Method for amplifying T cells and its applications

Abstract

The present invention provides a method for amplifying T cells. The method includes activating and culturing T cells that have been subjected to TCR gene silencing treatment, and the activation and culturing are carried out within 24 to 96 hours after the T cells have undergone the TCR gene silencing treatment. The method according to the embodiment of the present invention effectively improves the proliferation ability of T cells after TCR gene knockout. The amplification multiple of T cells is increased by 10 - 25 times compared with the amplification multiple of existing T cells after TCR gene knockout.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a method for expanding T cells and its application, and more specifically to a method for expanding T cells, T cells, and pharmaceutical compositions thereof. Background Technology

[0002] The TCR (T cell receptor) protein is a specific receptor on the surface of T cells, composed of the TCR alpha and beta chains. The CD3 protein is also specifically present on the T cell membrane surface, consisting of six peptide chains. It often binds tightly to the TCR protein to form the TCR-CD3 complex, which contains eight peptide chains. This complex activates T cells by recognizing and binding to antigens presented by MHC (a protein located on the surface of tumor cells, also known as HLA). TCR-CD3 complex membrane localization requires the simultaneous expression of both TCR and CD3. If the TRAC gene (TCRα) or TRBC gene (TCRβ) is knocked out using gene editing technology, the assembly and membrane localization of the TCR-CD3 protein complex are impaired, resulting in cells exhibiting a lack of CD3 and TCR on the cell membrane surface.

[0003] Universal CAR-T (UCAR-T) refers to the process of collecting T cells from a healthy allogeneic donor, genetically modifying them in vitro to create CAR-T cells, which can then be used for infusion therapy in multiple patients. The biggest challenge in universal CAR-T is overcoming graft-versus-host disease (GVHD) after cell transplantation and the donor's rejection of allogeneic T cells. Gene editing technology to knock out GVHD and immune rejection-related genes in CAR-T cells holds promise for overcoming these limitations.

[0004] The preparation of universal CAR-T cells requires the use of gene editing technology to knock out the TCR gene (such as TRAC or TRBC) in CAR-T cells, thereby eliminating graft-versus-host disease caused by allogeneic infusion. However, after the TRAC or TRBC gene is knocked out, the universal cells are CD3+. - / TCR - The inability to stimulate amplification using conventional CD3 / CD28 antibodies or antibody magnetic beads has resulted in the difficulty of amplifying universal CAR-T cells, which greatly restricts the improvement of cell yield.

[0005] Currently, there are no reports in the industry on a universal CAR-T amplification method. Summary of the Invention

[0006] To address the challenge of expanding CAR-T or T cells after TRAC gene or TRBC knockout in existing universal cell therapy technologies, the inventors of this application added CD3 / CD28 stimulants to TRAC gene knockout T or CAR-T cells, exploring the time window during which activation and expansion can still occur after TRAC knockout. This resulted in a method to effectively enhance the proliferation capacity of TRAC gene knockout T or CAR-T cells, achieving a 10-25 fold increase. This method is simple to operate and yields excellent cell expansion results.

[0007] In a first aspect, the present invention provides a method for expanding T cells. According to an embodiment of the invention, the method includes activating and culturing T cells that have undergone TCR gene silencing treatment, said activation and culture being performed within 24 to 96 hours after the T cells have undergone said TCR gene silencing treatment. For example, within 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96 hours. It should be noted that the "TCR gene silencing treatment" described in this application refers to a significant decrease in the expression level of the TCR gene compared to the wild type, including the absence of the TCR protein through TCR gene knockout. The method according to embodiments of the present invention effectively improves the proliferation capacity of T cells after TRAC gene knockout, increasing the fold increase of T cells by 10-25 times compared to existing TRAC gene knockout T cell expansion rates. The "TCR gene" described in this application is at least one of TRAC or TRBC.

[0008] According to embodiments of the present invention, the above method may further include at least one of the following additional technical features:

[0009] According to an embodiment of the present invention, the activation culture is performed by contacting the T cells with a CD3 activator. The inventors have discovered that the TCR-CD3 complex remains on the surface of T cells for 24–96 hours after TCR gene silencing treatment. Stimulating T cells with a CD3 activator within this time window can effectively increase the fold increase in the number of TRAC gene knockout T cells.

[0010] According to an embodiment of the present invention, TCR gene silencing is achieved by introducing a DNA or RNA sequence that silences the TCR into T cells.

[0011] According to embodiments of the present invention, the DNA or RNA sequence of the silenced TCR is provided in the form of plasmid, naked nucleic acid, RNA-protein complex or virus.

[0012] According to embodiments of the present invention, the T-cell activator includes antibodies selected from CD3, CD3 / CD28, and CD3 / CD28 / CD137.

