A KASP molecular marker related to the complete femaleness of bitter gourd and its application

Abstract

The present invention discloses a KASP molecular marker related to the complete femaleness of bitter gourd and its application. The molecular marker is located at position 24645998 on chromosome 1 of the bitter gourd genome, with a point mutation of T to C occurring at position 24645998; among them, the KASP primer set for amplifying the molecular marker includes a forward primer F1, a forward primer F2, and a reverse primer R; among them, the nucleotide sequence of the forward primer F1 is as shown in SEQ ID NO:7, the nucleotide sequence of the forward primer F2 is as shown in SEQ ID NO:8, and the nucleotide sequence of the reverse primer R is as shown in SEQ ID NO:4. This KASP molecular marker can be applied in the identification of the gender of bitter gourd, the screening of complete female plants of bitter gourd, or in breeding, and has the characteristics of simple operation, low cost, strong specificity, and high stability.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomolecular markers, and particularly relates to a KASP molecular marker related to the complete femaleness of bitter gourd and its application. Background Art

[0002] Bitter gourd (Momordica charantia L.) belongs to the genus Momordica of the Cucurbitaceae family and is a characteristic vegetable crop deeply loved by consumers in China. Bitter gourd is rich in substances such as vitamins, momordicin, saponins, polypeptides, alkaloids, flavonoids, etc., and has various medicinal effects such as removing dampness, lowering blood sugar, anti-tumor, and enhancing immunity.

[0003] Commercial bitter gourd develops from the ovary part of female flowers. Therefore, complete female plants have the advantages of early maturity and high yield, meeting the requirements of facility cultivation for bitter gourd varieties. In addition, when using complete female plants as female parents for hybrid seed production and replacing manual emasculation hybridization with bee pollination, the seed production cost can be effectively reduced, and theoretically, the hybridization rate can reach 100%, improving the seed production quality. Therefore, complete femaleness has great application value and broad application prospects in the creation of new bitter gourd varieties and the supporting seed production process.

[0004] Using molecular marker-assisted selection to screen and identify the complete femaleness of bitter gourd at an early stage can greatly improve the breeding selection efficiency and accelerate the breeding process. Although there have been reports on molecular markers related to the complete femaleness of bitter gourd, either the genetic distance is far, the screening accuracy is not high, or the operation is complex, making it difficult to meet the requirements of current high-throughput rapid breeding. KASP (Kompetitive Allele-Specific PCR) technology has the advantages of high accuracy, strong locus adaptability, low cost, and being suitable for detecting SNP loci of a large number of samples. Therefore, developing KASP molecular markers closely linked to the complete femaleness of bitter gourd is of great significance for improving the breeding efficiency and breeding level of complete female bitter gourd in China. Summary of the Invention

[0005] In order to overcome the shortcomings of the prior art, the primary object of the present invention is to provide a KASP molecular marker related to the complete femaleness of bitter gourd.

[0006] Another object of the present invention is to provide the application of the above-mentioned KASP molecular marker related to the complete femaleness of bitter gourd.

[0007] The present invention is implemented as follows. A KASP molecular marker related to the complete femaleness of bitter gourd, the molecular marker is located at position 24645998 on chromosome 1 of the bitter gourd genome, and a point mutation of T to C occurs at position 24645998; the nucleotide sequence of this position and 200 bp upstream and downstream thereof is as shown in SEQ ID NO:1;

[0008] Among them, the KASP primer set for amplifying the molecular marker includes forward primer F1, forward primer F2 and reverse primer R; the nucleotide sequence of the forward primer F1 is as shown in SEQ ID NO:7, the nucleotide sequence of the forward primer F2 is as shown in SEQ ID NO:8, and the nucleotide sequence of the reverse primer R is as shown in SEQ ID NO:4;

[0009] The forward primer F1 is composed of KASP24645998-F1 and its 5'-end connected to a fluorescent linker sequence. The nucleotide sequence of KASP24645998-F1 is as shown in SEQ ID NO:2, and the connected fluorescent linker is the FAM fluorescent linker. The nucleotide sequence of the FAM fluorescent linker is as shown in SEQ ID NO:5;

[0010] The forward primer F2 is composed of KASP24645998-F2 and its 5'-end connected to another fluorescent linker sequence. The nucleotide sequence of KASP24645998-F2 is as shown in SEQ ID NO:3, and the connected fluorescent linker is the HEX fluorescent linker. The nucleotide sequence of the HEX fluorescent linker is as shown in SEQ ID NO:6;

[0011] The reverse primer R is KASP24645998-R, and the nucleotide sequence is as shown in SEQ ID NO:4.

