ser Pro Arg His Pro Thr Tyr Tyr Gly Gln Gly 100 105 110 Thr Gln Val Thr Val Ser Ser 115 <210> 6 <211> 122 <212> PRT <213> Alpaca <400> 6 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Ala Asp Ser Ile Pro 20 25 30 Ala Met Gly Trp Tyr Arg Gln Ala Pro Gly Lys Glu Arg Glu Tyr Leu 35 40 45 Ala Ala Ile Ser Ser Gly Thr Asn Thr Tyr Tyr Ala Ser Ser Ala Lys 50 55 60 Gly Arg Phe Ala Ile Ser Arg Asn Asn Ala Asn Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr Cys Ala 85 90 95 Thr Cys Ser Ser Tyr Tyr Tyr Cys Ser Gly Pro Tyr Val Arg Ser Trp 100 105 110 Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 7 <211> 121 <212> PRT <213> Alpaca <400> 7 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Thr Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Pro Glu Trp Val 35 40 45 Ser Ile Ile Ser Thr Gly Gly Ala Ser Thr Val Tyr Thr Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ala Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Leu Tyr Tyr Cys 85 90 95 Val Arg Gly Asn Ser Arg Ser Gly Leu Ile Pro Arg Ala Tyr Trp Gly 100 105 110 Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 8 <211> 115 <212> PRT <213> Alpaca <400> 8 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Val Ala Ser Gly Ile Val Phe Arg Leu Asn 20 25 30 Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Arg Glu Arg Glu Leu Val 35 40 45 Ala Thr Ile Ala Ser Gly Gly Trp Ala Tyr Tyr Gly Asp Thr Met Ser 50 55 60 Gly Arg Val Thr Ile Ser Arg Asp Asn Asp Lys Asn Thr Leu Tyr Leu 65 70 75 80 Glu Met Asn Ser Leu Lys Pro Glu Asp Ser Ala Met Tyr Tyr Cys Ser 85 90 95 Ala Gly Gly Ala Arg Pro His Ser Trp Gly Gln Gly Thr Gln Val Thr 100 105 110 Val Ser Ser 115 <210> 9 <211> 115 <212> PRT <213> Alpaca <400> 9 Glu Val Gln Val Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Val Ala Ser Gly Phe Thr Phe Ser Val Ala 20 25 30 Ala Met Arg Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Trp Val 35 40 45 Ala Ser Ala Phe Ser Asp Gly Asn Leu His Tyr Glu Asp Phe Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asp Ala Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asp Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn 85 90 95 Ala Gly Thr Pro Ser Arg Ala Tyr Trp Gly Gln Gly Thr Gln Val Thr 100 105 110 Val Ser Ser 115 <210> 10 <211> 124 <212> PRT <213> Alpaca <400> 10 Gln Val Lys Leu Glu Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Val Ala Ser Gly Ser Ile Phe Ser Ile Asn 20 25 30 Ala Met Gly Trp Tyr Arg Arg Ala Pro Gly Lys Glu Arg Glu Leu Val 35 40 45 Ala Ser Ile Ser Ser Asp Gly Ser Ile Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Met Tyr Asp Cys Ala 85 90 95 Ala Leu Gly Val Val Asn Val Gly Val Arg Pro Thr Leu Glu Tyr Ile 100 105 110 Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 11 <211> 124 <212> PRT <213> Alpaca <400> 11 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Val Phe Gly Asn Thr Gly Ala Ile His 20 25 30 Ala Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Glu Val 35 40 45 Ala Arg Ile Ser Phe Gly Asp Gly Arg Thr Val Tyr Gly Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Gly Asp Asp Ala Lys Asn Thr Met Tyr 65 70 75 80 Leu Gln Met Asn Ile Leu Lys Ala Glu Asp Thr Ala Glu Tyr Tyr Cys 85 90 95 Asn Ala Val Phe Leu Gly Ile Gly Pro Thr Gly Arg Phe Glu Tyr Glu 100 105 110 Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 12 <211> 120 <212> PRT <213> Alpaca <400> 12 Gln Val Gln Leu Val Glu Thr Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ala Val Ser Ser Ile Asn 20 25 30 Ala Met Gly Trp Tyr Arg Gln Thr Pro Glu Lys Val Arg Lys Leu Val 35 40 45 Ala Thr Met Gly Ser Gly Gly Asn Thr Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Tyr Ala Lys Asn Thr Val Ala Leu 65 70 75 80 Gln Met Asn Asn Leu Ile Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Ala Asp Lys Phe Gly Ala Asp Ile His Glu Val Asp Tyr Trp Gly Lys 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 13 <211> 123 <212> PRT <213> Alpaca <400> 13 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Leu Thr Phe Ser Asp Phe 20 25 30 Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Ala Ile Ser Trp Ser Gly Gly Gln Thr Tyr Asn Val Glu Ser Ala 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Lys Leu Lys Pro Asp Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Ser Thr Met Val Val Thr Thr Val Ala Ala Asp Tyr Lys Tyr 100 105 110 Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 14 <211> 129 <212> PRT <213> Alpaca <400> 14 Glu Val Gln Val Val Glu Ser Gly Gly Gly Leu Val Lys Thr Gly Asp 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Gly Thr Ile Ser Gly Tyr 20 25 30 Glu Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Gly Ile Ser Arg Asn Gly Arg Ser Thr Gly Tyr Ser Asp Ser Ala 50 55 60 Lys Asp Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Gly Leu Lys Ala Asp Tyr Gly Asp Ser Tyr Val Asp Thr Ser 100 105 110 Thr Arg Asn Tyr Asn Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser 115 120 125 Ser <210> 15 <211> 125 <212> PRT <213> Alpaca <400> 15 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Gly Thr Phe Ser Arg Cys 20 25 30 Thr Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Ala Ile Ser Trp Gly Gly Ser Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Glu Gly Arg Phe Thr Ile Ser Arg Asp Asn Thr Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asp Ser Leu Lys Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Asp Tyr Asn Arg Leu Gln Ile Gly Gln Arg Ser Arg Asp Tyr 100 105 110 Asp Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 16 <211> 125 <212> PRT <213> Alpaca <400> 16 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Gly Thr Phe Ser Arg Thr 20 25 30 Thr Met Ala Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Ala Ile Ser Trp Ala Gly Ser Ser Thr Val Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Tyr Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Gly Arg Pro Phe Gly Leu Gln Leu Asp Thr His Gln Ala Asp Tyr 100 105 110 Asn Ile Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 17 <211> 124 <212> PRT <213> Alpaca <400> 17 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Ser Ala Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Thr Ala Ser Gly Arg Pro Phe Ser Ile Tyr 20 25 30 Asp Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Ser Val 35 40 45 Ala Val Ile Asn Leu Ser Arg Gly Asn Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Leu Asp Ser Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Ser Cys 85 90 95 Gly Val Asp Arg Arg Gln Tyr Gly Leu Gly Ile Pro Pro Leu Ala Asp 100 105 110 Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 18 <211> 125 <212> PRT <213> Alpaca <400> 18 Arg Gly Ala Gly Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Ser Leu Ser Cys Ala Ala Ser Gly Leu Thr Phe Ser Asn Tyr 20 25 30 Ala Met Ala Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Gly Ile Asn Trp Lys Gly Asp Arg Thr Tyr Tyr Thr Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser Thr Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Asp Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Val Ala Asp Tyr Arg Val Trp Gly Thr Arg Ile Ala Gly Thr Lys Tyr 100 105 110 Asp Ser Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 19 <211> 128 <212> PRT <213> Alpaca <400> 19 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Thr Leu Ser Cys Ala Ala Ser Gly Arg Thr Phe Asn Ser Tyr 20 25 30 Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Ala Ile Ser Gln Asn Gly Gly Ser Gln Gly Tyr Ala Glu Ala Val 50 55 60 Lys Asp Arg Phe Thr Ile Ser Arg Asp Asn Thr Asn Lys Val Val Ala 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Ala Tyr Tyr Cys 85 90 95 Ala Ala Asp Gly Asp Ala Ser Asp Arg Ser Tyr Ala Pro Pro Arg Asp 100 105 110 Tyr Lys Tyr Glu Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 20 <211> 123 <212> PRT <213> Alpaca <400> 20 Glu Val Gln Val Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Thr Ala Ser Gly Arg Thr Phe Ser Asn Tyr 20 25 30 Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Ser Val Thr Trp Gly Gly Ser Gly Thr Phe Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ile Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Asp Asn Val Gly Asp Ser Trp Tyr Ser Asp Asp Tyr Lys Tyr 100 105 110 Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 21 <211> 126 <212> PRT <213> Alpaca <400> 21 Glu Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Ser Phe Ser Gly Tyr 20 25 30 Ala Met Ala Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Ala Val Asn Trp Asn Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asp Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Asn Ala Arg Pro Thr Phe Gly Ala Tyr Tyr Ser Asp Tyr Lys Ser Gly 100 105 110 Val Asp Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 22 <211> 119 <212> PRT <213> Alpaca <400> 22 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Ala 1 5 10 15 Ser