[0013] According to embodiments of the present invention, the T cell activator comprises at least one selected from magnetic beads loaded with CD3 antibodies, magnetic beads loaded with CD3 / CD28 antibodies, and magnetic beads loaded with CD3 / CD28 / CD137 antibodies. Specifically, magnetic beads coated with CD3 and CD28 antibodies (magnetic beads loaded with CD3 / CD28 antibodies), approximately 4.5 μm in size, consistent with the size of T cells, can effectively bind to the CD3 / TCR complex and CD28 protein on the T cell membrane surface, forming an activation effect and resulting in a significant T cell proliferation effect.

[0014] According to embodiments of the present invention, the introduction of the DNA or RNA sequence of the silenced TCR into T cells is performed by electroporation, transfection, or infection. The method according to embodiments of the present invention is applicable to existing nucleic acid transduction techniques, such as electroporation, transfection, or infection, and stimulation of T cells within a time window of 24–96 hours can significantly promote T cell proliferation.

[0015] According to embodiments of the present invention, the introduction of the TCR-silencing DNA or RNA sequence into T cells is performed by electroporation, and when no genome integration occurs after sequence introduction, the activation culture is performed within 24 to 72 hours after plasmid introduction into T cells, preferably 24 to 48 hours. The inventors have discovered that within 24 to 72 hours after the TCR-silencing DNA or RNA sequence is introduced into T cells via electroporation, the TCR-CD3 complex still exists on the surface of the T cells. Stimulating T cells with a CD3 activator during this time window can effectively increase the fold increase in the number of TCR gene knockout T cells.

[0016] According to an embodiment of the present invention, the introduction of the DNA or RNA sequence of the silenced TCR into T cells is performed by electroporation, and when genome integration occurs after sequence introduction, such as when an integration plasmid carrying the sequence is introduced, the activation culture is performed within 24 to 96 hours after the sequence is introduced into the T cells.

[0017] According to an embodiment of the present invention, the introduction of the DNA or RNA sequence of the silenced TCR into T cells is carried out by infection, that is, when the sequence is packaged in a virus and infects T cells in the form of a virus, the activation culture is carried out within 24 to 96 hours after the T cells are infected with the virus.

[0018] According to an embodiment of the present invention, the activation culture time is 70 to 74 hours, preferably 72 hours.

[0019] According to an embodiment of the present invention, the activation culture is performed by contacting the T cells with magnetic beads loaded with CD3 / CD28 antibodies, wherein the ratio of the number of CD3 / CD28 antibody-loaded magnetic beads to the number of T cells is 2:3 to 1:1. The inventors have found that a ratio of 2:3 to 1:1 for CD3 / CD28 antibody-loaded magnetic beads to T cells results in a more significant activation effect on the expansion of T cells after TRAC gene knockout.

[0020] According to an embodiment of the present invention, the activation culture is performed by contacting the T cells with a CD3 / CD28 antibody, wherein the volume ratio of the CD3 / CD28 antibody to the density of the T cells is 25 μL: 1*10^6 / mL, and optionally, the CD3 / CD28 antibody is purchased from STEMCELL.

[0021] According to an embodiment of the present invention, the activation culture is performed by contacting the T cells with CD3 and CD28 antibodies. Before the activation culture, the process further includes coating the cell culture plate with CD3 antibody; optionally, coating the well plate with 1.5-5 μg / mL CD3 antibody, removing excess antibody solution, and adding CD28 antibody to the activation culture system, wherein the final concentration of CD28 antibody is 1 μg / mL.

[0022] According to embodiments of the present invention, the T cells are CAR-T cells, optionally, the T cells are universal CAR-T cells. This effectively solves the problem of the difficulty in expanding universal CAR-T cells and greatly increases cell yield.

[0023] According to an embodiment of the present invention, the method further includes passage culture of the activated cultured cells and CD3-negative T cell enrichment treatment to obtain the T cells.

[0024] According to an embodiment of the present invention, the time from the introduction of the DNA or RNA sequence of the silenced TCR into T cells to the end of the passage culture is 8 to 9 days. The inventors found that after the DNA or RNA sequence of the silenced TCR is introduced into T cells, the cells are cultured for about 9 more days and no longer proliferate, the cell mass reaches its maximum, and the cell viability is greater than 85%.

[0025] In a second aspect, the present invention provides a T cell. According to an embodiment of the invention, the T cell is obtained by expansion using the method described above. The T cell population according to an embodiment of the invention is a CD3- / TCR-T cell population, which, compared to CD3- / TCR-T cell populations obtained by existing methods, exhibits a significantly increased cell number and superior cell condition.

[0026] In a third aspect, the present invention provides a pharmaceutical composition. The pharmaceutical composition according to embodiments of the present invention comprises the aforementioned T cells. The number of immunotherapeutic T cells included in the pharmaceutical composition according to the present invention is significantly higher, enabling its use in the treatment of one or more patients worldwide, thus overcoming the technical barrier of insufficient quantity of existing immunotherapeutic T cells, which prevents large-scale application.

