TAU pathological targeting ligand

Abstract

This application describes methods and compositions for detecting tau pathology. The composition for detecting tau pathology comprises a targeting ligand that specifically binds to a tau pathology cell surface marker, wherein the targeting ligand is linked to a liposome comprising an imaging agent. The composition can be used in a method for imaging tau pathology in a subject, the method comprising administering an effective amount of the composition to the subject and imaging at least one site of the subject to determine whether the site exhibits tau pathology. The composition can also be used to detect tau pathology in a biological sample obtained from a subject.

Description

[0001] Cross - Reference to Related Applications

[0002] This application claims priority to U.S. Provisional Patent Application No. 62 / 871,380, filed Jul. 8, 2019, which is hereby incorporated by reference in its entirety.

[0003] Sequence Listing

[0004] The Sequence Listing is submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. A copy of the ASCII formatted file was created on Jul. 7, 2020, named “Alzeca-122_Sequence Listing_PCT_ST25.txt” and is 47,652 bytes in size. BACKGROUND OF THE INVENTION

[0005] The pathogenesis of tauopathies such as Alzheimer's disease (AD) mainly involves the microtubule-associated protein tau. The tau protein is encoded by the MAPT gene. Alternative splicing generates six tau protein isoforms that differ in the regulation of two inserts near the N-terminus (0N, 1N, 2N) and three or four repeats (3R, 4R) corresponding to conserved microtubule-binding regions near the C-terminus. The 4R:3R ratio of mRNA to protein in normal brain tissue is close to 1:1, but increases in pathological conditions.

[0006] Several molecular changes induce tau pathogenesis: phosphorylation, acetylation, ubiquitination, ubiquitin-like modification, glycation, nitration, and truncation. However, all of these molecular changes are associated with abnormal phosphorylation, leading to the conclusion that abnormal phosphorylation is the first step in tau pathology formation. Abnormal phosphorylation of the tau protein results in the formation of paired helical filaments, which constitute most of the neurofibrillary tangles found in degenerating neuronal cells in the pathogenesis of Alzheimer's disease. Neurofibrillary tangles, together with amyloid plaques, constitute the two major pathological features of Alzheimer's disease.

[0007] According to the latest criteria supported by the National Institute on Aging and the Alzheimer's Association, the diagnosis of Alzheimer's disease requires pathological amyloid and tau proteins (A+, T+), where amyloid is measured by an approved PET imaging agent and tau is measured by the imaging agent or cerebrospinal fluid (CSF) levels. As the disease progresses, the time-course study of key biomarkers such as amyloid PET and CSF tau has a long history. The latest consensus indicates that the pathological level of tau lags behind that of amyloid by several years. When a significant increase in both markers can be detected by conventional methods, the disease is usually in an advanced stage. In addition, although the identification of amyloid plaques by PET tracers is objective and clear, tau protein markers in CSF and blood are interfered by many other factors, including other diseases and treatments that patients may be receiving. The proteomic analysis of serum biomarkers by artificial intelligence has recently attracted great interest, but its accuracy is still not high compared to the PET gold standard.

[0008] Early indicators of tau pathology may enable the diagnosis of Alzheimer's disease to be made several years earlier, potentially in the pre-symptomatic stage. Summary of the Invention

[0009] Provided is a composition for identifying tau pathology, the composition comprising a targeting ligand that specifically binds to a tau pathology cell surface marker, wherein the targeting ligand is linked to a liposome comprising an imaging agent, such as a magnetic resonance imaging (MRI) contrast enhancer. In some aspects, the targeting ligand comprises an aptamer or a stabilized aptamer. In some aspects, the targeting ligand comprises a thiolated aptamer. In some aspects, the targeting ligand comprises a DNA nucleotide sequence selected from one or more of the following sequences: Tau_1 (SEQ ID NO:5), Tau_3 (SEQ ID NO:6), Tau_9 (SEQ ID NO:7), Tau_11 (SEQ ID NO:8), Tau_10 (SEQ ID NO:9), Tau_13 (SEQ ID NO:10), Tau_8 (SEQ ID NO:11), Tau_4 (SEQ ID NO:12), Tau_17 (SEQ ID NO:13), Tau_5 (SEQ ID NO:14), Tau_21 (SEQ IDNO:15), Tau_25 (SEQ ID NO:16), Tau_7 (SEQ ID NO:17), Tau_31 (SEQ ID NO:18), Tau_42 (SEQ ID NO:19), Tau_14 (SEQ ID NO:20), Tau_19 (SEQ ID NO:21), Tau_15 (SEQ ID NO:22), Tau_56 (SEQ ID NO:23), Tau_34 (SEQ ID NO:24), Tau_23 (SEQ ID NO:25), Tau_99 (SEQID NO:26), and Tau_102 (SEQ ID NO:27). In some aspects, the tau pathology cell surface marker comprises a cell surface marker of hyperphosphorylated tau protein. In some aspects, the tau pathology cell surface marker comprises a protein selected from keratin 6A (KRT6A), keratin 6B (KRT6B), heat shock protein (HSP), and vimentin (VIM). In some aspects, the systematic evolution of ligands by exponential enrichment (SELEX) method is used to determine the specific binding of the targeting ligand to the tau pathology cell surface marker. In some aspects, the targeting ligand is linked to polyethylene glycol, and the polyethylene glycol is conjugated to a phospholipid that binds to the liposome. In some aspects, the liposome consists of a membrane comprising: a first phospholipid; a sterically bulky excipient capable of stabilizing the liposome; a second phospholipid derived from a first polymer; a third phospholipid derived from a second polymer conjugated to the targeting ligand; an imaging agent encapsulated by or bound to the membrane.

[0010] Also provided is a method for tau pathology imaging of a subject, the method comprising: administering to the subject a detectable effective amount of a targeting ligand-liposome conjugate, the conjugate comprising a targeting ligand that specifically binds to a tau pathology cell surface marker, wherein the targeting ligand is conjugated to a liposome comprising an imaging agent; imaging at least one site of the subject to determine whether the site exhibits tau pathology. In some aspects, the site comprises a portion of the subject's brain. In some aspects, the imaging shows a tau pathology level sufficient to diagnose the subject with early Alzheimer's disease. In some aspects, the method further comprises providing prophylaxis or treatment for Alzheimer's disease in the subject. In some aspects, the imaging agent is an MRI contrast enhancer, and the binding level is determined by MRI.

[0011] Also provided is a method for detecting tau pathology, the method comprising: contacting a biological sample with an effective amount of a targeting ligand-liposome conjugate, the conjugate comprising a targeting ligand that specifically binds to a tau pathology cell surface marker, wherein the targeting ligand is conjugated to a liposome comprising a detectable label; washing the biological sample to remove unbound targeting ligand-liposome conjugate; detecting the tau pathology of the biological sample by measuring the amount of detectable label remaining in the biological sample. In some aspects, the biological sample is a sample containing nerve cells.

[0012] Also provided is a targeting composition, the targeting composition comprising: a phospholipid linked to a polymer, the polymer being linked to a targeting ligand that specifically binds to a tau pathological cell surface marker. In some aspects, the targeting ligand is an aptamer or a stabilized aptamer. In some aspects, the targeting ligand is a thiolaptamer. In some aspects, the aptamer or stabilized aptamer comprises a DNA nucleotide sequence selected from one or more of the following sequences: Tau_1 (SEQ ID NO:5), Tau_3 (SEQ ID NO:6), Tau_9 (SEQ ID NO:7), Tau_11 (SEQ ID NO:8), Tau_10 (SEQ ID NO:9), Tau_13 (SEQ ID NO:10), Tau_8 (SEQ ID NO:11), Tau_4 (SEQ ID NO:12), Tau_17 (SEQ ID NO:13), Tau_5 (SEQ ID NO:14), Tau_21 (SEQ ID NO:15), Tau_25 (SEQ ID NO:16), Tau_7 (SEQID NO:17), Tau_31 (SEQ ID NO:18), Tau_42 (SEQ ID NO:19), Tau_14 (SEQ ID NO:20), Tau_19 (SEQ ID NO:21), Tau_15 (SEQ ID NO:22), Tau_56 (SEQ ID NO:23), Tau_34 (SEQ ID NO:24), Tau_23 (SEQ ID NO:25), Tau_99 (SEQ ID NO:26) and Tau_102 (SEQ ID NO:27).

[0013] Also provided is an aptamer or a stabilized aptamer, the aptamer or the stabilized aptamer comprising a DNA nucleotide sequence selected from one or more of the following sequences: Tau_1 (SEQ ID NO:5), Tau_3 (SEQ ID NO:6), Tau_9 (SEQ ID NO:7), Tau_11 (SEQ ID NO:8), Tau_10 (SEQ ID NO:9), Tau_13 (SEQ ID NO:10), Tau_8 (SEQ ID NO:11), Tau_4 (SEQ ID NO:12), Tau_17 (SEQ ID NO:13), Tau_5 (SEQ ID NO:14), Tau_21 (SEQ ID NO:15), Tau_25 (SEQ ID NO:16), Tau_7 (SEQ ID NO:17), Tau_31 (SEQ ID NO:18), Tau_42 (SEQ ID NO:19), Tau_14 (SEQ ID NO:20), Tau_19 (SEQ ID NO:21), Tau_15 (SEQ ID NO:22), Tau_56 (SEQ ID NO:23), Tau_34 (SEQ ID NO:24), Tau_23 (SEQ ID NO:25), Tau_99 (SEQ ID NO:26), and Tau_102 (SEQ ID NO:27). BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The present invention is more readily understood in conjunction with the following drawings, in which:

[0015] Figure 1 It is an example description of aptamer-functionalized liposomes.

[0016] Figure 2 It is a schematic diagram showing how six alternative splicings of tau protein are sequentially phosphorylated and dephosphorylated by selected kinases and phosphatases. Usually, the imbalance of kinase and phosphatase activities caused by the downregulation of phosphatases leads to the shift of the balance to the right, and the formation of paired helical filaments and tau protein tangles.

[0017] Figures 3A - 3HPreliminary Cell-SELEX images of SH-SY5Y cells for identifying aptamers that bind to hyperphosphorylated cells. A: SH-SY5Y cells treated with retinoic acid differentiated into a neuron-like phenotype with axonal and dendritic structures. B: After treatment with okadaic acid, the cells strongly phosphorylated the tau protein. Upper row: pTau protein Thr205 / Ser202 stained with AT8, with the nucleus. Lower row: pTau protein Ser396 stained with PHF-1, mainly cytoplasmic. C: Membrane-bound aptamers of SELEX selected rounds (1, 5, 10, 13, 17, 19, 21, 23, 26, and -ve control). Rounds 13 and 21 were negative selections against non-hyperphosphorylated cells, and the supernatant was separated to ensure binding specificity. D: After IonTorrent sequencing, the 10 most abundant aptamers of round 26 and how the aptamer evolved through screening. E: Dendrogram showing three different families and containing 20 most abundant sequences. F: M-fold structures of Tau_1 (SEQ ID NO:5), Tau_3 (SEQ ID NO:6), and Tau_17 (SEQ ID NO:13), showing structural similarity. G, H: Tau_1 (SEQ ID NO:5) and Tau_3 (SEQ ID NO:6) aptamers, with Cy5 labeling binding to the membrane and axons of hyperphosphorylated SH-SY5Y cells.

[0018] Figure 4 Interaction group schematic diagram showing the protein targets of the MAPT gene and the Tau_1 (SEQ ID NO:5) and Tau_3 (SEQ ID NO:6) aptamers from the VisANT database: HSPD90, KRT6A, KRT6B, and VIM.

[0019] Figure 5 A-5C, where A: Image showing the thioaptamer Tau_3 (SEQ ID NO:6) (red) tightly binding to the hippocampal tissue of a P301S mouse brain in the area where the AT100 antibody also stained neurons (green); B: Indicating no correlation between AT8 staining (green) and Tau_3 (SEQ ID NO:6) binding (red); C: Indicating significant Tau_3 binding in the hippocampus of a normal mouse brain.

[0020] Figure 6The provided graphs and images show examples of MRI using the GRE / 45°FA sequence before and 4 days after intravenous injection of the targeted Tau_1 (SEQ ID NO:5) aptamer, the targeted Tau_3 (SEQ ID NO:6) aptamer, or non-targeted control nanoparticles, all of which are conjugated with Gd-DOTA as a contrast agent. Top panels: Axial pre- and 4-day post-images of the brain of 2-month-old transgenic P301S mice. Bottom panels: Axial pre- and 4-day post-images of the brain of wild-type littermate mice. (All images are shown on the same color map.) Also shown are the receiver operating characteristic (ROC) curves and their 95% confidence limits for the Tau_1 (SEQ ID NO:5) and Tau_3 (SEQ ID NO:6) targeted particles calculated for 20 animals in each experimental group. The Tau_1 and Tau_3 (SEQ ID NO:6) targeted particles showed significant signal enhancement (yellow arrows) in the cerebral cortex, hippocampus, and hypothalamic regions of transgenic animals, indicating binding of the particles to neurons with hyperphosphorylated tau protein. The accuracy rate for both formulations was 80%, the sensitivity was approximately 57%, and the specificity was approximately 93%.

[0021] Figure 7 Images of a 2-month-old P301S mouse treated with Tau_3 (SEQ ID NO:6) aptamer-targeted nanoparticles are shown. Axial spin echo and 45°FA GRE images show thalamus / hypothalamus enhancement (red arrow), while the T1 map shows a significant shortening of T1 in the hippocampus (green arrow). T1 mapping imaging technique provides more information and highlights the quantifiable signal.

[0022] Figure 8 Images of 2-month-old wild-type (WT) and P301S transgenic (Tg) mice injected with liposomal nanoparticles containing ADx-Tau_1 (SEQ ID NO:5), ADx-Tau_3 (SEQ ID NO:6), and non-targeted ADx-tau protein control (ADx-Un) aptamers are shown before and 4 days after contrast agent injection. Transgenic mice showed high signal enhancement (gold arrows) in the cortical and hippocampal regions, especially in the case of injection of the ADx-Tau_1 (SEQ ID NO:5) aptamer. T1-weighted spin echo (T1w-SE) and fast spin echo inversion recovery (FSE-IR) sequences demonstrated the in vivo efficacy.