Leu Arg Leu Ser Cys Thr Ala Ser Gly Ser Ile Phe Ser Ile Tyr 20 25 30 Ala Met Gly Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Tyr Ile Thr Ser Gly Gly Ser Thr Thr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn 85 90 95 Arg Gly Asn Tyr Tyr Arg Asp Tyr Lys Pro Glu Phe Trp Gly Gln Gly 100 105 110 Thr Gln Val Thr Val Ser Ser 115 <210> 23 <211> 125 <212> PRT <213> Alpaca <400> 23 Glu Val Gln Val Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Leu Asp His Tyr 20 25 30 Asp Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Ala Val 35 40 45 Ser Cys Ile Ser Ser Ser Asp Gly Arg Thr Tyr Tyr Glu Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Asn Leu Lys Pro Glu Asp Thr Ala Leu Tyr Arg Cys 85 90 95 Thr Thr Glu Val Ala Cys Tyr Ser Asp Tyr Lys Ser Thr Gln Ile Ser 100 105 110 Arg Ile Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 24 <211> 122 <212> PRT <213> Alpaca <400> 24 Glu Val Gln Val Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Val Ser Gly Arg Gly Phe Ser Glu His 20 25 30 Ala Met Gly Trp Tyr Arg Gln Ser Pro Gly Lys Gln Arg Glu Phe Val 35 40 45 Ala Gly Val Thr Ser Tyr Gly Gly Thr Asn Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Val Gly Asn Thr Val Phe Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn 85 90 95 Tyr Lys Arg Gly His Tyr Pro Asp Gly Val Ser Thr Tyr Glu Tyr Trp 100 105 110 Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 25 <211> 122 <212> PRT <213> Alpaca <400> 25 Glu Val Gln Val Val Glu Ser Gly Gly Gly Ser Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Gly Phe Thr Glu His 20 25 30 Ala Met Gly Trp Tyr Arg Gln Ser Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Gly Ile Ser Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Val Ser Arg Asp Ser Ala Gly Asn Thr Val Ala Leu 65 70 75 80 Gln Met Asp Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ser 85 90 95 Tyr Lys Arg Gly Arg Tyr Pro Asp Gly Val Ser Thr Leu Glu Tyr Trp 100 105 110 Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 26 <211> 121 <212> PRT <213> Alpaca <400> 26 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Val Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Trp Met Tyr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Ile Asp Thr Thr Gly Gly Ser Thr Ala Tyr Thr His Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Arg Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Asn Leu Lys Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Asn Ser Thr Tyr Phe Asn Asp Asp Pro Glu Tyr Asp Arg Trp Gly 100 105 110 Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 27 <211> 124 <212> PRT <213> Alpaca <400> 27 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn Tyr 20 25 30 Ala Met Thr Trp Tyr Arg Gln Ala Pro Gly Lys Glu Arg Glu Leu Val 35 40 45 Ala Ala Ile Ser Ser Ala Gly Tyr Thr Thr Thr Tyr Ala Gly Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Asn Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Asn Ala Gly Arg Leu Ser Tyr Gly Gly Ser Tyr Tyr Pro Asn Asp Asp 100 105 110 Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 28 <211> 125 <212> PRT <213> Alpaca <400> 28 Glu Val Gln Val Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Val Ser Gly Arg Thr Phe Ser Ser Tyr 20 25 30 Val Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Asp Phe Val 35 40 45 Ala Ala Ile Ser Arg Ser Gly Gly Arg Thr Trp Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Phe Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Ser Tyr Tyr Cys 85 90 95 Asn Thr Asp Tyr Thr Phe Ala Lys Leu Thr Ala Pro Asp Arg Arg Asn 100 105 110 Asp Asp Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 29 <211> 118 <212> PRT <213> Alpaca <400> 29 Glu Val Gln Val Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Asp Thr Ile Phe Ile Ser 20 25 30 Ala Met Gly Trp Tyr Arg Gln Ala Pro Gly Lys Glu Arg Glu Leu Val 35 40 45 Ala Ala Ile Thr Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn 85 90 95 Ala Asp Thr Ile Ala Thr Met Thr Asp Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Gln Val Thr Val Ser Ser 115 <210> 30 <211> 125 <212> PRT <213> Alpaca <400> 30 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Thr Leu Ser Cys Ala Ala Ser Gly Ser Ser Phe Ser Ser Tyr 20 25 30 Ala Met Ser Trp Tyr Arg Gln Ala Pro Gly Lys Glu Arg Glu Leu Val 35 40 45 Ala Ala Met Thr Ala Pro Gly Gly Asp Ile Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Arg Asn Ala Val Tyr 65 70 75 80 Leu Arg Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr Cys 85 90 95 Asn Ala Thr Arg Pro Arg Asp Asp Tyr Tyr Tyr Thr Gly Gly Phe Leu 100 105 110 Tyr Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 31 <211> 123 <212> PRT <213> Alpaca <400> 31 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Thr Phe Ser Ser Tyr 20 25 30 Gly Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Ala Val Asn Trp Ser Asn Ser Ser Ala Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Asp Arg Phe Thr Ile Ser Ser Asp Asn Ala Lys Ser Thr Ile Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Arg Pro Tyr Ser Asp Tyr Val Thr Tyr Asp Pro Asp Asp Tyr Asp Tyr 100 105 110 Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 32 <211> 123 <212> PRT <213> Alpaca <400> 32 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Asn Phe Ser Ser Tyr 20 25 30 Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Val Phe Val 35 40 45 Ala Thr Ile Asn Trp Lys Gly Val Ser Thr Tyr Tyr Ala Pro Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Asn Thr Asp Pro Asp Tyr Ser Asp Tyr Asp Asp Met Tyr Val Arg Ser 100 105 110 Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 33 <211> 124 <212> PRT <213> Alpaca <400> 33 Arg Gly Ala Gly Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Asp 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Thr Phe Ser Thr Tyr 20 25 30 Ala Thr Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Val Val 35 40 45 Ala Ala Ile Ser Trp Asn Gly Gly Asn Thr Tyr Tyr Ala Ala Ser Gly 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Thr Asn Ser Asn Thr Asp Trp Arg Thr Tyr Thr Glu Tyr Asn 100 105 110 Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 34 <211> 126 <212> PRT <213> Alpaca <400> 34 Gln Val Gln Leu Val Glu Thr Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Thr Phe Ser Ser Tyr 20 25 30 Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Asp Phe Val 35 40 45 Ala Gly Ile Ser Gly Ser Gly Gly Asn Thr Pro Tyr Ala Glu Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Ala 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Lys Phe Thr Ser Ser Ser Phe Tyr Tyr Arg Ser Pro Arg Glu 100 105 110 Tyr Ser Ser Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 35 <211> 127 <212> PRT <213> Alpaca <400> 35 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Val Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Ile Asn Ser Gly Gly Ser Ser Ser Ser Tyr Pro Glu Ser Val 50 55 60 Lys Asp Arg Phe Thr Val Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Phe Cys 85 90 95 Ala Ala Lys Asn Val Pro Gly Phe Tyr Tyr Ser Asp Tyr Ala Asn His 100 105 110 Glu Tyr Asp Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 36 <211> 124 <212> PRT <213> Alpaca <400> 36 Gln Val Gln Leu Val Glu Thr Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Val Ser Gly Asp Thr Ile Phe Thr Ile 20 25 30 Ala Ala Ala Trp Tyr Arg Gln Val Pro Gly Lys Glu Arg Glu Leu Val 35 40 45 Ala Ala Ile Thr Ser Gly Gly Ala Thr Arg Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Ala Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn 85 90 95 Ala Pro Lys Gly Gly Ser Tyr Tyr Phe Pro Ala Val Gly Gly Tyr Asp 100 105 110 Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 37 <211> 121 <212> PRT <213> Alpaca <400> 37 Gln Val Gln Leu Val Glu Thr Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Asp Thr Ile Phe Ile Ser 20 25 30 Ser Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Glu Arg Glu Leu Val 35 40 45 Ala Ser Ile Asp Ser Asp Asp Ile Ile Tyr Tyr Ala Ala Thr Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Asp Lys Pro Thr Met Tyr Leu 65 70 75 80 Gln Met Asp Thr Leu Gln Pro Glu Asp Thr Ala Val Tyr Tyr Cys Arg 85 90 95 Val Glu Ser Gln Asp Tyr Tyr Phe Asp Tyr Asp Arg Asp Ser Trp Gly 100 105 110 Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 38 <211> 117 <212> PRT <213> Alpaca <400> 38 Glu Val Gln Val Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ala Phe Ser Thr Tyr 20 25 30 Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Ala Val Glu Trp Val 35 40 45 Ser Ala Ile Asp Asp Ile Gly Ala Tyr Ile Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Leu Tyr Tyr Cys 85 90 95 Ala Thr Gly Tyr Trp Tyr Thr Pro Gly Asp Trp Gly Gln Gly Thr Gln 100 105 110 Val Thr Val Ser Ser 115 <210> 39 <211> 116 <212> PRT <213> Alpaca <400> 39 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Glu 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Val