[0027] Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. Attached Figure Description

[0028] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the description of the embodiments taken in conjunction with the following drawings, in which:

[0029] Figure 1 The effects of the addition of magnetic beads and different addition times on CAR-T proliferation after TRAC gene knockout according to embodiments of the present invention are as follows:

[0030] Figure 2 The CD3 expression levels in the experimental and control groups at D16 (10 days after electroporation) according to an embodiment of the present invention;

[0031] Figure 3 This describes the effect of the stimulation process according to embodiments of the present invention on changes in the CAR+ ratio of CAR-T cells;

[0032] Figure 4 The changes in CD3 in CAR-T cells before D6 electroporation, 24 hours and 72 hours after electroporation, according to an embodiment of the present invention;

[0033] Figure 5 The embodiment of the present invention shows the CD3- ratio in D14 (day 8 after electroporation) CAR-T cells;

[0034] Figure 6 The effects of the addition or absence of magnetic beads and different addition times according to embodiments of the present invention on the proliferation and viability of T cells after TRAC gene knockout; and

[0035] Figure 7 This describes the CD3 expression of T cells at D16 after stimulation amplification according to an embodiment of the present invention. Detailed Implementation

[0036] Embodiments of the present invention are described in detail below, examples of which are illustrated in the accompanying drawings, wherein the same or similar reference numerals denote the same or similar elements or elements having the same or similar functions throughout. The embodiments described below with reference to the accompanying drawings are exemplary and intended to explain the present invention, and should not be construed as limiting the present invention.

[0037] Furthermore, the terms "first" and "second" are used for descriptive purposes only and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one of that feature. In the description of this invention, "a plurality of" means at least two, such as two, three, etc., unless otherwise explicitly specified.

[0038] The present invention will now be described with reference to specific embodiments. It should be noted that these embodiments are merely descriptive and do not limit the present invention in any way.

[0039] The English abbreviations used in the following embodiments are as follows:

[0040] GlutaMAX-1 glutamine

[0041] IL7 (interleukin-7)

[0042] IL15 Interleukin-15

[0043] IL21 interleukin-21

[0044] CAR-T chimeric antigen receptor T cells

[0045] Dynabeads Human T-Activator CD3 / CD28 Anti-CD3 / CD28 Beads

[0046] SR serum substitutes

[0047] Example 1

[0048] I. Experimental Materials

[0049] Cell: Human T cell.

[0050] Reagents: CTS OpTmizer T-Cell Expansion SFM (RUO) serum-free medium, Dynabeads Human T-Activator CD3 / CD28, Lonza electroporation kit (P3 Primary Cell 4D-Nucleofector) TMXKit), Human IL-21, Human IL-7, human IL-15, Polybrene, GlutaMAX-1 (100X), Cas9 protein (TrueCut TM Cas9 Protein v2), gRNA synthesis kit (GeneArt Precision gRNA Synthesis Kit), serum substitute CTS TM Immune Cell SR, Lentiviral;

[0051] Culture medium:

[0052] T cell culture medium: CTS OpTmizer T-Cell Expansion SFM (RUO) serum-free medium + 1% CTS Immune Cell SR + 1% GlutaMAX-1 (100X) + Human IL-7 (final concentration 40U / ml) + Human IL-15 (final concentration 40U / ml) + Human IL-21 (final concentration 40U / ml).

[0053] Equipment: Cell culture incubator (Thermo 150i), laminar flow hood (Suzhou Antai), Beckman centrifuge (X-15R), cell counter (Countstar), inverted microscope (Leica DM IL LED), 4°C freezer (Haier HYC390), -20°C freezer (Haier), negative pressure aspirator (Yuwell), pipette (Eppendorf), BD flow cytometer (BD Vertebrate), ice maker, Lonza 4D-Nucleofector TM Nuclear converter), DynaMag-15 magnetic rack.

[0054] II. Experimental Methods

[0055] 1. T cell activation culture

[0056] (1) Count freshly isolated T cells or resuscitated T cells (hemocytometer method or AO / PI fluorescence counting method);

[0057] (2) Freshly isolated 2*10^6 T cells were resuspended in 2 mL of T cell culture medium and then 50 μL of anti-CD3 / CD28 (Dynabeads Human T-Activator CD3 / CD28 for T Cell Expansion and Activation) was added and cultured in a 37℃ 5% CO2 incubator.

[0058] (3) On the second day, add 2ml of T cell culture medium. On the third day, remove the magnetic beads using a DynaMag-15 magnetic rack and count the cells.

[0059] 2. Preparation of CAR-T cells by lentivirus transfection

[0060] (1) After counting the cells, 7*10^6 T cells were transfected.