[0023] Figure 9 shows representative fluorescence microscopy images of DAPI nuclear staining and AF488-labeled AT100 binding to pTau protein in the cortical regions of (a) wild-type and (b) transgenic mice, for postmortem confirmation of hyperphosphorylated tau protein (pTau protein) in the brains of 7-month-old transgenic P301S mice. Magnification is 10×. The AT100 images are shown with the same color bar scale.

[0024] Figure 10 shows ROC curves generated on a six-point ordinal scale (empirical values - green, fitted values - blue), indicating higher analytical accuracy for fast spin echo inversion recovery (FSE-IR) images compared to T1-weighted spin echo (T1w-SE) images (42 animals were tested, 7 for each genotype and each formulation type). ROC curves are shown for formulations of (a) ADx-Tau_1 (SEQ ID NO:5) and (b) ADx-Tau_3 (SEQ ID NO:6) of the T1w-SE sequence, and (c) ADx-Tau_1 (SEQ ID NO:5) and (d) ADx-Tau_3 (SEQ ID NO:6) of the FSE-IR sequence.

[0025] To illustrate the present invention, several embodiments of the present invention will now be described in more detail. Refer to the drawings outlined above. Those skilled in the art should recognize that the embodiments provided herein have many useful alternatives, all of which fall within the scope of the present invention. Detailed Description

[0026] The present disclosure provides methods and compositions for detecting tau pathology. The compositions for detecting tau pathology comprise a targeting ligand that specifically binds to a tau pathology cell surface marker, wherein the targeting ligand is linked to a liposome comprising an imaging agent. See Figure 1 . The composition can be used in a method for imaging tau pathology in a subject, the method comprising administering an effective amount of the composition to the subject and imaging at least one site of the subject to determine whether the site exhibits tau pathology. The composition can also be used to detect tau pathology in a biological sample obtained from a subject.

[0027] Definitions

[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the present specification (including definitions) shall prevail.

[0029] Unless otherwise indicated, "a", "an", "the", "one or more", and "at least one" are used interchangeably. The singular forms "a", "an", and "the" include their plural forms.

[0030] A numerical range recited by endpoints includes all of the values included within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).

[0031] The term “about,” when referring to a value or amount of mass, weight, time, volume, concentration, or percentage, is intended to encompass variations of ±10% relative to the specified amount.

[0032] The terms “comprises” and “comprising” are equivalent and are not limiting.

[0033] The phrase “consisting essentially of” means that a composition or method may include other ingredients and / or steps, provided that the other ingredients and / or steps do not materially alter the basic and novel characteristics of the claimed composition or method.

[0034] The phrase “selected from the group consisting of” means including a mixture of the listed group.

[0035] An “effective amount” or “detectably effective amount” of a composition is an amount sufficient to detect the presence of a cell surface marker associated with tau pathology, or to generate an appropriate image using equipment available for clinical use. The detectably effective amount of a detection agent or imaging agent may be administered in multiple injections. The detectably effective amount of a detection agent or imaging agent may vary depending on factors such as the degree of susceptibility of the individual, the age, sex, and weight of the individual, the individual's idiosyncratic response, and dosimetry. The detectably effective amount of a detection agent or imaging agent may also vary depending on instrument and film-related factors. Optimization of such factors is well within the level of skill in the art. The amount of imaging agent used for diagnosis and the duration of the imaging study will depend on the particular imaging agent used, the weight of the patient, the nature and severity of the disease being treated, the nature of the treatment the patient is receiving, and the patient's idiosyncratic response. Ultimately, the attending physician will determine the amount of imaging agent to be used for each patient and the duration of the imaging study.

[0036] The term “diagnosis” may include determining the nature of a disease afflicting a subject, as well as determining the severity and likely outcome of the disease or disease onset, the prognosis for recovery, or both. “Diagnosis” may also include diagnosis in the context of reasonable treatment, where the diagnosis guides treatment, including initial selection of therapy, corrective therapy (e.g., adjustment of dosage and / or dosing regimen), etc.

[0037] The term “antigen” refers to a molecule or part of a molecule that can be bound by a targeting ligand. An antigen is generally also capable of inducing an animal to produce an antibody that can bind to an epitope of the antigen. An antigen may have one or more epitopes. The above-mentioned specific reaction means that the antigen will react with its corresponding antibody in a highly selective manner, rather than with the numerous other antibodies that can be induced by other antigens.

[0038] The term "epitope" refers to the part of any molecule that can be recognized and bound by a targeting ligand such as an antibody or an aptamer. Epitopes are usually composed of surface groups of molecules with chemical activity, such as amino acids or sugar side chains, and usually have a specific three-dimensional structure and a specific charge characteristic.

[0039] The phrase "specifically binds" means that a targeting ligand binds to a target structure, where the targeting ligand binds to the target structure or its subunit, but does not bind to biomolecules of non-target structures, or the targeting ligand binds at least preferentially to the target structure. A targeting ligand (such as an aptamer or an antibody) that specifically binds to a target structure or its subunit may not cross-react with biomolecules outside the target structure family. A specific targeting ligand against tau pathology can be a targeting ligand that can bind to the specific protein with a specific affinity of about 10 -8 -10 -11 M. In some embodiments, the antibody or antibody fragment is greater than about 10 -7 M, 10 -8 M, 10 -9 M, 10 -10 M or 10 -11 M, between about 10 -8 M, 10 -11 M, 10 -9 M and 10 -10 M, and binds to the selected antigen with a specific affinity between about 10 -10 -10 -11 M. In some aspects, the specific activity is measured using a competitive binding assay as described in the article by Ausubel FM (1994, Current Protocols in Molecular Biology, Chichester: John Wiley and Sons ("Ausubel")), which is incorporated herein by reference.

[0040] The term "polynucleotide" refers to nucleic acid sequences including DNA, RNA, and microRNA, and can refer to double-stranded or single-stranded markers. Polynucleotides can also refer to synthetic variants containing alternative sugars, such as locked nucleic acids.

[0041] Tau Pathology Imaging

[0042] Imaging of hyperphosphorylated tau protein is a new method for identifying tau pathology. Previously, attempts have been made to image tau pathology targeting the condensate itself. Although it has been recognized that hyperphosphorylation of tau protein is crucial for the formation of paired helical filaments and ultimately tau tangles, the hyperphosphorylation marker as a surrogate or precursor of tau pathology has not been studied. The inventors have identified neuron cells in the hyperphosphorylated state and their anatomical distribution in the brain, thus serving as a novel sensitive and specific marker for future tau pathology.

[0043] The imaging agent will target the cell surface marker of hyperphosphorylated tau protein, eliminating the need for cell membrane permeability. Tau protein is an intracellular protein, and tau tangles are mainly intracellular, with one exception: after neuron death, tau tangles remain "ghost tangles". Therefore, all imaging markers of tau pathology must penetrate the neuron cell membrane before binding to their targets. Of course, the only exception is binding to "ghost tangles". Thus, all tau protein imaging agents are limited by membrane permeability. Binding to "ghost tangles" only indicates neuron death, which is a late stage of the disease. The claimed compositions and methods eliminate the requirement for penetrating the cell membrane, opening the door for nanoparticle readouts with strong signals but potentially difficult to internalize into cells.

[0044] The identification of such cell surface markers can provide new clues to the biology of tau protein fibrillation and tangle formation. The inventors conducted thioaptamer screening in a "black box" mode without knowing the binding target and found that thioaptamers specifically binding to hyperphosphorylated cells bind to KRT6A, KRT6B, HSP, and VIM.

[0045] Tau protein has many phosphorylation sites. For example, the longest isoform of tau protein, tau 441, has 80 serine / threonine sites that can be phosphorylated and 5 tyrosine sites that can be phosphorylated. Studies have shown that there are more than 40 tau protein phosphorylation sites in neurofibrillary tangles. Tau protein phosphorylation is mediated by several kinases, including GSK3β, CDK-5, CaMKII, PKA, and MARK p110. Known tau protein phosphorylation sites include S199-202 / T205, T231, T212 / S214, and S396, which are labeled with AT8, AT180, AT100, and PHF-1 antibodies. Phosphorylation is a continuous process, and each phosphorylation at a specific site is thought to prepare for the next phosphorylation by exposing key binding sites. It is generally believed that the S396 / PHF-1 site is phosphorylated relatively late in this process and is mainly associated with paired helical filaments and tangles, but recent studies have shown that the S396 / PHF-1 site may even be phosphorylated earlier than the S199-202 / T205 (AT8 staining) site under certain conditions.

[0046] Tau protein dephosphorylation is mediated by protein phosphatases, and the function of PP2A accounts for more than 70%. Studies have shown that the PP2A activity in the brains of Alzheimer's disease patients is less than 50% of the normal value, and this imbalance in kinase and phosphatase activities is considered to be an important factor leading to the hyperphosphorylation of tau protein and the formation of neurofibrillary tangles. See Figure 2 . Therefore, PP2A is inhibited in neuronal substitutes, and thioaptamers are conjugated with loaded nanoparticles to identify surface markers of this hyperphosphorylated state.

[0047] Compositions for identifying tau pathology

[0048] In one aspect, there is provided a composition for identifying tau pathology, the composition comprising a targeting ligand that specifically binds to a tau pathology cell surface marker, wherein the targeting ligand is linked to a liposome comprising an imaging agent.

[0049] In some aspects, the tau pathological cell surface marker is a cell surface marker of hyperphosphorylated tau protein. Tau pathology refers to abnormal tau proteins that cause tauopathies. Tau pathology is caused by hyperphosphorylation of tau protein. Normal tau protein contains 2-3 moles of phosphate per mole of protein, while the phosphate content in hyperphosphorylated tau protein is much higher. Hyperphosphorylation of tau protein leads to the formation of neurofibrillary tangles. Tau protein is present inside cells and is difficult to detect directly. However, the inventors have identified cell surface markers (i.e., epitopes) associated with potential tau pathology. In some embodiments, these cell surface markers are epitopes identified using the Cell-SELEX method, where neurons or neuronal cell models exhibiting tau pathology are used as targets for target ligands (such as aptamers). In some embodiments, the tau pathological cell surface markers include proteins selected from KRT6A, KRT6B, HSP, and VIM.

[0050] Targeting ligand

[0051] As used herein, the term "targeting ligand" includes any molecule that can be linked to a liposome to bind to a specific target, particularly to recognize tau pathology. Suitable targeting ligands include, but are not limited to, antibodies, antibody fragments, aptamers, stabilized aptamers, etc. In some embodiments, the targeting ligand can be an aptamer or a stabilized aptamer that specifically binds to a tau pathological cell surface marker.

[0052] The targeting ligand of the present invention is capable of specifically binding to cells exhibiting tau pathology. Specific binding refers to binding that discriminates between a selected target and other potential targets and has a high affinity for the selected target. High affinity means that the binding dissociation constant of the targeting ligand is at least about 10 -8 mol / m 3 , but in other embodiments, the binding dissociation constant of the targeting ligand can be at least about 10 -9 mol / m 3 , about 10 -10 mol / m 3 , about 10 -11 mol / m 3 or at least about 10 -12 mol / m 3 .

[0053] In some embodiments, the targeting ligand is an aptamer. An aptamer is a nucleic acid that binds to a specific target molecule or cell structure with high specificity and affinity through non-Watson-Crick base pairing interactions. Suitable aptamers can be single-stranded RNA, DNA, modified nucleic acids, or mixtures thereof. Aptamers can also be linear or circular. In some embodiments, the aptamer is single-stranded DNA, while in other embodiments, the aptamer is single-stranded RNA.

[0054] The aptamer function is independent of the nucleotide sequence itself but is based on the secondary / tertiary structure formed by the polynucleotide. Thus, aptamers are preferably regarded as non-coding sequences. The binding of nucleic acid ligands to target molecules is not determined by nucleic acid base pairing but by the three-dimensional structure of the aptamer. In solution, the nucleotide chain forms intramolecular interactions that fold the molecule into a complex three-dimensional shape. The shape of the nucleic acid ligand enables it to bind tightly to the surface of its target molecule. In addition to exhibiting significant specificity, nucleic acid ligands usually bind to their targets with very high affinity. For example, the equilibrium dissociation constants of most anti-protein nucleic acid ligands are in the femtomolar to low nanomolar range.

[0055] There is no particular limitation on the length of the aptamer suitable for use as a targeting ligand, including aptamers containing about 10 to 200 nucleotides, about 100 nucleotides or fewer, about 50 nucleotides or fewer, about 40 nucleotides or fewer, or about 35 nucleotides or fewer. In some embodiments, the size of the aptamer is about 15 - 40 nucleotides. In addition, in almost all known cases, various structural motifs involved in non-Watson-Crick type interactions related to aptamer binding, such as hairpin loops, symmetric and asymmetric bulges, and pseudoknots, can be formed in nucleic acid sequences of 30 nucleotides or fewer.

[0056] In some aspects, the aptamer is a stabilized aptamer, including chemical modifications to enhance its stability. The modifications include, but are not limited to, modifications that provide additional chemical groups, introducing additional charges, polarizability, hydrophobicity, hydrogen bonding, electrostatic interactions, and rheology to the nucleic acid ligand bases or the entire nucleic acid ligand. The above modifications include, but are not limited to, 2'-sugar modifications, 5'-pyrimidine modifications, 8'-purine modifications, exocyclic amine modifications, 4-thiouridine substitutions, 5-bromo or 5-iodouracil substitutions, backbone modifications, phosphorothioate or alkylphosphate modifications, methylation, unusual base pairing combinations such as isobases isocytidine and isoguanine, etc. The modifications can also include 3'-end and 5'-end modifications such as capping. In some embodiments, the nucleic acid ligand comprises an RNA molecule modified by 2'-fluoro (2'-F) on the sugar moiety of the pyrimidine residue.

[0057] Suitable stabilized aptamers can also include nucleotide analogs such as xanthine or hypoxanthine, 5-bromouracil, 2-aminopurine, deoxyinosine, or methylated cytosines such as 5-methylcytosine, N4-methoxydeoxycytosine, etc. Also included are bases of polynucleotide analogs such as methylated nucleic acids such as 2'-O-methRNA, peptide nucleic acids, locked nucleic acids, modified peptide nucleic acids, and any other structural moieties that act similarly to nucleotides or bases, for example, by exhibiting base complementarity to one or more bases in DNA or RNA.