Met Asn Trp Tyr Arg Gln Ala Pro Gly Lys Glu Arg Glu Leu Val 35 40 45 Ala Ala Ile Asp Asn Val Gly Gly Ser Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Tyr Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Asn Ala Lys Arg Tyr Trp Tyr Asp Tyr Trp Gly Gln Gly Thr Gln Val 100 105 110 Thr Val Ser Ser 115 <210> 40 <211> 127 <212> PRT <213> Alpaca <400> 40 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Ser Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Val Ser Gly Phe Thr Leu Asp Tyr Tyr 20 25 30 Asp Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Asp Trp Ile 35 40 45 Ser Cys Ile Ser Ser Ser Asp Gly Ser Gln Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Asp Arg Phe Phe Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Glu Pro Gly Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Asp Phe Asp Thr Tyr Arg Phe Cys Ser Gly Phe Gly Pro Asp 100 105 110 Ala Tyr Ser Ser Trp Gly Gln Gly Thr Gln Val Ile Val Ser Ser 115 120 125 <210> 41 <211> 117 <212> PRT <213> Alpaca <400> 41 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Thr Phe Ser Gly Tyr 20 25 30 Thr Met Gly Trp Phe Arg Arg Ala Pro Gly Lys Glu Arg Glu Leu Ile 35 40 45 Ala Asn Ile Leu Trp Asn Ser Ala Arg Arg Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Met Asn Thr Val Asp 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Val Leu Val Asp Ser Thr Tyr Arg Phe Ser Asn Gln Gly Thr Gln 100 105 110 Val Thr Val Ser Ser 115 <210> 42 <211> 121 <212> PRT <213> Alpaca <400> 42 Glu Val Gln Leu Val Glu Thr Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ala Cys Glu Val Ser Gly Arg Thr Phe Ser Ser Tyr 20 25 30 Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Arg Glu Arg Glu Phe Val 35 40 45 Ala Ser Ile Arg Val Ser Gly Gly Ile Thr Asp Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asp Thr Val Tyr 65 70 75 80 Leu Gln Met Ile Asn Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Asn Ala Asp Ile Ser Arg Tyr Arg Phe Ser Arg Gly Asp Tyr Trp Gly 100 105 110 Lys Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 43 <211> 124 <212> PRT <213> Alpaca <400> 43 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Thr Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Leu Thr Phe Gly Ser Tyr 20 25 30 Ala Met Glu Trp Tyr Arg Gln Ala Pro Gly Lys Glu Arg Glu Leu Val 35 40 45 Ala Thr Ile Ser Ser Gly Gly Asn Thr His Tyr Leu Ala Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Asp Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Ala Lys Tyr Gly Trp Thr Gly Ile Trp Tyr Ala Pro Ser Asp Tyr Val 100 105 110 His Leu Gly Pro Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 44 <211> 125 <212> PRT <213> Alpaca <400> 44 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Asp 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Asp Asn Phe Ser Arg Tyr 20 25 30 Thr Phe Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Val Ile Asn Trp Ser Gly Ser Tyr Thr Tyr Val Ala Asp Ser Val 50 55 60 Ala Gly Arg Phe Thr Met Ser Arg Asp Asn Ala Lys His Leu Val Tyr 65 70 75 80 Leu Gln Met Asp Ser Leu Asn Thr Gly Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala His Trp Asp Tyr Gly Ser Ser Ser Arg Arg Gln Arg Glu Tyr 100 105 110 Asp Tyr Trp Gly Gln Gly Thr Gln Val Ile Val Ser Ser 115 120 125 <210> 45 <211> 125 <212> PRT <213> Alpaca <400> 45 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Thr Ser Ser Arg Tyr 20 25 30 Val Met Gly Trp Phe Arg Gln Ser Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Ala Ile Ser Ala Asn Gly Arg Ser Thr Asn Tyr Ala Gly Ser Val 50 55 60 Asn Gly Arg Phe Lys Ile Ser Arg Asp Gly Ala Lys Asp Lys Val Asp 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Phe Cys 85 90 95 Ala Thr Asn Met Ala Phe Ser Ser Ser Ser Asn Phe Pro Ala Asn Tyr 100 105 110 Asp Val Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 46 <211> 127 <212> PRT <213> Alpaca <400> 46 Gln Val Gln Leu Ala Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Asp 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Ser Val Ser Ser Tyr 20 25 30 Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Ala Ile Ser Trp Ser Gly Glu Ser Thr His Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Glu Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ser Tyr Leu Ser Gly His Tyr Tyr Phe Gly Ile Gly Arg Asp Pro 100 105 110 Pro Phe Gly Ser Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 47 <211> 116 <212> PRT <213> Alpaca <400> 47 Arg Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Thr Ala Ser Gly Leu Pro Leu Asn Thr Ala 20 25 30 Ala Met Ser Trp Tyr Arg Gln Thr Pro Gly Lys Glu Arg Glu Leu Val 35 40 45 Ala Ser Ile Ser Ile Thr Gly Asp Ser Thr Thr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Val Lys Asn Ile Val Tyr 65 70 75 80 Leu Gln Met Asp Ile Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Thr Arg Ala Pro Trp Asp Tyr Lys Tyr Trp Gly Gln Gly Thr Gln Val 100 105 110 Thr Val Ser Ser 115 <210> 48 <211> 124 <212> PRT <213> Alpaca <400> 48 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Val Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Val Ala Ser Gly Leu Thr Phe Ser Asn Tyr 20 25 30 Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Thr Ala Ile Asn Trp Ser Gly Ala Ile Lys Asn Tyr Gly Asp Ser Ala 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Leu Asn Met Leu Tyr 65 70 75 80 Leu Gln Met Asn Arg Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Arg Gln Gly Asn Met Gly Asp Leu Val Val Lys Ser Gly Asp 100 105 110 Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 49 <211> 125 <212> PRT <213> Alpaca <400> 49 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Thr Phe Gly Arg His 20 25 30 Val Met Ala Trp Phe Arg Gln Ala Pro Gly Arg Glu Arg Glu Phe Val 35 40 45 Ala Ala Ile Ser Gly Asn Gly Arg Val Thr Asn Tyr Ala Leu Ser Met 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Asn Asp Met Val Tyr 65 70 75 80 Leu Gln Met Asp Gly Leu Lys Pro Glu Asp Thr Ala Val Tyr Ser Cys 85 90 95 Ala Thr Arg Met Ala Phe Asp Ser Asp Ser Asn Phe Pro Ala Thr Tyr 100 105 110 Asp Val Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 50 <211> 125 <212> PRT <213> Alpaca <400> 50 Gln Val Gln Leu Thr Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Ala 1 5 10 15 Ser Leu Arg Leu Ser Cys Val Ala Ser Pro Asp Thr Pro Ser Thr Tyr 20 25 30 Thr Ile Ala Trp Phe Arg Arg Ala Pro Gly Lys Glu Arg Asp Phe Val 35 40 45 Ala Asn Ile Ala Arg Ala Gly Thr Thr Ile Thr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Lys Asp Asn Ala Arg Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Asn Leu Thr Pro Ala Asp Thr Ala Ile Tyr Tyr Cys 85 90 95 Ala Ala Tyr Ser Pro Gly Ser Ile Ile Ala Arg Asp Ser Thr Gln Tyr 100 105 110 Arg Tyr Trp Gly Gln Gly Thr Arg Val Thr Val Ser Glu 115 120 125 <210> 51 <211> 124 <212> PRT <213> Alpaca <400> 51 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Glu 1 5 10 15 Ser Leu Arg Leu Ser Cys Val Ala Ser Gly Arg Thr Phe Ser Ser Tyr 20 25 30 Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Gln Glu Arg Glu Phe Val 35 40 45 Ala Arg Ile Ser Arg Arg Gly Thr Asn Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Arg Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Asp Arg Ser Asp Val Phe Glu Lys Asp Pro Gly Tyr Tyr Asp 100 105 110 Tyr Trp Gly Gln Gly Ala Gln Val Thr Val Ser Ser 115 120 <210> 52 <211> 116 <212> PRT <213> Alpaca <400> 52 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Thr Ala Ser Gly Phe Thr Leu Ser Thr Ser 20 25 30 Pro Val Ser Trp Ala Arg Gln Ala Pro Gly Lys Gly Pro Glu Trp Leu 35 40 45 Ala Gly Ile Tyr Ser Asp Gly Arg Thr Ser Asn Leu Val Ser Leu Arg 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Leu Pro Glu Asp Thr Ala Leu Tyr Tyr Cys Ala 85 90 95 Ile Gly Ala Ala Ala Val Gly Gly Leu Arg Gly Gln Gly Thr Gln Val 100 105 110 Thr Val Ser Ser 115 <210> 53 <211> 128 <212> PRT <213> Alpaca <400> 53 Gln Val Ser Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Thr Phe Arg Arg Ser 20 25 30 Ala Met Gly Trp Phe Arg Arg Pro Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Ala Ile Thr Ser Ser Gly Gly Ser Ile Tyr Asp Pro Asp Ile Ala 50 55 60 Lys Asp Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Thr Ser Val Tyr 65 70 75 80 Leu Gln Met Asn Asn Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ser Leu Lys Thr Thr Tyr Ser Gly Gly Pro Tyr Asp Tyr Thr Lys Gly 100 105 110 Pro Glu Tyr Asp Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 54 <211> 120 <212> PRT <213> Alpaca <400> 54 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Arg Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Ala Phe Ser Ser Tyr 20 25 30 Pro Met Gly Trp Phe Arg Arg Ala Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Ala Ile Ser Leu Ser Gly Ser Lys Gln Tyr Tyr Val Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Ser 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Leu