[0061] (2) Prepare the following virus infection system in a 24-well plate: 1*10^6 live cells per well + 0.32μL polybrene (stock solution concentration 10μg / μl) + 400μL T cell culture medium + virus solution (volume not exceeding 100μl, MOI = 1-2). Transfect cells in 7-well plates.

[0062] (3) Place the culture plate in a centrifuge, centrifuge at 1000g horizontally at room temperature for 40 minutes, and then place it in an incubator to incubate overnight.

[0063] (4) After the cells and virus were co-incubated for 15-24 hours, the cells were collected, centrifuged at 300g for 5 minutes, counted, and inoculated at a density of 10^6 / ml. The culture medium was T cell culture medium.

[0064] 3. Detection of T-cell lentiviral transfection efficiency

[0065] (1) On the third day after cell infection with the virus, cells were collected, 300g, RT, 10min, and centrifuged for counting.

[0066] (2) Collect some cells and use flow cytometry to detect the expression of CAR protein.

[0067] 4. CAR-T cell electroporation knockout of TRAC.

[0068] The custom spacer sequence for the first 20 nucleotides of the gRNA is TGTGCTAGACATGAGGTCTA (SEQ ID NO:1), and the target site sequence is TGTGCTAGACATGAGGTCTATGG (SEQ ID NO:2). The gRNA was obtained by in vitro transcription using a kit.

[0069] (1) After counting, determine the number of wells that need to be electroporated, dispense 1.5 mL of culture medium into 12-well plates, and preheat in a 37°C incubator for half an hour in advance;

[0070] (2) Using P3 Primary Cell 4D-Nucleofector TMX kit preparation of electroporation buffer (100 μL system): 82 μL of primary cell solution + 18 μL of supplement solution, mix well and set aside.

[0071] (3) Preparation of RNP (nucleic acid protein complex): Add 6 μg cas9 protein to 5 μL electroporation buffer, then add 6 μg gRNA (TRAC target), and incubate at room temperature for 10 min;

[0072] (4) The cells were aliquoted into 1.5ml EP tubes, centrifuged at 100g, RT, for 10min and the supernatant was discarded.

[0073] (5) Electroporation: Electroporation was performed on day 6 of culture. The steps were as follows: Resuspend the cells (5*10^6) in 95 μL of electroporation buffer, add it to an RNP incubation tube, mix well, transfer to an electroporation cuvette, electroporate the cells, and then transfer them to a 12-well plate pre-incubated with 1.5 ml of culture medium. The plate was then placed in a CO2 incubator for culture. A total of 12 wells of cells were electroporated.

[0074] 5. Cell proliferation after CAR-T electroporation

[0075] Twenty-four hours after electroporation, cells were collected at 100g for 10 minutes for cell counting and viability testing. Cells were then seeded in T-cell culture medium at a density of 10^6 cells / ml. Magnetic beads were added to each experimental group at different time points, while no magnetic beads were added to the control group.

[0076] Experimental Group-1:

[0077] (1) 24 hours after electroporation, take 1*10^6 CAR-T cells, resuspend them in 1ml T cell culture medium, add 25μL of anti-CD3 / CD28 (Dynabeads Human T-Activator CD3 / CD28 for T Cell Expansion and Activation) (25μl of magnetic beads is 1*10^6, which is equal to the ratio of magnetic beads to cells of 1:1), mix well, and incubate at 37℃ in a 5% CO2 incubator.

[0078] (2) 72 hours after electroporation, the magnetic beads were removed using a DynaMag-15 magnetic rack and the cells were cultured.

[0079] (3) Continue culturing until day 7 after electroporation, and count cells during the process.

[0080] Experimental Group-2:

[0081] (1) 24 hours after electroporation, take 1*10^6 CAR-T cells, resuspend them in 1 mL of T cell culture medium, and incubate at 37°C in a 5% CO2 incubator.

[0082] (2) 48 hours after electroporation, add 25 μL of anti-CD3 / CD28 (Dynabeads Human T-Activator CD3 / CD28 for T Cell Expansion and Activation), mix well,

[0083] (3) 72 hours after electroporation, the magnetic beads were removed using a DynaMag-15 magnetic rack and the cells were cultured.

[0084] (4) Continue culturing until day 7 after electroporation, and count cells during the process.

[0085] Experimental group-3

[0086] 72 hours after electroporation, 25 μL of anti-CD3 / CD28 (Dynabeads Human T-Activator CD3 / CD28 for T Cell Expansion and Activation) was added and mixed. It was found that the CD3 residue had been completely degraded and the magnetic beads could no longer stimulate TRAC knockout CAR-T cells, but could only stimulate TRAC non-knockout CAR-T cells.

