Genetically engineered phages

Abstract

A method of engineering a phage, the method comprising: isolating a phage; removing all attachment genes from the genome of the phage; inserting a first unique open reading frame encoding one or more attachment genes and inserting a second unique open reading frame encoding one or more genes for overcoming bacterial defenses; and inserting a non-native attachment gene into the first open reading frame, wherein the non-native attachment gene is specifically for attachment to a selected bacterium.

Description

Technical Field

[0001] Prevention, diagnosis, and treatment of bacterial infections in humans, animals, and plants. Background Art

[0002] Bacteria are single-celled biological entities, and most are harmless to humans - less than one percent of different types of bacteria cause illness in humans. Many bacterial species are beneficial to humans, such as those that aid in digestion, destroy disease-causing cells, and provide needed vitamins.

[0003] Infectious bacteria (the harmful one percent) cause diseases in humans and animals. They rapidly multiply in the body and produce toxic proteins, leading to tissue damage and disease.

[0004] Bacteriophages (also known as phages) were discovered by Ernest Hankin in 1896 and were used as antibacterial agents against cholera. These virus-specific to bacteria can infect and destroy bacterial cells.

[0005] Bacteriophages are composed of proteins that enclose a DNA or RNA genome. Bacteriophages replicate within bacteria by injecting their viral genetic material (DNA or RNA) into host cells, effectively taking over the cell's functions to produce progeny phages, resulting in cell wall rupture and subsequent bacterial cell death.

[0006] Bacteriophages were used as antibacterial agents until the 1930s. However, bacteria have been found to naturally develop resistance to bacteriophages. With the introduction of chemical antibiotics, the use of bacteriophages was abandoned.

[0007] Although antibiotics are useful treatment methods, bacterial mutations that confer antibiotic resistance are becoming increasingly common among pathogenic bacteria worldwide. For example, methicillin-resistant Staphylococcus aureus (MRSA) bacteria are an increasingly common form of infection, typically acquired through nosocomial transmission. MRSA infections are extremely difficult to treat with conventional antibiotics.

[0008] Bacteriophages can be very specific to the type of pathogenic bacteria. Most bacteriophages have a structure that enables it to bind to specific molecules on the surface of its target bacteria.

[0009] A key advantage of bacteriophages is that they are able to eliminate antibiotic-resistant bacteria without exposing humans, animals, and the environment to increasingly toxic antibiotics, or harmful or irritating chemicals (e.g., see U.S. Patent No. 6,699,701 to Intralytix).

[0010] In a natural environment, bacteriophages can be isolated from the environment where specific bacteria grow according to a pairing relationship, for example, isolated from sewage or feces. Different types of natural bacteriophage repositories have been established to provide bacteriophages for treating intractable infections caused by specific bacterial species.

[0011] One problem with using bacteriophages is that a patient's own body often mounts an immune response to the bacteriophages and eliminates the bacteriophages in the blood. U.S. Patent No. 5,660,812, U.S. Patent No. 5,688,501, U.S. Patent No. 5,811,093, and U.S. Patent No. 5,766,892 all disclose methods of selecting or generating (using mutations) bacteriophages to improve the half-life of the bacteriophages in the blood of the treated patient.

[0012] Another problem associated with the previous use of bacteriophages to disinfect or treat bacterial contaminants or diseases is that bacteria can develop resistance to bacteriophages. For example, the presence of prophages within bacteria may block the gene expression of infectious bacteriophages, thereby preventing the replication of infectious bacteriophages and preventing the lysis and killing of bacteria. Prophages may also cause the destruction of incoming bacteriophage DNA.

[0013] This previously meant that either the bacteriophages needed to be matched to the bacteria, often requiring complex genetic analysis of the bacteria, or multiple different bacteriophages needed to be used in combination. WO 03 / 080823 discloses the preparation of groups of different bacteriophages, such as groups of viral mutants obtained from temperate bacteriophages.

