Quantum dot micelle spherical nucleic acid sensor and its preparation method and its application in Pb 2+ Applications in detection

Abstract

This invention discloses a quantum dot micelle spherical nucleic acid sensor, its preparation method, and its application in Pb 2+ In its detection application, the sensor comprises two nucleic acid molecules coupled to the surface of quantum dot micelles: an aptamer and an enzyme substrate modified with a quencher. The aptamer is formed by hybridization of a 5'-amino-modified lead ion aptamer with a DNase sequence. The enzyme substrate is a hairpin DNA structure containing an rA site, with an amino group modified at its 5' end and a quencher modified at its 3' end. The aptamer in this invention's sensor specifically binds to Pb. 2+ A G-quadruplex is formed, releasing DNase, which then travels automatically along its substrate-based pathway. By measuring the fluorescence signal of the quantum dot micelles after this travel is complete, the control of Pb is achieved. 2+ The detection and analysis of Pb. In this invention, QM-SNA-based DNase walking is used for Pb detection and analysis. 2+ The fluorescence amplification detection method realizes Pb detection 2+ Its high sensitivity and high specificity provide a new detection method for heavy metal ions.

Description

Technical Field

[0001] This invention belongs to the field of biosensing technology, specifically relating to a quantum dot micelle spherical nucleic acid sensor and its preparation method, and its application in Pb... 2+ Applications in detection. Background Technology

[0002] Lead ions (Pb) 2+ Lead is a Class I environmental pollutant, commonly found in industrial production such as battery manufacturing, welding, and lead-zinc smelting. It can be ingested through the digestive and respiratory tracts, accumulating in the body and causing various health problems. Once inside the body, lead can interact with biomolecules, leading to chronic damage and impairing the functions of the digestive, nervous, respiratory, and reproductive systems. Various environmental organizations have established standards for lead ions, such as the US Environmental Protection Agency (EPA) setting a maximum limit of 72 nanomoles for lead ions in drinking water, and China's national standard setting a maximum limit of 0.01 mg / L. Several methods have been developed for the precise detection of lead ions in aquatic environments, such as traditional atomic absorption spectroscopy, atomic emission spectroscopy, and inductively coupled plasma mass spectrometry; however, none of these methods are suitable for on-site detection.

[0003] Fluorescent biosensors have emerged due to their ease of preparation, high detection sensitivity, and suitability for on-site testing. In fluorescent biosensors, functional nucleic acids such as aptamers are commonly used as ion recognition units. Aptamers are single-stranded nucleic acid sequences obtained through in vitro screening. By binding to a target, they form unique structures that specifically recognize a range of targets, including ions, small molecules, biomacromolecules, and cells. They offer advantages such as low cost, good stability, ease of modification, and flexible design. Common lead ion-specific aptamers include PS2.M, AGRO100, and T30695. Quantum dots, also known as inorganic nanocrystals, possess excellent optical properties such as good resistance to photobleaching, high brightness, and multicolor emission under single-wavelength excitation, making them widely used as signal display units in fluorescent biosensors. Quantum dot micelles (QMs) are water-soluble micelles made by directly coating phospholipids onto the surface of oil-soluble quantum dots through hydrophobic interactions. They offer advantages such as simple preparation, high fluorescence quantum yield, and a large surface area for further functionalization. Summary of the Invention

[0004] Objective of the invention: To address the problems existing in the prior art, this invention provides a quantum dot micelle spherical nucleic acid sensor (QM-SNA) that utilizes the DNase walking mechanism for Pb. 2+ Fluorescence amplification detection method can achieve high sensitivity and high specificity for the detection of heavy metal lead ions.

[0005] The present invention also proposes a method for preparing the quantum dot micelle spherical nucleic acid sensor and its application.

[0006] Technical Solution: To achieve the above objectives, the present invention provides a quantum dot micelle spherical nucleic acid sensor. The sensor is prepared by coupling two nucleic acid molecules (aptamer enzyme and enzyme substrate modified with quencher) onto the surface of quantum dot micelles. The aptamer enzyme is formed by hybridization of a 5'-amino-modified lead ion aptamer with a DNA enzyme sequence. The enzyme substrate is a hairpin DNA structure containing an rA site, with an amino group modified at its 5' end and a quencher modified at its 3' end.