[0087] Experimental group-4

[0088] Within 24 hours after electroporation, 25 μL of anti-CD3 / CD28 (Dynabeads Human T-Activator CD3 / CD28 for T Cell Expansion and Activation) was added, mixed, and cultured. The cell viability was found to decrease significantly, showing a viability of less than 20%.

[0089] Control group:

[0090] (1) 24 hours after electroporation, take 1*10^6 CAR-T cells, resuspend them in 1mL of T cell culture medium, and incubate them at 37℃ in a 5% CO2 incubator.

[0091] (2) Continue culturing until day 10 after electroporation, and count cells during the process.

[0092] Compare the cell growth curves and changes in CD3- ratio between the experimental and control groups.

[0093] III. Experimental Results and Conclusions

[0094] Figure 1 The study showed the effects of magnetic bead addition and different addition times on CAR-T proliferation after TRAC gene knockout (Note: D7 is 24 hours after cell electroporation, i.e., the first day after electroporation). Figure 2 The results show the CD3 expression in the experimental and control groups at D16 (10 days after electroporation). There was no significant difference in the CD3- ratio between the control and experimental groups. The CD3- ratios in experimental group-1, experimental group-2 and control group were 44.9%, 48.09% and 48.80%, respectively.

[0095] Conclusion: Magnetic bead stimulation does not change the CD3- ratio in the cell population. After 10 days of culture, the cell proliferation rate increases by 15-22 times (D16 compared to D7). Adding the bead 24 hours or 48 hours after electroporation is effective.

[0096] Example 2

[0097] CAR-T proliferation after TRAC knockout

[0098] I. Experimental Materials

[0099] Cells: T cells isolated from human PBMCs.

[0100] Reagents: CTS OpTmizer T-Cell Expansion SFM (RUO) serum-free medium, Dynabeads Human T-Activator CD3 / CD28, PBS, DAPI, Human IL-21, Human IL-7, Human IL-15, polybrene, GlutaMAX-1 (100X), Cas9 protein, gRNA, serum substitute CTS TM Immune Cell SR;

[0101] Equipment: Cell culture incubator (Thermo 150i), laminar flow hood (Suzhou Antai), Beckman centrifuge (X-15R), cell counter (Countstar), inverted microscope (Leica DM IL LED), 4°C freezer (Haier HYC390), -20°C freezer (Haier), negative pressure aspirator (Yuwell), pipette (Eppendorf), BD flow cytometer, ice maker, Lonza electroporator

[0102] II. Experimental Methods

[0103] I. Experimental Materials

[0104] Cell: Human T cell.

[0105] Reagents: CTS OpTmizer T-Cell Expansion SFM (RUO) serum-free medium, Dynabeads Human T-Activator CD3 / CD28, Lonza electroporation kit (P3 Primary Cell 4D-Nucleofector) TM XKit), Human IL-21, Human IL-7, human IL-15, Polybrene, GlutaMAX-1 (100X), Cas9 protein (TrueCut TM Cas9 Protein v2), gRNA synthesis kit (GeneArt Precision gRNA Synthesis Kit), serum substitute CTS TM Immune Cell SR, Lentiviral;

[0106] Culture medium:

[0107] T cell culture medium: CTS OpTmizer T-Cell Expansion SFM (RUO) serum-free medium + 1% CTS Immune Cell SR + 1% GlutaMAX-1 (100X) + Human IL-7 (final concentration 40U / ml) + Human IL-15 (final concentration 40U / ml) + Human IL-21 (final concentration 40U / ml).

[0108] Equipment: Cell culture incubator (Thermo 150i), laminar flow hood (Suzhou Antai), Beckman centrifuge (X-15R), cell counter (Countstar), inverted microscope (Leica DM IL LED), 4°C freezer (Haier HYC390), -20°C freezer (Haier), negative pressure aspirator (Yuwell), pipette (Eppendorf), BD flow cytometer (BD Vertebrate), ice maker, Lonza 4D-Nucleofector TM Nuclear converter), DynaMag-15 magnetic rack.

[0109] II. Experimental Methods

[0110] 1. T cell activation culture

[0111] (1) Count freshly isolated T cells or resuscitated T cells (hemocytometer method or AO / PI fluorescence counting method);

[0112] (2) Freshly isolated 2*10^6 T cells were resuspended in 2 ml of T cell culture and then 50 μL of anti-CD3 / CD28 (Dynabeads Human T-Activator CD3 / CD28 for T Cell Expansion and Activation) was added and cultured in a 37℃ 5% CO2 incubator.

[0113] (3) On the second day, add 2ml of T cell culture medium. On the third day, remove the magnetic beads using a DynaMag-15 magnetic rack and count the cells.

[0114] 2. Preparation of CAR-T cells by lentivirus transfection

[0115] (1) After counting the cells, 7*10^6 T cells were transfected.