[0014] Currently, only natural bacteriophages exist, as well as natural bacteriophages that have been mutated and selected to be specific for certain bacteria (for example, see U.S. Patent No. 8,685,697 to Intralytix). Summary of the Invention

[0015] The present invention is a template or platform technology for creating customized genetically modified bacteriophages that target and destroy specific bacterial organisms found in humans, animals, and crops, as well as on the surfaces of healthcare or food processing facilities.

[0016] Using this template technology, specific products can be developed, such as a disinfectant spray against MRSA, a food additive to prevent the use of antibiotics in animal feed, and a therapeutic agent for human bacterial infections. Accordingly, the present invention includes genetically modified bacteriophages and gene products derived from bacteriophages for treating and / or eliminating bacterial infections using bacteriophages.

[0017] According to one aspect, a method of manipulating a viral genome to cause a functional change in the viral life cycle is disclosed.

[0018] In one embodiment, the present invention provides a method for engineering a phage, the method comprising:

[0019] - isolating a phage;

[0020] - removing any attachment genes from the genome of the phage;

[0021] - inserting a first unique open reading frame encoding one or more attachment genes, and inserting a second unique open reading frame encoding one or more genes for overcoming bacterial defenses;

[0022] - inserting a non-natural attachment gene into the first open reading frame, wherein the non-natural attachment gene is specifically used for attachment to a selected bacterium. One or more genes for overcoming bacterial defenses are endolysin, biofilm reducer, polysaccharide-protein complex penetrant, or any combination thereof.

[0023] In another embodiment, the present invention provides a method for engineering a phage, the method comprising:

[0024] - isolating a phage;

[0025] - removing any attachment genes from the genome of the phage;

[0026] - inserting a multi-restriction enzyme cassette into the genome; and

[0027] - inserting a non-natural attachment gene into the cassette, wherein the non-natural attachment gene is specifically used for attachment to a selected bacterium.

[0028] The phage may include a non-natural attachment gene, wherein the non-natural attachment gene is specifically used for attachment to a selected bacterium. The phage may be without natural attachment genes. The phage may be lytic. The non-natural attachment gene is specific for pathogenic / non-pathogenic bacteria. The phage can be used for cleaning, treating, or preventing bacterial contamination.

[0029] The present invention also teaches a phage for diagnosing the presence of a specific bacterium.

[0030] The present invention also teaches a method for producing mutant phages, the method comprising inactivating the attachment genes from a selected phage, the selected phage being isolated from phages in the environment; inserting a first heterologous nucleic acid sequence into the selected phage to produce a mutant phage, the first heterologous nucleic acid sequence comprising a first open reading frame encoding a first specific attachment gene, the first specific attachment gene being different from the inactivated attachment gene and being specific for a selected bacterium. A second heterologous nucleic acid sequence may be inserted into a second open reading frame encoding a gene for overcoming bacterial defenses. The gene for overcoming bacterial defenses may be a biofilm-degrading gene, a glycocalyx-degrading gene, a gene encoding an antibacterial protein, and a gene for an enzyme that disrupts the bacterial cell wall, thereby producing a mutant phage. The inactivation step may inactivate all of the attachment genes of the selected phage.

[0031] The present invention also teaches a phage that is a lytic phage, a phage with a small genome size, or a phage with structural and functional genes to lyse Gram-negative and Gram-positive bacteria, or any combination thereof.

[0032] The present invention also teaches an antimicrobial composition for disinfecting or decontaminating a surface.

[0033] The present invention also teaches a method for eliminating microbial contaminants, the method comprising: obtaining one or more lysozymes produced by mutant phages; and applying the one or more lysozymes to bacterial contaminants without prior infection of the bacterial contaminants with phages to eliminate the bacterial contaminants. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 Shows an overview of a phage engineering platform according to an embodiment of the present invention.

[0035] Figure 2 Shows an overview of a method for producing mutant phages using a cell-free cloning method according to an embodiment of the present invention.