Lys Asp Gly Glu Pro Pro Ala Val Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 55 <211> 126 <212> PRT <213> Alpaca <400> 55 Gln Val Glu Leu Val Glu Ser Gly Gly Ala Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Lys Leu Ser Cys Val Asp Ser Gly Arg Ser Phe Ser Ser Tyr 20 25 30 Val Val Ala Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Arg Val Ser Ala Ser Gly Ala Ile Arg Thr Tyr Ala Asp Ser Val 50 55 60 Arg Gly Arg Phe Thr Ile Ser Arg Asp Asn Thr Lys Ala Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Ser Glu Asp Thr Ala Val Phe Phe Cys 85 90 95 Ala Ala Gly Gly Val Ser Thr Ala Val His Pro Phe Lys Pro Thr Ser 100 105 110 Tyr Asp Phe Trp Gly Gln Gly Thr Gln Val Thr Val Ser Val 115 120 125 <210> 56 <211> 120 <212> PRT <213> Alpaca <400> 56 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Glu Ser Ile Arg Ser Ile Tyr 20 25 30 Ala Met Gly Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Leu Val Thr Asp Asp Gly Ser Thr Asp Tyr Val Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Val Ser Arg Asp Ser Ala Lys Asn Thr Val Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr His Cys Tyr 85 90 95 Val Glu Gly Ser Thr His Tyr Asp Pro Val Arg Glu Tyr Trp Gly Lys 100 105 110 Gly Thr Leu Val Thr Val Ser Ser 115 120 <210> 57 <211> 124 <212> PRT <213> Alpaca <400> 57 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Leu Phe Ser Gly Thr Phe Gly Ile Tyr Gly 20 25 30 Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Ala Arg Glu Phe Val Ala 35 40 45 Gly Val Ser Arg His Gly Leu Thr Thr Gln Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Met Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Asp Tyr Tyr Cys Ala 85 90 95 Arg Ser Arg Leu Ser Ala Ser Leu Leu Val Thr Ala Ser Asp Tyr Asp 100 105 110 Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 58 <211> 122 <212> PRT <213> Alpaca <400> 58 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Asp 1 5 10 15 Ser Leu Arg Leu Ser Cys Thr Ala Ser Gly Thr Thr Phe Asp Arg Tyr 20 25 30 His Met Gly Trp Phe Arg Gln Ala Pro Gly Met Glu Arg His Val Val 35 40 45 Ala His Ile Ser Trp Ser Gly Ala Asn Thr Tyr Val Ala Asp Ser Met 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Ala Tyr 65 70 75 80 Leu Gln Ile Asn Asn Leu Lys Phe Glu Asp Thr Ala Leu Tyr Tyr Cys 85 90 95 Ala Ala Gly Ser Tyr Leu Ala Val Pro Gly Ser Arg Trp Asp Tyr Trp 100 105 110 Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 59 <211> 118 <212> PRT <213> Alpaca <400> 59 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr Ser Leu Ser Phe Tyr 20 25 30 Ala Met Gly Trp Tyr Arg Gln Ser Pro Gly Lys Gln Arg Glu Val Val 35 40 45 Ala Arg Ile Ala Gly Pro Gly Val Thr Asn Tyr Ala Asp Ser Val Met 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Met Val Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Glu Pro Glu Asp Thr Ala Val Tyr Tyr Cys Asn 85 90 95 Ala Gly Gly Thr Arg Trp Ser Val Gly Asp Tyr Trp Gly Lys Gly Thr 100 105 110 Leu Val Thr Val Ser Ser 115 <210> 60 <211> 121 <212> PRT <213> Alpaca <400> 60 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Asp 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Thr Phe Ser Ser Tyr 20 25 30 Ala Met Ala Trp Phe Arg Arg Pro Pro Gly Lys Ala Arg Glu Phe Val 35 40 45 Ala Leu Ile Arg Trp Ser Asn Gly Arg Thr Ala Val Val Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ala Ser Arg Asp Asn Ala Lys Asn Thr Gly Tyr 65 70 75 80 Leu Gln Met Asp Ser Leu Lys Ser Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Cys Asp Gln Ala Leu Asp Pro Pro Arg Cys Asn Asp Trp Gly 100 105 110 Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 61 <211> 122 <212> PRT <213> Alpaca <400> 61 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Thr Phe Phe Thr Tyr 20 25 30 Pro Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Gln Phe Val 35 40 45 Ala Ala Ile Ser Gly Asn Gly Asp Ser Ile Asp Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Ala Ala Leu Tyr Tyr Cys 85 90 95 Asn Ala Val Ile Thr His Asp Tyr Thr Arg Pro Leu Phe Ala Ser Trp 100 105 110 Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 62 <211> 122 <212> PRT <213> Alpaca <400> 62 Arg Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ala Leu Arg Leu Ser Cys Val Gly Ser Gly Phe Thr Phe Arg Asp Thr 20 25 30 Ala Met Ala Trp Phe Arg Gln Ser Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Gly Phe Ser Ile Leu Ser Arg Tyr Ala Asp Ser Val Lys Gly Arg 50 55 60 Phe Thr Ile Ser Arg Asp Asn Asp Lys Asn Thr Val Tyr Leu Gln Met 65 70 75 80 Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ala Gly 85 90 95 Asp Gly Thr Ile Ala Ser Val Leu Thr Thr Ser Gly Val Asn Phe Trp 100 105 110 Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 63 <211> 24 <212> DNA <213> Artificial sequence <220> <223> NGS sequencing primer <400> 63 gcagtggctg caggtgtcca ctcg 24 <210> 64 <211> 24 <212> DNA <213> Artificial sequence <220> <223> NGS sequencing primer <400> 64 gcaggtcccc aaggtgtcct gtcc 24 <210> 65 <211> 18 <212> DNA <213> Artificial sequence <220> <223> NGS sequencing primer <400> 65 ggtggtcctg gctgctct 18 <210> 66 <211> 21 <212> DNA <213> Artificial sequence <220> <223> NGS sequencing primer <400> 66 ttgtggtttt ggtgtcttgg g 21 <210> 67 <211> 21 <212> DNA <213> Artificial sequence <220> <223> NGS sequencing primer <400> 67 ggggtcttcg ctgtggtgcg c 21 <210> 68 <211> 21 <212> DNA <213> Artificial sequence <220> <223> Sanger sequencing primer <400> 68 tgctggtctg ctgctcctcg c 21 <210> 69 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Sanger sequencing primer <400> 69 accgtctatc agggcgatgg 20 <210> 70 <211> 4 <212> PRT <213> Alpaca <400> 70 Ala Asp Tyr Lys 1 <210> 71 <211> 16 <212> PRT <213> Alpaca <400> 71 Ala Ala Ser Thr Met Val Val Thr Thr Val Ala Ala Asp Tyr Lys Tyr 1 5 10 15 <210> 72 <211> 22 <212> PRT <213> Alpaca <400> 72 Ala Ala Gly Leu Lys Ala Asp Tyr Gly Asp Ser Tyr Val Asp Thr Ser 1 5 10 15 Thr Arg Asn Tyr Asn Tyr 20 <210> 73 <211> 18 <212> PRT <213> Alpaca <400> 73 Ala Ala Asp Tyr Asn Arg Leu Gln Ile Gly Gln Arg Ser Arg Asp Tyr 1 5 10 15 Asp Tyr <210> 74 <211> 18 <212> PRT <213> Alpaca <400> 74 Ala Gly Arg Pro Phe Gly Leu Gln Leu Asp Thr His Gln Ala Asp Tyr 1 5 10 15 Asn Ile <210> 75 <211> 17 <212> PRT <213> Alpaca <400> 75 Gly Val Asp Arg Arg Gln Tyr Gly Leu Gly Ile Pro Pro Leu Ala Asp 1 5 10 15 Tyr <210> 76 <211> 18 <212> PRT <213> Alpaca <400> 76 Val Ala Asp Tyr Arg Val Trp Gly Thr Arg Ile Ala Gly Thr Lys Tyr 1 5 10 15 Asp Ser <210> 77 <211> 21 <212> PRT <213> Alpaca <400> 77 Ala Ala Asp Gly Asp Ala Ser Asp Arg Ser Tyr Ala Pro Pro Arg Asp 1 5 10 15 Tyr Lys Tyr Glu Tyr 20 <210> 78 <211> 16 <212> PRT <213> Alpaca <400> 78 Ala Ala Asp Asn Val Gly Asp Ser Trp Tyr Ser Asp Asp Tyr Lys Tyr 1 5 10 15 <210> 79 <211> 19 <212> PRT <213> Alpaca <400> 79 Asn Ala Arg Pro Thr Phe Gly Ala Tyr Tyr Ser Asp Tyr Lys Ser Gly 1 5 10 15 Val Asp Tyr <210> 80 <211> 13 <212> PRT <213> Alpaca <400> 80 Asn Arg Gly Asn Tyr Tyr Arg Asp Tyr Lys Pro Glu Phe 1 5 10 <210> 81 <211> 18 <212> PRT <213> Alpaca <400> 81 Thr Thr Glu Val Ala Cys Tyr Ser Asp Tyr Lys Ser Thr Gln Ile Ser 1 5 10 15 Arg Ile <210> 82 <211> 16 <212> PRT <213> Alpaca <400> 82 Asn Tyr Lys Arg Gly His Tyr Pro Asp Gly Val Ser Thr Tyr Glu Tyr 1 5 10 15 <210> 83 <211> 16 <212> PRT <213> Alpaca <400> 83 Ser Tyr Lys Arg Gly Arg Tyr Pro Asp Gly Val Ser Thr Leu Glu Tyr 1 5 10 15 <210> 84 <211> 14 <212> PRT <213> Alpaca <400> 84 Ala Asn Ser Thr Tyr Phe Asn Asp Asp Pro Glu Tyr Asp Arg 1 5 10 <210> 85 <211> 17 <212> PRT <213> Alpaca <400> 85 Asn Ala Gly Arg Leu Ser Tyr Gly Gly Ser Tyr Tyr Pro Asn Asp Asp 1 5 10 15 Tyr <210> 86 <211> 18 <212> PRT <213> Alpaca <400> 86 Asn Thr Asp Tyr Thr Phe Ala Lys Leu Thr Ala Pro Asp Arg Arg Asn 1 5 10 15 Asp Asp <210> 87 <211> 12 <212> PRT <213> Alpaca <400> 87 Asn Ala Asp Thr Ile Ala Thr Met Thr Asp Asp Tyr 1 5 10 <210> 88 <211> 18 <212> PRT <213> Alpaca <400> 88 Asn Ala Thr Arg Pro Arg Asp Asp Tyr Tyr Tyr Thr Gly Gly Phe Leu 1 5 10 15 Tyr Tyr <210> 89 <211> 16 <212> PRT <213> Alpaca <400> 89 Arg Pro Tyr Ser Asp Tyr Val Thr Tyr Asp Pro Asp Asp Tyr Asp Tyr 1 5 10 15 <210> 90 <211> 16 <212> PRT <213> Alpaca <400> 90 Asn Thr Asp Pro Asp Tyr Ser Asp Tyr Asp Asp Met Tyr Val Arg Ser 1 5 10 15 <210> 91 <211> 17 <212> PRT <213> Alpaca <400> 91 Ala Ala Thr Asn Ser Asn Thr Asp Trp Arg Thr Tyr Thr Glu Tyr Asn 1 5 10 15 Tyr <210> 92 <211> 19 <212> PRT <213> Alpaca <400> 92 Ala Ala Lys Phe Thr Ser Ser Ser Phe Tyr Tyr Arg Ser Pro Arg Glu 1 5 10 15 Tyr Ser Ser <210> 93 <211> 20 <212> PRT <213> Alpaca <400> 93 Ala Ala Lys Asn Val Pro Gly Phe Tyr Tyr Ser Asp Tyr Ala Asn His 1 5 10 15 Glu Tyr Asp Tyr 20 <210> 94 <211> 18 <212> PRT <213> Alpaca <400> 94 Asn Ala Pro Lys Gly Gly Ser Tyr Tyr Phe Pro Ala Val Gly Gly Tyr 1 5 10 15 Asp Tyr <210> 95 <211> 15 <212> PRT <213> Alpaca <400> 95 Arg Val