[0058] In some embodiments, the stabilizing ligand includes a thiolaptamer. A thiolaptamer is an aptamer in which one or two non-bridging oxygen atoms are replaced by sulfur. The replacement of oxygen with sulfur not only increases the stability of the aptamer but also, in some cases, increases its binding affinity.

[0059] Targeting ligands such as aptamers are typically linked to liposomes containing imaging agents. However, another aspect of the present invention relates to the aptamer itself. In some embodiments, the aptamer includes a stabilized aptamer. In other embodiments, the stabilizing ligand is a thiolaptamer. In some embodiments, the aptamer or stabilized aptamer specifically binds to tau pathology. Suitable aptamers include aptamers containing DNA nucleotide sequences which, in certain cases, are selected from the group consisting of: Tau_1 (SEQ ID NO:5), Tau_3 (SEQ ID NO:6), Tau_9 (SEQ ID NO:7), Tau_11 (SEQ ID NO:8), Tau_10 (SEQ ID NO:9), Tau_13 (SEQ ID NO:10), Tau_8 (SEQ ID NO:11), Tau_4 (SEQ ID NO:12), Tau_17 (SEQ ID NO:13), Tau_5 (SEQ ID NO:14), Tau_21 (SEQID NO:15), Tau_25 (SEQ ID NO:16), Tau_7 (SEQ ID NO:17), Tau_31 (SEQ ID NO:18), Tau_42 (SEQ ID NO:19), Tau_14 (SEQ ID NO:20), Tau_19 (SEQ ID NO:21), Tau_15 (SEQ ID NO:22), Tau_56 (SEQ ID NO:23), Tau_34 (SEQ ID NO:24), Tau_23 (SEQ ID NO:25), Tau_99 (SEQID NO:26) and Tau_102 (SEQ ID NO:27).

[0060] In some embodiments, the aptamer is located between two primer nucleotide sequences, which facilitates amplification of the aptamer sequence, for example by polymerase chain reaction (PCR). For example, in some embodiments, the DNA nucleotide sequence of the aptamer is located between the sequences GATATGTCTAGAGCCTCAGATCA (SEQ ID NO:1) and CGGAGTTATGTTAGCAGTAGC (SEQ ID NO:2). In other embodiments, the DNA nucleotide sequence of the aptamer is located between the sequences CGC TCG ATA GAT CGA GCT TCG (SEQ ID NO:3) and GTC GAT CAC GCT CTA GAG CAC (SEQ ID NO:4).

[0061] Selection of Aptamers

[0062] In some embodiments, the SELEX method can be used to identify aptamers or stabilized aptamers that specifically bind to tau pathological cell surface markers. Any method known in the art can be used to identify suitable nucleic acid ligands, such as SELEX described by Gold et al. (U.S. Patent No. 5,270,163), which is incorporated herein by reference in its entirety. Other methods for identifying nucleic acid ligands are described in the article by Gilman et al. (U.S. Patent Application No. 2011 / 0104667), which is incorporated herein by reference in its entirety. The identification of suitable aptamers is shown in the examples herein.

[0063] SELEX is a strategy developed to identify nucleic acids that can bind to target molecules with high affinity and specificity through their three-dimensional conformations. This technique involves identifying rare nucleic acid molecules with high affinity for the target molecule from a random nucleic acid library. This process is carried out iteratively, followed by multiple rounds of selection and amplification. Studies have shown that this procedure is very useful for isolating tightly binding oligonucleotide ligands (aptamers) against many target molecules, such as nucleic acid-binding proteins, non-nucleic acid-binding proteins, and certain small molecules. SELEX is an effective screening method because iterative cycle selection can be carried out by PCR.

[0064] The SELEX process generally includes determining the target molecule, such as a protein, small molecule, or supramolecular structure. Creating a random oligonucleotide library (about 1x10 15 oligonucleotides). In a random DNA library, primer binding sites are usually present at the ends of each oligonucleotide, which provides an effective method for finding and PCR amplifying the oligonucleotides that bind to the target molecule. The target molecule is exposed to the oligonucleotide "library", and some of the oligonucleotides in the library will bind to the target, thereby determining the target-specific aptamers. The non-binding oligonucleotides are separated from the binding oligonucleotides.

[0065] Aptamer identification methods may include a one-step separation of nucleic acids that bind to a target molecule with the greatest affinity from nucleic acids that bind to the target molecule with a lesser affinity and nucleic acids that do not bind to the target molecule at all, thereby identifying the nucleic acid ligand of the target molecule. Under the conditions generated by the selective separation protocol, nucleic acids that bind to the target molecule with a lesser affinity and nucleic acids that do not bind to the target molecule at all do not form complexes with the target molecule, or form complexes with the target molecule only for a short period of time. In contrast, the conditions of the separation protocol enable nucleic acids that bind to the target molecule with the greatest affinity to form complexes with the target molecule and / or bind to the target molecule for the longest period of time, thereby separating in one step from the remaining nucleic acids in the candidate mixture the nucleic acid that has the greatest affinity for the target molecule, i.e., the nucleic acid ligand.

[0066] The separation can be accomplished by any of a number of methods by which selective one-step separation of nucleic acids that bind to a target molecule with the greatest affinity from nucleic acids that bind to the target molecule with a lesser affinity and nucleic acids that do not bind to the target molecule can be performed. Suitable separation procedures include HPLC gradient elution and gel electrophoresis.

[0067] After incubation, the mixture is washed with buffer to remove unbound target molecules. The magnetic beads bound to the target molecule are then incubated with the candidate nucleic acid mixture. The magnetic beads bound to the target molecule are first loaded into an HPLC column and then incubated with the candidate mixture. If the magnetic beads bound to the target molecule have been loaded into the HPLC column before incubation with the candidate mixture, the candidate mixture and the target molecule are incubated in the HPLC column.

[0068] After the candidate mixture has been incubated with the target molecule bound to the magnetic beads for a sufficient time to form magnetic bead / target molecule / nucleic acid complexes, HPLC gradient elution of the column is performed to obtain the nucleic acid ligand of the target molecule. During elution, the effluent will be enriched in nucleic acid ligands that have a higher affinity for the target molecule, and the final fraction contains the nucleic acid ligand that has the highest affinity for the target molecule.

[0069] In some embodiments, the Cell-SELEX method can be employed to identify aptamers or stabilized aptamers that specifically bind to tau pathological cell surface markers. Cell-SELEX uses complex whole cells as targets for aptamer selection. A counter-selection strategy is then employed to isolate aptamer sequences that interact only with the target cells and not with control cells. By this process, a set of cell-specific aptamers can be selected in a relatively short time, even when it is not known which target molecules are present on the cell surface and which membrane molecules may play an important role in the detected pathology.

[0070] In some embodiments, the Conjugate-SELEX method can be employed to identify aptamers or stabilized aptamers that specifically bind to tau pathological cell surface markers. Conjugate-SELEX is an improvement over the basic SELEX procedure, where the affinity of the entire aptamer-liposome conjugate is evaluated rather than the aptamer alone.

[0071] Sequencing

[0072] After identification, the aptamer can be sequenced. Sequencing can be performed using any method known in the art. DNA sequencing techniques include classical dideoxy sequencing reactions (Sanger method) using labeled terminators or primers for gel separation in a slab or capillary, sequencing by synthesis using reversible terminator-labeled nucleotides, pyrosequencing, 454 sequencing, allele-specific hybridization using a labeled oligonucleotide probe library, sequencing by synthesis through allele-specific hybridization of a labeled clone library followed by ligation, real-time monitoring of labeled nucleotide incorporation in the polymerization step, polymerase cloning sequencing, and SOLiD sequencing. Sequencing can be performed using any method known in the art. For example, see the articles by Sanger et al. (Proceedings of the National Academy of Sciences of the United States of America, 74(12):5463-5467, 1977), Maxam et al. (Proceedings of the National Academy of Sciences of the United States of America, 74:560-564, 1977), and Drmanac et al. (Nature Biotechnology, 16:54-58, 1998), which describe examples of conventional bulk sequencing techniques. Also see the articles by Lapidus et al. (U.S. Patent No. 7,169,560), Quake et al. (U.S. Patent No. 6,818,395), Harris (U.S. Patent No. 7,282,337), Quake et al. (U.S. Patent Application No. 2002 / 0164629), and Braslaysky et al. (Proceedings of the National Academy of Sciences of the United States of America, 100:3960-3964, 2003), which describe examples of single molecule sequencing by synthesis techniques. The above references are hereby incorporated by reference in their entirety.

[0073] The inventors identified aptamers that specifically bind to tau pathology. Examples of aptamers are shown in Table 1. Thus, in some embodiments, the aptamer or stabilized aptamer comprises a DNA nucleotide sequence selected from the group consisting of: Tau_1 (SEQ ID NO:5), Tau_3 (SEQ ID NO:6), Tau_9 (SEQ ID NO:7), Tau_11 (SEQ ID NO:8), Tau_10 (SEQ ID NO:9), Tau_13 (SEQ ID NO:10), Tau_8 (SEQ ID NO:11), Tau_4 (SEQ ID NO:12), Tau_17 (SEQ ID NO:13), Tau_5 (SEQ ID NO:14), Tau_21 (SEQ ID NO:15), Tau_25 (SEQ ID NO:16), Tau_7 (SEQ ID NO:17), Tau_31 (SEQ ID NO:18), Tau_42 (SEQ ID NO:19), Tau_14 (SEQ ID NO:20), Tau_19 (SEQ ID NO:21), Tau_15 (SEQ ID NO:22), Tau_56 (SEQ ID NO:23), Tau_34 (SEQ ID NO:24), Tau_23 (SEQ ID NO:25), Tau_99 (SEQ ID NO:26), and Tau_102 (SEQ ID NO:27). In another embodiment, the aptamer or stabilized aptamer comprises the DNA nucleotide sequences Tau_1 (SEQ ID NO:5) and Tau_3 (SEQ ID NO:6), or both.

[0074] Table 1: Aptamers that specifically bind to tau pathology

[0075] Identifier Nucleotide Sequence Sequence Number Tau_1 CCCCCCACGGTCTCCGCTCCACAAGTTCAC SEQ ID NO:5 Tau_3 CCCCCCACGGTCTCCGCTCCACAAGTCCAC SEQ ID NO:6 Tau_9 CCCCCCACGGTCTCCGCTCCACAGGTTCAC SEQ ID NO:7 Tau_11 CCCCCCCACGGTCTCCGCTCCACAAGTTCA SEQ ID NO:8 Tau_10 CTCGTGGGTGTGTGGTGGTGTTGTTGTGTG SEQ ID NO:9 Tau_13 CCCCCCACGGTCTCCGCTCCACAAGCCCAC SEQ ID NO:10 Tau_8 CTCGTCCCACCACAACATCATCTCAACGCC SEQ ID NO:11 Tau_4 CTCGTCCCACCACAACATTATCTCAACGCC SEQ ID NO:12 Tau_17 CTCGTGGGTGTACGGTGGTGTTGTTGTGTG SEQ ID NO:13 Tau_5 CTCCGACGGGATGTTCGATGAGCACACACT SEQ ID NO:14 Tau_21 CCCCCCCACGGTCTCCGCTCCACAAGTCCA SEQ ID NO:15 Tau_25 CCCCCCACGGTCTCCGCTCCACAGGTCCAC SEQ ID NO:16 Tau_7 CCCCCATTGGCTCCGCTCCACACAGCTTCA SEQ ID NO:17 Tau_31 CCCCCCACGGTCTCCGCTCCACAAGCTCAC SEQ ID NO:18 Tau_42 CCCCCCCACGGTCTCCGCTCCACAGGTTCA SEQ ID NO:19 Tau_14 CTCGTCCCACCACAACATTGTCTCAACGCC SEQ ID NO:20 Tau_19 CTCGTCCCACCACAACACCATCTCAACGCC SEQ ID NO:21 Tau_15 CTCCGACGGGGTGTTCGATGAGCACACACT SEQ ID NO:22 Tau_56 CCCCCCGCGGTCTCCGCTCCACAAGTTCAC SEQ ID NO:23 Tau_34 TGGGTGTGTGGTGGTGTTGTTGTGTGGGTG SEQ ID NO:24 Tau_23 CTCGCCCCACCACAACATCATCTCAACGCC SEQ ID NO:25 Tau_99 CCCCCCACGGTCTCCGCTCCACAAGTTCGC SEQ ID NO:26 Tau_102 CCCCCCCACGGTCTCCGCTCCACAAGCTCA SEQ ID NO:27

[0076] In some embodiments, the targeting ligand is an antibody that specifically binds to tau pathology. As used herein, the term "antibody" refers to a protein produced by activated B cells upon antigen stimulation, which can specifically bind to the antigen, thereby promoting the immune response of the biological system. A whole antibody usually consists of four subunits, including two heavy chains and two light chains. The term "antibody" includes natural and synthetic antibodies, including but not limited to monoclonal antibodies, polyclonal antibodies, or fragments thereof. Suitable antibodies include IgA, IgD, IgG1, IgG2, IgG3, IgM, etc. Suitable fragments include Fab, Fv, Fab’, F(ab’)2, etc. A monoclonal antibody is an antibody with a single specific spatial and polar structure that specifically binds to an epitope, and is thus defined as an antibody that is complementary to the single specific spatial and polar structure of the epitope. In some forms, monoclonal antibodies can also have the same structure. A polyclonal antibody refers to a mixture of different monoclonal antibodies. In some forms, a polyclonal antibody can be a mixture of monoclonal antibodies, where at least two monoclonal antibodies bind to different antigenic epitopes. The different antigenic epitopes can be located on the same target, different targets, or a combination of targets. Antibodies can be prepared using techniques well known in the art, such as immunizing a host and collecting serum (polyclonal), or preparing a continuous hybridoma cell line and collecting the secreted protein (monoclonal).

[0077] Targeting ligand conjugate

[0078] In some embodiments, the targeting ligand (such as an aptamer) is linked to a liposome or other carrier for targeted delivery of an imaging agent or a detection agent. For example, the imaging agent or detection agent can be encapsulated within the liposome. Using this technique, the tau pathology-specific aptamer conjugated to the liposome vesicles in the present invention can target the delivery of an imaging agent or a detection agent to cells expressing tau pathology. In some embodiments, a single targeting ligand is linked to the liposome. In other embodiments, multiple targeting ligands are linked to the liposome (such as Tau_1 and Tau-3).

