Expression

Abstract

The present application relates to an expression method. Specifically, the present application provides a method for producing a target polypeptide. The method includes expressing an expression vector for expressing the target polypeptide in a host cell, preferably in a mammalian cell, and recovering the target polypeptide, wherein the expression vector includes an expression cassette containing a polynucleotide encoding a recombinant polypeptide operably linked to a fibronectin secretory leader sequence.

Description

[0001] This application is a divisional application. The application date of the original application is April 29, 2014, the application number is 201480024993.4 (PCT / GB2014 / 000165), and the name of the invention is “Expression Method”. Technical Field

[0002] The present invention relates to a method for expressing a recombinant polypeptide, in particular a method for secreting a recombinant polypeptide. Background Art

[0003] It is obviously beneficial in the production of recombinant polypeptides if the polypeptide of interest can be exported from the cell in which it is expressed. Therefore, the expression system is advantageously designed to enable such export or secretion. Secretion of recombinant polypeptides from host cells generally involves the use of signal peptides, which are present in most eukaryotic and prokaryotic proteins destined for export from the cytoplasm. The secretory leaders used in such expression systems are generally native to the expression host, for example, the PhoA, MalB and OmpA signal peptides of Escherichia coli have been widely used to secrete polypeptides into the extracellular periplasm of this organism.

[0004] US 7,071,172 describes the use of a fibronectin secretory leader in an AAV-based delivery vector for gene therapy. Summary of the invention

[0005] According to a first aspect of the present invention, there is provided a method for producing a target polypeptide, the method comprising:

[0006] a) an expression vector for expressing a target polypeptide in a host cell, the expression vector comprising an expression cassette comprising a polynucleotide encoding a recombinant polypeptide operably linked to a fibronectin secretory leader sequence or a functional equivalent thereof; and

[0007] b) Recovering the target polypeptide.

[0008] The fibronectin leader that can be used for the present invention includes mammalian and reptile fibronectin secretion leaders. Examples of reptile fibronectin secretion leaders include African clawed frog (Xenopus laevis) fibronectin secretion leaders. Examples of mammalian fibronectin secretion leaders include human, rat, mouse, cattle, pig, dog, cat and Chinese hamster fibronectin secretion leaders, and their functional equivalents, such as the human fibronectin secretion leader with the sequence MLRGPGPGLLLLAVQCLGTAVPSTGA (SEQ ID No.1). In certain embodiments, preferably the Chinese hamster fibronectin secretion leader with the amino acid sequence MLRGPGPGLLLAVLCLGTAVRCTEA (SEQ ID No.2) and its functional equivalents.

[0009] The functional equivalent of the secretory leader is an amino acid sequence that shares 70% or greater identity, preferably 75% or greater identity, more preferably 80% or greater identity, and most preferably 90% or greater identity, such as 95% or more, and retains the ability to secrete the recombinant polypeptide. In some embodiments, the functionally equivalent secretory leader differs by a single amino acid by any addition, deletion or substitution.

[0010] In many embodiments, operably linked polynucleotide sequences are contiguous, and, in the case of a secretory leader, contiguous and in the same reading frame.

[0011] Preferably, the connection between the polynucleotide encoding the fibronectin secretory leader and the polynucleotide encoding the target polypeptide is that the secretory leader is connected to the N-terminus of the recombinant polypeptide. In certain embodiments, the recombinant polypeptide comprises an N-terminal tag, a connection between the secretory leader sequence and the polynucleotide encoding the recombinant polypeptide, wherein the secretory leader is attached to the tag, preferably to the N-terminus of the tag.

[0012] The polynucleotide encoding the fibronectin secretory leader sequence is preferably linked to the 5' end of the polynucleotide encoding the target polypeptide, and preferably has the sequence ATGCTGAGAGGCCCTGGACCTGGACTGCTGCTGCTGGCTGTGCAGTGTCTGGGAACCGCCGTGCCTTCTACCGGCGCC (SEQ ID No. 3) or ATGCTCAGGGGTCCGGGACCCGGGCTGCTGCTGGCCGTCCTGTGCCTGGGGACAGCGGTGCGCTGTACCGAAGCC (SEQ ID No. 4).

[0013] The vector of the present invention comprises a promoter operably linked to a secretory leader and an expression cassette for a recombinant polypeptide.

[0014] The promoter that can be used in the vector of the present invention is selected depending on the host cell in which the expression cassette is to be expressed.