[0036] Figure 3 Shows an overview of a method for producing mutant phages using a yeast strain according to an embodiment of the present invention.

[0037] Figure 4 is an agarose plate, which is the pp8 titration result against Escherichia coli DH5α after resurrection from a genetic template. The phage was spot-plated on a lawn of Escherichia coli. The concentration was determined to be 10 8 phage units isolated per 10 μl as 10 6 .

[0038] Figure 5Shows a schematic diagram of the entire genome of the disclosed mutant phage according to an embodiment of the present invention.

[0039] Figure 6 Shows the nucleotide sequence of the entire genome of PP8 and the proteins encoded therein, as well as restriction enzyme sites, according to an embodiment of the present invention.

[0040] Figure 7 Is a detailed description of the PP8 molecule and protein according to an embodiment of the present invention, with annotations.

[0041] Figure 8 Is a gel electrophoresis photograph of the digestion of PP8 DNA using enzymes that specifically remove inserts. EcoRI was used for ORF1 and ORF2, and TspRI was used for ORF3 and ORF4. Lane 1: 1 kb DNA ladder marker (NEB), Lane 2: empty, Lane 3: undigested PP8 DNA, Lane 4: digested PP8 ORF1 inserted into the SP5 attachment gene (46090), band size 1.1 kb, Lane 5: digested PP8 ORF2 inserted into the endolysin gene (73195), band size 2.1, Lane 6: digested PP8 ORF3 inserted into the SP6 attachment gene (19991), band size 1.2 kb, Lane 7: digested PP8 ORF4 inserted into the endolysin gene (60431), band size 2.1.

[0042] Figure 9a - Shows a gel electrophoresis photograph, where Lane 1: 1 kb DNA ladder marker (NEB), Lane 2: empty, Lane 3: extracted phage genome control, Lane 4: bacterial control (mock - phage infection), Lanes 5 - 7: purified bacterial colonies with potential integration. Expected band size: 554 bases.

[0043] Figure 9b – Is a gel electrophoresis photograph, where Lane 1: extracted phage genome control, Lane 2: bacterial control (mock - phage infection), Lanes 3 - 5: purified bacterial colonies with potential integration. Expected band size: 613 bases.

[0044] Figure 10 Shows an overview of the disclosed method for modifying binding sites according to an embodiment of the present invention.

[0045] Figure 11 Shows the results of the MRSA phage treatment experiment, where the phage PP8 (SR5) inserts and lyses MRSA patient samples 1 - 6. The concentration is 10 7The phages were used to generate the bactericidal curves for 6 MRSA-positive patient samples. These samples were named Patient 1-6.

[0046] Figure 12 Showing the titration of PP8 / SP5 against Staphylococcus aureus. The phage was spotted onto the lawn of Staphylococcus aureus. The concentration was determined to be 10 5 phage units per 10 μl.

[0047] Figure 13 Showing the titration of PP8 / SP6 against Staphylococcus aureus. The phage was spotted onto the lawn of Staphylococcus aureus. The concentration was determined to be 10 8 phage units per 10 μl.

[0048] Figure 14 Showing the results of the new MRSA phage treatment, where the bactericidal curves of PP8(SR5, SR6) insertions against MRSA patient samples 1-6 are shown. The concentration of 10 5 phages were used to generate the bactericidal curves for 6 MRSA-positive patient samples. The survival rate test of the patient samples was performed at a concentration of 10 6 .

[0049] Figure 15 Is a photograph showing the PP8 SP5 / SP6 bacterial challenge. The agarose plate was flooded with the phage PP8 SP5 / SP6. The lysis test of the bacterial strains was performed. 50) Escherichia coli O9, 51) Escherichia coli O1, 52) Escherichia coli O28, 53) Escherichia coli DH5α, 54) Salmonella enterica, 55) Listeria monocytogenes, 56) Enterococcus durans, 57-61) MRSA patient samples 1-5 respectively.

