Prosthesis for lungs and its use

Abstract

Prosthesis for treating pulmonary fibrosis, in particular idiopathic pulmonary fibrosis (IPF), and method of treating pulmonary fibrosis, in particular idiopathic pulmonary fibrosis (IPF).

Description

Background Art

[0001] Fibrosis is the thickening and scarring of connective tissue caused by injury and is characterized by the accumulation of extracellular matrix (ECM) components and excessive proliferation of fibroblasts. This abnormality is common in organs including the lungs, liver, and kidneys, causing destruction of tissue architecture and leading to severe impairment of organ function. 1,2 In fact, fibrosis can occur in almost every organ and is the leading cause of end-stage organ failure and death in many chronic diseases. 3 A common feature of pulmonary fibrosis is the excessive proliferation of fibroblasts around the air sacs (alveoli) of the lungs. 4 Extensive biomedical research has established that an increase in the number of fibroblasts, coupled with their excessive deposition in the ECM, ultimately leads to the destruction of alveolar architecture, decreased lung compliance, and disruption of gas exchange function. 5-7 .

[0002] The most common type of pulmonary fibrosis is idiopathic pulmonary fibrosis (IPF). This disease eventually affects an entire lobe of the lung, but it begins with microfibrotic lesions in the peripheral areas and slowly progresses inwards. This fibrosis eventually leads to respiratory failure. 8,9 IPF is a fatal disease with a median survival of only 2-4 years from diagnosis. 10 Scientifically, the mechanism and nature of IPF pathological progression are not fully understood, although several studies have implicated the contribution of a specific subset of alveolar epithelial cells, alveolar type II (AT2) cells. 11-13 .

[0003] The alveolar epithelium of the lung is composed of alveolar type I (AT1) cells and type II (AT2) cells. AT2 cells are alveolar stem cells that can differentiate into AT1 cells during alveolar homeostasis and post-injury repair. 14,15 AT1 cells ultimately make up almost 95% of the alveolar surface in the adult lung and are large squamous cells that function as the epithelial component of the thin air-blood barrier. 16 In IPF tissue, abnormally proliferating AT2 cells are often located near fibroblast foci. 17 In clinical practice, gene mutations that affect AT2 cell function are often observed in IPF tissues. 11-13,18,19 Previously, to correct tracheal displacement and overdistension of the remaining lung after pneumonectomy (PNX), a balloon prosthesis was used to occupy the pleural space, and such a balloon was preferably constructed to be approximately 10% larger than the size of the pleural space it is intended to occupy at the end of normal exhalation.

[0004] Although mechanical tension is an important regulator of lung formation, function, and metabolism, studies at the cellular and molecular levels have been limited by the lack of appropriate tools to investigate the effects of mechanical tension on cells in vitro and in vivo. Summary of the invention

[0005] The present invention relates to a method for treating pulmonary fibrosis, in particular idiopathic pulmonary fibrosis (IPF) and a prosthesis for treating pulmonary fibrosis, in particular idiopathic pulmonary fibrosis (IPF). The present invention is based on the important regulatory role of mechanical tension in driving the development of pulmonary fibrosis. The implanted prosthesis can reduce the mechanical tension level of the alveolar epithelium and rescue the enlarged alveolar phenotype. In particular, progressive pulmonary fibrosis can be prevented by reducing the mechanical tension level of the alveolar epithelium.

[0006] Firstly, the present invention provides a prosthesis for the treatment of pulmonary fibrosis, in particular idiopathic pulmonary fibrosis (IPF).

[0007] The prosthesis of the present invention can be designed to be placed beneath a lung lobe as long as the level of mechanical tension on the alveolar epithelium is reduced at the end of normal inspiration.

[0008] Preferably, the prosthesis is designed to be anchored below the lobe and above the diaphragm, and is preferably designed to match the base of the lobe as long as the mechanical tension on the alveolar epithelium is reduced at the end of normal inspiration.

[0009] Thus, the prosthesis is surrounded by pleural fluid. Preferably, at the end of normal inspiration, the prosthesis will occupy at least 1 / 8 of the space enclosed by the base of the lobe, the diaphragm and the wall of the pleural cavity. Preferably, at the end of normal inspiration, the prosthesis will occupy at least 1 / 4 of the space enclosed by the base of the lobe, the diaphragm and the wall of the pleural cavity. Preferably, at the end of normal inspiration, the prosthesis will occupy at least half of the space enclosed by the base of the lobe, the diaphragm and the wall of the pleural cavity. Preferably, at the end of normal inspiration, the prosthesis will occupy at least 3 / 4 of the space enclosed by the base of the lobe, the diaphragm and the wall of the pleural cavity. Preferably, at the end of normal inspiration, the prosthesis will occupy the entire space enclosed by the base of the lobe, the diaphragm and the wall of the pleural cavity.

[0010] Therefore, the prosthesis is surrounded by pleural fluid. Preferably, the area of ​​the prosthesis projected to the bottom of the lower lobe will occupy at least 1 / 8 of the area of ​​the bottom of the lower lobe. Preferably, the area of ​​the prosthesis projected to the bottom of the lower lobe will occupy at least 1 / 4 of the area of ​​the bottom of the lower lobe. Preferably, the area of ​​the prosthesis projected to the bottom of the lower lobe will occupy at least half of the area of ​​the bottom of the lower lobe. Preferably, the area of ​​the prosthesis projected to the bottom of the lower lobe will occupy at least 3 / 4 of the area of ​​the bottom of the lower lobe. Preferably, the area of ​​the prosthesis projected to the bottom of the lower lobe will occupy the entire area of ​​the bottom of the lower lobe.

[0011] The prosthesis of the present invention comprises a main body, wherein the main body has an upper side, a lower side and a side extending between the upper side and the lower side. The upper side of the prosthesis is preferably matched with the bottom of the lung lobe. The lower side of the prosthesis is preferably matched with the diaphragm. The outer side surface of the prosthesis is preferably matched with the wall of the pleural cavity between the bottom of the lung lobe and the diaphragm away from the heart. The inner side surface of the prosthesis is preferably matched with the outer wall of the lower lung lobe. In order to occupy the space under the lung lobe, the prosthesis can have a disc shape, an elliptical shape, an irregular U shape, an arc shape, a cone shape, a shoulder blade shape or an irregular shape, etc. The prosthesis has a smooth curved contour without edges and corners to reduce discomfort and avoid damage to the pleura.

[0012] Alternatively, the prosthesis of the present invention comprises a main body having an upper side, a lower side, a side extending between the upper side and the lower side, and an inner edge close to the heart, wherein the side is opposite to the inner edge. The upper side of the prosthesis is preferably matched with the bottom of the lobe. The lower side of the prosthesis is preferably matched with the diaphragm. The outer side of the prosthesis is preferably matched with the pleural cavity wall located between the bottom of the lobe and the diaphragm away from the heart. The prosthesis has a dish shape, an elliptical shape, an irregular U shape, an arc shape, a cone shape, a scapula shape or an irregular shape, etc., to occupy the space under the lower lobe. Preferably, the upper side of the prosthesis gradually tapers toward the inner edge. The lower side of the prosthesis gradually tapers toward the inner edge. The prosthesis has a smooth curved contour without edges to reduce discomfort and avoid damage to the pleura.

[0013] Preferably, the side has a height of 0.5 cm-8 cm. Preferably, the side has a height of 0.5 cm, 0.6 cm, 0.7 cm, 0.8 cm, 0.9 cm, 1 cm, 2 cm, 3 cm, 4 cm, 5 cm, 6 cm, 7 cm or 8 cm.

[0014] Preferably, the thickness of the prosthesis wall is between 0.1-4 cm. Preferably, the thickness is 0.1 cm, 0.2 cm, 0.3 cm, 0.4 cm, 0.5 cm, 0.6 cm, 0.7 cm, 0.8 cm, 0.9 cm, 1 cm, 1.1 cm, 1.2 cm, 1.3 cm, 1.4 cm, 1.5 cm, 1.6 cm, 1.7 cm, 1.8 cm, 1.9 cm, 2 cm, 3 cm or 4 cm.

[0015] Preferably, the prosthesis of the present invention has an arc shape, wherein the arc matches the lower edge of the lower lobe. Preferably, the arc matches at least 1 / 8 of the lower edge of the lower lobe away from the heart. Preferably, the arc matches at least 1 / 4 of the lower edge of the lower lobe away from the heart. Preferably, the arc matches at least 1 / 2 of the lower edge of the lower lobe away from the heart. Preferably, the arc matches the entire length of the lower edge of the lower lobe.

[0016] Preferably, the prosthesis has a height of 1 cm-4 cm.Preferably, the side has a height of 1 cm, 2 cm, 3 cm or 4 cm.

[0017] Preferably, the prosthesis is designed to be placed in the pleural cavity, in particular, the prosthesis is placed on the lower side of the pleural cavity to reduce the mechanical tension of the alveolar epithelium at the end of normal inspiration. The prosthesis can be fixed in the pleural cavity, in particular, the prosthesis is placed on the lower side of the pleural cavity. For example, the prosthesis can be sutured to the pleural cavity wall, in particular the lower part of the pleural cavity wall, with surgical sutures. Preferably, the prosthesis is sutured to the pleural cavity wall through the needle hole on the side.