[0079] As used herein, the term "liposome" refers to a vesicular structure composed of lipids. Lipids generally have a tail group containing a long hydrocarbon chain and a hydrophilic head group. The lipids arrange to form a lipid bilayer (i.e., a membrane), the internal aqueous environment of which is suitable for accommodating a reagent to be released (such as an imaging agent). The outer surface of such liposomes may contain a suitable targeting ligand that specifically binds to a cell surface marker of tau pathology. For example, a suitable liposome platform may be the "ADx" platform of Alzeca Biosciences, which includes hydrogenated soy L-α-phosphatidylcholine (HSPC), cholesterol (Chol), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-(methoxy(polyethylene glycol)-2000) (DSPE-mPEG2000), and Gd(III)-DSPE-DOTA (a macrocyclic gadolinium imaging moiety, Gd(III)-DOTA, conjugated to the phospholipid 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (DSPE)), and an entity conjugated to the targeting ligand DSPE-PEG-3400 (1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[maleimide(polyethylene glycol)-3400]).

[0080] In some embodiments, the membrane of the liposome may comprise at least three types of phospholipids. The membrane may comprise a first phospholipid that may be unmodified. Suitable first phospholipids include the phospholipids disclosed in U.S. Patent Nos. 7,785,568 and 10,537,649, which are hereby incorporated by reference in their entireties. In one embodiment, the first phospholipid is HSPC. The membrane may comprise a second phospholipid derivable from a first polymer. Suitable polymer-derived second phospholipids include the phospholipids disclosed in U.S. Patent Nos. 7,785,568 and 10,537,649. In one embodiment, the second phospholipid derivable from a first polymer is DSPE-mPEG2000. The membrane may include a third phospholipid derivable from a second polymer, wherein the second polymer is ultimately conjugated to a targeting ligand. Suitable polymer-derived third phospholipids include the phospholipids disclosed in U.S. Patent Nos. 7,785,568 and 10,537,649. In one embodiment, the third phospholipid derivable from a second polymer is DSPE-PEG-3400.

[0081] In some embodiments, the membrane may comprise a sterically bulky excipient capable of stabilizing the liposome. Suitable excipients include the excipients disclosed in U.S. Patent Nos. 7,785,568 and 10,537,649. In one embodiment, the sterically bulky excipient capable of stabilizing the liposome is cholesterol.

[0082] In some embodiments, the phospholipid moiety in the phospholipid-polymer targeting ligand conjugate may be represented by the following structural formula:

[0083]

[0084] The variable m can be one of the following values: 12, 13, 14, 15, 16, 17, or 18. For example, m can be 14 or 16. In different embodiments, the phospholipid moiety of any one of the first phospholipid, the second phospholipid, and the phospholipid-polymer targeting ligand conjugate can be one of HSPC, DPPC, DSPE, DSPC, or DPPE.

[0085] In some embodiments, the polymer moiety in the phospholipid-polymer targeting ligand conjugate is a polyol. The structural units forming the polyol-containing polymer include monomeric polyols such as pentaerythritol, ethylene glycol, and glycerol. Polyol-containing polymers include polyesters, polyethers, and polysaccharides. Suitable polyethers include, but are not limited to, diols such as diols of the general formula HO-(CH2CH2O) p -H, where p≥1, such as polyethylene glycol, polypropylene glycol, and poly(tetramethylene ether) glycol. Suitable polysaccharides include, but are not limited to, cyclodextrin, starch, glycogen, cellulose, chitin, and β-glucan. Suitable polyesters include, but are not limited to, polycarbonate, polybutyrate, and polyethylene terephthalate, all having hydroxyl groups as end groups. Polyol-containing polymers include polymers having a molecular weight of about 500,000 Da or less, including polymers having a molecular weight of about 300 to 100,000 Da.

[0086] In some embodiments, the polymer moiety in the phospholipid-polymer targeting ligand conjugate includes a hydrophilic poly(alkylene oxide) polymer. The hydrophilic poly(alkylene oxide) can include about 10-100 repeating units, and its molecular weight is, for example, about 500-10,000 Da. The hydrophilic poly(alkylene oxide) may include, for example, poly(ethylene oxide), poly(propylene oxide), etc. The polymer moiety in the phospholipid-polymer targeting ligand conjugate can be coupled to the phospholipid moiety through an amide or carbamate group. The polymer moiety in the phospholipid-polymer targeting ligand conjugate can be coupled through amide, carbamate, poly(alkylene oxide), triazole, and combinations thereof, etc. For example, the polymer moiety in the phospholipid-polymer targeting ligand conjugate can be represented by one of the following structural formulas:

[0087]

[0088] The variable n can be any integer from about 10-100, such as about 60-100, about 70-90, about 75-85, or about 77.

[0089] In some embodiments, the phospholipid-polymer moiety in the phospholipid-polymer targeting ligand conjugate can be represented by one of the following structural formulas:

[0090]

[0091] The variable n can be any integer from about 10 to 100, such as from about 60 to 100, from about 70 to 90, from about 75 to 85, or about 77. The variable m can be one of the following values: 12, 13, 14, 15, 16, 17, or 18. For example, n can be 77 and m can be 14. In another instance, n can be 77 and m can be 16.

[0092] The targeting ligand (e.g., aptamer) can be connected to one or more polymer (such as PEG) moieties of the phospholipid-polymer targeting ligand conjugate with or without one or more linkers. The PEG moiety can be any type of PEG moiety (linear, branched, multi-branched, star-shaped, comb-shaped, or dendritic) and have any molecular weight. The same or different PEG moieties can be connected to the aptamer with the same or different linkers or without a linker. Common linkers include, but are not limited to, amines, thiols, and azides, and can include phosphate groups. For example, in some embodiments, the targeting ligand is linked to polyethylene glycol, and the polyethylene glycol is conjugated to a phospholipid that binds to the liposome.

[0093] In some embodiments, the liposome consists of a membrane that contains: a first phospholipid selected from HSPC, DPPC, DSPE, DSPC, and DPPE; cholesterol; DPPC, DSPE, DSPC, and / or DPPE derived from PEG; DPPC, DSPE, DSPC, and / or DPPE derived from PEG and a targeting ligand that specifically binds to the cell surface marker of tau pathology; an imaging agent encapsulated by or bound to the membrane. In other embodiments, the targeting ligand is a thioaptamer and the imaging agent is an MRI contrast enhancer.

[0094] In some aspects, the present invention provides a targeting composition. The targeting composition includes a phospholipid linked to a polymer, the polymer is linked to a targeting ligand that specifically binds to the cell surface marker of tau pathology. The phospholipid can be any phospholipid described herein. In some embodiments, the phospholipid includes one or more of DPPC, DSPE, DSPC, and DPPE. Similarly, the polymer can be any polymer described herein (such as a polyol). In some embodiments, the polymer is polyethylene glycol.

[0095] Imaging agent or detection agent

[0096] The compositions for detecting tau pathology described herein may include imaging agents or detection agents. The imaging agent or detection agent is typically bound to the liposomal portion of the composition. The imaging agent or detection agent may be retained within the liposome or conjugated to the liposome. In one embodiment, the imaging agent or detection agent is linked to a polymer that links a phospholipid, wherein the phospholipid is bound to the membrane forming the liposome. In one embodiment, the imaging agent or detection agent is linked to a polymer that links a phospholipid, wherein the phospholipid is bound to the membrane forming the liposome containing Gd(III)-DSPE-DOTA.

[0097] In some embodiments, the compositions for detecting tau pathology include detection agents. Detection agents include dyes such as GFP, biotin, cholesterol, fluorescent dyes, electrochemically active reporters, and compositions containing radioactive residues, such as radionuclides suitable for positron emission tomography (PET) detection, such as 18 F, 11 C, 13 N, 15 O, 82 Rb or 68 Ga.

[0098] In some embodiments, the compositions for detecting tau pathology include imaging agents. Imaging agents differ from detection agents in that imaging agents not only show the presence of tau pathology but are also suitable for various imaging methods, wherein an image of the tissue region with tau pathology can be created and shown by the imaging method. Imaging agents include near-infrared imaging agents, positron emission tomography imaging agents, single-photon emission computed tomography imaging agents, fluorescent components, radioisotopes, and MRI contrast agents, etc.

[0099] In some embodiments, the imaging agent is an MRI contrast enhancer. It is often difficult to detect diseases by MRI because the signal intensity of the diseased area is similar to that of the surrounding healthy tissue. When performing an MRI examination, the imaging agent can also be called a contrast agent. The MRI contrast enhancer can be a non-radioactive MRI contrast enhancer, a contrast enhancer encapsulated by or bound to a membrane, or a contrast enhancer both encapsulated by and bound to a membrane. For example, the non-radioactive MRI contrast enhancer can be both encapsulated by and bound to a membrane, for example, a dual-contrast liposome. The liposomal composition is characterized by the relaxation rate of each particle (in mM -1 s -1The count) is at least about one or more of the following: 100,000, 125,000, 150,000, 165,000, 180,000, 190,000, and 200,000. The preparation for detecting liposomes using MRI can be carried out within a magnetic field range of, for example, about 1 - 3.5 T or about 1.5 - 3 T. Non-radioactive MRI contrast agents can include gadolinium. Suitable non-radioactive MRI contrast agents can include Gd(III)-DSPE-DOTA and (diethylenetriaminepentaacetic acid)-bis(stearamide), gadolinium salts (Gd-DTPA-BSA). Paramagnetic gadolinium chelates such as GdDTPA, GdDOTA, GdHPDO3A, GdDTPA-BMA, and GdDTPA-BSA are also suitable known MRI contrast agents. See U.S. Patent No. 5,676,928 to Klaveness et al., which is incorporated herein by reference in its entirety.

[0100] Method for imaging or detecting tau pathology

[0101] In another aspect, the present invention provides a method for imaging tau pathology in a subject. The method includes administering to the subject a detectable effective amount of a targeted ligand-liposome conjugate, the conjugate comprising a targeted ligand that specifically binds to a tau pathology cell surface marker, wherein the targeted ligand is conjugated to a liposome comprising an imaging agent; imaging at least one site of the subject to determine whether the site exhibits tau pathology.

[0102] The term "subject" refers to an animal such as a vertebrate or invertebrate. In some embodiments, the subject is a mammal, including but not limited to primates, including anthropoids and humans, equines (such as horses), canines (such as dogs), felines, various domesticated livestock (such as ungulates like pigs, goats, sheep, etc.), as well as domesticated pets and zoo animals. In some embodiments, the subject is a human subject. In some embodiments, the subject is a subject at increased risk of Alzheimer's disease. Risk factors for Alzheimer's disease include genetic susceptibility, smoking, diabetes, a history of head injury, depression, and hypertension. See the article by Burns A, Iliffe S. (British Medical Journal, 338:b158 (2009)).

[0103] The target ligand-liposome conjugate may include any feature described herein. For example, in some embodiments, the target ligand is an aptamer or a stabilized aptamer, while in other embodiments, the target ligand is a thiolated aptamer. In still other embodiments, the aptamer or stabilized aptamer used in the method comprises a DNA nucleotide sequence selected from the group consisting of: Tau_1 (SEQ ID NO:5), Tau_3 (SEQ ID NO:6), Tau_9 (SEQ ID NO:7), Tau_11 (SEQ ID NO:8), Tau_10 (SEQ ID NO:9), Tau_13 (SEQ ID NO:10), Tau_8 (SEQ ID NO:11), Tau_4 (SEQ ID NO:12), Tau_17 (SEQ ID NO:13), Tau_5 (SEQ ID NO:14), Tau_21 (SEQ ID NO:15), Tau_25 (SEQ ID NO:16), Tau_7 (SEQ ID NO:17), Tau_31 (SEQ ID NO:18), Tau_42 (SEQ ID NO:19), Tau_14 (SEQ ID NO:20), Tau_19 (SEQ ID NO:21), Tau_15 (SEQ ID NO:22), Tau_56 (SEQ ID NO:23), Tau_34 (SEQ ID NO:24), Tau_23 (SEQ ID NO:25), Tau_99 (SEQ ID NO:26), and Tau_102 (SEQ ID NO:27).

[0104] In some embodiments, the present invention may provide a method for generating an image of a tissue region of a subject, the method comprising administering to the subject a detectable effective amount of a composition for detecting tau pathology, and generating an image of a site (i.e., tissue region) of the subject in which the composition containing the imaging agent is distributed. In order to generate an image of the tissue region, it is necessary for a detectable effective amount of the imaging agent to reach the tissue region, but the imaging agent is not necessarily limited to that region only. However, in some embodiments, the composition containing the imaging agent is targeted or administered locally, and thus is mainly present in the tissue region. The image includes two-dimensional cross-sectional views and three-dimensional images, etc. In some embodiments, computer analysis of the data generated by the imaging agent is employed to generate a visual image. The tissue region or site of the subject may be an organ of the subject, such as the brain, heart, lungs or blood vessels. In other embodiments, the site of the subject may be a tissue region known to include nerve cells, such as the brain. The imaging methods include optical imaging, fluorescence imaging, computed tomography, positron emission tomography, single photon emission computed tomography and MRI, etc. Any other suitable type of imaging method known to those skilled in the art may be considered.

[0105] In some embodiments, the imaging agent is an MRI contrast agent, and the binding level is determined by MRI. MRI is a medical application of nuclear magnetic resonance, which uses a strong magnetic field, magnetic field gradients and radio waves to generate an image of a site of a subject, thereby forming an image of the body's anatomy and physiological processes. MRI is commonly used in neuroimaging, cardiovascular imaging, musculoskeletal imaging, liver imaging and gastrointestinal imaging. Since the different properties of tissues or blood provide natural contrast, MRI for anatomical structure or blood flow imaging does not require a contrast agent. However, for more specific types of imaging, exogenous contrast agents can be used. For a review of neuroimaging techniques, see the article by Mehrabian et al. (Frontiers in Oncology 9:440 (2019)).

[0106] Another aspect of the present invention may provide a method for detecting tau pathology. The method includes contacting a biological sample with an effective amount of a targeted ligand-liposome conjugate, the conjugate comprising a targeted ligand that specifically binds to a cell surface marker of tau pathology, wherein the targeted ligand is conjugated to a liposome containing a detectable label; washing the biological sample to remove unbound targeted ligand-liposome conjugate; and detecting tau pathology of the biological sample by measuring the amount of remaining detectable label in the biological sample.