[0015] Promoters that can be used in prokaryotic host cells include bacteriophage polymerase promoters, such as individual T7 promoter regions, including those disclosed by Studier and Moffat, J. Mol. Biol. 189: 113-130 (1986), which is incorporated herein by reference, especially the T7 gene 10 promoter region and host polymerase promoters, particularly E. coli polymerase promoters, such as T7A1, T7A2, T7A3, λpL, λpR, lac, lacUV5, trp, tac, trc, phoA and rrnB.

[0016] When utilizing a T7 RNA-polymerase dependent promoter region, it will be appreciated that a source of T7 RNA polymerase is required, which is provided by methods known in the art and is typically provided by inserting into the host strain a lambda DE3 prophage expressing the desired phage polymerase to produce a productive host strain. T7 RNA polymerase can also be delivered to cells by infection with a specialized lambda transducing phage carrying the gene for T7 RNA polymerase.

[0017] Promoters that may be used for yeast host cells include the gal promoter and AOX promoters such as AOX1 and AOX2, GAP (glyceraldehyde 3-phosphate dehydrogenase), FLP (formaldehyde dehydrogenase), and GAL1 and GAL10.

[0018] Promoters that can be used for mammalian host cells are endogenous or exogenous to the host cells. Suitable promoters include viral promoters such as CMV, SV40 promoter and RSR-LTR. Promoters from housekeeping genes such as hEF1α and mouse phosphoglycerate kinase (mPGK) can also be used. In some embodiments, preferred promoters are human CMV and rat CMV. If more than one polypeptide is to be expressed (e.g., MAbHC and LC polypeptides), the promoters may be the same or different. The promoter may be used in combination with an enhancer sequence, such as a major immediate early enhancer of cytomegalovirus, particularly human cytomegalovirus.

[0019] The expression vector can be integrated into the host cell genome or contained on an extrachromosomal element such as a plasmid.

[0020] The expression vector also typically contains a selective marker suitable for the host cell in which the vector is to be expressed. Selective markers for prokaryotic host cells include antibiotic resistance markers, such as tetracycline or kanamycin resistance markers. Selective markers for yeast hosts include antibiotic resistance markers, such as Zeocin, puromycin, neomycin and hygromycin resistance. Selective markers for mammalian cells, particularly Chinese hamster ovary cells, include glutamine synthetase and dihydrofolate reductase marker systems.

[0021] The vector used includes features that are suitable for expression in suitable host cells that are routine in the art. Prokaryotic expression vectors typically include a replication origin, a restriction enzyme site, a transcription terminator, and a plasmid stability locus, such as a cer stability sequence. Yeast expression vectors typically include a promoter, a transcription terminator, a selection marker, and if replicated, an origin of replication. Mammalian expression vectors typically include polyadenylation sequences, such as human β-globin poly A sequences, bovine growth hormone poly A sequences, and SV40 early or late poly A sequences.

[0022] The expression vector of the present invention can be used to express recombinant polypeptides, particularly proteins, in host cells. Prokaryotes, particularly eukaryotic host cells can be utilized. Examples of prokaryotic cells include bacterial cells, such as gram-negative bacterial cells, including Escherichia coli (E.coli), Salmonella typhimurium (Salmonella typhimurium), Serratia marsescens (Serratia marsescens), Pseudomonas putida (Pseudomonas putida), Pseudomonas aeruginosa (Pseudomonas aeruginosa), and gram-positive bacterial cells, including Bacillus subtilis (Bacillus subtilis). Preferred prokaryotic host cells are bacteria, particularly enterobacteria, preferably Escherichia coli, particularly its B or K12 strains.

[0023] Examples of eukaryotic host cells that can be used include yeast, mammalian and insect cells. Yeast host cells specifically include Saccharomyces cerevisiae, Pichia pastoris and Hansenula polymorpha.

[0024] Preferred host cells are mammalian cells, such as baby hamster kidney cells, human embryonic kidney cell lines, such as HEK293 cells, human retinal derived cell lines, such as PER C6 cells, and mouse lymphoid cell lines, such as NS0 and SP2 cells. And the most preferred are Chinese hamster ovary cells, and specifically CHOK1, DG44, DUXKB11 and CHOpro3-cells.

[0025] The expression vector of the present invention is usually used in the form of a plasmid, which can be an autonomously replicating plasmid or an integrating plasmid.

[0026] In certain highly preferred embodiments of the present invention, the fibronectin secretory leader is selected corresponding to the host cell used. For example, human fibronectin is used in cells derived from humans, rat fibronectin is used in rat cells, and Chinese hamster fibronectin is used in particular in Chinese hamster ovary cells.