[0050] Figure 16 Showing an overview of a phage engineering platform for engineering phages with Escherichia coli, Salmonella, and Clostridium specific binding domains and endolysin genes according to an embodiment of the present invention.

[0051] Figure 17 Showing an overview of a phage engineering platform for engineering phages with Escherichia coli, Salmonella, and Clostridium specific recognition binding domains and recognized endolysin genes or engineering phages with T7 tail fibers and GFP according to an embodiment of the present invention.

[0052] Figure 18 Showing the agarose gel of the tail fiber gene digested for inserting the PP8 genetic template.

[0053] Figure 19 Showing the agarose gel of the PP8 digest for confirming the specific tail fiber insertion.

[0054] Figure 20 Show the titration of the PP2 / PP8 gene template with E. coli pilus insertions on an E. coli lawn.

[0055] Figure 21 Show the titration of the PP8 gene template with Salmonella typhimurium strain A3 pilus insertions.

[0056] Figure 22 Show the titration of the PP8 genetic template with Clostridium perfringens CPS2 pilus insertions. Detailed Description

[0057] Unless otherwise noted, the methods and techniques of the present disclosure are generally performed according to conventional methods well known in the art and the methods described in the various general and more specific references cited and discussed in this specification.

[0058] The terms "polypeptide", "peptide", and "protein" are generally used interchangeably herein and refer to polymers of amino acid residues. Amino acids can be represented herein by their common three-letter symbols or the single-letter symbols recommended by the IUPAC-IUB Commission on Biochemical Nomenclature. Each protein or polypeptide has a unique function. The present invention includes polypeptides and functional fragments thereof, as well as mutants and variants having the same biological function or activity.

[0059] In some embodiments, polymer molecules (such as polypeptide sequences or nucleic acid sequences) are considered to be "homologous" to each other if their sequences are at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 99% identical.

[0060] In some embodiments, a fragment of a nucleic acid sequence is a fragment of an open reading frame sequence. In some embodiments, such a fragment encodes a polypeptide fragment of the protein encoded by the open reading frame nucleotide sequence (as defined herein).

[0061] As used herein, the term "nucleic acid fragment" refers to a nucleic acid sequence with deletions. In some embodiments, a fragment of a nucleic acid sequence is a fragment of an open reading frame sequence. In some embodiments, such a fragment encodes a polypeptide fragment of the protein encoded by the open reading frame nucleotide sequence (as defined herein).

[0062] The term "construct" refers to a nucleic acid sequence encoding a protein, operably linked to a promoter and / or other regulatory sequences.

[0063] The term "genomic sequence" refers to a sequence having non - contiguous open reading frames, where introns interrupt the protein - coding regions.

[0064] As used herein, the term "encoding (encoding, coding or encoded)" when used in the context of a particular nucleic acid means that the nucleic acid includes the necessary information to direct the translation of a nucleotide sequence into a particular protein. The information for encoding a protein is specified using codons. A nucleic acid encoding a protein may include untranslated sequences (such as introns) within the translated region of the nucleic acid, or may lack such intervening untranslated sequences (such as in cDNA).

[0065] In the context of nucleic acid sequences, the term "percent sequence identity" or "identical" refers to residues that are the same when two sequences are aligned for maximum correspondence. For example, polynucleotide sequences can be compared using the computer program BLAST (Altschul et al., J. Mol. 215:403 - 410 (1990); Gish and States, Nature Genet. 3:266 - 272 (1993).

[0066] The term "substantially homologous" or "substantially similar" when referring to a nucleic acid or a fragment thereof, means that there is at least about 70%, 80%, 85%, or at least about 90%, or at least about 95%, 96%, 97%, 98% or 99% nucleotide sequence identity of nucleotide bases when optimally aligned with another nucleic acid (or its complementary strand) with appropriate nucleotide insertions or deletions, as determined by any well - known sequence identity algorithm as discussed above, such as BLAST assays.