[0107] The targeted ligand-liposome conjugate can include any of the features described herein. For example, in some embodiments, the targeted ligand is an aptamer or a stabilized aptamer, while in other embodiments, the targeted ligand is a thiolated aptamer. In still other embodiments, the aptamer or stabilized aptamer used in the method comprises a DNA nucleotide sequence selected from the group consisting of: Tau_1 (SEQ ID NO:5), Tau_3 (SEQ ID NO:6), Tau_9 (SEQ ID NO:7), Tau_11 (SEQ ID NO:8), Tau_10 (SEQ ID NO:9), Tau_13 (SEQ ID NO:10), Tau_8 (SEQ ID NO:11), Tau_4 (SEQ ID NO:12), Tau_17 (SEQ ID NO:13), Tau_5 (SEQ ID NO:14), Tau_21 (SEQID NO:15), Tau_25 (SEQ ID NO:16), Tau_7 (SEQ ID NO:17), Tau_31 (SEQ ID NO:18), Tau_42 (SEQ ID NO:19), Tau_14 (SEQ ID NO:20), Tau_19 (SEQ ID NO:21), Tau_15 (SEQ ID NO:22), Tau_56 (SEQ ID NO:23), Tau_34 (SEQ ID NO:24), Tau_23 (SEQ ID NO:25), Tau_99 (SEQID NO:26), and Tau_102 (SEQ ID NO:27).

[0108] Methods for detecting labels are well known to those of skill in the art. Thus, for example, if the label is a radioactive label, detection methods include scintillation counters or photographic film in autoradiography. If the label is a fluorescent label, the fluorescent dye can be excited with light of an appropriate wavelength and the fluorescent label can be assayed by detecting the resulting fluorescence. Fluorescence can be visually detected with photographic film, using an electronic detector such as a charge-coupled device (CCD) or a photomultiplier tube. Similarly, an enzyme label can be detected by providing the enzyme with an appropriate substrate and detecting the resulting reaction product. The level of the detected label can be compared to a control level to determine whether a biological sample exhibits an elevated level of a cell surface marker of tau pathology.

[0109] Biological samples can be body fluids of mammals, blood (including whole blood and its plasma and serum), etc., serum, CSF (cerebrospinal fluid), urine, sweat, saliva, tears, lung secretions, breast aspirates, prostatic fluid, semen, feces, cervical smears, cysts, amniotic fluid, intraocular fluid, mucus, exhaled water vapor, animal tissues, cell lysates, tumor tissues, hair, skin, oral smears, nails, bone marrow, cartilage, prions, bone meal, earwax, etc., and even from external or archival sources, such as tumor samples (i.e., fresh samples, frozen samples or paraffin-embedded samples). Samples such as body fluids or serum obtained during clinical trials may be suitable biological samples. In some embodiments, the biological sample includes CSF or a sample containing nerve cells, such as a nerve (e.g., brain) tissue sample.

[0110] The biological sample can be a fresh sample or a stored sample. The sample can be stored for different times, such as 1 hour, 1 day, 1 week, 1 month or more than 1 month. The obtained biological sample can be clearly used for the method of the present invention or can be a sample for other uses, and can be resampled for the analysis of the present invention. In some embodiments, filtering, centrifuging or otherwise pretreating the biological sample can be beneficial to remove impurities or other adverse substances that may interfere with the analysis of the biological sample.

[0111] In some embodiments, the method includes the step of obtaining a biological sample from a subject. The method of obtaining a biological sample varies according to the type of biological sample obtained, and such methods are well known to those skilled in the art. For example, a brain tissue sample can be obtained by stereotactic brain needle biopsy, while a cerebrospinal fluid sample can be obtained by lumbar puncture.

[0112] Alzheimer's disease

[0113] In some embodiments, the imaging shows that the tau pathology level is sufficient to diagnose that the subject has Alzheimer's disease. In other embodiments, the method indicates that the subject has early Alzheimer's disease, an increased risk of developing Alzheimer's disease, or both. The tau pathology level sufficient to diagnose that the subject has Alzheimer's disease or early Alzheimer's disease can be attributed to an increased level of cell surface markers that reflect an increased level of phosphorylation (such as hyperphosphorylation) of tau protein in cells (such as nerve cells). Cell surface markers that reflect an elevated level of tau protein phosphorylation include KRT6A, KRT6B, HSP, and VIM, etc.

[0114] Alzheimer's disease is a chronic neurodegenerative disease that typically progresses slowly and worsens over time, accounting for 60 - 70% of dementia cases. Alzheimer's disease is characterized by the loss of neurons and synapses in the cerebral cortex and certain subcortical regions. This loss leads to extensive atrophy in the corresponding areas, including the temporal lobe, parietal lobe, parts of the frontal cortex, and the cingulate gyrus. Alzheimer's disease is a protein misfolding disease (proteinopathy) caused by the aggregation of abnormally folded amyloid-beta and tau protein plaques in the brain.

[0115] Moderate-stage Alzheimer's disease can usually be diagnosed. Generally, the symptoms of Alzheimer's disease are cognitive dysfunction or deficits, including dementia diagnosed through medical and psychological examinations, problems in at least two aspects of mental function, and progressive loss of memory and other mental functions, especially when symptoms start to appear between the ages of 40 and 90, and there is no other disease that can explain the dementia and no other conditions that may resemble dementia, including hypothyroidism, overmedication, drug interactions, vitamin B12 deficiency, and depression. As the disease progresses, symptoms may include language problems, disorientation (including getting lost easily), mood swings, lack of motivation, inability to take care of oneself, and behavioral problems. In some embodiments, the methods and compositions described herein are used to detect early Alzheimer's disease, which can occur before the manifestation of one or more such symptoms. Thus, in some embodiments, the method is used to diagnose a subject who does not exhibit any other symptoms of Alzheimer's disease.

[0116] In some embodiments, the method further includes preventing a subject from developing Alzheimer's disease or providing treatment. Preventing Alzheimer's disease includes lifestyle and dietary changes to reduce the risk of developing Alzheimer's disease. For example, intellectual activities such as reading, board games, solving puzzles, playing a musical instrument, learning a second language, and even regular social interaction can reduce the risk of Alzheimer's disease. Similarly, a healthy diet such as a Japanese or Mediterranean diet is also associated with a reduced risk of Alzheimer's disease.

[0117] Several drugs have also been found to be useful in treating Alzheimer's disease-related cognitive problems. These drugs include acetylcholinesterase inhibitors such as tacrine, rivastigmine, galantamine, and donepezil, as well as the NMDA receptor antagonist memantine. Huperzine A is a promising drug for treating Alzheimer's disease, and atypical antipsychotics can be used to reduce aggression and psychosis in Alzheimer's patients.

[0118] Drug Compositions

[0119] In some embodiments, the compositions described herein are administered in the form of pharmaceutical compositions. The pharmaceutical compositions comprising the compositions of the present invention are prepared according to standard techniques and further comprise a pharmaceutically acceptable carrier. Normal saline is generally used as a pharmaceutically acceptable carrier. Other suitable carriers include, for example, water, buffered water, isotonic solutions (such as glucose), 0.4% normal saline, 0.3% glycine, etc., including glycoproteins for enhancing stability, such as albumin, lipoprotein, globulin, etc. The above compositions can be sterilized by well-known conventional sterilization techniques. The resulting aqueous solution can be packaged for use or filtered and lyophilized under sterile conditions, and the lyophilized preparation is mixed with a sterile aqueous solution before administration. According to the requirements of approximate physiological conditions, the compositions may contain pharmaceutically acceptable adjuvants, such as pH regulators and buffers, tonicity regulators, etc., for example, sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, etc. In addition, the liposomal compositions of the present invention can be suspended in a suspension containing a lipid protectant, which can prevent the lipids from being damaged by free radicals and lipid peroxidation reactions during storage. Lipophilic radical quenchers such as α-tocopherol and water-soluble iron-specific chelators such as deferoxamine are suitable.

[0120] The concentration of the liposomal compositions of the present invention in pharmaceutical formulations varies widely, i.e., from less than about 0.05%, usually or at least about 2 - 5%, to as high as 10 - 30% (by weight), mainly depending on the specific mode of administration selected, and is selected by liquid volume, viscosity, etc. For example, the concentration can be increased to reduce the liquid load associated with treatment. The dosage of the composition will depend on the specific aptamer used, the condition being treated, and the judgment of the clinician. The dosage of the composition is generally sufficient to provide a therapeutically effective dose of nucleic acid. Those skilled in the art can determine the amount of the composition required to provide a therapeutically effective dose. Typical dosages are usually about 0.01 - 50 mg of nucleic acid per kilogram of body weight, preferably about 0.1 - 10 mg of nucleic acid per kilogram of body weight, and most preferably about 2.0 - 5.0 mg of nucleic acid per kilogram of body weight. The dosage for mice is usually 50 - 100 μg per 20 g mouse.

[0121] Kit

[0122] In some embodiments, the present invention also provides a kit for preparing the above liposomal complex / composition. The kit can be prepared from the above ready-made materials and reagents. For example, the kit can include any one or more of the following materials: liposomes, nucleic acids (concentrated or non-concentrated), hydrophilic polymers, hydrophilic polymers derived from targeting ligands such as aptamers, and instructions. Depending on the intended user of the kit and the specific needs of the user, a variety of kits and components can be prepared. For example, as described above, the kit can contain any one of several targeting moieties for targeting the complex to a specific cell type.

[0123] It may include guidance materials for the preparation and use of liposome complexes. Although the guidance materials usually include written or printed materials, it is not limited thereto. Any medium capable of storing the guidance and communicating it to the end user can be considered. Such media include but are not limited to electronic storage media (such as disks, tapes, cartridges, chips), optical media (such as CD ROM), etc. Such media may include the address of an Internet website providing the guidance materials.

[0124] In different embodiments, the instructions may guide the user to perform any of the method steps described herein. For example, the instructions may guide the user to diagnose the risk of a subject having Alzheimer's disease by detecting the presence of tau pathology using the targeted liposome composition described herein.

[0125] To more clearly illustrate the specific embodiments of the present invention, different examples are provided. However, there are many other embodiments within the scope of the present invention, and the embodiments of the present invention are not limited to the specific examples provided herein.

[0126] Examples

[0127] Example 1 - Ligand and Target Identification

[0128] Excellent methods for identifying cell surface markers include the well-known phage display technique (Koivunen et al., Journal of Biological Chemistry 268, 20205–20210 (1993)) and cell-SELEX: a method for screening DNA aptamers against cell-carried targets (Shangguan et al., Chemistry & Biology & Biochemistry 8, 603–606 (2007)). The inventors employed cell-SELEX to identify aptamers that bind to hyperphosphorylated SH-SY5Y cells (a neuroblastoma cell line) differentiated into a neuronal phenotype. The summary of the screening and thiol-aptamer identification is shown in Figure 3. Treatment of SH-SY5Y cells with retinoic acid can induce a neuronal phenotype with axonal and neurite structures ( Figure 3A ). Treatment with okadaic acid (a potent inhibitor of PP2A) can induce hyperphosphorylation, as demonstrated by nuclear pTau Thr205 / Ser202 stained with the AT8 antibody ( Figure 3B , upper row) and cytoplasmic pTau Ser396 stained with the PHF-1 antibody ( Figure 3B , lower row).

[0129] Cell-SELEX for neuronal cells was performed in a "black box" mode. Membrane-bound thiol-aptamers were isolated by differential centrifugation and PCR amplified using leader sequence-specific primers. The thiol-aptamer starting library was a 10 15A library of thioaptamers containing a 30-base random sequence of two primer regions (5’-GATATGTCTAGAGCCTCAGATCA-(N30)-CGGAGTTATGTTAGCAGTAGC-3’ SEQ ID NO:28). Two negative SELEX steps were included in rounds 13 and 21, including screening cells treated with retinoic acid but not with okadaic acid, thus mimicking “normal” or non-hyperphosphorylated neurons. In the above steps, the supernatant, i.e., thioaptamers not bound to the cell membrane or not internalized, was isolated for amplification, so as to ensure that the only thioaptamers remaining during screening were those selectively binding to hyperphosphorylated neurons. The top 250 sequences identified in the 26th cycle are shown in Table 2, which is located at the end of this Example 1. Then, the method and chip were used for next-generation sequencing of the remaining aptamers in rounds 26 and selected intermediate rounds (1, 5, 10, 13, 17, 19, 21, 23, 26) of Cell SELEX( Figure 3C ), followed by sequence alignment using the Aptaligner code. Lu et al., Biochemistry 53, 3523–3525 (2014). The top 20 sequences belong to three different structural families ( Figure 3E phylogenetic tree shown). Evidence of the success of the negative screening strategy is shown in Figure 3D , where the thioaptamer Tau_2 (SEQ ID NO:218) (orange bar) dominated the library in round 10, but after the negative screening in round 13, Tau_2 (SEQ ID NO:218) almost disappeared and was replaced by, for example, Tau_1 (blue bar). The M-fold structures of Tau_1 (SEQ IDNO:5), Tau_3 (SEQ ID NO:6) and Tau_17 (SEQ ID NO:13) showed significant similarity, which was consistent with their binding to a consistent selective target. When synthesized de novo and exposed to hyperphosphorylated SH-SY5Y cells, Tau_1 (SEQ ID NO:5) and Tau_3 (SEQ ID NO:6) bound tightly to the membrane and axonal processes ( Figure 3G and 3H ).

[0130] The protein targets of the thioaptamers Tau_1 (SEQ ID NO:5), Tau_3 (SEQ ID NO:6), Tau_4 (SEQ ID NO:12), and Tau_5 (SEQ ID NO:14) were identified by affinity pull-down (using the thioaptamers as capture agents), followed by mass spectrometry analysis. The scrambled DNA sequence R4 was used as a control. Hyperphosphorylated neuronal transformed SH-SY5Y cells at 90 - 95% confluence were washed with cold PBS buffer and incubated with biotinylated thioaptamers and R4 (each at 24 mM) in PBS (Dulbecco’s PBS containing calcium chloride and magnesium chloride) at 4 °C for 2 hours with gentle agitation. After incubation, the cells were cross-linked with 1% formaldehyde at room temperature for 10 minutes. Formaldehyde cross-linking was quenched with glycine. The cells were scraped from the flask, washed, lysed with lysis buffer, and treated with a protease inhibitor mixture. After the lysate was frozen and thawed on ice for 30 minutes, it was clarified by centrifugation at 10,000 g for 2 minutes at 4 °C.