[0027] Polypeptides that can be expressed by the methods of the invention include therapeutic proteins and peptides, including cytokines, growth factors, antibodies, antibody fragments, immunoglobulin-like polypeptides, enzymes, vaccines, peptide hormones, chemokines, receptors, receptor fragments, kinases, phosphatases, isomerases, hydrolases, transcription factors, and fusion polypeptides.

[0028] Antibodies that can be expressed include monoclonal antibodies, polyclonal antibodies, and biologically active antibody fragments, including multivalent and / or multispecific forms of any of the foregoing.

[0029] Naturally occurring antibodies usually consist of four polypeptide chains, two identical heavy chains (H) and two identical light chains (L) connected internally by disulfide bonds. Each heavy chain includes a variable region (V H ) and constant region (C H ), the C H The region in its natural form consists of three regions, C H 1, C H 2 and C H 3. Each light chain includes a variable region (V L ) and a constant region comprising a domain, C L .

[0030] V H and V L The V region can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with more conserved regions, termed framework regions (FRs). H and V L It comprises three CDRs and four FRs, arranged from amino-terminus to carboxyl-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0031] Antibody fragments that can be expressed include a portion of an intact antibody that has the desired biological activity. Antibody fragments generally include at least one antigen binding site. Examples of antibody fragments include: (i) L, , C L 、V H and C H 1 domain Fab fragment, (ii) Fab derivatives, such as in C H 1 domain has one or more cysteine ​​residues at the C-terminus, which can form a bivalent fragment between two Fab derivatives through a disulfide bond; (iii) a Fab' fragment having V H and C H 1 domain of Fd fragments; (iv) Fd derivatives, such as in C H The Fd derivative has one or more cysteine ​​residues at the C-terminus of the 1 domain; (v) a V having a single arm of the antibody L and V H Domain F V (vi) a single-chain antibody molecule, such as V L and V H The domain is a covalently linked single-chain F V(scFv) antibody; (vii) with or without another variable region domain (V H or V L domain polypeptide) without constant region domains H or V L Domain polypeptides (e.g. V H -V H 、V H -V L or V L -V L ); (viii) domain antibody fragments, such as V H Domain or V L Domain and V H or V L (ix) so-called "dibodies" comprising two antigen-binding sites, for example in combination with a light chain variable domain (V L ) connected to the heavy chain variable domain (V H ); and (x) so-called linear antibodies, which include a pair of tandem Fd fragments that together with complementary light chain polypeptides form a pair of antigen binding regions.

[0032] Preferred antibody fragments that can be prepared are mammalian single variable domain antibodies, which are antibody fragments containing a folded polypeptide domain containing sequences that are characteristic of immunoglobulin variable domains, and which specifically bind to antigen (i.e., with a dissociation constant of 500 nM or less, such as 400 nM or less, preferably 250 nM or less, most preferably 100 nM or less), and which bind to antigen as a single variable domain, i.e., without any complementary variable domains. Single variable domain antibodies include complete antibody variable domains, and modified variable domains (e.g., in which one or more loops have been replaced by sequences that are not characteristic of antibody variable domains, or have been truncated or contain N- or C-terminal extensions), as well as folded fragments of variable domains. Preferred single variable domains that can be prepared are selected from V H and V L , which includes V kappa and V lambda Most preferably, the single variable domain is a human or camelid domain, including a humanized camelid domain.

[0033] When the target polypeptide contains two or more chains to be secreted, particularly when the target polypeptide is an antibody or antibody fragment comprising two or more chains, at least one or preferably each chain is connected to a fibronectin secretory leader, and the polynucleotide encoding such a polypeptide is designed accordingly. The fibronectin secretory leader used may be the same or different. The polynucleotide encoding two or more chains may be included in the same expression cassette, but is preferably included in different expression cassettes. When different expression cassettes are utilized, the expression cassettes may be located on different vectors, but are preferably located on the same vector. The promoters utilized may be the same or different.

[0034] The expression system is expressed by methods known in the art for the cells used. Preferred expression methods include culturing the host cells in a growth medium and then recovering the expressed polypeptide. The term "growth medium" refers to a nutrient medium used to grow the host cells. In many embodiments, a nutrient solution is utilized. Suitable growth medium for a given host cell and methods for recovering the polypeptide are known in the art.