[0067] As used herein, a "heterologous nucleic acid sequence" is any sequence that is placed at a location in the genome where it is not normally present. In some embodiments, the heterologous nucleic acid sequence is a native phage sequence, although it is from a different phage.

[0068] A particular nucleic acid sequence also includes its conservatively modified variants (such as degenerate codon substitutions) and complementary sequences, as well as the explicitly indicated sequences. Thus, a nucleic acid sequence encoding a protein sequence disclosed herein also includes its modified variants as described herein. Substantially similar nucleic acid fragments of the invention can also be characterized by the percent identity of the amino acid sequences they encode to the amino acid sequences disclosed herein, as determined by algorithms commonly employed by those of skill in the art.

[0069] "Original bacteriophage" refers to bacteriophages isolated from natural or artificial environments without genetic engineering modification. "Mutant bacteriophage" refers to bacteriophages, or the genomes of bacteriophages, whose genomes have been genetically modified by inserting heterologous nucleic acid sequences into the genome. In some embodiments, the genome of the original bacteriophage is modified by recombinant DNA technology to introduce heterologous nucleic acid sequences at defined sites in the genome.

[0070] An expression control sequence that is "operably linked" or "operatively linked" refers to a linkage in which the expression control sequence is contiguous with the coding sequence of interest to control the expression of the coding sequence of interest, as well as an expression control sequence that acts in trans or at a distance to control the expression of the coding sequence.

[0071] "Coding sequence" or "open reading frame" is a nucleotide sequence that encodes a polypeptide or protein. The ends of the coding sequence are the start codon and the stop codon. The present disclosure also includes natural, isolated or recombinant nucleic acid sequences encoding proteins, as well as vectors and / or (host) cells containing the protein coding sequence.

[0072] The present invention also includes fragments and variants of the disclosed nucleotide sequences and the proteins encoded thereby. By "fragment" is meant a portion of a nucleotide sequence or the amino acid sequence encoded thereby and a portion of a protein. Fragments of a nucleotide sequence can encode protein fragments that retain the biological activity of the native protein. Accordingly, the present disclosure relates to any nucleic acid fragment comprising a nucleotide sequence that encodes all or a substantial portion of the amino acid sequence encoded thereby.

[0073] This technology uses synthetic biology to generate bacteriophages that can bind to specific bacterial strains. Since bacteriophages must attach to host bacterial cells to initiate infection of the bacteria, genetic selection or manipulation in the viral DNA or RNA can define the binding characteristics, thereby expanding the range of host cells beyond natural pairing relationships. According to one embodiment, there are some characteristics of the disclosed bacteriophages, including the following.

[0074] The bacteriophages are safe, non-corrosive, and non-toxic. Bacteriophages can be engineered not to affect beneficial bacteria, animal or human cells. Thus, there is no interference with the food chain as with antibiotics.

[0075] The bacteriophages are designed and not found in nature. Thus, this technology can be applied to any bacterial infection. Undesirable genetic components are eliminated. In contrast, existing methods of isolating natural bacteriophages for specific bacteria are like "looking for a needle in a haystack" for the target bacteria.

[0076] The phages are engineered to avoid mutations / adaptations of the target bacteria, resulting in excellent lethality and no resistance. Therefore, the phages have better efficacy than known phages. The phages can also prevent the formation of biofilms.

[0077] According to one embodiment, the platform is universal. The disclosed phages can be used to solve any bacterial problem. The disclosed phages can be applied to human health (personalized medicine, disinfectants, and diagnostics), for example, for MRSA and VRE; animal health (livestock medicine, diagnostics), for example, an ear drop for treating Staphylococcus aureus infection in dogs; and food safety (product cleaning, detecting bacterial contamination), for example, for Escherichia coli (E. coli), Campylobacter jejuni (C. Jejuni), Salmonella (Salmonela), and Listeria.

[0078] According to one embodiment, the phages can be used not only to treat antibiotic-resistant bacterial infections but also to prevent bacterial contamination in the environment and food that may have a negative impact on human and animal health.