[0012] The present invention further discloses a KASP primer set related to the all-female trait of bitter gourd. This primer set includes the above-mentioned forward primer F1, forward primer F2 and reverse primer R; among them, the nucleotide sequence of the forward primer F1 is as shown in SEQ ID NO:7, the nucleotide sequence of the forward primer F2 is as shown in SEQ ID NO:8, and the nucleotide sequence of the reverse primer R is as shown in SEQ ID NO:4.

[0013] The present invention further discloses a kit for identifying the sex type of bitter gourd. This kit contains the above-mentioned KASP primer set, which includes the above-mentioned forward primer F1, forward primer F2 and reverse primer R; among them, the nucleotide sequence of the forward primer F1 is as shown in SEQ ID NO:7, the nucleotide sequence of the forward primer F2 is as shown in SEQ ID NO:8, and the nucleotide sequence of the reverse primer R is as shown in SEQ ID NO:4.

[0014] The present invention further discloses the application of the above-mentioned KASP molecular marker, the above-mentioned KASP primer or the above-mentioned kit in the identification of the sex of bitter gourd, the screening of all-female plants of bitter gourd or in breeding.

[0015] The present invention further discloses a method for identifying the sex of bitter gourd using KASP molecular markers, and the method comprises the following steps:

[0016] (1) Using the genomic DNA of the sample to be tested as a template, performing a PCR amplification reaction with the above KASP primer set to obtain an amplification product;

[0017] (2) Detecting and analyzing the amplification product.

[0018] Preferably, in step (1), the PCR amplification reaction is Touchdown PCR amplification. Among them, the total volume of the PCR reaction system is 10 μL, including 5 μL of 2*KASP mastermix, 2.5 μL of PrimerMix, and 2.5 μL of template DNA (30 ng / μL);

[0019] The PCR amplification program is: pre-denaturation at 94 °C for 10 min; denaturation at 94 °C for 20 s; annealing and extension at 61 °C - 56 °C for 60 s, a total of 10 touchdown cycles, and the annealing and extension temperature decreases by 0.8 °C for each cycle; in the second round of cycles, denaturation at 94 °C for 20 s; annealing and extension at 55 °C for 60 s, for 26 cycles.

[0020] Preferably, in step (2), the detection is fluorescence detection of the amplification product. Among them, T / T represents the genotype of a complete female plant, T / C represents the heterozygous genotype of a monoecious plant; C / C represents the homozygous genotype of a monoecious plant.

[0021] Compared with the disadvantages and deficiencies of the prior art, the present invention has the following beneficial effects: The KASP markers of the present invention are used to identify the sex of bitter gourd, and have the characteristics of simple operation, low cost, strong specificity, and high stability. It can accurately and efficiently detect whether the bitter gourd plant to be tested is a homozygous monoecious plant, a heterozygous monoecious plant, or a homozygous complete female plant, and the coincidence rate of the detection result with the field is 100%; using the method of the present invention to assist in identifying the sex type of bitter gourd, the target strain can be screened at the seedling stage, and it can be used to screen a large number of samples, greatly shortening the breeding cycle of bitter gourd and improving the breeding efficiency, and having important application prospects. Description of the Drawings

[0022] Figure 1 It is a phenotypic observation diagram of the complete female bitter gourd material MB and the monoecious bitter gourd material GYH in Example 1 of the present invention;

[0023] Figure 2This is the genotyping map of 52 F2 test populations detected by the molecular marker KASP24645998 in Example 1 of the present invention. Among them, the circles represent homozygous all-female single plants with the genotype (T / T), the squares represent homozygous andromonoecious plants with the genotype (C / C), the triangles represent heterozygous andromonoecious plants with the genotype (T / C), and the hash signs represent the no-template control NTC. Detailed implementation manners

[0024] In order to make the objectives, technical solutions and advantages of the present invention more clear and understandable, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0025] The present invention uses the BSA mapping method to map an interval controlling the all-female trait of bitter gourd, develops markers within the interval for fine mapping, finds a completely linked mutation site, and develops a KASP molecular marker related to the all-female gene of bitter gourd based on this site.

[0026] I. Construction of the population

[0027] The all-female bitter gourd material MB is a high-generation inbred line of bitter gourd selected by the Vegetable Research Institute of Jiangsu Academy of Agricultural Sciences. The andromonoecious bitter gourd material GYH is a high-generation inbred line of bitter gourd selected by the Vegetable Research Institute of Jiangsu Academy of Agricultural Sciences.

[0028] The trait diagrams of the above MB and GYH are as Figure 1 shown. Using MB as the female parent and GYH as the male parent for hybridization to obtain F1, and self-crossing the F1 plants to obtain an F2 segregation population.