Glu Ser Gln Asp Tyr Tyr Phe Asp Tyr Asp Arg Asp Ser 1 5 10 15 <210> 96 <211> 10 <212> PRT <213> Alpaca <400> 96 Ala Thr Gly Tyr Trp Tyr Thr Pro Gly Asp 1 5 10 <210> 97 <211> 9 <212> PRT <213> Alpaca <400> 97 Asn Ala Lys Arg Tyr Trp Tyr Asp Tyr 1 5 <210> 98 <211> 20 <212> PRT <213> Alpaca <400> 98 Ala Ala Asp Phe Asp Thr Tyr Arg Phe Cys Ser Gly Phe Gly Pro Asp 1 5 10 15 Ala Tyr Ser Ser 20 <210> 99 <211> 10 <212> PRT <213> Alpaca <400> 99 Ala Val Leu Val Asp Ser Thr Tyr Arg Phe 1 5 10 <210> 100 <211> 14 <212> PRT <213> Alpaca <400> 100 Asn Ala Asp Ile Ser Arg Tyr Arg Phe Ser Arg Gly Asp Tyr 1 5 10 <210> 101 <211> 17 <212> PRT <213> Alpaca <400> 101 Ala Ile Gly Ala Pro Asp Pro Phe Asn Tyr Ser Gly Trp Arg Arg Asn 1 5 10 15 Leu <210> 102 <211> 16 <212> PRT <213> Alpaca <400> 102 Ala Ile Gly Ile Ser Pro His Tyr Gly Ser Asp Trp Tyr Ala Leu Arg 1 5 10 15 <210> 103 <211> 13 <212> PRT <213> Alpaca <400> 103 Ala Ile Gly Leu Ser Pro Gly Tyr Arg Asp Pro Asn Leu 1 5 10 <210> 104 <211> 13 <212> PRT <213> Alpaca <400> 104 Ala Ile Gly Leu Ser Pro Gly Tyr Ser Asp Pro Asn Leu 1 5 10 <210> 105 <211> 13 <212> PRT <213> Alpaca <400> 105 Ala Leu Gly Ala Met Arg Glu Gly Val Tyr Ser Asp Leu 1 5 10 <210> 106 <211> 13 <212> PRT <213> Alpaca <400> 106 Ala Val Gly Ala Pro Leu Val Ser Ser Pro Tyr Arg Ser 1 5 10 <210> 107 <211> 15 <212> PRT <213> Alpaca <400> 107 Ala Val Gly Ala Trp Tyr Glu Lys Arg Lys Lys Glu Lys Gly Leu 1 5 10 15 <210> 108 <211> 17 <212> PRT <213> Alpaca <400> 108 Ala Val Gly Ile Val Val Pro Tyr Ser Glu Asp Ala Trp Tyr Ser Thr 1 5 10 15 Leu <210> 109 <211> 15 <212> PRT <213> Alpaca <400> 109 Gly Ile Gly Arg Trp Tyr Asp Gln Arg Lys Lys Glu Glu Gly Leu 1 5 10 15 <210> 110 <211> 16 <212> PRT <213> Alpaca <400> 110 Asn Ala Ala Pro Trp Gly Ser Tyr His Pro Gln Thr Asp Ile Val Ser 1 5 10 15 <210> 111 <211> 17 <212> PRT <213> Alpaca <400> 111 Asn Ala Ala Pro Trp Gly Ser Tyr Ser Pro Gly Pro Gly Asp Ile Ala 1 5 10 15 Ser <210> 112 <211> 14 <212> PRT <213> Alpaca <400> 112 Asn Gly Ala Pro Trp Gly Asp His Ala Pro Val Val Gly Ser 1 5 10 <210> 113 <211> 14 <212> PRT <213> Alpaca <400> 113 Asn Gly Ala Pro Trp Gly Asp Ile Ala Pro Val Ala Val Ser 1 5 10 <210> 114 <211> 15 <212> PRT <213> Alpaca <400> 114 Asn Pro Ala Pro Trp Gly Asp Tyr Thr Ala Thr Asp Phe His Ser 1 5 10 15 <210> 115 <211> 9 <212> PRT <213> Alpaca <400> 115 Gln Leu Gly Ile His Pro Gly Ala Phe 1 5 <210> 116 <211> 13 <212> PRT <213> Alpaca <400> 116 Gln Val Gly Arg Tyr Val Ser Gly Val Asp Tyr Gln Pro 1 5 10 <210> 117 <211> 13 <212> PRT <213> Alpaca <400> 117 Gln Val Gly Arg Tyr Val Ser Gly Val Tyr Tyr Gln Pro 1 5 10 <210> 118 <211> 14 <212> PRT <213> Alpaca <400> 118 Val Ile Gly Arg Gly Gly Tyr Ala Met Gly Asp Arg Arg Leu 1 5 10 <210> 119 <211> 14 <212> PRT <213> Alpaca <400> 119 Val Ile Gly Arg Arg Gly Tyr Ala Met Gly Asp Arg Thr Leu 1 5 10 <210> 120 <211> 14 <212> PRT <213> Alpaca <400> 120 Val Val Gly Arg Arg Gly Tyr Ala Met Gly Ser Arg Gln Leu 1 5 10 <210> 121 <211> 127 <212> PRT <213> Alpaca <400> 121 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr 20 25 30 Thr Val Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val 35 40 45 Ser Cys Ile Asn Asn Gly Asp Asp Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Ser Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Val Tyr Ile Trp Cys Thr Val Ala Ala Gly Ile Gly Ser Leu Gly 100 105 110 Asp Leu Gly Ser Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 122 <211> 131 <212> PRT <213> Alpaca <400> 122 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Thr Gly Phe Thr Ser Asp Tyr Tyr 20 25 30 Ala Leu Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val 35 40 45 Ser Cys Ile Ser Ser Arg Gly Gly Asp Gly Thr Ile Tyr Tyr Ala Asp 50 55 60 Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Tyr Ala Lys Asn Thr 65 70 75 80 Val Tyr Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Gly Val Tyr 85 90 95 Tyr Cys Ala Ala Asp Leu Arg Val Pro Val Glu Glu Met Cys Val Met 100 105 110 Ala Asp Asn Tyr Gly Met Asp Tyr Trp Gly Lys Gly Thr Pro Val Thr 115 120 125 Val Ser Ser 130 <210> 123 <211> 119 <212> PRT <213> Alpaca <400> 123 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Val Val Ser Arg Ser Ile Ser Ser Met Asn 20 25 30 Ser Met Gly Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Met Val 35 40 45 Ala Val Met Tyr Ser Gly Asp Ser Thr Leu Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Phe Cys Lys 85 90 95 Gly Glu Asp Trp Thr Thr Pro Val Arg Ser Asp Tyr Trp Gly Gln Gly 100 105 110 Thr Gln Val Thr Val Ser Ser 115 <210> 124 <211> 130 <212> PRT <213> Alpaca <400> 124 Glu Val Gln Val Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Leu Asp Tyr Tyr 20 25 30 Tyr Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val 35 40 45 Ser Cys Ile Ser Ser Ser Asp Gly Ser Thr Asp Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Ala Ile Ser Arg Asp Asn Ala Lys Lys Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Glu Gly Ser Trp Asn Phe Asp Ala Met Arg Pro Cys Ser Ile 100 105 110 Gln Glu Ala Asp Phe Gly Ser Trp Gly Gln Gly Thr Gln Val Thr Val 115 120 125 Ser Ser 130 <210> 125 <211> 119 <212> PRT <213> Alpaca <400> 125 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Glu Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Pro Leu Ser Gly Leu Gly Phe Ser Pro Asn 20 25 30 His Met Cys Trp Tyr Arg Gln Ser Pro Gly Lys Leu Arg Glu Met Val 35 40 45 Ala Cys Ile Thr Ser Gly Gly Ser Pro Asn Tyr Ser Asp Thr Ala Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Arg Thr Thr Asn Thr Val Tyr Leu 65 70 75 80 Gln Met Asp Ser Leu Lys Pro Asp Asp Thr Ala Ile Tyr Tyr Leu Lys 85 90 95 Ala Glu Asp Trp Thr Thr Thr Pro Arg Ser Asp Tyr Trp Gly Gln Gly 100 105 110 Thr Gln Val Thr Val Ser Ser 115 <210> 126 <211> 116 <212> PRT <213> Alpaca <400> 126 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Val Gly Gly 1 5 10 15 Ser Leu Lys Leu Thr Cys Ala Ala Ser Gly Ser Ile Ser Arg Ile Ala 20 25 30 Val Gly Trp Tyr Arg Gln Ile Pro Gly Lys Gln Arg Glu Leu Val Ala 35 40 45 Arg Val Ser Ser Gly Gly Ile Leu Trp Tyr Asp Asp Ser Val Lys Gly 50 55 60 Arg Phe Ile Ile Thr Arg Asp Asn Ala Lys Asn Met Val Tyr Leu Gln 65 70 75 80 Met Asp Ser Leu Arg Pro Glu Asp Thr Ala Val Tyr Phe Cys Arg Gly 85 90 95 Ser Asp Ser Asp Arg Phe Leu Gly Ser Trp Gly Gln Gly Thr Gln Val 100 105 110 Thr Val Ser Ser 115 <210> 127 <211> 127 <212> PRT <213> Alpaca <400> 127 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Asn Phe Asn Asn Tyr 20 25 30 Val Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val 35 40 45 Ser Cys Phe Thr Ser Ala Asp Asn Arg Thr Tyr Tyr Ala Gly Ser Val 50 55 60 Glu Gly Arg Phe Thr Ile Ser Ser Asp Asn Thr Lys Asn Thr Gly Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Leu Glu Asp Glu Ala Val Tyr Ser Cys 85 90 95 Ser Val Arg Val Tyr Arg Cys Thr Gly Arg Lys Cys Cys Asp Pro Leu 100 105 110 Gly Met Asp Tyr Trp Gly Lys Gly Thr Pro Val Thr Val Ser Ser 115 120 125 <210> 128 <211> 115 <212> PRT <213> Alpaca <400> 128 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Thr Ile Ser Gly Phe Thr Phe Asp Arg Phe 20 25 30 Pro Met Thr Trp Tyr Arg Gln Val Pro Gly Met Glu Arg Glu Leu Val 35 40 45 Ala Arg Val Ser Thr Thr Gly Leu Thr Glu Tyr Phe Ala Asn Ala Leu 50 55 60 Glu Gly Arg Phe Thr Ala Ser Arg Asp Asn Ala Lys Asn Thr Gly Tyr 65 70 75 80 Leu Gln Met Asn Asp Leu Lys Pro Gly Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Asn Val Val Pro Pro Leu Arg Gln Trp Gly Gln Gly Thr Gln Val Thr 100 105 110 Val Ser Ser 115 <210> 129 <211> 131 <212> PRT <213> Alpaca <400> 129 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Ser Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Leu Ser Asn Tyr 20 25 30 Ala Val His Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val 35 40 45 Ser Ser Ile Ala Ile Ile Asp Asp Thr Tyr Tyr Gly Glu Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Asp Ala Asn Ala Val Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Ile Tyr Tyr Cys Ala 85 90 95 Ala Asp Arg Thr Asp Ile Ala Phe Trp Leu Gln Val Gly Gly Asp Gly 100 105 110 Gly Ser Gly Arg His Tyr Asp Tyr Trp Gly Gln Gly Thr Gln Val Thr 115 120 125 Val Ser Ser 130 <210> 130 <211> 119 <212> PRT <213> Alpaca <400> 130 Glu Val Gln Val Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Thr Leu Ser Cys Ala Ala Ser Arg Gly Ile Phe Thr Phe Asn 20 25 30 Ala Met Gly Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Val Val 35 40 45 Val His Phe Thr Ser Gly Asp Ser Glu Phe Trp Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Ser Arg Lys Asn Thr Val Tyr Leu 65 70 75 80 Tyr Met Asn Asn Leu Gln Pro Glu Asp Thr Ala Val Tyr Tyr Cys Lys 85 90 95 Ala Glu Asp Trp Thr Thr Ser Pro Arg Thr Asp Tyr Trp Gly Gln Gly 100 105 110 Thr Gln Val Thr Val Ser Ser 115 <210> 131 <211> 247 <212> PRT <213> Artificial Sequence <220> <223> Cetuximab <400> 131 Gln