[0116] (2) Prepare the following virus infection system in a 24-well plate: 1*10^6 live cells per well + 0.32μL polybrene (stock solution concentration 10μg / μl) + 400μL T cell culture medium + virus solution (volume not exceeding 100μL, MOI 1-2). Transfect cells in 7-well plates.

[0117] (3) Place the culture plate in a centrifuge, centrifuge at 1000g horizontally at room temperature for 40 minutes, and then place it in an incubator to incubate overnight.

[0118] (4) After co-incubating the cells with the virus for 15-24 hours, collect the cells, centrifuge at 300g for 5 minutes, count the cells, and inoculate them at a density of 10^6 / ml in T cell culture medium.

[0119] 3. Detection of T-cell lentiviral transfection efficiency

[0120] (1) On the third day after cell infection with the virus, cells were collected, 300g, RT, 10min, and centrifuged for counting.

[0121] (2) Collect some cells and use flow cytometry to detect the expression of CAR protein.

[0122] 4. Electroporation of CAR-T cells to knock out the TRAC gene

[0123] The custom spacer sequence for the first 20 nucleotides of the gRNA is TGTGCTAGACATGAGGTCTA (SEQ ID NO:1), and the target site sequence is TGTGCTAGACATGAGGTCTA. TGG (SEQ ID NO:2) gRNA was obtained through in vitro transcription using a kit.

[0124] (1) After counting the cells, determine the number of wells to be electroporated, dispense 1.5 ml of culture medium into 12-well plates, and preheat the plates in a 37°C incubator for half an hour in advance.

[0125] (2) Using P3 Primary Cell 4D-Nucleofector TM X kit preparation of electroporation buffer (100 μL system): 82 μL of primary cell solution + 18 μL of supplement solution, mix well and set aside.

[0126] (3) Preparation of RNP (nucleic acid protein complex): Add 6 μg cas9 protein to 5 μL electroporation buffer, then add 6 μg gRNA (target: TRAC gene site), and incubate at room temperature for 10 min;

[0127] (4) The cells were aliquoted into 1.5ml EP tubes, centrifuged at 100g, RT, for 10min and the supernatant was discarded.

[0128] (5) Electroporation: Electroporation was performed on day 6 of culture. The steps were as follows: Resuspend the cells (5*10^6) in 95 μl of electroporation buffer, add it to an RNP incubation tube, mix well, transfer to an electroporation cuvette, electroporate the cells, and then transfer them to a 12-well plate pre-incubated with 1.5 ml of culture medium. The plate was then placed in a CO2 incubator for culture. A total of 12 wells were electroporated, with a total cell volume of 6*10^7.

[0129] 5. Cell proliferation after CAR-T electroporation

[0130] 24 hours after electroporation, cells were collected at 100g for 10 minutes, and cell counting and viability were performed. The cells were then cultured in T cell culture medium at a density of 10^6 cells / ml.

[0131] (1) Add 10 μl of anti-CD3 / CD28 magnetic beads (Dynabeads Human T-Activator CD3 / CD28 for T Cell Expansion and Activation) to every 10^6 live cells according to the number of live cells (the ratio of the number of magnetic beads to the number of cells is 2:3), mix well, and incubate at 37°C in a 5% CO2 incubator.

[0132] (2) 72 hours after electroporation, the magnetic beads were removed using a DynaMag-15 magnetic rack and the cells were cultured.

[0133] (3) Continue culturing until day 10 after electroporation, and perform cell technology in the middle of the process.

[0134] Record cell growth curves and changes in the percentage of CD3-negative cells before and after stimulation.

[0135] III. Experimental Results and Conclusions

[0136] Table 1: Cell count and viability records after electroporation

[0137]

[0138] Figure 3 This demonstrates the effect of stimulation on changes in the CAR+ ratio of CAR-T cells; Figure 4 The changes in CD3 levels in CAR-T cells were shown before D6 electroporation, and at 24 and 72 hours after electroporation. The results showed that CD3 levels were higher at 24 hours after electroporation. + At approximately 89.42%, a large amount of CD3 membrane protein remained in TRAC knockout CAR-T cells 24 hours after electroporation, and the residual CD3 membrane protein was completely degraded 72 hours after electroporation. Figure 5 This shows the CD3+ level in CAR-T cells at D14 (day 8 after electroporation). - The ratio is 52.36%.

[0139] Conclusion: Adding 10 μL of anti-CD3 / CD28 magnetic beads per 10^6 live cells did not change the CAR ratio in the cell population, and the cell proliferation was 11-fold on day 14 compared to day 7 (i.e., day 8 after electroporation compared to day 1 after electroporation).

[0140] Example 3

[0141] CD3-T proliferation after TRAC knockout stimulated by magnetic beads

[0142] I. Experimental Materials

[0143] Cell: Human T cell.