[0029] II. Identification of bitter gourd gender

[0030] The F2 population was planted in a greenhouse, and the gender of bitter gourd was investigated during the full-bloom period. The criteria for trait investigation were as follows: plants with all female flowers on all branches and vines during the full-bloom period were counted as all-female, and the appearance of one or more male flowers was counted as andromonoecious. The investigation results are shown in Table 1 below:

[0031] Table 1 Statistical table of gender investigation of bitter gourd F2 population

[0032]

[0033] The investigation results showed that all F1 were andromonoecious, and the number of all-female plants and andromonoecious plants in the F2 segregation population conformed to the segregation ratio of 1:3, indicating that the all-female trait of bitter gourd is controlled by a recessive single gene.

[0034] III. Mapping of the all-female gene of bitter gourd

[0035] Thirty full-female and thirty hermaphrodite offspring were separately selected from the F2 population. The genomic DNA of leaf tissues was extracted using the CTAB method. Equal amounts of DNA from each individual plant were mixed to construct the G pool and the M pool respectively. In addition, five plants each of MB and GYH were selected, the genomic DNA of leaf tissues was extracted and equally mixed to construct the P1 pool and the P2 pool respectively. The TruSeq DNA LT Sample Prep Kit (Illumina) was used to construct DNA libraries for the four pools, and the libraries were sequenced using the Illumina HiSeqTM PE150 platform with a sequencing depth of 30×. By calculating the △(SNP-index) value between the G pool and the M pool, the full-female gene of bitter gourd was initially mapped to the interval of 21.18 - 24.74 Mb at the end of chromosome 1 of bitter gourd.

[0036] To further narrow down the candidate interval, the re-sequencing data of the two parents were aligned to the reference genome of the third-generation sequencing of bitter gourd (Matsumura et al., 2020, PNAS), the DNA sequence variations between the two parents were analyzed, KASP markers were developed, and the developed KASP molecular markers were used to genotype individual plants of the F2 population to identify the recombinant individuals. Based on the bitter gourd sex phenotype survey data and the genotypes of the identified recombinant individuals, the full-female gene was mapped to the interval of 24098153 - 24745000 on chromosome 1 of bitter gourd.

[0037] IV. Development of Molecular Markers Linked to the Full-Female Gene of Bitter Gourd

[0038] Sequences with a length of 200 bp were selected in the upstream and downstream directions at the position of 24645998 on chromosome 1 of the bitter gourd genome to obtain a 401-bp sequence. The nucleotide sequence of this 401-bp sequence is shown in SEQ ID NO:1. The molecular marker is located at position 24645998 on chromosome 1 of the bitter gourd genome, corresponding to the 201st position of SEQ ID NO:1, and this nucleotide is T or C.

[0039] For the SNP site variation at this position, according to the KASP design principle, KASP primers were designed on the Poly Marker website, and two forward primers KASP24645998-F / KASP24645998-F2 and one universal reverse primer KASP24645998-R were designed, and their nucleotide sequences are as follows:

[0040] KASP24645998-F1: 5’-GTATTCTCGCACGTTTGTTCTATT (SEQ ID NO:2);

[0041] KASP24645998-F2: 5’-GTATTCTCGCACGTTTGTTCTATC (SEQ IDNO:3);

[0042] KASP24645998-R: 5'-ACTAATTGGTTTAATGTTTTGAAACATAC (SEQ ID NO:4).

[0043] The KASP primers are designed according to the genotypes at the position 24645998 on chromosome 1 of the all-female plants and the hermaphrodite plants. The genotype of the all-female plants is T / T, the genotype of the heterozygous hermaphrodite plants is T / C, and the genotype of the homozygous hermaphrodite plants is C / C.

[0044] V. Verification of the correlation between the KASP markers developed by the present invention and the sex of bitter gourd

[0045] (1) Extract genomic DNA

[0046] Use the CTAB (Cetyltrimethylammonium Bromide) method to extract the genomic DNA of the bitter gourd leaves of individual plants in the MB, GYH, F1, and F2 populations.

[0047] (2) Genotyping detection of bitter gourd materials using KASP markers

[0048] The 5' end of the KASP24645998-F1 primer is ligated with the FAM fluorescent linker sequence, and the 5' end of the KASP24645998-F2 primer is ligated with the HEX fluorescent linker sequence. The primer sequences after ligation with the fluorescent linker are as follows:

[0049] Forward primer F1: GAAGGTGACCAAGTTCATGCT GTATTCTCGCACGTTTGTTCTATT (SEQ ID NO:7, where the underlined part is the FAM fluorescent tag sequence);

[0050] Forward primer F2: GAAGGTCGGAGTCAACGGATT GTATTCTCGCACGTTTGTTCTATC (SEQ ID NO:8, where the underlined part is the HEX fluorescent tag sequence);

[0051] Reverse primer R: ACTAATTGGTTTAATGTTTTGAAACATAC (SEQ ID NO:4).