[0018] The prosthesis can be made of soft sponge latex, foamed latex, 380-micron hollow fiber, gelatin foam material, plastic sponge (Eflon), polyethylene bag filled with glass fiber, rubber, silicone rubber, silicone gel, carbon material, etc. The carbon material includes carbon nanotubes, graphene, ultra-light porous carbon, hollow porous carbon, carbon fiber, carbon-titanium alloy, etc.

[0019] The prosthesis may be solid, or the prosthesis may be a bag or packet filled with a fluid or gel.

[0020] Secondly, the present invention provides the use of the prosthesis for treating pulmonary fibrosis, in particular idiopathic pulmonary fibrosis (IPF).

[0021] The prosthesis of the present invention can be designed to be placed beneath a lung lobe as long as the level of mechanical tension on the alveolar epithelium is reduced at the end of normal inspiration.

[0022] Preferably, the prosthesis is designed to be anchored below the lobe and above the diaphragm, and is preferably designed to match the base of the lobe as long as the mechanical tension of the alveolar epithelium is reduced at the end of normal inspiration.

[0023] Thus, the prosthesis is surrounded by pleural fluid. Preferably, at the end of normal inspiration, the prosthesis will occupy at least 1 / 8 of the space enclosed by the base of the lung lobe, the diaphragm and the wall of the pleural cavity. Preferably, at the end of normal inspiration, the prosthesis will occupy at least 1 / 4 of the space enclosed by the base of the lung lobe, the diaphragm and the wall of the pleural cavity. Preferably, at the end of normal inspiration, the prosthesis will occupy at least half of the space enclosed by the base of the lung lobe, the diaphragm and the wall of the pleural cavity. Preferably, at the end of normal inspiration, the prosthesis will occupy at least 3 / 4 of the space enclosed by the base of the lung lobe, the diaphragm and the wall of the pleural cavity. Preferably, at the end of normal inspiration, the prosthesis will occupy the entire space enclosed by the base of the lung lobe, the diaphragm and the wall of the pleural cavity.

[0024] Therefore, the prosthesis is surrounded by pleural fluid. Preferably, the area of ​​the prosthesis projected to the bottom of the lower lobe will occupy at least 1 / 8 of the area of ​​the bottom of the lower lobe. Preferably, the area of ​​the prosthesis projected to the bottom of the lower lobe will occupy at least 1 / 4 of the area of ​​the bottom of the lower lobe. Preferably, the area of ​​the prosthesis projected to the bottom of the lower lobe will occupy at least half of the area of ​​the bottom of the lower lobe. Preferably, the area of ​​the prosthesis projected to the bottom of the lower lobe will occupy at least 3 / 4 of the area of ​​the bottom of the lower lobe. Preferably, the area of ​​the prosthesis projected to the bottom of the lower lobe will occupy the entire area of ​​the bottom of the lower lobe.

[0025] The prosthesis of the present invention comprises a main body, wherein the main body has an upper side, a lower side and a side extending between the upper side and the lower side. The upper side of the prosthesis is preferably matched with the base of the lobe. The lower side of the prosthesis is preferably matched with the diaphragm. The outer side of the prosthesis is preferably matched with the wall of the pleural cavity between the bottom of the lobe and the diaphragm away from the heart. The inner side of the prosthesis is preferably matched with the outer wall of the lower lobe. The prosthesis can have a disc shape, an elliptical shape, an irregular U shape, an arc shape, a cone shape, a shoulder blade shape or an irregular shape, etc., to occupy the space under the lobe. The prosthesis has a smooth curved contour without edges and corners to reduce discomfort and avoid damage to the pleura.

[0026] Optionally, the prosthesis of the present invention comprises a main body having an upper side, a lower side, a side extending between the upper side and the lower side, and an inner edge close to the heart, wherein the side is opposite to the inner edge. The upper side of the prosthesis is preferably matched with the bottom of the lobe. The lower side of the prosthesis is preferably matched with the diaphragm. The outer side of the prosthesis is preferably matched with the pleural cavity wall located between the bottom of the lobe and the diaphragm away from the heart. The prosthesis has a dish shape, an elliptical shape, an irregular U shape, an arc shape, a cone shape, a scapula shape or an irregular shape, etc., to occupy the space under the lower lobe. Preferably, the upper side of the prosthesis gradually decreases toward the inner edge. The lower side of the prosthesis gradually decreases toward the inner edge. The prosthesis has a smooth curved contour without edges to reduce discomfort and avoid damage to the pleura.

[0027] Preferably, the side has a height of 0.5 cm-8 cm. Preferably, the side has a height of 0.5 cm, 0.6 cm, 0.7 cm, 0.8 cm, 0.9 cm, 1 cm, 2 cm, 3 cm, 4 cm, 5 cm, 6 cm, 7 cm or 8 cm.

[0028] Preferably, the thickness of the prosthesis wall is between 0.1-4 cm. Preferably, the thickness is 0.1 cm, 0.2 cm, 0.3 cm, 0.4 cm, 0.5 cm, 0.6 cm, 0.7 cm, 0.8 cm, 0.9 cm, 1 cm, 1.1 cm, 1.2 cm, 1.3 cm, 1.4 cm, 1.5 cm, 1.6 cm, 1.7 cm, 1.8 cm, 1.9 cm, 2 cm, 3 cm or 4 cm.

[0029] Preferably, the prosthesis of the present invention has an arc shape, wherein the arc matches the lower edge of the lower lobe. Preferably, the arc matches at least 1 / 8 of the lower edge of the lower lobe away from the heart. Preferably, the arc matches at least 1 / 4 of the lower edge of the lower lobe away from the heart. Preferably, the arc matches at least 1 / 2 of the lower edge of the lower lobe away from the heart. Preferably, the arc matches the entire length of the lower edge of the lower lobe.

[0030] Preferably, the prosthesis has a height of 1 cm-4 cm.Preferably, the side has a height of 1 cm, 2 cm, 3 cm or 4 cm.

[0031] Preferably, the prosthesis is designed to be placed in the pleural cavity, in particular, the prosthesis is placed on the lower side of the pleural cavity to reduce the mechanical tension of the alveolar epithelium at the end of normal inspiration. The prosthesis can be fixed in the pleural cavity, in particular, the prosthesis is placed on the lower side of the pleural cavity. For example, the prosthesis can be sutured to the pleural cavity wall, in particular to the lower part of the pleural cavity wall. Preferably, the prosthesis is sutured to the pleural cavity wall through the needle hole on the side.

[0032] The prosthesis can be made of soft sponge latex, foamed latex, 380-micron hollow fiber, gelatin foam material, plastic sponge (Eflon), polyethylene bag filled with glass fiber, rubber, silicone rubber, silicone gel, carbon material, etc. The carbon material includes carbon nanotubes, graphene, ultra-light porous carbon, hollow porous carbon, carbon fiber, carbon-titanium alloy, etc.

[0033] The prosthesis may be solid, or the prosthesis may be a bag or packet filled with a fluid or gel.

[0034] Third, the present invention provides a method for treating pulmonary fibrosis, in particular idiopathic pulmonary fibrosis (IPF), the method comprising the step of reducing the mechanical tension of the alveolar epithelium at the end of normal inspiration. Preferably, the present invention provides a method for treating pulmonary fibrosis, in particular idiopathic pulmonary fibrosis (IPF), the method comprising placing a prosthesis in the pleural cavity, in particular the lower part of the pleural cavity, to reduce the level of mechanical tension of the alveolar epithelium at the end of normal inspiration. The prosthesis can be fixed in the pleural cavity, in particular, the prosthesis is placed in the lower part of the pleural cavity. For example, the prosthesis can be sutured to the wall of the pleural cavity, in particular the lower part of the chest wall.

[0035] The prosthesis of the present invention can be designed to be placed beneath a lung lobe as long as the level of mechanical tension on the alveolar epithelium is reduced at the end of normal inspiration.

[0036] Preferably, the prosthesis is designed to be anchored below a lobe and above the diaphragm, and is preferably designed to match the base of the lobe as long as the mechanical tension on the alveolar epithelium is reduced at the end of normal inspiration.

[0037] Thus, the prosthesis is surrounded by pleural fluid. Preferably, at the end of normal inspiration, the prosthesis will occupy at least 1 / 8 of the space enclosed by the base of the lung lobe, the diaphragm and the wall of the pleural cavity. Preferably, at the end of normal inspiration, the prosthesis will occupy at least 1 / 4 of the space enclosed by the base of the lung lobe, the diaphragm and the wall of the pleural cavity. Preferably, at the end of normal inspiration, the prosthesis will occupy at least half of the space enclosed by the base of the lung lobe, the diaphragm and the wall of the pleural cavity. Preferably, at the end of normal inspiration, the prosthesis will occupy at least 3 / 4 of the space enclosed by the base of the lung lobe, the diaphragm and the wall of the pleural cavity. Preferably, at the end of normal inspiration, the prosthesis will occupy the entire space enclosed by the base of the lung lobe, the diaphragm and the wall of the pleural cavity.