Val Gln Leu Lys Gln Ser Gly Pro Gly Leu Val Gln Pro Ser Gln 1 5 10 15 Ser Leu Ser Ile Thr Cys Thr Val Ser Gly Phe Ser Leu Thr Asn Tyr 20 25 30 Gly Val His Trp Val Arg Gln Ser Pro Gly Lys Gly Leu Glu Trp Leu 35 40 45 Gly Val Ile Trp Ser Gly Gly Asn Thr Asp Tyr Asn Thr Pro Phe Thr 50 55 60 Ser Arg Leu Ser Ile Asn Lys Asp Asn Ser Lys Ser Gln Val Phe Phe 65 70 75 80 Lys Met Asn Ser Leu Gln Ser Asn Asp Thr Ala Ile Tyr Tyr Cys Ala 85 90 95 Arg Ala Leu Thr Tyr Tyr Asp Tyr Glu Phe Ala Tyr Trp Gly Gln Gly 100 105 110 Thr Leu Val Thr Val Ser Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly 115 120 125 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ala Ser Asp Ile Leu Leu 130 135 140 Thr Gln Ser Pro Val Ile Leu Ser Val Ser Pro Gly Glu Arg Val Ser 145 150 155 160 Phe Ser Cys Arg Ala Ser Gln Ser Ile Gly Thr Asn Ile His Trp Tyr 165 170 175 Gln Gln Arg Thr Asn Gly Ser Pro Arg Leu Leu Ile Lys Tyr Ala Ser 180 185 190 Glu Ser Ile Ser Gly Ile Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly 195 200 205 Thr Asp Phe Thr Leu Ser Ile Asn Ser Val Glu Ser Glu Asp Ile Ala 210 215 220 Asp Tyr Tyr Cys Gln Gln Asn Asn Asn Trp Pro Thr Thr Phe Gly Ala 225 230 235 240 Gly Thr Lys Leu Glu Leu Lys 245 <210> 132 <211> 119 <212> PRT <213> Alpaca <400> 132 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Arg Ser Ser 20 25 30 Ala Met Ser Trp Ala Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Asp Ile Tyr Pro Asp Gly Arg Thr Asp Tyr Ala Asp Ser Ile Lys 50 55 60 Gly Arg Phe Thr Met Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr Leu 65 70 75 80 Leu Met Asp Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr His Cys Gln 85 90 95 Val Gly Arg Tyr Val Ser Gly Val Tyr Tyr Gln Pro Arg Gly Gln Gly 100 105 110 Thr Gln Val Thr Val Ser Ser 115 <210> 133 <211> 120 <212> PRT <213> Alpaca <400> 133 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Ser 20 25 30 Ala Met Ser Trp Ala Arg Gln Ala Pro Gly Lys Gly Leu Glu Cys Val 35 40 45 Ser Asp Ile Tyr Pro Asp Gly Thr Ser Ser Tyr Ala Asp Ser Met Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Thr Arg Asn Thr Met Tyr Leu 65 70 75 80 Gln Met Asn Val Leu Lys Pro Glu Asp Thr Ala Thr Tyr Tyr Cys Val 85 90 95 Ile Gly Arg Gly Gly Tyr Ala Met Gly Asp Arg Arg Leu Arg Gly Gln 100 105 110 Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 134 <211> 120 <212> PRT <213> Alpaca <400> 134 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Ile Ser Ser Ile Tyr 20 25 30 Ala Met Gly Trp Tyr Arg Gln Ala Pro Gly Lys Leu Arg Glu Leu Val 35 40 45 Ala Ala Ile Thr Thr Gly Gly Ser Thr Phe Tyr Arg Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Val Ala Asn Thr Val Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr His Cys Asn 85 90 95 Gly Ala Pro Trp Gly Asp Ile Ala Pro Val Ala Val Ser Trp Gly Gln 100 105 110 Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 135 <211> 119 <212> PRT <213> Alpaca <400> 135 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Pro Ser 20 25 30 Ala Met Ser Trp Ala Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Tyr Ser Asp Gly Ser Thr Tyr Tyr Arg Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Arg Asn Met Val Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Leu Gly Ala Met Arg Glu Gly Val Tyr Ser Asp Leu Leu Gly Gln Gly 100 105 110 Thr Gln Val Thr Val Ser Ser 115 <210> 136 <211> 120 <212> PRT <213> Alpaca <400> 136 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Glu Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Ile Phe Ser Ile Tyr 20 25 30 Ala Met Gly Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Gly Leu Val 35 40 45 Ala Ala Ile Thr Ser Gly Gly Asp Thr Phe Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Arg Asn Thr Val Tyr Leu 65 70 75 80 Gln Met Asn Asn Leu Lys Ser Glu Asp Thr Ala Val Tyr Asp Cys Asn 85 90 95 Gly Ala Pro Trp Gly Asp His Ala Pro Leu Val Ala Ser Trp Gly Gln 100 105 110 Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 137 <211> 117 <212> PRT <213> Alpaca <400> 137 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val His Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Asp Cys Ala Val Ser Glu Arg Ile Ala Ser Phe Asn 20 25 30 Val Met Gly Trp Tyr Arg Gln Ala Pro Gly Gln Gln Arg Glu Val Val 35 40 45 Ala Thr Ile Thr Ser Val Gly Arg Thr Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ala Lys Asp Asn Asp Lys Asn Thr Tyr Leu Gln 65 70 75 80 Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Lys Ala 85 90 95 Val Ile Val Gly Thr Tyr Asp Thr Glu Tyr Trp Gly Gln Gly Thr Leu 100 105 110 Val Thr Val Ser Ser 115 <210> 138 <211> 117 <212> PRT <213> Alpaca <400> 138 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val His Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ala Cys Ala Ala Ser Glu Arg Ile Leu Ser Phe Asn 20 25 30 Val Met Gly Trp Tyr Arg Gln Ala Pro Gly Gln Gln Arg Glu Val Val 35 40 45 Ala Thr Ile Thr Ser Val Gly Arg Thr Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Phe Lys Asp Asn Gly Lys Asn Thr Tyr Leu Gln 65 70 75 80 Met Ser Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Lys Ala 85 90 95 Val Thr Val Gly Asp Val Asp Thr Glu Tyr Trp Gly Gln Gly Thr Gln 100 105 110 Val Thr Val Ser Ser 115 <210> 139 <211> 241 <212> PRT <213> Artificial Sequence <220> <223> OPDIVO <400> 139 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Asp Cys Lys Ala Ser Gly Ile Thr Phe Ser Asn Ser 20 25 30 Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Val Ile Trp Tyr Asp Gly Ser Lys Arg Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Phe 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Thr Asn Asp Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser 100 105 110 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 115 120 125 Gly Gly Gly Gly Ala Ser Glu Ile Val Leu Thr Gln Ser Pro Ala Thr 130 135 140 Leu Ser Leu Ser Pro Gly Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser 145 150 155 160 Gln Ser Val Ser Ser Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 165 170 175 Ala Pro Arg Leu Leu Ile Tyr Asp Ala Ser Asn Arg Ala Thr Gly Ile 180 185 190 Pro Ala Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 195 200 205 Ile Ser Ser Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln 210 215 220 Ser Ser Asn Trp Pro Arg Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 225 230 235 240 Lys <210> 140 <211> 246 <212> PRT <213> Artificial Sequence <220> <223> KEYTRUDA <400> 140 Glu Ile Val Leu Thr Gln Ser Pro Ala Thr Leu Ser Leu Ser Pro Gly 1 5 10 15 Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Lys Gly Val Ser Thr Ser 20 25 30 Gly Tyr Ser Tyr Leu His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro 35 40 45 Arg Leu Leu Ile Tyr Leu Ala Ser Tyr Leu Glu Ser Gly Val Pro Ala 50 55 60 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser 65 70 75 80 Ser Leu Glu Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln His Ser Arg 85 90 95 Asp Leu Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Gly 100 105 110 Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val 115 120 125 Gln Leu Val Gln Ser Gly Val Glu Val Lys Lys Pro Gly Ala Ser Val 130 135 140 Lys Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Asn Tyr Tyr Met 145 150 155 160 Tyr Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Gly 165 170 175 Ile Asn Pro Ser Asn Gly Gly Thr Asn Phe Asn Glu Lys Phe Lys Asn 180 185 190 Arg Val Thr Leu Thr Thr Asp Ser Ser Thr Thr Thr Ala Tyr Met Glu 195 200 205 Leu Lys Ser Leu Gln Phe Asp Asp Thr Ala Val Tyr Tyr Cys Ala Arg 210 215 220 Arg Asp Tyr Arg Phe Asp Met Gly Phe Asp Tyr Trp Gly Gln Gly Thr 225 230 235 240 Thr Val Thr Val Ser Ser 245 <210> 141 <211> 20 <212> PRT <213> Homo sapiens <400> 141 Ser Phe Val Leu Asn Trp Tyr Arg Met Ser Pro Ser Asn Gln Thr Asp 1 5 10 15 Lys Leu Ala Ala 20 <210> 142 <211> 19 <212> PRT <213> Homo sapiens <400> 142 Tyr Leu Cys Gly Ala Ile Ser Leu Ala Pro Lys Ala Gln Ile Lys Glu 1 5 10 15 Ser Leu Arg <210> 143 <211> 39 <212> PRT <213> Homo sapiens <400> 143 Ser Phe Val Leu Asn Trp Tyr Arg Met Ser Pro Ser Asn Gln Thr Asp 1 5 10 15 Lys Leu Ala Ala Tyr Leu Cys Gly Ala Ile Ser Leu Ala Pro Lys Ala 20 25 30 Gln Ile Lys Glu Ser Leu Arg 35 <210> 144 <211> 32 <212> PRT <213> Homo sapiens <400> 144 Ala Phe Thr Val Thr Val Pro Lys Asp Leu Tyr Val Lys Asn Ile Ile 1 5 10 15 Gln Phe Val His Gly Ser Tyr Gly Gly Ala Asp Tyr Lys Arg Ile Thr 20 25 30 <210> 145 <211> 4 <212> PRT <213> Artificial Sequence <220> <223> PD1:PDL1 Screening Peptide 1 <400> 145 Ala Asp Tyr Lys 1 <210> 146 <211> 4 <212> PRT <213> Artificial Sequence <220> <223> PD1:PDL1 Screening Peptide 2 <400> 146 Asp Tyr Lys Arg 1 <210> 154 <211> 12 <212> PRT <213> Alpaca <400> 154 Lys Ala Val Ile Val Gly Thr Tyr Asp Thr Glu Tyr 1 5 10 <210> 155 <211> 12 <212> PRT <213> Alpaca <400> 155 Lys Ala Val Thr Val Gly Asp Val Asp Thr Glu Tyr 1 5 10