[0052] Dissolve the synthesized forward primer F1, forward primer F2 and reverse primer R in TE (pH 8.0) to 10 μM, and then prepare a primer mixture (i.e., KASP Primer Mix) according to the ratio of F1:F2:R = 1:1:3. Using the genomic DNA of each bitter gourd material obtained in step (1) as a template, perform PCR reaction according to the following reaction system and reaction program. Among them, ddH2O is used as a negative control instead of template DNA for the reaction.

[0053] The total volume of the PCR reaction system is 10 μL, including 5 μL of 2*KASP mastermix, 2.5 μL of PrimerMix, and 2.5 μL of template DNA (30 ng / μL). The PCR amplification program is: pre-denaturation at 94 °C for 10 min; denaturation at 94 °C for 20 s; annealing and extension at 61 °C - 56 °C for 60 s, a total of 10 touchdown cycles, and the annealing and extension temperature decreases by 0.8 °C for each cycle; in the second round of cycling, denaturation at 94 °C for 20 s; annealing and extension at 55 °C for 60 s, 26 cycles.

[0054] When performing fluorescence detection on the amplification products, if only the fluorescence signal corresponding to the forward primer F1 linked with the fluorescence adapter sequence is detected in the sample PCR product, the genotype of the detection site is T / T, and it is determined as a homozygous all-female single plant; if only the fluorescence signal corresponding to the forward primer F2 linked with the fluorescence adapter sequence is detected in the sample PCR product, the genotype of the detection site is C / C, and it is determined as a homozygous andromonoecious single plant; if both fluorescence signals corresponding to the primers F1 and F2 linked with the fluorescence adapter sequence are detected simultaneously, the genotype of the detection site is T / C, and it is determined as a heterozygous andromonoecious single plant showing andromonoecy.

[0055] The results are as Figure 2 shown in Table 2. When the marker KASP24645998 is used for amplification of bitter gourd materials, the T / T genotype is detected in all all-female plants, the C / C genotype is detected in all homozygous andromonoecious single plants, and the T / C genotype is detected in all heterozygous andromonoecious single plants.

[0056] Table 2 Detection results

[0057]

[0058]

[0059] The above experimental data show that each genotype can cluster together on the genotyping map and can correspond to the phenotype. Therefore, the KASP24645998 marker provided by the present invention can be used to accurately identify the gender of bitter gourd or screen all-female bitter gourd plants.

[0060] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention shall be included within the protection scope of the present invention. Sequence Listing <110> Jiangsu Academy of Agricultural Sciences <120> A KASP Molecular Marker Related to the Complete Femaleness of Momordica charantia and Its Application <160> 8 <170> SIPOSequenceListing 1.0 <210> 1 <211> 401 <212> DNA <213> Momordica charantia L. <400> 1 tcttcgactt ggctccattt gctacgtttt aggttaacgc attcggcata tgtacccgat 60 cgcgatagaa aacgtggtgg ccataggaca agttggttta ttcactatgt ggtgacattt 120 gatccttact tttgtgttag ttgcacgaac ttgattttct agttctatca atcgggtgta 180 ttctcgcacg tttgttctat ttgtatgttt caaaacatta aaccaattag ttaaatataa 240 cttatttatt ttacatatat ttaaattgac gtacctggag gaaaaactag aacaggcagg 300 tttgctggtg gatgatcacc accgtgtacg tgttcttgtg actggcctgc ttggtctggc 360 ctcatttttc tacaaactta ggtagacaac caatgagtat t 401 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <400> 2 gtattctcgc acgtttgttc tatt 24 <210> 3 <211> 24 <212> DNA <213> Artificial Sequence <400> 3 gtattctcgc acgtttgttc tatc 24 <210> 4 <211> 29 <212> DNA <213> Artificial Sequence <400> 4 actaattggt ttaatgtttt gaaacatac 29 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <400> 5 gaaggtgacc aagttcatgc t 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <400> 6 gaaggtcgga gtcaacggat t 21 <210> 7 <211> 45 <212> DNA <213> Artificial Sequence <400> 7 gaaggtgacc aagttcatgc tgtattctcg cacgtttgtt ctatt 45 <210> 8 <211> 45 <212> DNA <213> Artificial Sequence <400> 8 gaaggtcgga gtcaacggat tgtattctcg cacgtttgtt ctatc 45

Claims

1. A KASP primer set related to the complete femaleness of bitter gourd, characterized in that, The primer set consists of forward primer F1, forward primer F2 and reverse primer R; wherein, the nucleotide sequence of the forward primer F1 is as shown in SEQ ID NO:7, the nucleotide sequence of the forward primer F2 is as shown in SEQ ID NO:8, and the nucleotide sequence of the reverse primer R is as shown in SEQ ID NO:

4.

2. A kit for identifying the sex type of bitter gourd, characterized in that, This kit contains the KASP primer set described in claim 1.

Images