[0007] The DNA enzyme is a magnesium ion or zinc ion specific nuclease sequence.

[0008] The quencher is BHQ2, and different fluorescent quenchers can be selected according to the fluorescence emission wavelength of different quantum dots.

[0009] The 5'-amino-modified lead ion aptamer, the DNAseed sequence, and the enzyme substrate are respectively:

[0010] NH2-(CH2)6-TTTTTTACACAGTACACCGCCTTGTCGCAGTCATACG AATCCACATGGGTG GGTGGGTGGGT;

[0011] CATGTTCAGCGATCCGGAACGG CACCCATGTGGATT;

[0012] NH2-(CH2)6-TTTTTTACACAGTACA AATCC rAG GAACATG AGCGATCCGGAACGGCACCCATGTACTGTGTTTTTTT-BHQ2.

[0013] The quantum dot micelles are prepared by a thin-film hydration and ultrasonication method using quantum dots and dipalmitoylphosphatidylethanolamine-polyethylene glycol-carboxyl groups (DSPE-PEG-COOH). Specifically, quantum dots are dissolved in chloroform, dipalmitoylphosphatidylethanolamine-polyethylene glycol-carboxyl groups (DSPE-PEG-COOH) are added, and a thin film containing quantum dot micelles is prepared by rotary evaporation. Deionized water is then added to the film and ultrasonic treatment is performed to prepare uniformly dispersed quantum dot micelles.

[0014] The method for preparing the quantum dot micelle spherical nucleic acid sensor of the present invention is characterized by comprising the following steps:

[0015] EDC solution was added to a QM-containing buffer, and the mixture was activated with Sulfo-NHS solution. Aptamer enzyme solution and acid substrate solution were added to the buffer, and after stirring and reacting, the mixture was purified by ultrafiltration to obtain a quantum dot micelle spherical nucleic acid sensor.

[0016] The quantum dot micelle spherical nucleic acid sensor described in this invention is based on Pb 2+ Applications in detection.

[0017] Among them, the quantum dot micelle spherical nucleic acid sensor is in Pb 2+ Applications in quantitative detection.

[0018] The aptamer enzyme in the quantum dot micelle spherical nucleic acid sensor specifically binds to Pb. 2+ A G-quadruplex is formed, releasing DNase. The DNase, aided by magnesium ions, automatically travels along its substrate-based pathway. The fluorescence signal of the quantum dot micelles after the travel is completed is measured using a fluorescence spectrophotometer, enabling the determination of Pb. 2+ Detection and analysis.

[0019] Among them, the added target Pb 2+ The aptamer specifically binds to the aptamer unit in the aptamer to form a G-quadruplex, while releasing the DNase unit. The released DNase automatically recognizes the enzyme substrate, and after binding with metal ions, the enzyme activity is activated. It specifically cleaves the rA site on the substrate and releases a fragment with a quencher. The DNase travels away from the surface of the quantum dot micelles, causing a large number of quenchers to move away from the surface of the quantum dot micelles. The fluorescence resonance energy transfer effect disappears, and the fluorescence of the quantum dot micelles is restored.