[0035] In many embodiments, polypeptide recovery comprises one or more of filtration, centrifugation, diafiltration, ion exchange chromatography, affinity chromatography, such as protein A affinity chromatography, hydrophobic interaction chromatography (HIC), gel filtration, and HPLC.

[0036] According to a preferred aspect of the present invention, there is provided a method for producing a target polypeptide, the method comprising:

[0037] (a) transfecting or transforming a host cell with an expression vector for expressing a target polypeptide in the host cell, wherein the expression vector comprises an expression cassette comprising a polynucleotide encoding the target polypeptide operably linked to a fibronectin secretory leader sequence or a functional equivalent thereof;

[0038] (b) culturing the host cells under conditions that allow proliferation of the host cells and expression and secretion of the target polypeptide from the host cells,

[0039] (c) and recovering the target polypeptide.

[0040] According to other aspects of the present invention, Chinese hamster ovary cells are provided, preferably CHOK1, DG44, DUXKB11 or CHOpro3 cells, which are transfected with an expression vector containing an expression cassette, wherein the expression cassette contains a polynucleotide encoding a target polypeptide operably linked to a fibronectin secretory leader sequence or a functional equivalent thereof.

[0041] In other aspects of the invention, the encoded target polypeptide preferably comprises a monoclonal antibody. An expression cassette containing both the heavy chain and the light chain encoding the monoclonal antibody and preferably each of the polynucleotides operably linked to the fibronectin secretory leader can be used. In some embodiments, separate expression cassettes containing the heavy chain and the light chain are used, which can be located on separate vectors, but are often located on the same vector. The fibronectin secretory leaders used can be the same or different, but are preferably the same.

[0042] In many preferred embodiments, the expression cassette comprises a housekeeping gene promoter, particularly a hEF1α promoter operably linked to a polynucleotide encoding a target polypeptide, and when two or more expression cassettes are utilized, each expression cassette comprises a housekeeping gene promoter, preferably the same promoter, most preferably a hEF1α promoter.

[0043] The expression cassette for the or each target polypeptide preferably comprises a bovine growth hormone poly A sequence.

[0044] The expression vector preferably includes a selection marker, most preferably a dihydrofolate reductase marker system. In certain cases, the dihydrofolate reductase marker system includes an expression cassette further comprising a murine phosphoglycerate kinase promoter.

[0045] A DNA construct comprising an expression cassette containing a promoter effective in mammalian cells and a polynucleotide encoding a target polypeptide operably linked to a fibronectin secretory leader sequence constitutes another aspect of the invention.

[0046] The DNA construct preferably includes separate expression cassettes for the heavy and light chains of the monoclonal antibody. Most preferably, each expression cassette includes the same promoter, particularly a housekeeping gene promoter, most particularly the hEF1α promoter. Particularly preferably, each expression cassette further includes a bovine growth hormone poly A sequence. The DNA construct often advantageously includes a selection marker, most preferably a dihydrofolate reductase marker system. In some cases, the marker system for dihydrofolate reductase includes an expression cassette further containing a mouse phosphoglycerate kinase promoter. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 The structure of the expression cassette of the present invention is shown. DETAILED DESCRIPTION

[0048] The invention is illustrated without limitation by the following examples.

[0049] Example 1

[0050] For each secretory leader (SL) to be evaluated, two single gene vectors were constructed containing either the hγ1FL heavy chain (HC) of the anti-MUC-1 MAb or the λ light chain (LC) of the anti-MUC-1 MAb. Each expression cassette consisted of a rat CMV promoter functionally linked to a polynucleotide sequence encoding a secretory leader linked in frame to a polynucleotide sequence encoding the HC or LC mature polypeptide and a human β-globin poly A sequence. The structure of the expression cassette is described in Figure 1 In the description.

[0051] The secretory leaders utilized were as follows:

[0052] Secretory leader region A: human collagen, sequence MLSFVDTRTLLLLAVTLCLATCQS (SEQ ID No. 5)

[0053] Secretory leader region B: human fibronectin, sequence: MLRGPGPGLLLLAVQCLGTAVPSTGA (SEQ ID No. 1)

[0054] Secretory leader C: Chinese hamster fibronectin, sequence: MLRGPGPGLLLAVLCLGTAVRCTEA (SEQ ID No. 2)

[0055] Secretory leader D: Chinese hamster albumin, sequence MKWVTFLLLLFVSDSAFS (SEQ ID No. 6)

[0056] The CHODG44 host cells were counted at 1.2 × 10 6 The cells were seeded at 100 cells / well in MEM-α medium supplemented with 10% serum, 2 mM glutamine and 0.45% glucose and incubated overnight at 36.5°C, 7.5% CO2.