[0131] To pull down the cross-linked proteins, equal amounts of cell lysates were incubated with pre-washed streptavidin magnetic beads at room temperature with continuous rotation for 1 hour. The beads were subjected to protein digestion to isolate the target proteins, and the samples were processed for mass spectrometry analysis. Each sample was analyzed three times. After the raw data files were processed, Mascot Distiller was used to generate the Mascot generic format, and the SwissProt_2012_01 (human) database was searched using the Mascot search engine v2.3.02 running on an in-house server. Proteins from the control (R4) pull-down were ignored in the experimental thioaptamer pull-downs. The hits that remained were considered unique. Thus, Tau_1 bound tightly to HSPD1 (emPAI > 6) and KRT6A / KRT6B (emPAI ~ 0.38). Tau_3 bound tightly to VIM (emPAI = 2.7) and HSPD1 (emPAI ~ 0.62). Tau_4 bound to HSPD1 (emPAI ~ 1.08) and KRT6A (emPAI ~ 0.79). The VisANT database generated the links between each of these and tau proteins, as Figure 4 shown. The identification of HSPs indirectly confirmed that the cell model did cause misfolding. The redistribution of VIM in the cytoskeleton and membrane was thought to be related to the formation of tau protein aggregates. However, no mechanistic studies have been conducted. Keratin 9 is associated with tau pathology but not with KRT6A / KRT6B.

[0132] After the thioaptamers Tau_1 (SEQ ID NO:5), Tau_3 (SEQ ID NO:6), Tau_4 (SEQ ID NO:12), and Tau_5 (SEQ ID NO:14) were synthesized with 3’ Cy3 tags respectively, they were incubated with the brain tissues of P301S mice, and then counterstained with one of the pTau antibodies, AT100 (indicating late phosphorylation) or AT8 (indicating early phosphorylation). Tau_3 had the strongest staining and bound to the hippocampal tissue in a highly correlated manner with the AT100 antibody ( Figure 5 A), but not with AT8 ( Figure 5 B), and did not stain normal brain tissues ( Figure 5 C). Therefore, Tau_3 is a suitable marker for Tau phosphorylation.

[0133] Table 2: The first 250 aptamer sequences of the 26th SELEX cycle (the numerical values of the identifiers in Table 2 are related to the numerical values of the identifiers in Table 1)

[0134]

[0135]

[0136]

[0137]

[0138]

[0139]

[0140]

[0141]

[0142] Example 2 - MRI Visualization of Hyperphosphorylated Neurons in Vivo Using Gadolinium-Containing Thioaptamer-Targeted Liposome Nanoparticles in a P301S Mouse Tau Protein Deposition Model Figure 5

[0143] In vitro and ex vivo studies as described above indicate that Tau_3 is a suitable candidate thioaptamer that binds to AT100-positive hyperphosphorylated neurons (indicating late-stage hyperphosphorylation). Therefore, the inventors chose to test the ability of the Tau_3 (SEQ ID NO:6) aptamer to target nanoparticles to tau pathology sites in a mouse model of Alzheimer's disease proteinopathy (P301S). In addition, Tau_1 (SEQ ID NO:5) targeted nanoparticles were tested because they were the most common in the SELEX screen, although they did not show binding to mouse brain tissue in vitro in a pTau-specific manner. The synthesized aptamer has a conjugateable amine terminus at the 3' end and is linked to carboxyl-containing liposomes (HSPC: cholesterol: DSPE-DOTA-Gd: DSPE-PEG3400-COOH: MPEG2000DSPE: PE-rhodamine, 31.3:40:25:0.5:3:0.2 molar ratio) by carbodiimide chemistry (EDC + sulfo-NHS). More specifically, the liposomes were prepared by first dissolving the lipids and conjugate in tert-butanol and hydrating in saline at a total lipid concentration of 50 mM, followed by extrusion through 400 and 200 nm nuclear pore track-etched membranes, then dialysis against PBS and concentration to a total lipid concentration of 100 mM using a hygroscopic gel. The liposomes (5 mL) were activated with 2 mM EDC and 3 mM sulfo-NHS (equivalent to a 10-fold excess of EDC), followed by the addition of 500 μL of aptamer (1 μmole total) at pH 7.5 and reaction at room temperature for 2 hours. After storing the liposomes overnight at 4 °C, they were dialyzed against PBS with a molecular weight cut-off of 1000 kDa and pH 7.5 to remove free aptamer. After dialysis, the liposomes were concentrated to 1.9 mL using a centrifugal column with a molecular weight cut-off of 3000 Da and analyzed by nanodrop to quantify the aptamer concentration. It was estimated that approximately 400 thioaptamer molecules were attached to each liposome. The relevant procedures are described in recent publications and are incorporated herein by reference in their entirety. Mu, Q. et al., Molecular Therapy - Nucleic Acids 5, e382 (2016); Mann et al., Oncotarget 2, 298–304 (2011).

[0144] In terms of MRI, P301S mice at 2, 6, and 9 months of age, as well as age-matched non-transgenic littermate mice, were tested. Intracellular tau pathology begins to appear in this model at 6 months of age, and typical intracellular and extracellular (ghost) pathology appears at 9 months of age. Thus, the inventors tested the pre-pathological, pathological onset, and late pathological stages of the disease. Prior to injection, pre-scanning was performed according to the following sequence: T2-weighted FSE (2 outer averages) - scan time: 12 min (anatomical reference scan) TR = 6500, TE = 80, SliceThk = 1.2 mm, matrix = 192x192, NEX = 2 FA = 90, slices = 16, FOV = 30 mm. T1-weighted SE (4 outer averages) - scan time: 14 min. TR = 260, TE = 8.8, SliceThk = 1.2 mm, matrix = 192x192, NEX = 4 FA = 90, slices (2D / 3D) = 8 / 16, FOV = 30 mm. T1-weighted GRE (5 flip angles) - scan time: 7 min. TR = 20, TE = 3.6, SliceThk = 1.2 mm, matrix = 192x192, NEX = 1 FA = [8 15 25 35 45 70]°, slices = 16, FOV = 30 mm.

[0145] Animals were then treated with Tau_1 (SEQ ID NO:5)-aptamer-targeted liposomes, Tau_3 (SEQ ID NO:6)-aptamer-targeted liposomes, or non-targeted polyethylene glycolylated control liposome formulations containing all remaining components (Gd chelator conjugate, rhodamine, and matrix lipid). The liposome dose was approximately 250 μL per mouse, calibrated to a total of 0.2 mmol Gd per kilogram of body weight. A rapid "localization scan" confirmed the addition of the contrast agent, and then the animals were returned to their cages after anesthesia recovery and allowed the contrast agent to circulate, extravasate, and bind to the target over 4 days. At the 96-hour time point (after clearance of the contrast agent from the circulation, any remaining contrast agent must be bound or sequestered in some way), after all animals were imaged in the same order as above, they were sacrificed and the brain, liver, spleen, and kidneys were collected for subsequent analysis. Histological examination of spleen and liver tissues showed contrast agent accumulation (visible by rhodamine signal), but no obvious signs of toxicity.

[0146] Tau_1 (SEQ ID NO:5)- and Tau_3 (SEQ ID NO:6)-targeted liposomes appear to bind to the cortex, hippocampus, and parts of the thalamus and hypothalamus of young (2-month-old) P301s transgenic animals, but not to wild-type littermate mice ( Example 3 - Signal Quantification of T1 Maps) binds to parts of the cortex, hippocampus, thalamus, and hypothalamus. Similar results were obtained in older animals. To quantify the predictive accuracy of the Tau_1 (SEQ ID NO:5) and Tau_3 (SEQ ID NO:6) targeted liposomal formulations, the signal enhancement of 1.2-mm thick sections of brain regions near section 55 of the Paxinos atlas (including the cerebral cortex, hippocampus, and hypothalamus) was calculated. For this purpose, a 45° GRE sequence was used because this sequence seemed to have the best signal. In an independent study, the scan-scan variability (95% confidence interval) of the baseline signal intensity of the same animal on different days was approximately 5%. Therefore, at each comparison, the signal intensity changes of all 20 animals covering all 3 age groups were quantified using a 6-point scale:

[0147] 1: Absolute negative (< -10%); 2: Very likely negative (-5% to -10%); 3: Likely negative (0 to -5%); 4: Likely positive (0 to +5%); 5: Very likely positive (+5% to +10%); 6: Absolute positive (> +10%).

[0148] Using the genotype as the gold standard, the ROC curve, as well as the predictive accuracy, sensitivity, and specificity, were calculated using the JROCFIT calculator. P301S mice start to show synaptic tau pathology at 3 months of age, intracellular filaments at approximately 6 months of age, and neurofibrillary tangles at approximately 9 months of age. There is little to no tau pathology at 2 months of age. Notably, even in 2-month-old mice, the aptamer-targeted nanoparticles showed a positive signal by MRI, with an estimated accuracy of 80% (sensitivity of approximately 57% and specificity of approximately 92%). This is an unprecedented result because aptamer-targeted nanoparticles can predict the onset of tau pathology before the formation of intracellular tangles.

[0149] Figure 7

[0150] Since multiple flip angle images were acquired, the actual T1 values of the pre-contrast and post-contrast images were calculated. The signal equation for the spoiled gradient echo sequence is: where k is a scaling factor and [H] is a function of the spin density. Assuming a constant spin density, the short TE relative to T2* is consistent with a T1-weighted sequence, and T1 can be estimated by non-linear fitting of the signal at multiple flip angles, which is a well-known technique.

[0151] The advantage of this method is that, although the T1-weighted signal intensity itself has no quantitative relationship with the contrast agent concentration, the 1 / ΔT1 value is proportional to the concentration, and the proportionality constant is equal to the molar relaxation rate of the T1 shortening agent. Therefore, the local contrast agent concentration can be estimated and the local drug dosage can be quantified in this way. In addition, the T1 map is a contrast agent localization marker. Since the T1 map effectively takes into account the information of all flip angles, the T1 map can highlight changes that are not obvious at a single flip angle, such as Example 4 - MRI Visualization of Hyperphosphorylated Neurons in Vivo Using Gadolinium-Containing Thioaptamer-Targeted Liposome Nanoparticles in a P301S Mouse Tau Protein Deposition Model shown, where the 45° flip angle image mainly shows thalamus / hypothalamus enhancement, but the T1 map also shows a significant shortening of T1 in the hippocampus.

[0152] Figure 8 ​

[0153] Two liposomal formulations ("ADx-Tau1" and "ADx-Tau3") were prepared for in vivo experiments. The ADx-Tau1 formulation contains the amino-terminated Tau-1 (SEQ ID NO:5) aptamer (5’- / 5AmMC6 / CGC TCG ATA GAT CGA GCT TCG CCCACG GTC TCC GCT CCA CAA GTT CAC GTC GAT CAC GCT CTA GAG CAC TG-3’-SEQ ID NO:256). The ADx-Tau3 formulation contains the amino-terminated Tau_3 (SEQ ID NO:6) aptamer (5’- / 5AmMC6 / CGC TCG ATAGAT CGA GCT TCG CCC ACG GTC TCC GCT CCA CAA GTC CAC GTC GAT CAC GCT CTA GAGCAC TG-3’-SEQ ID NO:257). The synthesized aptamers have a conjugateable amine terminus at the 3’ end and are linked to liposomes containing DSPE-PEG3400-COOH by known carbodiimide chemistry (EDC + sulfo-NHS). The lipid composition and molar ratio (%) used to prepare the ADx-Tau formulations were HSPC: cholesterol: DSPE-mPEG2000: DSPE-PEG3400-COOH: DSPE-DOTA-Gd = 31.5:40:3:0.5:25. Approximately 250 - 500 molecules of the Tau_1 aptamer and approximately 150 - 400 molecules of the Tau_3 aptamer were conjugated to the liposomes.

[0154] As a control, a non-targeted ADx-Tau formulation lacking the targeting aptamer ("ADx-Un") (prepared without DSPE-PEG3400-COOH when forming the lipid bilayer) was also prepared and included in the in vivo study.

[0155] The efficacy of the ADx-Tau formulation was tested in a P301S mouse model of Tau pathology. Animals (wild-type and transgenic) underwent ADx-Tau-activated MRI at an early age (2-3 months) to detect any pre-Tau pathology. Histological analysis of brain sections showed the presence of fibrillar tau protein deposits in the cortex, hippocampus, and brainstem of transgenic mice ≥7 months old.

[0156] MRI was performed on a 1T permanent magnet scanner (M7 system, Aspect Imaging, Shoham, Israel). Mice were sedated with 2.5% isoflurane and placed on a custom bed with an integrated face mask for continuous anesthesia by inhalation (1-2% isoflurane). Respiratory rate was monitored using a pneumatically controlled pressure pad placed under the abdomen of the mouse. MR images were acquired using the following sequences and scan protocols: (1) T1-weighted spin echo (T1w-SE) sequence (repetition time (TR) = 260 ms, echo time (TE) = 8.5 ms, slices = 16, voxel size: 0.16 x 0.16 x 1.2 mm, scan time = 8 min), (2) fast spin echo inversion recovery (FSE-IR) sequence, which approximates a T1w-fluid attenuated inversion recovery (T1w-FLAIR) sequence (TR = 13500 ms, TE = 86 ms, TI = 2000 ms, slices = 6, voxel size: 0.16 x 0.16 x 2.4 mm). The 1T scanner was used because its field strength is closer to the commonly used clinical 1.5T, thus increasing the translational relevance of these small animal studies, and the relaxation rate of Gd nanoparticles is higher at low field strengths. Delayed post-contrast scans were performed four days after intravenous injection of the contrast agent (ADx-Tau1, ADx-Tau3, or ADx-Un). Pre- and post-contrast scans were performed using the T1w-SE and FSE-IR sequences with parameters listed above. After the mice were fed until 7-9 months old, they were sacrificed using the AT100 antibody for postmortem histological examination to verify pTau pathology.

[0157] To account for differences between mice and potential artifacts due to positioning or MR instrument factors, the mean and standard deviation of the MR signal intensity of the T1w-SE and FSE-IR sequences were determined for all wild-type and transgenic mice. The threshold signal intensity of the molecular weight cut-off for the two sequences was then estimated and set at two standard deviations above the mean, and expressed as a percentage of the mean signal intensity: 5.1% (FSE-IR) and 5.6% (T1w-SE).