[0144] Reagents: CTS OpTmizer T-Cell Expansion SFM (RUO) serum-free medium, Dynabeads Human T-Activator CD3 / CD28, Lonza electroporation kit (P3 Primary Cell 4D-Nucleofector) TM XKit), Human IL-21, Human IL-7, human IL-15, GlutaMAX-1 (100X), Cas9 protein (TrueCut TM Cas9 Protein v2), gRNA synthesis kit (GeneArt Precision gRNA Synthesis Kit), serum substitute CTS TMImmune Cell SR;

[0145] Culture medium:

[0146] T cell culture medium: CTS OpTmizer T-Cell Expansion SFM (RUO) serum-free medium + 1% CTSImmune Cell SR + 1% GlutaMAX-1 (100X) + Human IL-7 (final concentration 40 U / ml) + Human IL-15 (final concentration 40 U / ml) + Human IL-21 (final concentration 40 U / ml)

[0147] Equipment: Cell culture incubator (Thermo 150i), laminar flow hood (Suzhou Antai), Beckman centrifuge (X-15R), cell counter (Countstar), inverted microscope (Leica DM IL LED), 4°C freezer (Haier HYC390), -20°C freezer (Haier), negative pressure aspirator (Yuwell), pipette (Eppendorf), BD flow cytometer (BD Vertebrate), ice maker, Lonza 4D-Nucleofector TM Nuclear transfer instrument), DynaMag-15 magnetic rack

[0148] II. Experimental Methods

[0149] 1. T cell activation culture

[0150] (1) Count freshly isolated T cells or resuscitated T cells (hemocytometer method or AO / PI fluorescence counting method);

[0151] (2) Freshly isolated 2*10^6 T cells were resuspended in 2 ml of T cell culture and then 50 μL of anti-CD3 / CD28 (Dynabeads Human T-Activator CD3 / CD28 for T Cell Expansion and Activation) was added and cultured in a 37℃ 5% CO2 incubator.

[0152] (3) On the second day, add 2ml of T cell culture medium. On the third day, remove the magnetic beads using a DynaMag-15 magnetic rack and count the cells.

[0153] 2. T cell electroporation, knockout of the TRAC gene

[0154] The custom spacer sequence for the first 20 nucleotides of the gRNA is TGTGCTAGACATGAGGTCTA (SEQ ID NO:1), and the target site sequence is TGTGCTAGACATGAGGTCTA. TGG (SEQ ID NO:2) gRNA was obtained through in vitro transcription using a kit.

[0155] (1) After counting, determine the number of wells that need to be electroporated, dispense 1.5 ml of culture medium into 12-well plates, and preheat in a 37°C incubator for half an hour in advance;

[0156] (2) Using P3 Primary Cell 4D-Nucleofector TM Preparation of electroporation buffer (100 μL system) for kit X: 82 μL of primary cell solution + 18 μL of supplement solution, mix well and set aside.

[0157] (3) Preparation of RNP (nucleic acid protein complex): Add 6 μg cas9 protein to 5 μL electroporation buffer, then add 6 μg gRNA (TRAC target), and incubate at room temperature for 10 min;

[0158] (4) The cells were aliquoted into 1.5ml EP tubes, centrifuged at 100g, RT, for 10min and the supernatant was discarded.

[0159] (5) Electroporation: Electroporation was performed on day 6 of culture. The steps were as follows: Resuspend the cells (5*10^6) in 95 μL of electroporation buffer, add it to an RNP incubation tube, mix well, transfer to an electroporation cuvette, electroporate the cells, and then transfer them to a 12-well plate pre-incubated with 1.5 mL of culture medium. The plate was then placed in a CO2 incubator for culture. A total of 4 wells of cells were electroporated.

[0160] 5. T cell proliferation

[0161] Experimental group (T-CIP+Beads group):

[0162] (1) 24 hours after electroporation, take 6*10^6 electroporated T cells, resuspend them in 6 ml of T cell culture medium, and add 25 μl of anti-CD3 / CD28 magnetic beads (Dynabeads Human T-Activator CD3 / CD28 for T Cell Expansion and Activation) per 10^6 cells, i.e., add 150 μl of magnetic beads. After mixing, incubate at 37℃ in a 5% CO2 incubator.

[0163] (2) 72 hours after electroporation, the magnetic beads were removed using a DynaMag-15 magnetic rack and the cells were cultured.

[0164] (3) Continue culturing until day 7 after electroporation, and count cells during the process.

[0165] Control group-1 (T+beads group):

[0166] (1) 24 hours after electroporation, take 6*10^6 unelectroporated T cells, resuspend them in 6 ml of T cell culture medium, and add 25 μl of anti-CD3 / CD28 magnetic beads (Dynabeads Human T-Activator CD3 / CD28 for T Cell Expansion and Activation) per 10^6 cells, i.e., add 150 μl of magnetic beads. After mixing, incubate at 37℃ in a 5% CO2 incubator.