[0038] Therefore, the prosthesis is surrounded by pleural fluid. Preferably, the area of ​​the prosthesis projected to the bottom of the lower lobe will occupy at least 1 / 8 of the area of ​​the bottom of the lower lobe. Preferably, the area of ​​the prosthesis projected to the bottom of the lower lobe will occupy at least 1 / 4 of the area of ​​the bottom of the lower lobe. Preferably, the area of ​​the prosthesis projected to the bottom of the lower lobe will occupy at least half of the area of ​​the bottom of the lower lobe. Preferably, the area of ​​the prosthesis projected to the bottom of the lower lobe will occupy at least 3 / 4 of the area of ​​the bottom of the lower lobe. Preferably, the area of ​​the prosthesis projected to the bottom of the lower lobe will occupy the entire area of ​​the bottom of the lower lobe.

[0039] The prosthesis of the present invention comprises a main body, wherein the main body has an upper side, a lower side and a side extending between the upper side and the lower side. The upper side of the prosthesis is preferably matched with the bottom of the lung lobe. The lower side of the prosthesis is preferably matched with the diaphragm. The outer side of the prosthesis is preferably matched with the wall of the pleural cavity between the bottom of the lung lobe and the diaphragm away from the heart. The inner side of the prosthesis is preferably matched with the outer wall of the lower lung lobe. The prosthesis can have a disc shape, an elliptical shape, an irregular U shape, an arc shape, a cone shape, a shoulder blade shape or an irregular shape, etc., to occupy the space under the lung lobe. The prosthesis has a smooth curved contour without edges and corners to reduce discomfort and avoid damage to the pleura.

[0040] Alternatively, the prosthesis of the present invention comprises a main body having an upper side, a lower side, a side extending between the upper side and the lower side, and an inner edge close to the heart, wherein the side is opposite to the inner edge. The upper side of the prosthesis is preferably matched with the base of the lobe. The lower side of the prosthesis is preferably matched with the diaphragm. The outer side of the prosthesis is preferably matched with the wall of the pleural cavity between the bottom of the lobe and the diaphragm away from the heart. The prosthesis has a dish shape, an elliptical shape, an irregular U shape, an arc shape, a cone shape, a scapula shape or an irregular shape, etc., to occupy the space under the lobe. Preferably, the upper side of the prosthesis gradually tapers toward the inner edge. The lower side of the prosthesis gradually tapers toward the inner edge. The prosthesis has a smooth curved contour without edges to reduce discomfort and avoid damage to the pleura.

[0041] Preferably, the side has a height of 0.5 cm-8 cm. Preferably, the side has a height of 0.5 cm, 0.6 cm, 0.7 cm, 0.8 cm, 0.8 cm, 0.9 cm, 1 cm, 2 cm, 3 cm, 4 cm, 5 cm, 6 cm, 7 cm or 8 cm.

[0042] Preferably, the thickness of the prosthesis wall is between 0.1-4 cm. Preferably, the thickness is 0.1 cm, 0.2 cm, 0.3 cm, 0.4 cm, 0.5 cm, 0.6 cm, 0.7 cm, 0.8 cm, 0.9 cm, 1 cm, 1.1 cm, 1.2 cm, 1.3 cm, 1.4 cm, 1.5 cm, 1.6 cm, 1.7 cm, 1.8 cm, 1.9 cm, 2 cm, 3 cm or 4 cm.

[0043] Preferably, the prosthesis of the present invention has an arc shape, wherein the arc matches the lower edge of the lower lobe. Preferably, the arc matches at least 1 / 8 of the lower edge of the lower lobe away from the heart. Preferably, the arc matches at least 1 / 4 of the lower edge of the lower lobe away from the heart. Preferably, the arc matches at least 1 / 2 of the lower edge of the lower lobe away from the heart. Preferably, the arc matches the entire length of the lower edge of the lower lobe.

[0044] Preferably, the prosthesis has a height of 1 cm-4 cm.Preferably, the side has a height of 1 cm, 2 cm, 3 cm or 4 cm.

[0045] Preferably, the prosthesis is designed to be placed in the pleural cavity, in particular, the prosthesis is placed on the lower side of the pleural cavity to reduce the mechanical tension of the alveolar epithelium at the end of normal inspiration. The prosthesis can be fixed in the pleural cavity, in particular, the prosthesis is placed on the lower side of the pleural cavity. For example, the prosthesis can be sutured to the pleural cavity wall, in particular to the lower part of the pleural cavity wall. Preferably, the prosthesis is sutured to the pleural cavity wall through the needle hole on the side.

[0046] The prosthesis can be made of soft sponge latex, foamed latex, 380-micron hollow fiber, gelatin foam material, plastic sponge (Eflon), polyethylene bag filled with glass fiber, rubber, silicone rubber, silicone gel, carbon material, etc. The carbon material includes carbon nanotubes, graphene, ultra-light porous carbon, hollow porous carbon, carbon fiber, carbon-titanium alloy, etc.

[0047] The prosthesis may be solid, or the prosthesis may be a bag or packet filled with a fluid or gel.

[0048] The present invention covers all combinations of specific embodiments described herein.

[0049] The present invention encompasses all combinations of the specific embodiments described herein. Idiopathic pulmonary fibrosis (IPF) is a fatal progressive lung disease with few treatment options. Our invention demonstrates that impaired alveolar regeneration leads to increased mechanical tension, which in turn drives the development and progression of pulmonary fibrosis. We determined that a simple treatment method of implanting a prosthesis in the pleural cavity greatly slows the progression of pulmonary fibrosis. We expect that prosthesis implantation will bring about a major breakthrough in promoting future developments in the treatment of IPF. Therefore, the present invention is a groundbreaking invention that enables the treatment of IPF, a worldwide intractable disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figures 1A-1F Six views of a prosthesis made in accordance with the present invention are shown.

[0051] Figures 2A-2D Four views of a prosthesis made in accordance with the present invention are shown.

[0052] Figures 3A-3D Four views of a prosthesis made in accordance with the present invention are shown.

[0053] Figures 4A-4F Six views of a prosthesis made in accordance with the present invention are shown.

[0054] Figures 5A-5EFive views of a prosthesis made according to the present invention are shown.

[0055] Figures 6A-6F Six views of a prosthesis made in accordance with the present invention are shown.

[0056] Figures 7A-7C Three views of a prosthesis made according to the present invention are shown.

[0057] Figures 8A-8C Three views of a prosthesis made according to the present invention are shown.

[0058] Figures 9A-9C Three views of a prosthesis made according to the present invention are shown.

[0059] Figures 10A-10C Three views of a prosthesis made according to the present invention are shown.

[0060] Figures 11A-11C Three views of a prosthesis made according to the present invention are shown.

[0061] Figures 12A-12C Three views of a prosthesis made according to the present invention are shown.

[0062] Figures 13A-13D Four views of a prosthesis made in accordance with the present invention are shown.

[0063] Figures 14A-14D Four views of a prosthesis made in accordance with the present invention are shown.

[0064] Figures 15A-15D Four views of a prosthesis made in accordance with the present invention are shown.

[0065] Figures 16A-16E Five views of a prosthesis made according to the present invention are shown.

[0066] Fig.17 The prosthesis of the present invention is shown in place on a human chest.

[0067] Fig.18 Shown is the construction of a mouse strain in which the Cdc42 gene is specifically deleted in AT2 cells.

[0068] Fig.19 It was shown that the loss of Cdc42 gene in AT2 cells resulted in the impairment of AT2 cell differentiation during alveolar regeneration or alveolar homeostasis after PNX.

[0069] Fig. 20 It was shown that deletion of the Cdc42 gene in AT2 cells resulted in progressive pulmonary fibrosis in PNX-treated mice.

[0070] Fig.21It was shown that the deletion of Cdc42 gene in AT2 cells resulted in progressive pulmonary fibrosis in aged mice without PNX treatment.

[0071] Fig. 22 Figure 2 shows the expression of α-SMA in the lungs of Cdc42 AT2 null mice. + Development of fibroblastic foci.

[0072] Fig.23 It was shown that the expression level of CDC42-GTP was significantly increased on day 7 after PNX.

[0073] Fig.24 It has been shown that reducing alveolar mechanical tension can attenuate progressive pulmonary fibrosis.

[0074] Fig.25 Fragments of the Cdc42 DNA sequence before or after deletion of exon 2 of the Cdc42 gene are shown. DETAILED DESCRIPTION

[0075] The descriptions of specific embodiments and examples are provided by way of illustration and not limitation. Those skilled in the art will readily recognize that a variety of noncritical parameters can be changed or modified to produce essentially similar results.

[0076] The pleural cavity is a thin, fluid-filled space between the two pulmonary pleurae of each lung (called the visceral pleura and the parietal pleura). The pleura is a serous membrane that folds over on itself to form a two-layered, membranous pleural sac. The outer pleura (parietal pleura) is attached to the chest wall, but the two are separated by the endothoracic fascia. The inner pleura (visceral pleura) covers the lungs and adjacent structures, including blood vessels, bronchi, and nerves. The pleural cavity can be considered a potential space because, under all normal circumstances, the two pleurae are adhered to each other (by a thin film of serous fluid). The pleural cavity is surrounded by the rib cage, which surrounds the lungs. A small amount of fluid is located in the potential space between the two layers of pleura.