[0020] In this invention, quantum dot micelles are prepared from oil-soluble quantum dots via a thin-film hydration method. The aptamer is formed by hybridization of a lead ion aptamer modified with a 5' amino group and a DNase. The DNase substrate is a hairpin DNA structure containing an rA site, with an amino group modified at its 5' end and a quencher modified at its 3' end. Both the aptamer and the substrate are linked to the surface of the quantum dot micelles via amide bonds at their 5' ends. Due to the quencher modified on the substrate, the fluorescence of the quantum dot micelles is quenched. Target triggering and with magnesium ion assistance, the DNase automatically travels along the DNA orbitals (substrate sequence) on the spherical nucleic acid surface of the quantum dot micelles. In the absence of a target, the aptamer is a hybrid double strand formed by the DNase and the aptamer sequence, with closed upper and lower arms. Adding the target, Pb... 2+ The DNase specifically binds to the aptamer unit in the aptamer to form a G-quadruplex, releasing the previously bound DNase. The released DNase hybridizes with the substrate via its upper and lower arms, and upon binding with metal ions, its enzyme activity is activated. It then specifically cleaves the rA site on the substrate, releasing a fragment containing a quencher; this process continues in a self-driven manner. Finally, the DNase migration ends, causing a large amount of quencher to move away from the quantum dot micelle surface, the fluorescence resonance energy transfer effect disappears, and the fluorescence of the quantum dot micelles recovers. The fluorescence signal of the quantum dot micelles after the DNase migration is measured using a fluorescence spectrophotometer to achieve Pb 2+ High-sensitivity, high-specificity detection and analysis. QM fluorescence intensity calibration of target Pb. 2+The quantity, QM fluorescence intensity and target abundance have a linear relationship, and a standard curve is plotted.

[0021] This invention combines quantum dot micelles with aptamers to design a specific nucleic acid aptamer that retains the high specificity of aptamers while possessing the efficient signal amplification capabilities of DNases. This allows for the construction of a quantum dot micelle spherical nucleic acid sensor, which can be used for high-sensitivity and high-specificity analysis of lead ions. The aptamer, formed by the coupling of the aptamer and nuclease, combines the advantages of both, achieving both specific molecular recognition and catalytic signal amplification. In this invention, the DNase walking based on QM-SNA is used for Pb... 2+ The fluorescence amplification detection method was used to achieve Pb detection. 2+ Its highly sensitive and specific detection provides a new method for detecting heavy metal ions.

[0022] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0023] This invention fabricates a fluorescence sensor with a quantum dot micelle spherical nucleic acid structure. It utilizes aptamer technology to combine a highly specific aptamer with a metal-dependent DNase-mediated signal amplification. By triggering the DNase's autowalking through the target to mediate QM fluorescence enhancement, it achieves high sensitivity and high specificity for the target Pb2+. This quantum dot micelle spherical nucleic acid sensor can be used for subsequent on-site detection of lead ions.

[0024] The present invention requires only 45 minutes for detection (walking); the detection limit is as low as 5 picoseconds (pM), the detection range is wide, and the repeatability is good; and the target can be detected by changes in fluorescence intensity. Attached Figure Description

[0025] Figure 1 The QM-SNA sensor utilizes the DNAse walking mechanism to detect Pb 2+ Schematic diagram;

[0026] Figure 2 Characterization of near-infrared absorption, hydrodynamic size, and fluorescence properties of QM and QM-SNA;

[0027] Figure 3 For Pb 2+ Trigger conformational changes in aptamers;

[0028] Figure 4 For QM-SNA-based DNAse walking kinetics;

[0029] Figure 5 For Pb detection using QM-SNA sensor 2+ Sensitivity and standard curve;

[0030] Figure 6 To enhance the specificity of the QM-SNA sensor in detecting Pb2+. Detailed Implementation

[0031] The present invention will be further described below with reference to the accompanying drawings and embodiments.

[0032] Unless otherwise specified, all materials and reagents used in the embodiments are commercially available.