[0158] Qualitative and quantitative analyses of MRI images were performed in OsiriX (version 5.8.5, 64-bit) and MATLAB (version 2015a). Brain extraction was performed in OsiriX using a method combining thresholding and manual segmentation. Signal changes between pre-contrast and delayed post-contrast images were evaluated by quantifying the signal intensity in the cortical region near the center of the image stack. Tau protein-positive mice were identified by evaluating the signal enhancement in the cortex and hippocampus before and after delayed contrast. Signal changes between pre-contrast and post-contrast images were quantified by integrating the signals in the region of interest (ROI), which included cortical tissue in the central slice of the MRI volume. Signal enhancement in the delayed MR images of Tau protein-positive mice activated by ADx-Tau (determined by the genotype and expression phenotype of ataxia and / or hind limb paralysis at 7-9 months of age) was observed to be higher than the signal variance threshold and was considered a true positive result. In contrast, signal enhancement between pre-contrast and delayed post-contrast images in tau protein-negative mice was lower than the signal variance threshold and was considered a true negative result. ROC curves were generated on a six-point scale to evaluate the sensitivity and specificity of ADx-Tau. Sensitivity was determined by the ratio of true positives identified by MRI to the total number of true positives. Specificity was determined by the ratio of true negatives identified by MRI to the total number of true negatives. Accuracy was represented by the area under the curve (AUC) of the empirical ROC curve.

[0159] In 2-month-old transgenic mice, when tau protein deposition had not yet occurred, MR signal enhancement was observed after injection of ADx-Tau1 or ADx-Tau3, while wild-type mice ( ​ ) showed less signal enhancement. After injection of non-targeted agents (ADx-Un) into transgenic mice, no MR signal enhancement was observed. AT100 staining of P301S cortical brain sections showed elevated pTau levels relative to wild-type mice (Figure 9). When compared with the gold standard of genotype verification and expression phenotype of ataxia and / or hind limb paralysis at 7-9 months of age, the accuracy of both ADx-Tau1 and ADx-Tau3 aptamer-targeted particles using the FSE-IR sequence (Figure 10) was approximately 75%.

[0160] All patents, patent applications, and publications, as well as the full text of the electronic materials cited herein, are hereby incorporated by reference in their entirety. The above detailed description and examples are for clarity of understanding only. Therefore, no unnecessary limitations should be construed. The present invention is not limited to the specific details shown and described, and variations that are obvious to those skilled in the art will be included within the scope of the invention as defined by the claims. SEQUENCE LISTING <110> Alzeca Biosciences, LLC Texas Children's Hospital <120> TARGETING LIGANDS FOR TAU PATHOLOGY <130> Alzeca-122 <150> 62 / 871380 <151> 2019-07-08 <160> 257 <170> PatentIn version 3.5 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 1 gatatgtcta gagcctcaga tca 23 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 2 cggagttatg ttagcagtag c 21 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 3 cgctcgatag atcgagcttc g 21 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 4 gtcgatcacg ctctagagca c 21 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 5 ccccccacgg tctccgctcc acaagttcac 30 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 6 ccccccacgg tctccgctcc acaagtccac 30 <210> 7 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 7 ccccccacgg tctccgctcc acaggttcac 30 <210> 8 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 8 ctcgtgggtg tacggtggtg ctgttgtgtg 30 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 9 cccccccacg gtctccgctc cacaagttca 30 <210> 10 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 10 ctcgtgggtg tgtggtggtg ttgttgtgtg 30 <210> 11 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 11 ccccccacgg tctccgctcc acaagcccac 30 <210> 12 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 12 ctcgtcccac cacaacatca tctcaacgcc 30 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 13 ctcgtcccac cacaacatta tctcaacgcc 30 <210> 14 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 14 ctcgtgggtg tacggtggtg ttgttgtgtg 30 <210> 15 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 15 ctccgacggg atgttcgatg agcacacact 30 <210> 16 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 16 cccccccacg gtctccgctc cacaagtcca 30 <210> 17 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 17 ccccccacgg tctccgctcc acaggtccac 30 <210> 18 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 18 cccccattgg ctccgctcca cacagcttca 30 <210> 19 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 19 ccccccacgg tctccgctcc acaagctcac 30 <210> 20 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 20 cccccccacg gtctccgctc cacaggttca 30 <210> 21 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 21 ctcgtcccac cacaacattg tctcaacgcc 30 <210> 22 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 22 ctcgtcccac cacaacacca tctcaacgcc 30 <210> 23 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 23 ctccgacggg gtgttcgatg agcacacact 30 <210> 24 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 24 ccccccgcgg tctccgctcc acaagttcac 30 <210> 25 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 25 tgggtgtgtg gtggtgttgt tgtgtgggtg 30 <210> 26 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 26 ctcgccccac cacaacatca tctcaacgcc 30 <210> 27 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 27 ccccccacgg tctccgctcc acaagttcgc 30 <210> 28 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 28 cccccccacg gtctccgctc cacaagctca 30 <210> 29 <211> 74 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <220> <221> misc_feature <222> (24)..(53) <223> n is a, c, g, or t <400> 29 gatatgtcta gagcctcaga tcannnnnnn nnnnnnnnnn nnnnnnnnnn nnncggagtt 60 atgttagcag tagc 74 <210> 30 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 30 cgctcgatag atcgagcttc gcccacggtc tccgctccac aagttcacgt cgatcacgct 60 ctagagcact g 71 <210> 31 <211> 71 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 31 cgctcgatag atcgagcttc gcccacggtc tccgctccac aagtccacgt cgatcacgct 60 ctagagcact g 71 <210> 32 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 32 ctttgaccca aacacaactg cggtgaatcc 30 <210> 33 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 33 ctccaacctg gaccccaaac gaactgagat 30 <210> 34 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 34 cacgtcaacc acaccaaatt ggggaccgaa 30 <210> 35 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 35 ctcgtacgtc aacctcacca aattgggaac 30 <210> 36 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 36 ctcgcacgtc aaccacacca aattggggac 30 <210> 37 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 37 ctcgtacgtc aaccacacca aattggggac 30 <210> 38 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 38 ctcgtctcac cacaacatta tctcaacgcc 30 <210> 39 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 39 ctcgtctcac cacaacatca tctcaacgcc 30 <210> 40 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 40 ctcgcctcac cacaacatta tctcaacgcc 30 <210> 41 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 41 ctcgccccac cacaacatta tctcaacgcc 30 <210> 42 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 42 ctcgcctcac cacaacatca tctcaacgcc 30 <210> 43 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 43 ctcgtctcac cataacatta tctcaacgcc 30 <210> 44 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 44 ctcgtcccac cataacatta tctcaacgcc 30 <210> 45 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 45 ctcgtcccac cataacatca tctcaacgcc 30 <210> 46 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 46 ctcgcctcac cataacatta tctcaacgcc 30 <210> 47 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 47 ctcgccccac cataacatta tctcaacgcc 30 <210> 48 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 48 ctcgccccac cataacatca tctcaacgcc 30 <210> 49 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 49 ctcgcctcac cataacatca tctcaacgcc 30 <210> 50 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 50 ctcgcctcac cacaacatta tcccaacgcc 30 <210> 51 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 51 ctcgccccac cacaacatta tcccaacgcc 30 <210> 52 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 52 ctcgcctcac cacaacattg tcccaacgcc 30 <210> 53 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 53 ctcgccccac cacaacattg tcccaacgcc 30 <210> 54 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 54 ctcgtcccac cacaacattg tctcaatgcc 30 <210> 55 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 55 ctcgccccac cacaacattg tctcaatgcc 30 <210> 56 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 56 ctcgccccac cacaacattg tctcaacgcc 30 <210> 57 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 57 ctcgcctcac cacaacattg tctcaacgcc 30 <210> 58 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 58 ctcgtctcac cacaacattg tctcaacgcc 30 <210> 59 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 59 ctcgtcccac cacaacattg cctcaacgcc 30 <210> 60 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 60 ctcgtcccac cacaacatcg tctcaacgcc 30 <210> 61 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 61 ctcgtcccac cataacattg tctcaacgcc 30 <210> 62 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 62 ctcgtcccac cacaacacta tcccaacgcc 30 <210> 63 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 63 ctcgtctcac cacaacatta tcccaacgcc 30 <210> 64 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 64 ctcgtcccac cacaacatca tcccaacgcc 30 <210> 65 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 65 ctcgtcccac cacaacatta tcccaacgcc 30 <210> 66 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 66 ctcgtcccac cacaacattg tcccaacgcc 30 <210> 67 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 67 ctcgtcccac cacaacaata tctcaacgcc 30 <210> 68 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 68 ctcgtcccac cacaacatta tctcgacgcc 30 <210> 69 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 69 ctcgtcccac cgcaacatta tctcaacgcc 30 <210> 70 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 70 ctcgcctcac cacaacatta tctcaatgcc 30 <210> 71 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 71 ctcgcctcac cacaacatca tctcaatgcc 30 <210> 72 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 72 ctcgtcccac cacaacatca tctcaatgcc 30 <210> 73 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 73 ctcgtcccac cacaacatta tctcaatgcc 30 <210> 74 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 74 ctcgtcccac cacaacacca tctcaatgcc 30 <210> 75 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 75 ctcgtcccac cacaacacta tctcaatgcc 30 <210> 76 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 76 ctcgccccac cacaacacca tctcaatgcc 30 <210> 77 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 77 ctcgccccac cacaacatta tctcaatgcc 30 <210> 78 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 78 ctcgccccac cacaacatca tctcaatgcc 30 <210> 79 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 79 ctcgtcccac cacaacacca cctcaacgcc 30 <210> 80 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 80 ctcgtcccac cacaacatca cctcaacgcc 30 <210> 81 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 81 ctcgtcccac cataacacca tctcaacgcc 30 <210> 82 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 82 ctcgtcccac cataacacta tctcaacgcc 30 <210> 83 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 83 ctcgtctcac cacaacacta tctcaacgcc 30 <210> 84 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 84 ctcgtctcac cacaacacca tctcaacgcc 30 <210> 85 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 85 ctcgtcccac cacaacacta tctcaacgcc 30 <210> 86 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 86 ctcgtcccac cacaacactg tctcaacgcc 30 <210> 87 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 87 ctcgtcccac cacaacaccg tctcaacgcc 30 <210> 88 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 88 ctcgtcccac cacagcatta tctcaacgcc 30 <210> 89 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 89 ctcgtcccac cacagcatca tctcaacgcc 30 <210> 90 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 90 ctcgtcccac cacaacatta tctcagcgcc 30 <210> 91 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 91 ctcgtcccac cacaacatca tctcagcgcc 30 <210> 92 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 92 ctcgtcccgc cacaacatta tctcaacgcc 30 <210> 93 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 93 ctcgtcccgc cacaacatca tctcaacgcc 30 <210> 94 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 94 ctcgcctcac cacaacacaa tctcaatgcc 30 <210> 95 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 95 ctcgcctcac cataacacaa tctcaacgcc 30 <210> 96 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 96 ctcgcctcac cacaacacta tctcaacgcc 30 <210> 97 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 97 ctcgcctcac cacaacacaa tctcaacgcc 30 <210> 98 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 98 ctcgcctcac cacaacacca tctcaacgcc 30 <210> 99 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 99 ctcgccccac cacaacacta tctcaacgcc 30 <210> 100 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 100 ctcgccccac cacaacacca tctcaacgcc 30 <210> 101 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 101 ctcgccccac cacaacacaa tctcaacgcc 30 <210> 102 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 102 ctcgccccac cacaacactg tctcaacgcc 30 <210> 103 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 103 ctcgcctcac cacaacactg tctcaacgcc 30 <210> 104 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 104 ctcgcctcac cacaacaccg tctcaacgcc 30 <210> 105 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 105 ctcgccccac cacaacaccg tctcaacgcc 30 <210> 106 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 106 ctcgtgtcca caccattcac aacgccaaat 30 <210> 107 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 107 cctcaccaca acattgtctc aacgccacaa 30 <210> 108 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 108 tcccaccaca acattgtctc aacgccacaa 30 <210> 109 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 109 ccccaccaca acattgtctc aacgccacaa 30 <210> 110 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 110 tcccaccaca acactgtctc aacgccacaa 30 <210> 111 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 111 tcccaccaca acaccgtctc aacgccacaa 30 <210> 112 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 112 tcccaccaca acattatctc aacgccacaa 30 <210> 113 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 113 tcccaccaca acatcatctc aacgccacaa 30 <210> 114 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 114 tcccaccaca acaccatctc aacgccacaa 30 <210> 115 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 115 tcccaccaca acactatctc aacgccacaa 30 <210> 116 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 116 tcccaccaca acattatctc aacgccacag 30 <210> 117 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 117 tcccaccaca acatcatctc aacgccataa 30 <210> 118 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 118 tcccaccaca acattatctc aacgccataa 30 <210> 119 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 119 tcccaccaca acattgtctc aacgccataa 30 <210> 120 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 120 tcccaccaca acatcatctc aatgccacaa 30 <210> 121 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 121 tcccaccaca acaccatctc aatgccacaa 30 <210> 122 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 122 ccccaccaca acattatctc aacgccacaa 30 <210> 123 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 123 ccccaccaca acatcatctc aacgccacaa 30 <210> 124 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 124 cctcaccaca acattatctc aacgccacaa 30 <210> 125 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 125 cctcaccaca acatcatctc aacgccacaa 30 <210> 126 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 126 ccccaccaca acaccatctc aacgccacaa 30 <210> 127 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 127 cctcaccaca acacaatctc aacgccacaa 30 <210> 128 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 128 gcgccgccta cgcacaacca atcacaccat 30 <210> 129 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 129 gcgccgccta cgcacaacca atcacaccac 30 <210> 130 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 130 cccacagcac caacacacac acccgtataa 30 <210> 131 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 131 cccacagcac caacacacac atccgtataa 30 <210> 132 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 132 ctcgcccaca gcaccaacac acatacccgt 30 <210> 133 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 133 ctcgcccaca gcaccaacac acacacccgt 30 <210> 134 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 134 ctcgcccaca gcaccaacac acacatccgt 30 <210> 135 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 135 ctcgcccaca gcaccaacac acacatccgc 30 <210> 136 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 136 ctcgcccaca gcaccaacac acacacccgc 30 <210> 137 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 137 ctccgacacc acgaggagat gcacctgcaa 30 <210> 138 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 138 ctcgaacaca cccagggaat acacgaaaca 30 <210> 139 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 139 ctccccacag tctccacccc acaagcccac 30 <210> 140 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 140 ctccccacag tctccattcc acaagctcac 30 <210> 141 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 141 ctccccacag tctccactcc acaagctcac 30 <210> 142 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 142 ctccccacag tctccattcc acaggcccac 30 <210> 143 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 143 ctccccacag tctccactcc acaggcccac 30 <210> 144 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 144 ctccccacag tctccactcc acaagcccac 30 <210> 145 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 145 ctccccacag tctccattcc acaagcccac 30 <210> 146 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 146 ctccccacag tccccactcc acaagcccac 30 <210> 147 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 147 ctccccacag tccccattcc acaagcccac 30 <210> 148 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 148 ctccccacag cctccactcc acaagtccac 30 <210> 149 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 149 ctccccacag cctccactcc acaagcccac 30 <210> 150 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 150 ctccccacag cctccattcc acaagctcac 30 <210> 151 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 151 ctccccacag cctccattcc acaagcccac 30 <210> 152 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 152 ctccccacag cccccattcc acaagcccac 30 <210> 153 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 153 ctccccacag tctccactcc acaagttcac 30 <210> 154 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 154 ctccccacag tccccactcc acaagttcac 30 <210> 155 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 155 ctccccacag tctccattcc acaagttcac 30 <210> 156 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 156 ctccccacag tccccattcc acaagttcac 30 <210> 157 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 157 ctccccacag cctccattcc acaagttcac 30 <210> 158 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 158 ctccccacag cctccactcc acaagttcac 30 <210> 159 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 159 ctccccacag cccccactcc acaagttcac 30 <210> 160 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 160 ctccccacag cccccattcc acaagttcac 30 <210> 161 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 161 ctccccacag cccccactcc acaagtccac 30 <210> 162 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 162 ctccccacag tctccactcc acaagtccac 30 <210> 163 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 163 ctccccacag tccccactcc acaagtccac 30 <210> 164 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 164 ctccccacag cctccattcc acaagtccac 30 <210> 165 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 165 ctccccacag tctccattcc acaagtccac 30 <210> 166 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 166 ctccccacag tccccattcc acaagtccac 30 <210> 167 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 167 ctccccacag cccccattcc acaagtccac 30 <210> 168 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 168 ctccccacag tctccacccc acaagttcac 30 <210> 169 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 169 ctccccacag cctccacccc acaagttcac 30 <210> 170 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 170 ctccccacag tccccactcc acaggttcac 30 <210> 171 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 171 ctccccacag tctccactcc acaggttcac 30 <210> 172 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 172 ctccccacag tctccattcc acaggttcac 30 <210> 173 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 173 ctccccacag cctccattcc acaggttcac 30 <210> 174 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 174 ctccccacag cctccactcc acaggttcac 30 <210> 175 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 175 ccccccattg gctccgctcc acacagcttc 30 <210> 176 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 176 cccccattgg ctccgctcca cacggcttca 30 <210> 177 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 177 cccccattgg ctccgctcca cacaacttca 30 <210> 178 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 178 cccccattgg ctccgctcca cacagcctca 30 <210> 179 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 179 cccccccgcg gtctccgctc cacaagttca 30 <210> 180 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 180 cccccccacg gtctccgctc cacaagccca 30 <210> 181 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 181 cccccccacg gtctccgctc cacaggtcca 30 <210> 182 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 182 cccccacggt ctccgctcca caagttcaca 30 <210> 183 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 183 cccccacggt ctccgctcca caagtccaca 30 <210> 184 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 184 ccccccacgg tctccgctcc acaagcacac 30 <210> 185 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 185 ccccccacgg tctccgctcc acaggcccac 30 <210> 186 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 186 ccccccacgg tctccgctcc acaggctcac 30 <210> 187 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 187 ccccccacgg tctccgctcc acaagtccgc 30 <210> 188 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 188 ccccccacgg cctccgctcc acaagttcac 30 <210> 189 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 189 ccccccacgg cctccgctcc acaagtccac 30 <210> 190 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 190 ccccccccgg tctccgctcc acaagttcac 30 <210> 191 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 191 ccccccgcgg tctccgctcc acaagtccac 30 <210> 192 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 192 ctctctggtc cccccggccg tccctctcat 30 <210> 193 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 193 ctcgtaccac ccccggccgt ccctctcatc 30 <210> 194 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 194 ctccccgtcc acctcgcacc caaggcaatc 30 <210> 195 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 195 ctccccgtcc acctcgcact caaggcaatc 30 <210> 196 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 196 ctccccgtcc accccgcact caaggcaatc 30 <210> 197 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 197 ctccccccca cctggcactg tccccggaga 30 <210> 198 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 198 ctccccacct ggcactgtcc caacgccaca 30 <210> 199 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 199 ctcggccagc agttacagca caccacactt 30 <210> 200 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 200 ctccgacggg atgttcgacg agcacacact 30 <210> 201 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 201 ctccgacggg gtgttcgacg agcacacact 30 <210> 202 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 202 ccccgacggg atgttcgatg agcacacact 30 <210> 203 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 203 ctccgacggg atgttcgatg agcacacacc 30 <210> 204 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 204 tgccctccgc tcgtattgtc accccgcaat g 31 <210> 205 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 205 cgcctgctgc cttcccatac gtcgatccag 30 <210> 206 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 206 cgcctgctgc cttcccacac gtcgatccag 30 <210> 207 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 207 cgcctgctgc cttcctatac gccgatccag 30 <210> 208 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 208 cgcctgctgc cttcctatac gtcgatccag 30 <210> 209 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 209 cgcctgctgc cttcctgtac gtcgatccag 30 <210> 210 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 210 cgcctgctgc cttcctgtac gccgatccag 30 <210> 211 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 211 ctcgctgacc agatgagggg ggtttactgg 30 <210> 212 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 212 ctcgctgacc agatgaaggg ggtttactgg 30 <210> 213 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 213 ctcgccgacc agatgaaggg gggtttactg 30 <210> 214 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 214 ctcgctgacc agatggaggg gggtttactg 30 <210> 215 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 215 ctcgctgacc aggtgaaggg gggtttactg 30 <210> 216 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 216 ctcgctggcc agatgaaggg gggtttactg 30 <210> 217 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 217 ctcgctgacc ggatgaaggg gggtttactg 30 <210> 218 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 218 ctcgctgacc agacgaaggg gggtttactg 30 <210> 219 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 219 ctcgctgacc agatgaaggg gggtttgctg 30 <210> 220 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 220 ctcgctgacc agatgagggg gggtttactg 30 <210> 221 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 221 ctcgctgacc agatgaaggg gggtttactg 30 <210> 222 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 222 ctcgctgacc agatgaaggg gggcttactg 30 <210> 223 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 223 ctgaccagat gaaggggggg tttactgggg 30 <210> 224 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 224 ctgaccagat ggaggggggt ttactggggg 30 <210> 225 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 225 ccgaccagat gaaggggggt ttactggggg 30 <210> 226 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 226 ctggccagat gaaggggggt ttactggggg 30 <210> 227 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 227 ctgaccaggt gaaggggggt ttactggggg 30 <210> 228 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 228 ctgaccggat gaaggggggt ttactggggg 30 <210> 229 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 229 ctgaccagat gagggggggt ttactggggg 30 <210> 230 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 230 ctgaccagat gaaggggggt ttgctggggg 30 <210> 231 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 231 ctgaccagat gaaggggggt ttactggggg 30 <210> 232 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 232 ctgaccagat gaaggggggc ttactggggg 30 <210> 233 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 233 gtgggtgtgt atgtgtggcg ggggtgcgtt 30 <210> 234 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 234 ggtgtattct ccgtggcggg ggtgcgttgg 30 <210> 235 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 235 ttgggtgtat tctccgtggc ggggtgcgtt 30 <210> 236 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 236 ctcgggttca tgtgttgtgt gggtgggggt 30 <210> 237 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 237 ggttcatgtg ttgtgtgggt gggggtgtgt 30 <210> 238 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 238 ctcggtgtcc agattgatgt tggggtgggg 30 <210> 239 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 239 tgggtgtgcg gtggtgttgt tgtgtgggtg 30 <210> 240 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 240 tgggtgtgtg gtggtgttgt tgtgtggatg 30 <210> 241 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 241 tgggtgtacg gtggtgttgt tgtgtgggtg 30 <210> 242 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 242 tgggtatacg gtggtgttgt tgtgtgggtg 30 <210> 243 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 243 tgggtgtacg gtagtgttgt tgtgtgggtg 30 <210> 244 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 244 tgggtgtacg gttgtgttgt tgtgtgggtg 30 <210> 245 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 245 ctcgtgggta tgcggtggtg ttgttgtgtg 30 <210> 246 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 246 ctcgtgggtg tatggtggtg ttgttgtgtg 30 <210> 247 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 247 ctcgcgggtg tgtggtggtg ttgttgtgtg 30 <210> 248 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 248 ctcgtgggtg tgtggtagtg ttgttgtgtg 30 <210> 249 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 249 ctcgtgggtg tgtggttgtg ttgttgtgtg 30 <210> 250 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 250 ctcgtgggtg tgtggtggtg ctgttgtgtg 30 <210> 251 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 251 ctcgtgggtg tgcggtggtg ttgttgtgtg 30 <210> 252 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 252 ctcgtgggta tacggtagtg ttgttgtgtg 30 <210> 253 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 253 ctcgtgggta tacggttgtg ttgttgtgtg 30 <210> 254 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 254 ctcgtgggta tacggtggtg ttgttgtgtg 30 <210> 255 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 255 ctcgtgggtg tacggtagtg ttgttgtgtg 30 <210> 256 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 256 ctcgtgggtg tacggttgtg ttgttgtgtg 30 <210> 257 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 257 ctcgtgggtg cacggtggtg ttgttgtgtg 30