[0077] Pleural fluid is a serous fluid produced by the serosa covering the normal pleura. Most of the pleural fluid is produced by the parietal circulation (intercostal arteries) through bulk flow and is reabsorbed by the lymphatic system. Therefore, pleural fluid is continuously produced and reabsorbed.

[0078] The lungs are located in the chest cavity on either side of the heart in the rib cage. They are cone-shaped, with a narrow rounded apex and a wide concave base that sits on the convex surface of the diaphragm. The lungs are surrounded by the pulmonary pleura. The pleura are two layers of serous membranes; the outer parietal pleura lines the inner wall of the rib cage, and the inner visceral pleura lines directly on the surface of the lungs. Between the pleura is a potential space called the pleural cavity, which contains a thin layer of pleural fluid that acts as a lubricant. Each lung is divided into several lobes by fissures formed in the pleura. The fissures are double folds of the pleura that separate the lungs and help them expand. The right lung has three lobes, namely the upper lobe, middle lobe and lower lobe, while the left lung has only two lobes: the upper and lower lobe.

[0079] In the present invention, the term "mechanical tension" means "physical tension", "stretching", "expansion", "stress" or "strain", for example, "strain" includes "compressive strain", "tensile strain", and angular deformation is "shear strain".

[0080] Idiopathic pulmonary fibrosis (IPF) is a chronic lung disease characterized by a progressive and irreversible decline in lung function. Symptoms typically include progressive shortness of breath and a dry cough. Other changes may include feeling tired and clubbing of the nails. Complications may include pulmonary hypertension, heart failure, pneumonia, or pulmonary embolism.

[0081] A prosthesis is an artificial device that replaces a body part, with the intention of restoring the normal function of said body part. Prostheses can be made by hand or using CAD (Computer Aided Design), a software interface that helps creators visualize their creations in 3D. Prostheses are made to be lightweight for the convenience of the subject, and some of the materials include: plastics (polyethylene, polypropylene, acrylics, polyurethane), light metals (titanium, aluminum), composites (carbon fiber), and silicone rubber.

[0082] Surgical sutures are used to hold body tissues together after injury or surgery. Surgical sutures are made from many materials. Original sutures are made from biomaterials such as catgut and silk, as well as synthetic materials such as absorbable polyglycolic acid, polylactic acid, absorbable suture (Monocryl) and polydioxanone, and non-absorbable nylon, polyester, PVDF and polypropylene. Polymer materials are based on one or more of the following five cyclic monomers: glycolide, l-lactide, p-dioxanone, trimethylene carbonate and ε-caprolactone.

[0083] Silicone rubber is an elastomer composed of silicone, which is a polymer containing silicon as well as carbon, hydrogen and oxygen. Silicone rubber offers properties such as good resistance to extreme temperatures, elongation, creep, cyclic flexing, tear strength, compression set, dielectric strength (at high voltages), thermal conductivity, fire resistance, and in some cases, tensile strength at extreme temperatures that can be far superior to typical organic rubbers.

[0084] Those skilled in the art will anticipate that any drug or prosthesis that reduces the mechanical tension of the alveolar epithelium will be included within the scope of the present invention, as the inventors of the present invention have for the first time established a direct link between mechanical tension and IPF, that is, reducing the mechanical tension of the alveolar epithelium will be effective.

[0085] Example

[0086] method

[0087] Mice and survival curve recording

[0088] Rosa26-CAG-mTmG (Rosa26-mTmG) 20 and Cdc42 flox / flox Mouse 21 All experiments were performed in accordance with the recommendations in the Guide for Care and Use of Laboratory Animals of the National Institute of Biological Sciences. To monitor the survival of mice, the body weight of control mice and Cdc42 AT2 gene null mice was measured weekly after PNX treatment. Once mice reached the predefined endpoint criteria, the mice were sacrificed. We defined the endpoint according to the predefined criteria. 22,23 .

[0089] Generation of Spc-CreER knock-in allele

[0090] CreERT2, p2a and rtTA elements were enzymatically linked and inserted into the endogenous Sftpc gene of mice. The insertion site was the stop codon of the endogenous Sftpc gene, and then a new stop codon was generated at the 3' end of rtTA. The CreERT2-p2a-rtTA fragment was inserted into the genome using CRISPR / Cas9 technology.

[0091] Pneumonectomy (PNX) and prosthesis implantation

[0092] 8-week-old male mice were injected with tamoxifen (dose: 75 mg / kg) every other day for 4 times. The mice were anesthetized and connected to a ventilator (Kent Scientific, Topo) on the 14th day after the last injection of tamoxifen. The chest wall was cut open at the fourth intercostal space and the left lung lobe was removed. For prosthesis implantation, a soft silicone prosthesis with a size and shape similar to the left lung lobe was inserted into the empty left lung cavity.

[0093] Lung function tests

[0094] Using the invasive lung function test system (DSI Pulmonary function parameters were measured using a PFT controller. Mice were first anesthetized and then an endotracheal tube was inserted into their trachea. Dynamic compliance results were obtained from resistance and compliance tests.

[0095] Hematoxylin-eosin (H&E) staining and immunostaining

[0096] Lungs were filled with 4% paraformaldehyde (PFA) and fixed continuously in 4% PFA for 24 hours at 4° C. Lungs were then cryoprotected in 30% sucrose and embedded in OCT (Tissue Tek).

[0097] H&E staining experiments followed standard H&E protocols. Briefly, slides were washed with water to remove OCT. Cell nuclei were stained with hematoxylin (Abcam, ab150678) for 2 minutes and cytoplasm was stained with eosin (Sigma, HT110280) for 3 minutes. After a dehydration and clearing step, sections were mounted with neutral resin.

[0098] Immunofluorescence staining experiments followed the previously described protocol. 24 Briefly, after removing OCT, lung sections were blocked with 3% BSA / 0.1% TritonX-100 / PBS for 1 hour, and then the slides were incubated with the primary antibody overnight at 4°C. After the slides were washed three times with 0.1% TritonX-100 / PBS, the sections were incubated with the secondary antibody at room temperature for 2 hours.

[0099] The primary antibodies used in this article are as follows:

[0100]

[0101] The secondary antibodies used in this article are as follows:

[0102]

[0103] Statistical analysis. All data are presented as mean ± sem (as indicated in the figure legends). The data shown in the figures are from multiple independent experiments performed on different days using different mice. Unless otherwise stated, most of the data shown in the figures are based on at least three independent experiments. The inferential statistical significance of the differences between sample means was assessed using a two-tailed unpaired Student's t-test.

[0104] Isolation of mouse AT2 cells. After 4 doses of tamoxifen, lungs of Spc-CreER, Rosa26-mTmG mice were isolated as previously described. 19,44Briefly, anesthetized mice were perfused with neutral protease (Worthington-Biochem, LS02111) and DNase I (Roche, 10104159001). AT2 cells were sorted directly based on GFP fluorescence using single cell selection mode in BD FACS Aria II and III devices.

[0105] Quantitative RT-PCR (qPCR). Total RNA was isolated from whole lung or primary AT2 cells using the Zymo Research RNA Miniprep Kit (R2050). Reverse transcription was performed using a two-step cDNA synthesis kit (Takara, catalog number 6210A / B) following the manufacturer's recommendations. qPCR was performed using a CFX96 Touch TM Real-time PCR detection system was used. The mRNA level of the target gene was normalized to the level of Gapdh mRNA.

[0106] The primers used for qPCR are as follows.

[0107]

[0108] 3D alveolar reconstruction. For vibratome sections, the lungs were gently filled to full capacity with 2% low melting point agarose. The lungs were then fixed overnight in 4% PFA at 4°C. Vibratome sections with a thickness of 200 μm were cut using a vibratome (Leica VT100S). Immunostaining experiments were performed according to standard whole-body staining protocols. Z stack images were acquired using a Leica LSI macro confocal microscope and / or an A1-R inverted confocal microscope.

[0109] CDC42-GTP Assay. GTP-CDC42 levels were determined using the CDC42 Activation Assay Biochemical Kit (cytoskeleton, #BK127) following the manufacturer's recommendations. Briefly, whole lung lobes were ground in liquid nitrogen and then lysed using cell lysis buffer (provided in the kit). The cell lysate was then added to the wells of the included microplate. After the reaction, the absorbance was measured at 490 nm.

[0110] Example 1

[0111] like Figures 1A-1F As shown, the prosthesis has an arc shape and occupies about 3 / 4 of the lower edge of the lung lobe. The side has a height of about 1.5 cm. The prosthesis has a thickness of about 2 mm. The bottom of the prosthesis has a width of 1 cm. The prosthesis can be sutured on the pleural cavity wall. The surface of the prosthesis is as round and smooth as possible.

[0112] The opening is oriented toward the heart. At the end of normal inspiration, the prosthesis compresses the lower part of the lung lobe and the mechanical tension of the alveolar epithelium is reduced.

[0113] Example 2

[0114] like Figures 2A-2D As shown, the prosthesis has an arc shape and occupies about 1 / 8 of the lower edge of the lung lobe. The side has a height of about 3 cm. The prosthesis has a thickness of about 7 mm. The bottom of the prosthesis has a width of 2 cm. The prosthesis can be sewn on the side wall of the pleural cavity away from the heart. The surface of the prosthesis is as round and smooth as possible.