Claims

1. A method for generating camel antibodies specific for an antigen, comprising: a) Enriching and proliferating B cells from immunized camelids specific for the antigen; b) Generate an antibody NGS library containing VHHs from antigen - specific B cells 2 , VHH 3 and VH 1 chain sequences, where VHH 2 , VHH 3 and VH 1 represent the heavy chains of camelid IgG isotypes IgG2, IgG3, and IgG1, respectively; c) Group the antibody sequences of VHH 2 、VHH 3 and VH 1 chains by lineage, where the minimum CDR3 distance of a specific CDR3 in the CDR3 group from the lineage is less than or equal to 1, and the minimum CDR3 distance of the specific CDR3 is the minimum Hamming distance of such CDR3 compared to other CDR3s of the same length; and subdivide the lineage by unique VHH characteristics, where the unique VHH characteristics are selected from the group: i) Hydrophilic region of FR2; ii) Extended CDR1; iii) Additional disulfide bonds between CDR1-CDR3 or FR2-CDR3; iv) Additional disulfide bonds within CDR3; v) CDR3 length of at least 12 amino acids; vi) Additional disulfide bonds within CDR1; vii) Non-classical VHHs having the same V and J germlines as conventional IgG1; viii) Non-classical VHHs having certain predetermined sequence features; ix) Certain predetermined classical binding loop structures; x) Convergent motifs or sequence features between individual animals from the same immunized group; xi) CDR2 length; xii) Positively charged N-terminus; xiii) CDR3 length and characteristics; xiv) Presence of 3 or more positive charges in the CDR3 region; xv) Number of cysteines in the amino acid sequence; and xvi) 2-4 amino acid motifs in the CDR region, the motifs being identified from the 3D structure of a ligand / receptor complex; d) Ranking the lineages from step c) by one or more lineage priority factors, where the lineage priority factors are selected from the group consisting of: lineages with decreasing sequence abundance from high to low, lineages with decreasing amplification factor from high to low, changes in lineage sequence abundance during the immune process, changes in lineage sequence abundance before and after depletion of certain unwanted B cells, lineages sharing the same naive B cell origin between VHH and VH 1 and combinations thereof; e) Select representative sequences from the NGS library according to the top-ranked VHH-containing 2 or VHH 3 lineages; and f) Testing the antibody comprising the selected sequence in step e) to determine whether the antibody binds to the antigen or a portion thereof.