[0167] (2) 48 hours later, i.e. 72 hours after electroporation, the magnetic beads were removed using a DynaMag-15 magnetic rack and the cells were cultured.

[0168] (4) Continue culturing until the 7th day after electroporation, and measure cell viability during the process.

[0169] Control group-2 (T group):

[0170] (1) 24 hours after electroporation, take 6*10^6 T cells that have not been electroporated, resuspend them in 6ml of T cell culture medium and culture them.

[0171] (2) Continue culturing until the 7th day after electroporation, and measure cell viability during the process.

[0172] III. Experimental Results and Conclusions

[0173] Figure 6 The study showed the effect of the addition of magnetic beads on T cell proliferation and viability after TRAC gene knockout (Note: D7 is 24 hours after cell electroporation). Results showed that cells expanded 21-fold on D16 compared to D7. Although secondary stimulation with beads caused a decrease in cell viability (e.g., on D9, two days after the second bead addition on D7), cell viability gradually increased with continued culture, returning to normal on D13, comparable to the cell viability of control groups-1 and-2.

[0174] Figure 7 The study showed the CD3 expression of T cells at D16 after stimulation and expansion.

[0175] Conclusion: Electroporation followed by magnetic bead stimulation can effectively expand TRAC knockout T cells, increasing their proliferation by 21-fold. In the later stages of proliferation, the CD3- level of the cells did not change significantly.

[0176] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0177] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention. SEQUENCE LISTING <110> Guangdong Dongyangguang Pharmaceutical Co., Ltd. <120> Methods for expanding T cells and their applications <130> PIDC4200236 <160> 2 <170> PatentIn version 3.5 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Custom spacer sequence of the first 20 nucleotides in gRNA <400> 1 tgtgctagac atgaggtcta 20 <210> 2 <211> twenty three <212> DNA <213> Artificial Sequence <220> <223> Target site sequence <400> 2 tgtgctagac atgaggtcta tgg 23

Claims

1. A method for expanding T cells, characterized in that, The T cells treated by TCR gene silencing are activated and cultured, and the activation culture is carried out within 24 to 96 hours after the TCR gene silencing treatment of the T cells; The activation culture is carried out by contacting the T cells with a T cell activator; The T cell activator includes at least one selected from CD3 / CD28 antibody, CD3 / CD28 / CD137 antibody, magnetic beads loaded with CD3 / CD28 antibody, or magnetic beads loaded with CD3 / CD28 / CD137 antibody; The TCR gene silencing treatment is achieved by introducing a sequence of DNA or RNA that silences TRAC into the T cells.

2. The method according to claim 1, characterized in that, The sequence of DNA or RNA that silences TRAC is provided in the form of a plasmid, naked nucleic acid, RNA-protein complex, or virus.

3. The method according to claim 1, characterized in that The introduction of the sequence of DNA or RNA that silences TRAC into the T cells is carried out by electroporation, transfection, or infection.

4. The method according to claim 3, characterized in that The introduction of the sequence of DNA or RNA that silences TRAC into the T cells is carried out by electroporation, and the activation culture is carried out within 24 to 72 hours after the TCR gene silencing treatment.

5. The method according to claim 4, wherein The activation culture is carried out within 24 to 48 hours after the TCR gene silencing treatment.

6. The method according to claim 1, wherein The time of the activation culture is 70 to 74 hours.

7. The method according to claim 6, wherein The time of the activation culture is 72 hours.

8. The method according to claim 1, wherein The activation culture is carried out by contacting the T cells with magnetic beads loaded with CD3 / CD28 antibody, and the ratio of the number of magnetic beads loaded with CD3 / CD28 antibody to the number of T cells is 2:3 to 1:

1.

9. The method according to claim 1, characterized in that, The activation culture is carried out by contacting the T cells with CD3 / CD28 antibody, and the ratio of the volume of CD3 / CD28 antibody to the density of T cells is 25 μL: 1×10^6 cell / mL.

10. The method according to claim 1, characterized in that, The activation culture is carried out by contacting the T cells with CD3 and CD28 antibodies. Before the activation culture, it further includes coating the cell culture plate with CD3 antibody.

11. The method according to claim 10, wherein The well plate is coated with 1.5 - 5 μg / mL CD3 antibody.

12. The method according to claim 10, characterized in that, In the activation culture system, the concentration of CD28 antibody is 1 μg / mL.

13. The method according to claim 1, wherein The T cells are CART cells.

14. The method according to claim 13, wherein The T cells are universal CART cells.

15. The method according to claim 1, wherein It further includes subculturing the cells after activation culture and enriching CD3-negative T cells to obtain the T cells.

16. The method according to claim 1, characterized in that, The time from the introduction of the sequence of DNA or RNA that silences TRAC into the T cells to the end of subculturing is 8 to 9 days.

Images