[0079] For example, phages are useful for human health. Methicillin-resistant Staphylococcus aureus (MRSA) bacteria are an increasingly common hospital-acquired infection, often acquired by contact with contaminated surfaces. For facilities identified with an MRSA problem, the product can be used to thoroughly clean surfaces and reduce the occurrence of new infections. According to one embodiment, a multi-strain MRSA-specific disinfectant cleaner is provided, which can be used on porous and non-porous surfaces in hospitals, including beds, curtains, tables, chairs, diagnostic and monitoring equipment, and medical instruments.

[0080] According to one embodiment, the disclosed phages can be used to reduce or eliminate any pathogenic and / or resistant bacteria to humans and / or animals. In some aspects, compared with commonly used disinfectants (such as bleach), the advantages of using such disinfectants are multi-faceted. First, phages are more effective than conventional means in eliminating bacteria. Second, phages can remain on the surface to disrupt new bacterial contamination events and can survive for about 24 hours. Third, unlike bleach, phages do not leave corrosive residues and thus do not harm instruments, fabrics, and skin. Fourth, phages customized for harmful bacteria are non-toxic, unlike cleaning fluids.

[0081] Phages are also useful in the treatment of animal health. For example, phages are customized to solve bacterial infections in chickens, replacing commonly used antibiotics, making the chickens antibiotic-free - a commercial benefit in today's market. This treatment method also helps to reduce the increasing number of antibiotic-resistant infections, which occur as bacteria mutate and evolve to be unaffected by antibiotics.

[0082] Phages are also useful in food safety. For example, phage cleaning sprays can be applied to crops to prevent foodborne diseases caused by bacterial contamination during plant cultivation or harvesting, such as E. coli contamination of strawberries.

[0083] The phage display technology is used to generate phages with various specific binding domains (thereby selecting the host range). This technology provides a high concentration of phages.

[0084] In some embodiments, phage-derived gene products can be used for "exogenous lysis", thereby eliminating bacteria without the need for infection.

[0085] According to one embodiment, a method for eliminating bacterial contaminants without prior phage infection of the bacterial contaminants is provided, the method comprising obtaining one or more lytic enzymes produced by the disclosed phages; applying the one or more lytic enzymes to the bacterial contaminants to eliminate the bacterial contaminants.

[0086] Phages or bacteriophages are defined as viruses that infect bacteria. Phages are highly specific for their corresponding host bacteria. To infect bacteria, phages attach to specific receptors on the bacterial surface. This attachment determines the host range of each phage and is usually limited to bacteria of some genera, species, or even subspecies. This specificity of phages can provide clinicians, laboratory technicians, field technicians, and consumers with the ability to utilize this phage property to identify (detect or diagnose) specific types of bacteria.

[0087] Phages undergo two types of natural life cycles, or methods of viral replication, called the lytic cycle and the lysogenic cycle. In the lytic cycle, the host cell will be destroyed and will die after viral replication. In contrast, the lysogenic cycle does not result in the immediate lysis of the host cell and the consequent death of the host cell; instead, the phage genome integrates with the host DNA or establishes itself as a plasmid and replicates along with the genome of the organism. The endogenous phage remains dormant until the host is exposed to specific conditions (such as stress), at which point the phage can be activated to initiate the reproductive cycle, resulting in the lysis of the host cell.

[0088] Endolysins are produced from their host cells at the final stage of the phage lytic cycle and most are released into the periplasmic space (Borysowski et al., 2006). From there, endolysins cleave covalent bonds in peptidoglycan, releasing the viral progeny (Fischetti, 2008). Among the endolysin subgroups, there are five classes: amidases, endopeptidases, muramidases, glucosaminidases, and transglycosylases (Gasset, 2010).