[0057] For each transfection, 4 μg of HC and LC single gene vectors (2 μg) were mixed together and diluted in 250 μl of serum-free MEM-α medium (Life Technologies). A mock transfection (PBS only) was also included. For each transfection, 12.5 μl of Lipofectamine 2000 (Life Technologies) was diluted in 250 μl of serum-free MEM-α medium and mixed. The mixture was incubated at room temperature (15-25°C) for 5 minutes. Combine the diluted DNA and Lipofectamine 2000. TMReagents, mixed, and incubated at room temperature for 20 minutes. Add an additional 500 microliters of MEM-а medium to each transfection mixture, remove the growth medium from the wells, and then add the complex to the wells of the 6-well plate containing cells. After 5 hours, remove the medium and add new growth medium. Incubate the cells at 36.5°C, 7.5% CO2 for 5 days. Obtain the supernatant and clarify it by centrifugation. Determine the antibody titer using the Octet (Forte Bio) protein A assay.

[0058] The results are given in Table 1 below.

[0059] Table 1

[0060] Secretory leader used Average antibody titer (mg / l) A 2.91 B 7.79 C 8.85 D 1.89

[0061] The produced antibodies were recovered from the supernatant by protein A capture, eluted and purified by cation exchange chromatography followed by anion exchange chromatography at low pH. The eluate from the anion exchange chromatography was subjected to viral nanofiltration followed by buffer exchange and concentration.

[0062] Example 2

[0063] Vector construction

[0064] A dual gene vector was constructed containing the hEF1α promoter driving expression of both the hγ1FL heavy chain of the anti-MUC-1 MAb and the human λ light chain of the anti-MUC-1 MAb.

[0065] Other dual gene promoters were constructed in which the hEF1α promoter was replaced with the hCMV-MIE promoter or the rat CMV promoter.

[0066] Each expression cassette in the double gene vector consists of a promoter functionally linked to a polynucleotide sequence encoding the CHO fibronectin signal peptide of Example 1, which is linked in the reading frame of a polynucleotide sequence encoding a HC or LC mature polypeptide. Correct mRNA processing is ensured by the presence of a bovine growth hormone poly A sequence.

[0067] To allow selection of stable cell lines, the vector also contains a copy of the murine dihydrofolate reductase (dhfr) gene under the control of the murine phosphoglycerate (mPGK) promoter and the hygromycin resistance gene under the control of the thymidine kinase (TK) promoter.

[0068] Routine subculture of CHO DG44 cells

[0069] CHO DG44 cells were routinely cultured in suspension shaker flasks in EX-CELLACF CHO medium (Sigma) supplemented with 8 mM L-glutamine and 1× HT supplement (Life Technologies). 5 Cells were seeded at a concentration of 10 cells / mL and the cells were split every 3 days. The flasks were incubated at 37°C, 7.5% CO2 in an orbital shaking incubator at 140 rpm.

[0070] Stable cell line transfection

[0071] Cells for transfection were grown in cell suspension medium as detailed above. Cells from the growth medium were centrifuged and resuspended to 2 x 10 7 cells / ml concentration. A 0.1 mL volume of cell suspension and 4 micrograms of linearized plasmid DNA were added to the electroporation cup. The cup was then placed in an Amaxa nuclear transfection instrument (Lonza) for nuclear transfection. After transfection, the cells were added to 20 ml of preheated EX-CELL ACFCHO medium (Sigma) supplemented with 8 mM glutamine and 1x HT supplement in a T75 flask. The transfected cells were incubated at 37°C, 7.5% CO2. After removing hypoxanthine and thymidine (HT) from the culture medium (48 hours after transfection) and adding 400 micrograms / ml hygromycin B (Invitrogen) and 25 nM MTX cells (144 hours after transfection), the cells were plated at 5000 cells / well (2.5x10 4 The plates were incubated at 37°C in an atmosphere of 7.5% CO2 in air. The plates were monitored for colony growth until about 3 weeks after transfection. Supernatants from up to 100 wells containing cell growth were harvested and analyzed for antibodies using the Octet (Forte Bio) protein A assay. The top 24 expressing colonies were expanded into 24-well plates and cultured for 10 days. The supernatants were then assayed for antibodies using the Octet (ForteBio) protein A assay. The results are given in Table 2 below.