[0115] At the end of normal inspiration, the prosthesis compresses the lower part of the lung lobe and the mechanical tension of the alveolar epithelium is reduced.

[0116] Example 3

[0117] like Figures 3A-3D As shown, the prosthesis has an arc shape and occupies about 1 / 4 of the lower edge of the lung lobe. The side has a height of about 3 cm. The prosthesis has a thickness of about 6 mm. The bottom of the prosthesis has a width of 1.3 cm. The prosthesis can be sewn on the side wall of the pleural cavity away from the heart. The surface of the prosthesis is as round and smooth as possible.

[0118] At the end of normal inspiration, the prosthesis compresses the lower part of the lung lobe and the mechanical tension of the alveolar epithelium is reduced.

[0119] Example 4

[0120] like Figures 4A-4F As shown, the prosthesis has a dish shape and matches the entire area of ​​the base of the lower lobe. The side has a height of about 2.5 cm. The prosthesis has a thickness of about 2 mm. The prosthesis can be sutured on the side wall of the pleural cavity. The surface of the prosthesis is as round and smooth as possible.

[0121] At the end of normal inspiration, the prosthesis compresses the lower part of the lung lobe and the level of mechanical tension on the alveolar epithelium is reduced.

[0122] Example 5

[0123] like Figures 5A-5E As shown, the prosthesis has a shell-like shape and matches the entire area of ​​the bottom of the lower lobe. The prosthesis has a concave in the middle and gradually narrows toward the side wall of the pleural cavity. The prosthesis also has a concave on the heart side to accommodate the heart. The prosthesis has a thickness of about 4 mm. The surface of the prosthesis is as round and smooth as possible.

[0124] At the end of normal inspiration, the prosthesis compresses the lower part of the lung lobe and the mechanical tension of the alveolar epithelium is reduced.

[0125] Example 6

[0126] like Figures 6A-6F As shown, the prosthesis has a U-shaped shape and matches more than 3 / 4 of the edge of the lower lobe. The cross-section of the prosthesis is close to a triangle. The side that contacts the edge of the lower lobe is a concave arc. The outer side of the prosthesis has a height of 1.0 cm. The surface of the prosthesis is as round and smooth as possible.

[0127] The prosthesis can be sewn to the side wall of the pleural cavity. At the end of normal inspiration, the prosthesis compresses the lower part of the lung lobe and the mechanical tension of the alveolar epithelium is reduced.

[0128] Example 7

[0129] like Figures 7A-7C As shown, the prosthesis has an arc shape and matches more than 1 / 4 of the edge of the lower lobe. The cross section of the prosthesis is close to a triangle. The side that contacts the edge of the lower lobe is a concave arc. The outer side of the prosthesis has a height of 1.6 cm. The surface of the prosthesis is as round and smooth as possible.

[0130] The prosthesis can be sewn to the side wall of the pleural cavity away from the heart. At the end of normal inspiration, the prosthesis compresses the lower part of the lung lobe, and the mechanical tension of the alveolar epithelium is reduced.

[0131] Example 8

[0132] like Figures 8A-8C As shown, the prosthesis has an arc shape and matches more than 1 / 4 of the edge of the lower lobe. The prosthesis has a smaller curvature than the prosthesis of Example 7. The cross-section of the prosthesis is close to a triangle. The side that contacts the edge of the lower lobe is a concave arc. The outer side of the prosthesis has a height of 2.2 cm. The surface of the prosthesis is as round and smooth as possible.

[0133] The prosthesis can be sewn to the side wall of the pleural cavity away from the heart. At the end of normal inspiration, the prosthesis compresses the lower part of the lung lobe, and the mechanical tension of the alveolar epithelium is reduced.

[0134] Example 9

[0135] like Figures 9A-9C As shown, the prosthesis has an arc shape and matches more than 1 / 8 of the edge of the lower lobe. The prosthesis has a smaller curvature than the prosthesis of Example 7. The cross-section of the prosthesis is close to a triangle. The side that contacts the edge of the lower lobe is a concave arc. The outer side of the prosthesis has a height of 3.5 cm. The surface of the prosthesis is as round and smooth as possible.

[0136] The prosthesis can be sewn to the side wall of the pleural cavity away from the heart. At the end of normal inspiration, the prosthesis compresses the lower part of the lung lobe, and the mechanical tension of the alveolar epithelium is reduced.

[0137] Example 10

[0138] like Figures 10A-10C As shown, the prosthesis has an arc shape and matches more than 3 / 4 of the edge of the lower lung lobe. The cross section of the prosthesis is close to a circle. The radius of the cross section is about 0.5 cm.

[0139] At the end of normal inspiration, the prosthesis compresses the lower part of the lung lobe and the mechanical tension of the alveolar epithelium is reduced.

[0140] Embodiment 11

[0141] like Figures 11A-11C As shown, the prosthesis has an arc shape and matches more than 1 / 4 of the edge of the lower lung lobe. The cross section of the prosthesis is close to a circle. The radius of the cross section is about 0.8 cm.

[0142] The prosthesis can be sewn to the side wall of the pleural cavity away from the heart. At the end of normal inspiration, the prosthesis compresses the lower part of the lung lobe, and the mechanical tension of the alveolar epithelium is reduced.

[0143] Example 12

[0144] like Figures 12A-12C As shown, the prosthesis has an arc shape and matches more than 1 / 8 of the edge of the lower lung lobe. The cross section of the prosthesis is close to a circle. The radius of the cross section is about 1.0 cm.

[0145] The prosthesis can be sewn to the side wall of the pleural cavity away from the heart. At the end of normal inspiration, the prosthesis compresses the lower part of the lung lobe, and the mechanical tension of the alveolar epithelium is reduced.

[0146] Embodiment 13

[0147] like Figures 13A-13D As shown, the prosthesis has a dish shape and matches the area of ​​more than 1 / 3 of the base of the lower lobe. The side has a height of about 1.0 cm. The prosthesis has a thickness of about 0.4 cm. The prosthesis has a concave bottom. The prosthesis can be sutured to the side wall of the pleural cavity. The surface of the prosthesis is as round and smooth as possible.

[0148] At the end of normal inspiration, the prosthesis compresses the lower part of the lung lobe and the mechanical tension of the alveolar epithelium is reduced.

[0149] Embodiment 14

[0150] like Figures 14A-14D As shown, the prosthesis has a dish shape and matches the area of ​​more than 1 / 3 of the base of the lower lobe. The side has a height of about 4 cm. The prosthesis has a thickness of about 1.0 cm. The prosthesis can be sutured to the side wall of the pleural cavity. The surface of the prosthesis is as round and smooth as possible.

[0151] At the end of normal inspiration, the prosthesis compresses the lower part of the lung lobe and the mechanical tension of the alveolar epithelium is reduced.

[0152] Embodiment 15

[0153] like Figures 15A-15D The prosthesis has a semi-disc shape and matches the area of ​​more than 1 / 3 of the base of the lower lobe. The side has a height of about 5 cm. The prosthesis has a thickness of about 0.5 cm. The prosthesis can be sutured to the side wall of the pleural cavity. The surface of the prosthesis is as round and smooth as possible.

[0154] At the end of normal inspiration, the prosthesis compresses the lower part of the lung lobe and the mechanical tension of the alveolar epithelium is reduced.

[0155] Example 16

[0156] like Figures 16A-16E The prosthesis has a semi-disc shape and matches the area of ​​more than 1 / 3 of the base of the lower lobe. The side has a height of about 3 cm. The prosthesis has a thickness of about 0.3 cm. The prosthesis can be sutured to the side wall of the pleural cavity. The surface of the prosthesis is as round and smooth as possible.

[0157] At the end of normal inspiration, the prosthesis compresses the lower part of the lung lobe and the mechanical tension of the alveolar epithelium is reduced.

[0158] Embodiment 17

[0159] like Fig.17 As described above, the prosthesis of Example 4 is placed in the human chest cavity. At the end of normal inspiration, the prosthesis compresses the lower part of the lung lobe, and the mechanical tension of the alveolar epithelium is reduced.

[0160] Embodiment 18

[0161] Construction and characterization of Cdc42 AT2 gene null mice

[0162] In order to construct an animal model of progressive pulmonary fibrosis, Cdc42 AT2 gene-null mice were generated by specifically knocking out the Cdc42 gene in alveolar type II epithelial cells (AT2 cells).

[0163] To specifically delete the Cdc42 gene in AT2 cells, mice carrying the Spc-CreER knock-in allele were crossed with Cdc42 floxed (Cdc42 flox / flox ) mouse hybrid( Fig.18 A). In Cdc42 flox / flox In mice, there are two loxp sites on both sides of exon 2 of the Cdc42 gene containing the Cdc42 gene translation start exon. flox / flox In mice, exon 2 of the Cdc42 gene in AT2 cells was specifically deleted by Cre / loxp-mediated recombination after tamoxifen treatment ( Fig.18 B) Spc-CreER; Cdc42 flox / flox The mice were named Cdc42AT2 gene null mice.

[0164] Spc-CreER,Cdc42 flox / - The mice were subjected to genomic purification and PCR amplification. The flox and deletion bands of Cdc42 were then purified and sequenced using the following primers: CTGCCAACCATGACAACCTAA (SEQ ID NO: 23); AGACAAAACAACAAGGTCCAG (SEQ ID NO: 24).