Claims

1. A composition for identifying tau pathology, comprising a targeting ligand that specifically binds to a tau pathology cell surface marker, wherein the targeting ligand is linked to a liposome containing an imaging agent, and wherein the targeting ligand is a DNA nucleotide sequence selected from the group consisting of: Tau_1 (SEQ ID NO:5), Tau_3 (SEQ ID NO:6).

2. The composition according to claim 1, wherein The targeting ligand includes an aptamer.

3. The composition according to claim 1, wherein The targeting ligand includes a stabilized aptamer.

4. The composition according to claim 1, wherein The targeting ligand includes a thiolated aptamer.

5. The composition according to claim 1, wherein The tau pathology cell surface marker includes a cell surface marker with hyperphosphorylated tau protein.

6. The composition according to claim 1, wherein The specific binding of the targeting ligand to the tau pathology cell surface marker is determined by the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) method.

7. The composition according to claim 1, wherein The cell surface markers of the tau pathology include proteins selected from KRT6A, KRT6B, HSP, and VIM.

8. The composition according to claim 1, wherein Multiple targeting ligands are linked to the liposome.

9. The composition according to claim 1, wherein The targeting ligand is linked to polyethylene glycol, and the polyethylene glycol is conjugated to a phospholipid that binds to the liposome.

10. The composition according to claim 1, characterized in that The imaging agent includes a magnetic resonance imaging (MRI) contrast enhancer.

11. The composition according to claim 1, characterized in that The liposome consists of a membrane that contains: A first phospholipid; A sterically bulky excipient capable of stabilizing the liposome; A second phospholipid derived from a first polymer; A third phospholipid derived from a second polymer conjugated to the targeting ligand; An imaging agent encapsulated by or bound to the membrane.

12. The composition according to claim 11, wherein The targeting ligand includes a thiolated aptamer, and the imaging agent includes an MRI contrast enhancer.

13. The composition according to claim 11, wherein: The first phospholipid includes HSPC; The sterically bulky excipient capable of stabilizing the liposome includes cholesterol; The second phospholipid derived from a first polymer includes DSPE-PEG; The third phospholipid derived from a second polymer conjugated to the targeting ligand includes DSPE-PEG conjugated to at least one of Tau_1 and Tau_3; The imaging agent encapsulated by or bound to the membrane includes DSPE-DOTA-Gd.

14. The composition according to claim 11, wherein: The first phospholipid includes HSPC; The sterically bulky excipient capable of stabilizing the liposome includes cholesterol; The second phospholipid derived from a first polymer includes DSPE-PEG2000; The third phospholipid derived from a second polymer conjugated to the targeting ligand includes DSPE-PEG3400 conjugated to at least one of Tau_1 (SEQ ID NO:5) and Tau_3 (SEQ ID NO:6); The imaging agent encapsulated by or bound to the membrane includes DSPE-DOTA-Gd.

15. The composition according to claim 14, wherein The ratio of HSPC:cholesterol:DSPE-mPEG2000:DSPE-PEG3400:DSPE-DOTA-Gd is 31.5:40:3:0.5:

25.

16. The composition according to claim 15 further comprises 250 - 500 molecules of conjugated Tau_1 (SEQ ID NO:5).

17. The composition according to claim 15 further comprises 150 - 400 molecules of conjugated Tau_3 (SEQ ID NO:6).

18. A targeting composition comprising a phospholipid linked to a polymer, the polymer being linked to a targeting ligand that specifically binds to a tau - pathology cell - surface marker, wherein the targeting ligand is a DNA nucleotide sequence selected from the group consisting of: Tau_1 (SEQ ID NO:5), Tau_3 (SEQ ID NO:6).

19. The targeted composition according to claim 18, wherein The targeting ligand comprises an aptamer.

20. The targeted composition according to claim 18, wherein The targeting ligand comprises a stabilized aptamer.

21. The targeted composition according to claim 18, wherein The targeting ligand comprises a thiolated aptamer.

22. The targeted composition according to claim 18, wherein The phospholipid comprises one or more of DPPC, DSPE, DSPC, and DPPE.

23. The targeted composition according to claim 18, wherein The polymer comprises polyethylene glycol.

24. An aptamer or stabilized aptamer, which is a DNA nucleotide sequence selected from the group consisting of: Tau_1 (SEQ ID NO:5), Tau_3 (SEQ ID NO:6).

25. The aptamer or stabilized aptamer according to claim 24, wherein The DNA nucleotide sequence is located between SEQ ID NO:1 and SEQ ID NO:2.

Images