[0072] Table 2

[0073]

[0074] Example 3

[0075] Purification of antibodies from CHO supernatants

[0076] Protein A resin was used to purify the supernatant of the recombinant CHO DG44 cell line produced by the hEF1α promoter double gene vector described in Example 2. 350 mL of the clarified harvest was loaded onto a pre-loaded column containing MabSelect SuRe resin (GE Healthcare). First, 20 mM sodium phosphate, 1 M NaCl (pH 7.0) was used, followed by washing the resin with 20 mM sodium phosphate (pH 7.0). The antibody was then eluted with 100 mM acetic acid. The product was quantitatively recovered using the Octet (Forte Bio) protein A assay, and is shown in Table 3.

[0077] Table 3

[0078] Volume (mL) Concentration (mg / mL) Clarified harvest 350 1.3 Eluted Antibodies 50.55 7.7 <110> Fujifilm Dioscin Biotech UK Ltd <120> Expression <130> BIL 81024 / WO <160> 6 <170> BiSSAP 1.3 <210> 1 <211> 26 <212> PRT <213> Human <400> 1 Met Leu Arg Gly Pro Gly Pro Gly Leu Leu Leu Leu Ala Val Gln Cys 1 5 10 15 Leu Gly Thr Ala Val Pro Ser Thr Gly Ala 20 25 <210> 2 <211> 25 <212> PRT <213> Gray hamster <400> 2 Met Leu Arg Gly Pro Gly Pro Gly Leu Leu Leu Ala Val Leu Cys Leu 1 5 10 15 Gly Thr Ala Val Arg Cys Thr Glu Ala 20 25 <210> 3 <211> 78 <212> DNA <213> Human <400> 3 atgctgagag gccctggacc tggactgctg ctgctggctg tgcagtgtct gggaaccgcc 60 gtgccttcta ccggcgcc 78 <210> 4 <211> 75 <212> DNA <213> Gray hamster <400> 4 atgctcaggg gtccgggacc cgggctgctg ctggccgtcc tgtgcctggg gacagcggtg 60 cgctgtaccg aagcc 75 <210> 5 <211> twenty four <212> PRT <213> Human <400> 5 Met Leu Ser Phe Val Asp Thr Arg Thr Leu Leu Leu Leu Ala Val Thr 1 5 10 15 Leu Cys Leu Ala Thr Cys Gln Ser 20 <210> 6 <211> 18 <212> PRT <213> Gray hamster <400> 6 Met Lys Trp Val Thr Phe Leu Leu Leu Leu Phe Val Ser Asp Ser Ala 1 5 10 15 Phe Ser

Claims

1. A method for producing a target recombinant polypeptide, comprising: (a) expressing an expression vector for expressing a target recombinant polypeptide in a CHO host cell, the expression vector comprising an expression cassette containing a polynucleotide encoding the target recombinant polypeptide operably linked to a Chinese hamster fibronectin secretory leader sequence, wherein the fibronectin secretory leader sequence is MLRGPGPGLLLAVLCLGTAVRCTEA; and (b) recovering the target recombinant polypeptide.

2. A method for producing a target polypeptide, comprising: (a) transfecting a CHO host cell with an expression vector for expressing a target polypeptide in the host cell, the expression vector comprising an expression cassette comprising a polynucleotide encoding the target polypeptide operably linked to a Chinese hamster fibronectin secretory leader sequence, wherein the fibronectin secretory leader sequence is MLRGPGPGLLLAVLCLGTAVRCTEA; (b) culturing the host cell under conditions that allow the host cell to proliferate and the target polypeptide to be expressed and secreted from the host cell; and (c) recovering the target polypeptide.

3. The method according to claim 1 or 2, wherein the expression cassette comprises the hEF1α promoter.

4. The method according to claim 1 or 2, wherein the expression cassette comprises a polyA sequence.

5. The method according to claim 4, wherein the polyA sequence is selected from human beta globin polyA, bovine growth hormone polyA SV40 early or late polyA sequence.

6. The method according to claim 1 or 2, wherein the target recombinant polypeptide or target polypeptide is the light chain and heavy chain of a monoclonal antibody, and two expression cassettes are utilized, one expression cassette containing a polynucleotide encoding the light chain of the monoclonal antibody, and the second expression cassette containing a polynucleotide encoding the heavy chain of the monoclonal antibody.

7. The method of claim 6, wherein the two expression cassettes comprise the same promoter, secretion leader sequence and polyA sequence. 8 . The method according to claim 7 , wherein the promoter is the hEF1α promoter, and the polyA sequence is the bovine β-globin polyA sequence.

Images