[0165] The fragment of Cdc42 DNA sequence before or after exon 2 of Cdc42 gene is deleted. Fig.25 .

[0166] like Fig.19 As shown in A, 200 μm lung sections from control mice and Cdc42 AT2 gene null mice were immunostained with antibodies against GFP, Pdpn, and Prospc. On day 21 after PNX, many newly differentiated AT1 cells and newly formed alveoli were observed in control lungs ( Fig.19 B). However, in Cdc42 AT2 gene null lungs, only a few AT2 cells differentiated into AT1 cells and no new alveoli were formed at day 21 after PNX ( Fig.19 B) Severe overstretching of alveoli was observed in the peripheral regions of PNX-treated Cdc42 AT2 null lungs ( Fig.19 B).

[0167] During alveolar homeostasis, AT2 cells slowly differentiate into AT1 cells and establish new alveoli. Examination of 12-month-old Cdc42 AT2 null mice without PNX treatment revealed enlarged alveoli without any new AT1 cell formation; in contrast, lungs of 12-month-old control mice showed the formation of many new alveoli ( Fig.19 C and 19D).

[0168] PNX-treated Cdc42 AT2 null mice and control mice were observed for a longer period of time after PNX treatment ( Fig. 20 A). At day 30 after PNX, some Cdc42 AT2 null mice showed significant weight loss and increased respiratory rate. In fact, by day 60 after PNX, fully 50% of PNX-treated Cdc42 AT2 null mice reached predefined health status criteria for endpoint euthanasia ( Fig. 20B), by day 180 after PNX, approximately 80% of PNX-treated Cdc42 AT2 null mice reached their endpoint ( Fig. 20 B).

[0169] H&E staining of PNX-treated control mice and Cdc42 AT2-null mice revealed that Cdc42 AT2-null mice had severe pulmonary fibrosis at their endpoint ( Fig. 20 C-20D). To determine the point at which Cdc42 AT2 null mice begin to develop pulmonary fibrosis after PNX, lungs of Cdc42 AT2 null mice were analyzed using H&E staining at various time points after PNX ( Fig. 20 D). By day 21 after PNX, some Cdc42 AT2 null lungs showed signs of tissue thickening in the subpleural region ( Fig. 20 D and Fig. 20 By endpoint, dense fibrosis had progressed to the center of most Cdc42 AT2 null lungs.

[0170] In addition to the strong immunofluorescence signal of collagen I detected in these dense fibrotic areas ( Fig. 20 In addition, we also observed that the proportion of collagen I expression areas in each lung lobe of Cdc42 AT2 gene null mice gradually increased after PNX ( Fig. 20 F). Our qPCR analysis also showed that the expression level of collagen I mRNA gradually increased from day 21 after PNX ( Fig. 20 G). In addition, starting from day 21 after PNX, a gradual decrease in lung compliance was observed in PNX-treated Cdc42 AT2 null mice compared with PNX-treated control mice ( Fig. 20 H), given that decreased lung compliance is known to occur frequently when the lung becomes fibrotic 20-25 , this is an interesting finding.

[0171] Starting at 2 months of age, control mice and Cdc42 AT2 null mice were exposed to 4 doses of tamoxifen for 14 days. Lungs of control mice and Cdc42 AT2 null mice not treated with PNX were collected at 10, 12, 16, or 24 months of age. Fig.21 A). Analysis of the lungs of the control mice and Cdc42 AT2 gene null mice without PNX treatment revealed that there were no significant fibrotic changes in the Cdc42 AT2 gene null mice before they reached 10 months of age ( Fig.21 B and 21C). By 12 months, fibrosis clearly developed in the subpleural region of the Cdc42 AT2 null lungs and progressed toward the center of the lung ( Fig.21C). Thus, loss of the Cdc42 gene in AT2 cells leads to progressive pulmonary fibrosis starting around 12 months of age in Cdc42 AT2 null mice that have not been treated with PNX.

[0172] Fibroblastic foci are considered to be relevant morphological markers of progressive pulmonary fibrosis and are considered to be sites of initiation and / or continuation of the fibrotic response in progressive pulmonary fibrosis. Fibroblastic foci contain proliferating α-SMA + Fibroblasts. On day 21 after PNX, lungs of Cdc42 AT2 null mice were stained with anti-α-SMA antibody ( Fig. 22 A) Some α-SMA was observed in relatively normal alveolar areas of Cdc42AT2 null lungs + Fibroblasts gathered into AT2 cell clusters (GFP + Cell) (area 1, Fig. 22 A). Also, dense fibrotic areas of the lung are filled with α-SMA + Fibroblasts (Zone 2, Fig. 22 A) In addition, α-SMA was observed in the lungs of Cdc42 AT2 null mice at day 21 after PNX by immunostaining using antibodies against α-SMA and the proliferation marker Ki67. + The cell proliferation of cells increased dramatically, indicating the proliferation of α-SMA + Fibroblasts contribute to the development of pulmonary fibrosis ( Fig. 22 B).

[0173] Embodiment 19

[0174] Increased mechanical tension caused by impaired alveolar regeneration leads to progressive pulmonary fibrosis

[0175] PNX treatment significantly accelerated pulmonary fibrosis in Cdc42 AT2 null mice ( Fig. 20 ) This fact indicates that there is a close connection between pulmonary fibrosis and alveolar regeneration induced by mechanical tension.

[0176] The loss of alveoli caused by PNX greatly increases the mechanical tension applied to the alveolar epithelium. Subsequent effective alveolar regeneration in normal mice eventually reduces the intensity of mechanical tension to pre-PNX levels; however, since Cdc42 AT2 gene null cells cannot differentiate into AT1 cells, they cannot regenerate new alveoli ( Fig.19 B), the alveolar epithelium of Cdc42 AT2 null mice continues to experience elevated mechanical tension ( Fig.19 B), which leads to the progressive development of fibrosis ( Fig. 20 D).

[0177] Embodiment 20

[0178] Progressive pulmonary fibrosis could be prevented with prosthesis implant

[0179] By measuring the expression level of CDC42-GTP (the state of CDC42 bound to GTP) in the lung after PNX, it was found that the activity of CDC42-GTP was significantly increased on the 7th day after PNX ( Fig.23 A-23B). This increase in CDC42-GTP expression can be suppressed by implanting a prosthesis in the chest cavity ( Fig.23 A-23B).

[0180] like Fig.24 As shown in A-24H, reducing alveolar mechanical tension can reduce progressive pulmonary fibrosis. Control mice and Cdc42 AT2 gene null mice were exposed to 4 doses of tamoxifen for 14 days before PNX. Prostheses were implanted on day 14 after PNX ( Fig.24 A). Lungs from control and Cdc42 AT2 null mice implanted with prosthesis were collected on day 21 after PNX. Images show maximum intensity of 200 μm Z-projections of lung sections stained with antibodies against GFP, Pdpn, and Prospc ( Fig.24 B). The mean alveolar size of control mice and Cdc42 AT2 gene null mice implanted with prosthesis was not significantly different at day 21 after PNX (mean ± SEM, n = 3), indicating that the alveolar enlargement phenotype of Cdc42 AT2 gene null lungs can be greatly rescued by implantation of prosthesis ( Fig.24 B-24C). Review: A moderate increase in actin-cytoskeleton regulatory genes and a decrease in surfactant-related gene expression levels were observed in the lungs of IPF patients. By qPCR, we compared the expression levels of actin-cytoskeleton regulatory genes and AT2 biomarker genes in AT2 cells from Cdc42 AT2 null mice without and with prosthesis implantation (mean ± SEM, n = 3). In Cdc42 null AT2 cells without prosthesis implantation, the expression levels of actin-cytoskeleton regulatory genes were increased, and the expression levels of AT2 biomarker genes were decreased ( Fig.24 D-24E). Implantation of the prosthesis not only inhibits the increase in expression of actin-cytoskeleton regulatory genes ( Fig.24 D), and significantly rescued the reduction in AT2 biomarker gene expression ( Fig.24E). Our results support the conclusion that increased mechanical tension in the overstretched alveoli of Cdc42 AT2 null lungs positively regulates actin-cytoskeleton regulatory genes and negatively regulates AT2 biomarker gene expression. The percentage of survivors of Cdc42 AT2 null mice without and with prosthesis implantation at day 180 after PNX was calculated. Strikingly, by day 180 after PNX, no Cdc42 AT2 null mice with prosthesis implantation (n=10) had died, whereas approximately 70% of Cdc42 AT2 null mice without prosthesis implantation (n=19) had died by this time point ( Fig.24 F). Fig.24 G shows the hydroxyproline levels in the lungs of Cdc42 AT2 null mice without and with prosthesis implantation when the Cdc42 AT2 null mice without prosthesis implantation reached their endpoint (mean ± SEM, n = 5). H&E staining showed that by day 180 after PNX, there was almost no obvious lung fibrosis in the Cdc42 AT2 null mice with prosthesis implantation, while mild to severe lung fibrosis was observed in all surviving Cdc42 AT2 null mice without prosthesis implantation after PNX ( Fig.24 H). Together, these results demonstrate the important regulatory role of mechanical tension in driving the development of pulmonary fibrosis in Cdc42 AT2 null mice. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001; NS, not significant; Student's t test. Scale bars: 20 μm (B); 2 mm (H).