2. The method for generating camel antibodies according to claim 1, wherein, Select VHHs in e) 2 and VHHs 3 from the first 100 lineages.

3. The method for generating camel antibodies according to claim 1 or 2, wherein, The antibody in f) is expressed by prokaryotic or eukaryotic cells.

4. The method for generating camel antibodies according to claim 1 or 2, wherein, The method further comprises monitoring the immune responses of camel antibodies IgG2, IgG3 and IgG1.

5. The method for generating camel antibodies according to claim 1 or 2, wherein, also includes repeating steps e)-f) to optimize the selected VHH 2 or VHH 3 sequences within the same lineage group of the single-chain antibody only 6. A method for generating camel antibodies specific for an antigen, comprising: a) Enriching and proliferating B cells from immunized camelids specific for the antigen, b) Generate an antibody NGS library containing VHHs from the antigen-specific B cells 2 、VHHs 3 、VHs 1 and Vls 1 chain sequences, where VHHs 2 、VHHs 3 and VHs 1 represent the heavy chains of camelid IgG isotypes IgG2, IgG3, and IgG1, respectively, and Vl 1 represents the light chain of camel IgG1, c) Group the sequences of VHH 2 、VHH 3 、VH 1 and VL 1 in the NGS library by lineage, where the minimum CDR3 distance of a specific CDR3 in the CDR3 group from the lineage is less than or equal to 1, and the minimum CDR3 distance of the specific CDR3 is the minimum Hamming distance of such CDR3 compared to other CDR3s of the same length. d) VH 1 / VL 1 lineage pairing according to the anchored binding agents generated by single B cell sorting and heterologous hybridoma methods e) Ranking the lineages and lineage pairs in steps c) and d) by one or more lineage priority factors selected from the group consisting of: lineages with decreasing sequence abundance from high to low, lineages with decreasing amplification coefficient from high to low, changes in lineage sequence abundance during the immune process, changes in lineage sequence abundance before and after depletion of certain unwanted B cells, lineages sharing the same naive B cell source between VHH and VH 1 and combinations thereof that avoid poorly developable sequences, f) Representative sequences or sequence pairs are selected from the top-ranked VHHs in the NGS library according to the ranking in step e), 2 or VHH 3 lineages and VH 1 / VL 1 lineage pairs, wherein the VHH clones have characteristics selected from the following group: i) Hydrophilic region of FR2; ii) Extended CDR1; iii) Additional disulfide bonds between CDR1-CDR3 or FR2-CDR3; iv) Additional disulfide bonds within CDR3; v) CDR3 length of at least 12 amino acids; vi) Additional disulfide bonds within CDR1; vii) Non-classical VHHs having the same V and J germlines as conventional IgG1; viii) Non-classical VHHs having certain predetermined sequence features; ix) Certain predetermined classical binding loop structures; x) Convergent motifs or sequence features between individual animals from the same immunized group; xi) CDR2 length; xii) Positively charged N-terminus; xiii) CDR3 length and characteristics; xiv) Presence of 3 or more positive charges in the CDR3 region; xv) Number of cysteines in the amino acid sequence; and xvi) 2-4 amino acid motifs in the CDR region, the motifs being identified from the 3D structure of a ligand / receptor complex g) Testing the antibodies against the selected sequence pairs or sequences from step f) to determine whether the antibody binds to the antigen or a portion thereof.

7. The method for generating camel antibodies according to claim 6, wherein, the anchor of the IgG1 library is generated by single B cell sorting and heterologous hybridoma methods.

8. The method for generating camel antibodies according to claim 6, wherein, The sorting of the pedigree pairs in step e) is based on the VH of the pedigree pairs 1 The pedigree preference factor of the pedigree.

9. The method for generating camel antibodies according to claim 7, wherein, Select a VHH representative sequence or a VH / VL representative pair as an anchor from among 100 top-ranked lineages or lineage pairs 1 / VL 1 pair as an anchor.

10. The method for generating camel antibodies according to claim 9, wherein, The 100 lineages or pairs of lineages include 70 VHH lineage groups and 30 VH 1 / Vκ or VH 1 / Vλ lineage group pairs.

11. A method for generating a humanized VHH 2 or VHH 3 antibody, comprising a) Enriching and proliferating B cells from an immunized camelid specific for the antigen, b) Generate an antibody NGS library that contains VHHs from antigen-specific B cells 2 、VHH 3 、VH 1 chain sequences, where VHH 2 、VHH 3 and VH 1 represent the heavy chains of three camelid IgG isotypes IgG2, IgG3, and IgG1, respectively c) Group the sequences of VHH 2 and VHH 3 and VH 1 in the NGS library by lineage, and the minimum CDR3 distance of a specific CDR3 in the CDR3 group from the lineage is less than or equal to 1 wherein, the minimum CDR3 distance of a specific CDR3 is the minimum Hamming distance of such CDR3 compared to other CDR3s of the same length; and subdividing the lineage by unique VHH characteristics, the unique VHH characteristics selected from the group consisting of: i) Hydrophilic region of FR2; ii) Extended CDR1; iii) Additional disulfide bonds between CDR1 - CDR3 or FR2 - CDR3; iv) Additional disulfide bonds within CDR3; v) CDR3 length of at least 12 amino acids; vi) Additional disulfide bonds within CDR1; vii) Non - classical VHH having the same V and J germlines as conventional IgG1; viii) Non - classical VHH having certain predetermined sequence characteristics; ix) Certain predetermined classical binding loop structures; x) Convergent motifs or sequence characteristics between individual animals from the same immunized group; xi) CDR2 length; xii) Positively charged N - terminus; xiii) CDR3 length and characteristics; xiv) Presence of 3 or more positive charges in the CDR3 region; xv) Number of cysteines in the amino acid sequence; and xvi) 2 - 4 amino acid motifs in the CDR region, the motifs identified from the 3D structure of a ligand / receptor complex; d) identifying parental VHHs sharing the same naïve B cell origin by comparing its amino acid sequence with the amino acid sequences of a variety of related antibodies 2 、VHH 3 antibodies or VH 1 substitutable positions therein, wherein the related antibodies each bind the same epitope as the parental antibody in the same lineage e) Replace the amino acid at one or more replaceable positions of the parental VHH 2 , VHH 3 with the amino acid at the corresponding position in a human antibody f) Testing antibodies containing substituted residues within the selected sequences to determine whether the antibody binds to the antigen or a portion thereof.

12. The method for generating a humanized VHH 2 or VHH 3 antibody as claimed in claim 11, wherein, the substitutable positions are in the CDR regions.

13. The method for generating a humanized VHH 2 or VHH 3 antibody, wherein, the substitutable positions are in the FR regions.

14. The method according to any one of claims 1, 2, 6 - 13, wherein, the antigen is a complex immunogen, and the method further comprises: using the antibody determined in step (f) to bind to the complex immunogen, and identifying the individual antigens contained in the complex immunogen by protein array, cell / tissue antigen cDNA library, or mass spectrometry - based immunoprecipitation.

15. The method according to any one of claims 6 - 10 and 11 - 13, wherein, The method further includes applying the selected VHH sequence to guide the selection of VH 1 -VL 1 pairs of clones sharing the same naïve B cell origin, wherein the criteria for the selection include one or more of the following: 1) the same CDR3 sequence between the VHH and VH 1 ; 2) the differences in CDR1 and CDR2; and 3) the differences in FR1, FR2, FR3, and FR4.

16. The method according to claim 1 or 2, wherein, the method further comprises repeating steps e) - f) to generate antibodies.

17. The method according to any one of claims 6 - 10, wherein, the method further comprises repeating steps f) - g) to generate camel antibodies.

18. The method according to any one of claims 1, 2, 6 - 10, 11 - 13, wherein, The expression cells of the antibody to be measured include eukaryotic cells.

19. The method according to any one of claims 1, 2, 6-10, 11-13, characterized in that enriching antigen-specific B cells includes: physical surface antigen panning, magnetic bead separation or fluorescence-activated cell sorting.

20. The method according to any one of claims 1, 2, 6-10, 11-13, characterized in that activating the enriched B cells in the presence of an antigen, a camel CD40-L expressing cell and a growth factor to proliferate the B cells.

Images