[0033] Example 1

[0034] aptamer, DNase, and substrate sequence design

[0035] like Figure 1 As shown, for the target Pb 2+ Corresponding aptamer DNA and substrate were designed. The aptamer consists of an aptamer sequence and a DNase sequence. The aptamer sequence mainly includes a target-binding region and a DNase complementary region, with an amino group modified at the 5' end for coupling to the QM surface. The target-binding region is a target-specific recognition sequence used to bind to the target and form a G-quadruplex, disrupting the double-stranded structure of the aptamer and releasing the DNase. The DNase sequence mainly includes three parts: the aptamer complementary region, the (substrate) orbital-binding region, and the catalytic center region. The aptamer complementary region is the complementary sequence of the aptamer, used to hybridize with the aptamer sequence to form the aptamer, immobilizing and inhibiting enzyme activity; the orbital-binding region includes upper and lower arm sequences for binding to the substrate; the catalytic center region is used to bind metal ions and then recognize and cleave the rA site. The substrate sequence mainly includes the complementary sequences of the upper and lower arms, the rA site, an amino group modified at the 5' end for coupling to the QM surface, and a BHQ modification at the 3' end for quenching QM fluorescence. All aptamers, DNases, and substrate sequences were synthesized by Nanjing Genscript Biotech Co., Ltd.

[0036] The sequences are shown in Table 1. In Aptamer, positions 47 to 62 (GGGTGGGTGGGTGGGT) are the target binding region; the underlined portion (AATCCACATGGGTG) is the DNase complementary region. In DNAzyme, the underlined portion (CACCCATGTGGATT) is the aptamer complementary region; positions 1 to 7 (CATGTTC) and 32 to 36 (GGATT) are the orbital recognition region; positions 8 to 31 (AGCGATCCGGAACGGCACCCATGT) are the catalytic center region. In Substrate, positions 17 to 21 (AATCC) and 24 to 30 (GAACATG) are the DNase recognition region; position 22 is the rA site (the DNase recognition and cleavage site).

[0037] Table 1. Sequence design of aptamers, DNases, and substrate nucleic acids.

[0038]

[0039] Example 2

[0040] Preparation of QM-SNA with loaded enzyme and substrate

[0041] Quantum dot micelles (QM) were prepared by thin-film hydration and ultrasonication: the quantum dots used were CdSe / ZnS (purchased from Suzhou Xingshuo Nanotechnology Co., Ltd.). 0.1 mg of quantum dots and 4 mg of dipalmitoylphosphatidylethanolamine-polyethylene glycol-carboxyl (DSPE-PEG2000-COOH) were dissolved in 1 mL of chloroform. The mixture was reacted at 45 °C using a rotary evaporator for 15 min to obtain a thin film containing QM; 1 mL of deionized water was then added to the film, and the mixture was dispersed by ultrasonication to prepare a QM solution.

[0042] QM-SNA was prepared via chemical cross-linking: In a 500 μL reaction system, 10 μL of EDC solution (1 mM) and 10 μL of Lulfo-NHS solution (0.5 mM) were added to 10 nM QM buffer (phosphate buffer: 0.01 M, pH 7.4), and the mixture was activated at room temperature for 30 min. Then, 16.7 μL (1 μM) of aptamer solution and 66.7 μL (1 μM) of enzyme substrate solution were added to the buffer, and the mixture was stirred for 4 h. The mixture was then purified by centrifugation using a 5K ultrafiltration tube. The aptamer was obtained by hybridization of 100 μL of Aptamer (2 μM) and 100 μL of DNAzyme (2 μM) at 37 °C for 1 h. Both the aptamer and enzyme substrate solutions were 0.01 M pH 7.4 phosphate buffer.

[0043] The composition, hydrodynamic size, and fluorescence properties of the prepared QM-SNA were systematically determined, with QM micelles used as a negative control. The results are as follows: Figure 2 As shown. From Figure 2 In study A, it was found that, compared to QM, QM-SNA exhibited a benzene ring (1556 cm⁻¹) characteristic of nucleic acids in its infrared spectrum. -1 ) and phosphorus-oxygen double bond (1062cm) -1 The infrared characteristic peaks indicate successful ligation of nucleic acids on the QM surface. Figure 2 As shown in Figure B, compared to QM, the hydrodynamic size of QM-SNA increased by ~7 nm, indicating that a higher density of nucleic acids is coupled to the QM surface. Figure 2 In C, it was found that the fluorescence of QM was quenched after being linked to a substrate modified with BHQ, with a quenching efficiency of approximately 86%.