[0181] like Figure 20-22 As shown, genetic nullification of Cdc42 in AT2 cells leads to progressive pulmonary fibrosis following lung injury. The progressive development of pulmonary fibrosis that we observed here is remarkably similar to the pathological process that occurs in patients with IPF, with fibrosis initially starting in peripheral regions of the lung and then slowly progressing inwards, eventually affecting entire lobes. We show that the loss of alveoli caused by PNX greatly increases the mechanical tension exerted on the alveolar epithelium. The subsequent efficient regeneration of alveoli that occurs in normal mice eventually reduces the magnitude of mechanical tension to pre-PNX levels; however, because Cdc42-null AT2 cells cannot differentiate into AT1 cells and therefore cannot regenerate new alveoli, the alveolar epithelium of Cdc42 AT2-null mice continues to experience elevated mechanical tension.

[0182] In addition, the present invention provides a new and creative method for treating IPF, a disease whose progression has not been reversed or even slowed down so far. The method of the present invention uses a lung prosthesis implanted in the human pleural cavity and is an effective method for treating IPF without using any drugs.

[0183] References

[0184] 1 Wynn, T. Cellular and molecular mechanisms of fibrosis, The Journal of Pathology: A Journal of the Pathological Society of Great Britain and Ireland 214, 199-210 (2008).

[0185] 2 Wynn, TA & Ramalingam, TR Mechanisms of fibrosis: therapeutic translation for fibrotic disease, Nature medicine 18, 1028 (2012).

[0186] 3 Mehal, WZ, Iredale, J. & Friedman, SL Scraping fibrosis: expressway to the core of fibrosis, Nature medicine 17, 552 (2011).

[0187] 4 Barkauskas, CE & Noble, PW Cellular mechanisms of tissue fibrosis. 7. New insights into the cellular mechanisms of pulmonary fibrosis, American Journal of Physiology-Cell Physiology 306, C987-C996 (2014).

[0188] 5 Rock, JR et al., Multiple stromal populations contribute to pulmonary fibrosis without evidence for epithelial to mesenchymal transition, Proceedings of the National Academy of Sciences 108, E1475-E1483 (2011).

[0189] 6 Gross, TJ & Hunninghake, GW Idiopathic pulmonary fibrosis, New England Journal of Medicine 345, 517-525 (2001).

[0190] 7 Vyalov, SL, Gabbiani, G. & Kapanci, Y. Rat alveolar myofibroblasts acquire alpha-smooth muscle actin expression during bleomycin-induced pulmonary fibrosis, The American journal of pathology 143, 1754 (1993).

[0191] 8 King Jr, TE, Pardo, A. & Selman, M. Idiopathic pulmonary fibrosis, The Lancet 378, 1949-1961 (2011).

[0192] 9 Plantier, L. et al., Ectopic respiratory epithelial cell differentiation in bronchiolised distal airspaces in idiopathic pulmonary fibrosis, Thorax 66, 651-657 (2011).

[0193] 10 Steele, MP & Schwartz, DA Molecular mechanisms in progressive idiopathic pulmonary fibrosis, Annual review of medicine 64, 265-276 (2013).

[0194] 11 Nogee, LM, et al., Mutation in the surfactant protein C gene associated with familial interstitial lung disease, New England Journal of Medicine 344, 573-579 (2001).

[0195] 12 Seibold, MA et al., A common MUC5B promoter polymorphism and pulmonary fibrosis, New England Journal of Medicine 364, 1503-1512 (2011).

[0196] 13 Wang, Y. et al., Genetic defects in surfactant protein A2 are associated with pulmonary fibrosis and lung cancer, The American Journal of Human Genetics 84, 52-59 (2009).

[0197] 14 Barkauskas, CE et al., Type 2 alveolar cells are stem cells in adult lung, The Journal of clinical investigation 123, 3025-3036 (2013).

[0198] 15 Desai, TJ, Brownfield, DG & Krasnow, MA Alveolar progenitor and stem cells in lung development, renewal and cancer, Nature 507, 190 (2014).

[0199] 16 Haies, DM, Gil, J. & Weibel, ER Morphometric study of rat lung cells: I. Numerical and dimensional characteristics of parenchymal cell population, American Review of Respiratory Disease 123, 533-541 (1981).

[0200] 17 Selman, M. & Pardo, A. Idiopathic pulmonary fibrosis: an epithelial / fibroblastic cross-talk disorder, Respiratory Research 3, 3 (2001).

[0201] 18 Kropski, JA, Blackwell, TS & Loyd, JE The genetic basis of idiopathic pulmonary fibrosis, European Respiratory Journal 45, 1717-1727 (2015).

[0202] 19 Goodwin, AT & Jenkins, G. Molecular endotyping of pulmonary fibrosis, Chest 149, 228-237 (2016).

[0203] 20 Meltzer, EB & Noble, PW Idiopathic pulmonary fibrosis, Orphanet journal of rare diseases 3, 8, doi:10.1186 / 1750-1172-3-8 (2008).

[0204] 21 Richeldi, L., Collard, HR & Jones, MG. Idiopathic pulmonary fibrosis, The Lancet 389, 1941-1952, doi:10.1016 / s0140-6736(17)30866-8(2017).

[0205] 22 TE, JK et al., Idiopathic pulmonary fibrosis, American journal of respiratory and critical care medicine 161, 646-664 (2000).

[0206] 23 Lynch, DA et al., High-resolution computed tomography in idiopathic pulmonary fibrosis: diagnosis and prognosis, American journal of respiratory and critical care medicine 172, 488-493 (2005).

[0207] 24 Noble, PW, et al., Pirfenidone in patients with idiopathic pulmonary fibrosis (CAPACITY): two randomised trials, The Lancet 377, 1760-1769 (2011).

[0208] 25 Raghu, G. et al., An official ATS / ERS / JRS / ALAT statement: idiopathic pulmonary fibrosis: evidence-based guidelines for diagnosis and management, American journal of respiratory and critical care medicine 183, 788-824 (2011). Sequence Listing <110> Beijing Institute of Life Sciences <120> Prosthesis for lungs and its use <130> RYP1918236.4 <160> 26 <170> PatentIn version 3.5 <210> 1 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 1 aaggtcggtg tgaacggatt tgg 23 <210> 2 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 2 cgttgaattt gccgtgagtg gag 23 <210> 3 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 3 ttgtcgtggt gattgtaggg 20 <210> 4 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 4 tggaaaaggt agcgatggtg 20 <210> 5 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 5 gcaagctcta cacctgcctc tt 22 <210> 6 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 6 cgtgccttgt aagttctgtg gc 22 <210> 7 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 7 tgccagaact ctgaaaagga atgg 24 <210> 8 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 8 cagtgctttg gtctccacgg tt 22 <210> 9 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 9 catgggcaag aaagtctctg cag 23 <210> 10 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 10 actggtagag gcacttctgt cg 22 <210> 11 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 11 acctggatga ggagcttcag ac 22 <210> 12 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 12 ctgactgccc attggtggaa aag 23 <210> 13 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 13 cattgctgac aggatgcaga agg 23 <210> 14 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 14 tgctggaagg tggacagtga gg 22 <210> 15 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 15 tcgccaagtg tcaacgctcg tt 22 <210> 16 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 16 ggtcgatggt ttccagcagc tt 22 <210> 17 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 17 catcgtaggc tacaaggact cg 22 <210> 18 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 18 ccaagtgtca gcccattgac ga 22 <210> 19 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 19 atcgaggtgc agcagatgaa gg 22 <210> 20 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 20 cggagcatct gctccttttc tc 22 <210> twenty one <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> twenty one ggctttgagt cgtccacctt ct 22 <210> twenty two <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> twenty two gtcctttgac ctggaagagc ct 22 <210> twenty three <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> twenty three ctgccaacca tgacaaccta a 21 <210> twenty four <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> twenty four agacaaaaca acaaggtcca g 21 <210> 25 <211> 1128 <212> DNA <213> Mouse (Mus musculus) <400> 25 tgttctattt taaagtacag gtaatcatgc atgagaagtc aaaaccttta aaactgtcaa 60 acagtgggct gctgtgtgtg gcatttgctg ccaaccatga caacctaagt tcaacttaag 120 agcccaacaa tggaaaaaga ccccttcaag ttgtcctctg ccatctacac atacaccaaa 180 gcaggacaca ggtatgtaca gaattcataa cttcgtataa tgtatgctat acgaagttat 240 gttcgaacga agttcctatt ctctagaaag tataggaact tcgctagact agtacgcgtg 300 tacaccttgt aattgctgct ctgagcaagt tgccattttt tctttttaga ggttttcagt 360 catagcagta atgctagttc tggtttgagt ggctgagcct gttgctaggg gaaaaaagta 420 tggatttaaa cataaatcaa taaaataatt gtctttaatt tcttcttagg acaagatcta 480 atttgaaata ttaaaagtgg atacaaaact gtttccgaaa tgcagacaat taagtgtgtt 540 gttgttggtg atggtgctgt tggtaaaaca tgtctcctga tatcctacac aacaaacaaa 600 ttcccatcgg aatatgtacc aactgtaagt ataaaggctt tttactagca aaagattgta 660 atgtagtgtc tgtccattgg aaaacacttg gcctgcctgc agtatttttg actgtcttgc 720 cctttaaaaa aaattaaatt ttactacctt tattactttg tggggtgtgt gttataactt 780 cgtataatgt atgctatacg aagttatggt accgaattca gtttctggac cttgttgttt 840 tgtcttaagt atcaaagtag aacagtgacc gatatattcc ttttattttt ttttttcttc 900 cctgagactg ggtttctctg tgtagccctt gctgttctgt aactcactct gtgagtggcc 960 tcaaactcag agatccgcct gccttgggca aggaaggtgc tataaaaaga gtctcgtgtg 1020 gtatatgaag tatagtttgt gaaagctgct tcagtgtgag cacacacgca ttatatgcaa 1080 gaccaattgc agcccgaaga atactctaaa aaatgactca ctgcccag 1128 <210> 26 <211> 561 <212> DNA <213> Mouse (Mus musculus) <400> 26 tgttctattt taaagtacag gtaatcatgc atgagaagtc aaaaccttta aaactgtcaa 60 acagtgggct gctgtgtgtg gcatttgctg ccaaccatga caacctaagt tcaacttaag 120 agcccaacaa tggaaaaaga ccccttcaag ttgtcctctg ccatctacac atacaccaaa 180 gcaggacaca ggtatgtaca gaattcataa cttcgtataa tgtatgctat acgaagttat 240 ggtaccgaat tcagtttctg gaccttgttg ttttgtctta agtatcaaag tagaacagtg 300 accgatatat tccttttatt tttttttttc ttccctgaga ctgggtttct ctgtgtagcc 360 cttgctgttc tgtaactcac tctgtgagtg gcctcaaact cagagatccg cctgccttgg 420 gcaaggaagg tgctataaaa agagtctcgt gtggtatatg aagtatagtt tgtgaaagct 480 gcttcagtgt gagcacacac gcattatatg caagaccaat tgcagcccga agaatactct 540 aaaaaatgac tcactgccca g 561