[0044] Example 3

[0045] Pb 2+ Triggering conformational changes in aptamers

[0046] The CD spectrum of DNA was measured using a Chirascan circular dichroism spectrometer. The aptamer enzyme sample was dissolved in 0.01 M pH 7.4 phosphate buffer to a final concentration of 5 μM, and its CD spectrum was measured. Then, 5000 pM Pb was added. 2+ After reacting at room temperature for 30 minutes, its CD spectrum was measured. Recordings were made using a quartz cell with a 2 mm optical path length and an instrument scanner, with a scanning range of 200 to 320 nm. Three scans were performed, and the average value was taken.

[0047] The results are as follows Figure 3 As shown, there is no Pb. 2+ Under these conditions, the aptamer enzyme exhibits a positive peak at 275 nm and a shoulder at 285 nm, characteristic of double-stranded DNA. Adding Pb... 2+ After (5000 pM), the aptamer enzyme showed a negative peak at 242 nm and a positive peak at 270 nm, indicating Pb binding to the aptamer. 2+ The resulting typical G-quadruplexes share the same characteristics, indicating that Pb 2+ It can open the double-stranded structure of aptamers and release DNA enzymes.

[0048] Example 4

[0049] QM surface target-triggered DNAse walk

[0050] The Pb content of the 10 nM QM-SNA sensor was measured using a fluorescence spectrophotometer. 2+ The fluorescence spectrum of quantum dot micelles after complete reaction was observed, and the fluorescence response of the quantum dot micelles was investigated. 195 μL of a mixed solution (containing 10 nM QM-SNA and 50 mM Pb) was added. 2+ The target Pb was reacted with a 0.01M phosphate buffer solution (pH 7.4) at 37°C for 1 hour. 2+ React fully with the aptamer enzyme. Then add 5 μL of Mg. 2+ (2M) solution, fluorescence spectrum measured every 5 minutes.

[0051] The fluorescence intensity change of QM is as follows Figure 4 As shown, during the designed DNase's migration process, QM fluorescence continuously increases with the extension of migration time, reaching its maximum value at 45 min, which is beneficial for achieving Pb... 2+ A faster detection.

[0052] Example 5

[0053] QM-SNA sensor detects Pb2+ Sensitivity and standard curve

[0054] QM-SNA and Mg 2+ The solutions were added to 0.01M pH 7.4 phosphate buffer solution to obtain final concentrations of 10 nM and 50 mM, respectively, which were then reacted with different concentrations of the target Pb. 2+ Co-incubation (adding concentrations of 0, 1, 5, 10, 20, 50, 100, 200, 500, 1000, 2000, 5000, 10000, 50000, 10 5 The quantum dots were reacted at 37°C for 2 hours (pM). The fluorescence spectra of the quantum dots were measured using a fluorescence spectrometer, and the standard curve was plotted as: y = 2.902x - 0.309.

[0055] like Figure 5 As shown, both the fluorescence spectrum and the photographs indicate that with the increase of Pb... 2+ With increasing concentration, the red fluorescence of QM gradually intensifies. The standard curve shows that QM-SNA exhibits strong fluorescence for Pb in the range of 5–5000 pM. 2+ It exhibits good linear response, i.e., quantitative detection of Pb 2+ The linear dynamic range is three orders of magnitude; Pb is calculated according to the three-standard-deviation rule. 2+ The detection limit was 5 pM, and the correlation coefficient was ≥0.99. These results indicate that the QM-SNA sensor utilizes a DNase-mediated signal amplification mechanism to detect Pb. 2+ It has high sensitivity.

[0056] Example 6

[0057] The QM-SNA sensor has specificity for detecting metal ions.

[0058] QM-SNA (final concentration 10 nM) and Mg 2+ A 50mM final concentration solution was added to a 0.01M pH 7.4 phosphate buffer solution, and then reacted with Pb. 2+ K + Na + Ca 2+ Mg 2+ Cu 2+ Zn 2+ Fe 2+ Mn 2+ Cd 2+ Cr 3+ Fe 3+ Ag + Hg 2+ (All concentrations were 5000 pM) The mixture was reacted together at 37℃ for 2 h, and the QM-SNA fluorescence spectrum was measured and a bar chart was plotted.

[0059] The results are as follows Figure 6 As shown, only Pb 2+ When Pb is present, the QM-SNA sensor produces a significant fluorescence response, while no fluorescence response is produced in the presence of other ions. These results indicate that the QM-SNA sensor can detect Pb. 2+ It has high specificity. sequence list <110> Southeast University <120> Quantum dot micelle spherical nucleic acid sensor, its preparation method and its application in Pb2+ detection <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 62 <212> DNA <213> Artificial Sequence <400> 1 ttttttacac agtacaccgc cttgtcgcag tcatacgaat ccacatgggt gggtgggtgg 60 gt 62 <210> 2 <211> 36 <212> DNA <213> Artificial Sequence <400> 2 catgttcagc gatccggaac ggcacccatg tggatt 36 <210> 3 <211> 68 <212> DNA <213> Artificial Sequence <400> 3 ttttttacac agtacaaatc craggaacat gagcgatccg gaacggcacc catgtactgt 60 gttttttt 68

Claims

1. A quantum dot micelle spherical nucleic acid sensor for Pb 2+ detection, characterized in that The sensor is obtained by coupling aptamer enzyme and quencher-modified enzyme substrate on the surface of quantum dot micelles, the aptamer enzyme is formed by hybridizing 5'-amino-modified lead ion aptamer with DNA enzyme sequence; the enzyme substrate is hairpin structure DNA containing rA site, the 5' end is modified with amino, and the 3' end is modified with quencher; The 5'-amino-modified lead ion aptamer, DNA enzyme sequence and enzyme substrate are respectively: NH2-(CH2)6-TTTTTTACACAGTACACCGCCTTGTCGCAGTCATACG AATCCACATGGGTG GGTGGGTGGGT; CATGTTCAGCGATCCGGAACGG CACCCATGTGGATT NH2-(CH2)6-TTTTTTACACAGTACA AATCC rAG GAACATG AGCGATCCGGAACGGCACCCATGTACTGTGTTTTTTT-BHQ2.

2. The quantum dot micelle spherical nucleic acid sensor of claim 1, wherein, The quantum dot micelles are prepared by the method of thin film hydration ultrasonic through quantum dots and dipalmitoyl phosphatidyl ethanolamine-polyethylene glycol-carboxyl.

3. A method for preparing the quantum dot micelle spherical nucleic acid sensor of claim 1, wherein, The method comprises the following steps: EDC solution and Sulfo-NHS solution are added to QM buffer solution for activation; aptamer enzyme solution and quencher-modified enzyme substrate are added to the buffer solution, and after stirring and reaction, the quantum dot micelle spherical nucleic acid sensor is obtained by ultrafiltration purification.

4. Use of the quantum dot micelle spherical nucleic acid sensor of claim 1 for detection of Pb 2+ .

5. Use according to claim 4, characterized in that, The quantum dot micelle spherical nucleic acid sensor is applied in the quantitative detection of Pb 2+ in the application.

6. Use according to claim 4, characterized in that, The aptamer in the quantum dot micelle spherical nucleic acid sensor specifically binds to Pb 2+ Form G-quadruplex, release DNA enzyme, DNA enzyme automatically walks with enzyme substrate as track with the aid of magnesium ion; the fluorescence signal of quantum dot micelle after walking is measured by fluorescence spectrophotometer to realize detection and analysis of Pb 2+ .

7. Use according to claim 6, characterized in that, Target Pb added 2+ The aptamer unit in the aptazyme specifically binds to form a G-quadruplex, while releasing the DNAzyme unit. The released DNAzyme automatically recognizes the enzyme substrate, and the enzyme activity is activated after binding with metal ions. The rA site on the substrate is specifically cleaved, releasing the fragment with the quencher. The DNAzyme walking leads to a large number of quenchers away from the surface of the quantum dot micelles, and the fluorescence resonance energy transfer effect disappears, and the fluorescence of the quantum dot micelles is restored.

Images