Claims

1. A prosthesis for the treatment of pulmonary fibrosis designed to be placed under a lung lobe as long as the level of mechanical tension on the alveolar epithelium is reduced at the end of normal inspiration, in, The prosthesis includes a main body having an upper side, a lower side, a side extending between the upper side and the lower side, and an inner edge close to the heart, wherein the side is opposite to the inner edge, The prosthesis has a disc shape, an ellipse shape, an irregular U shape, an arc shape, a cone shape, a scapula shape or an irregular shape to occupy the space below the lower lobe of the lung. Wherein, the side surface has a height of 0.5cm-8cm, Wherein, the thickness of the wall of the prosthesis is between 0.1-4 cm, The prosthesis is made of soft sponge latex, foamed latex, 380-micron hollow fiber, gelatin foam material, plastic sponge, polyethylene bag filled with glass fiber, rubber, silicone rubber, silicone gel or carbon material, and the carbon material includes carbon nanotubes, graphene, ultra-light porous carbon, hollow porous carbon, carbon fiber or carbon-titanium alloy.

2. The prosthesis of claim 1, designed to be anchored below a lung lobe and above the diaphragm as long as the mechanical tension of the alveolar epithelium is reduced at the end of normal inspiration.

3. The prosthesis of claim 1, wherein the prosthesis occupies at least 1 / 8 of the space enclosed by the base of the lung lobe, the diaphragm, and the wall of the pleural cavity at the end of normal inspiration.

4. The prosthesis of claim 3, wherein the prosthesis occupies at least 1 / 4 of the space enclosed by the base of the lung lobe, the diaphragm and the wall of the pleural cavity at the end of normal inspiration.

5. The prosthesis of claim 3, wherein the prosthesis occupies at least half of the space enclosed by the base of the lung lobe, the diaphragm, and the wall of the pleural cavity at the end of normal inspiration.

6. The prosthesis of claim 3, wherein the prosthesis occupies at least 3 / 4 of the space enclosed by the base of the lung lobe, the diaphragm and the wall of the pleural cavity at the end of normal inspiration.

7. The prosthesis of claim 3, wherein the prosthesis occupies the entire space enclosed by the base of the lung lobe, the diaphragm and the wall of the pleural cavity at the end of normal inspiration.

8. The prosthesis of claim 3, wherein the prosthesis is surrounded by pleural fluid.

9. The prosthesis of claim 1, wherein the area of ​​the prosthesis projected onto the bottom of the lower lobe occupies at least 1 / 8 of the area of ​​the bottom of the lower lobe.

10. The prosthesis of claim 1, wherein the area of ​​the prosthesis projected onto the bottom of the lower lobe occupies at least 1 / 4 of the area of ​​the bottom of the lower lobe.

11. The prosthesis of claim 1, wherein the area of ​​the prosthesis projected onto the bottom of the lower lobe occupies at least half of the area of ​​the bottom of the lower lobe.

12. The prosthesis of claim 1, wherein the area of ​​the prosthesis projected onto the bottom of the lower lobe occupies at least 3 / 4 of the area of ​​the bottom of the lower lobe.

13. The prosthesis of claim 1, wherein the area of ​​the prosthesis projected onto the bottom of the lower lobe occupies the entire area of ​​the bottom of the lower lobe.

14. The prosthesis of claim 1, wherein the upper side of the prosthesis matches the bottom of a lung lobe.

15. The prosthesis of claim 1, wherein an underside of the prosthesis mates with a diaphragm.

16. The prosthesis of claim 1, wherein the outer surface of the prosthesis mates with the wall of the pleural cavity between the base of the lung lobe and the diaphragm distal to the heart.

17. The prosthesis of claim 1, wherein a superior side of the prosthesis tapers toward a medial edge, and a inferior side of the prosthesis tapers toward a medial edge.

18. The prosthesis of claim 1, wherein the prosthesis has a smooth curved profile without sharp corners to reduce discomfort and avoid damage to the pleura.

19. The prosthesis of claim 1, wherein the side has a height of 0.5 cm, 0.6 cm, 0.7 cm, 0.8 cm, 0.9 cm, 1 cm, 2 cm, 3 cm, 4 cm, 5 cm, 6 cm, 7 cm, or 8 cm.

20. The prosthesis of claim 1, wherein the thickness is 0.1 cm, 0.2 cm, 0.3 cm, 0.4 cm, 0.5 cm, 0.6 cm, 0.7 cm, 0.8 cm, 0.9 cm, 1 cm, 1.1 cm, 1.2 cm, 1.3 cm, 1.4 cm, 1.5 cm, 1.6 cm, 1.7 cm, 1.8 cm, 1.9 cm, 2 cm, 3 cm, or 4 cm.

21. The prosthesis of any one of claims 1-20, wherein the prosthesis is designed to be placed in the pleural cavity to reduce mechanical tension on the alveolar epithelium at the end of normal inspiration.

22. The prosthesis of any one of claims 1-20, wherein the prosthesis is secured within the pleural cavity.

23. The prosthesis of claim 22, wherein the prosthesis is sutured to the wall of the pleural cavity with surgical sutures.

24. The prosthesis of claim 22, wherein the prosthesis is sutured to the pleural cavity wall through a needle hole on the side.

25. The prosthesis of any one of claims 1-20, wherein the prosthesis is a solid, or the prosthesis is a bag or a pack filled with a fluid or a gel.

26. The prosthesis of claim 1, wherein the pulmonary fibrosis is idiopathic pulmonary fibrosis.

27. The prosthesis of claim 2, wherein the prosthesis is designed to mate with the base of a lung lobe.

28. The prosthesis of claim 21, wherein the prosthesis is placed on the inferior side of the pleural cavity.

29. The prosthesis of claim 22, wherein the prosthesis is secured to the underside of the pleural cavity.

30. The prosthesis of claim 23, wherein the prosthesis is sutured to the lower portion of the pleural cavity wall with surgical sutures.

31. Use of the prosthesis according to any one of claims 1 to 30 in preparing a device for treating pulmonary fibrosis.

32. The use of claim 31, comprising placing the prosthesis in the pleural cavity to reduce the level of mechanical tension on the alveolar epithelium at the end of normal inspiration.

33. The use according to claim 32, wherein the prosthesis is fixed in the pleural cavity.

34. The use according to claim 33, wherein the prosthesis is sutured to the wall of the pleural cavity.

35. The use of claim 32, wherein the prosthesis is designed to be placed beneath a lung lobe as long as the level of mechanical tension on the alveolar epithelium is reduced at the end of normal inspiration.

36. The use of claim 32, wherein the prosthesis is designed to be anchored below a lung lobe and above the diaphragm as long as the level of mechanical tension on the alveolar epithelium is reduced at the end of normal inspiration.

37. The use according to claim 31, wherein the pulmonary fibrosis is idiopathic pulmonary fibrosis.

38. The use of claim 32, wherein the prosthesis is placed in the lower part of the pleural cavity.

39. The use of claim 33, wherein the prosthesis is fixed to the lower part of the pleural cavity.

40. The use according to claim 34, wherein the prosthesis is sutured to the lower part of the chest wall.

41. The use of claim 36, wherein the prosthesis is designed to match the base of a lung lobe.

Images