[0089] According to one embodiment, there is provided the use of lytic enzymes or enzybiotics from bacteriophages in combating antimicrobial resistance. Enzybiotics are defined as proteins that degrade the bacterial cell wall, which means that they are not affected by phage proteins (Borysowski and Gorski, 2010). The term enzybiotics was first proposed in the article "Prevention and elimination of upper respiratory colonization of mice by group A streptococci by using bacteriophage lytic enzyme" (Nelson et al., 2001). Phage lysozymes are specific. Phage-derived lysozymes and their destructive activity against certain components of the cell wall are seen in pathogenic bacterial strains but not in the natural microbiota of animals (Gasset, 2010). Two examples include streptolysin C, which can effectively lyse group A streptococci but has no effect on normal oral streptococci (Fischetti, 2006). A more relevant example is obtained from the use of the outer membrane protein FyuA, which is normally expressed in pathogenic Gram-negative Escherichia coli. The fusion of the FyuA binding domain with T4 lysozyme results in the transfer of the fusion from the outer membrane to the periplasmic space, where the lysozyme is able to destabilize the bacterial cell wall (Lukacik et al., 2013).

[0090] According to one embodiment, a method for providing an endolysin protein or multiple endolysin proteins is disclosed, which overcomes the problems brought by whole phages. One or more endolysins specifically target and degrade the bacterial cell wall (peptidoglycan) intracellularly or extracellularly, resulting in lysis. In some aspects, a method is provided to generate various clones of endolysin genes from a multitude of phages and use high-throughput screening to evaluate the success rate of endolysin clones against one or more bacteria, such as Escherichia coli strains, Salmonella typhimurium, and Campylobacter jejuni.

[0091] Thus, the technology expands the number of bacterial strains that can be treated with phages or phage gene products in both infected and non-infected situations.

[0092] Phages self-replicate by infecting and killing bacteria. In this process, components of the bacterial cell wall are released along with the phages. These components can be toxic to humans, animals, and bacteria. Therefore, large-scale phage preparation using bacteria requires post-manufacturing treatment with irritating organic chemicals to reduce the toxicity to an acceptable level for clinical treatment.

[0093] Accordingly, in one embodiment, a method is provided for growing the disclosed phages in the presence of large-scale use of bacteria by using yeast strains such as Kluyveromyces lactis and Pichia pastoris. The disclosed method circumvents the release of toxic end products.

[0094] Generate mutant phages

[0095] Isolate and fully characterize environmental samples to identify candidates that meet certain criteria. Preferably, suitable prophages are selected from candidates that include one or more of the following characteristics:

[0096] - Lytic phages;

[0097] - Genetically different from known phages; and

[0098] - Carry only one attachment gene,

[0099] According to one embodiment, a method is provided for genetically modifying one or more suitable prophages.

[0100] In one embodiment, the prophage includes one attachment gene. In another embodiment, the prophage includes more than one attachment gene.

[0101] In one embodiment, the method produces a phage platform configured to allow further interchange of one or more desired proteins, such as attachment proteins.

[0102] According to one embodiment, the phage genome is manipulated to alter the viral life cycle, resulting in gain-of-function, loss-of-function, or for virus recognition (reporter gene). Figure 1 A general overview is shown.

[0103] In one aspect, the prophage is a lytic phage. In one aspect, the prophage is a lytic phage carrying one or more attachment genes. In another aspect, the prophage is a lytic phage carrying only one attachment gene. In one aspect, the prophage carries only one attachment gene.

[0104] According to one embodiment, a method for producing mutant phages is provided. In one aspect, the method includes modifying the phage binding site of a prophage such that the mutant phage is capable of attaching to different serotypes. In one embodiment, the mutant phage is then resurrected and a new binding domain is determined.

[0105] According to one embodiment, the engineered phage only includes lytic genes, wherein any and all lysogenic genes have been removed to ensure that integration cannot occur.

[0106] According to one embodiment, a method of "cell-free cloning" is provided to provide a templating (or platform) technology that allows modification / insertion / deletion of viral genes. The platform is generated by constructing mutant phages (defined as phages produced from known and unknown genetic codes) using isolated environmental samples.

[0107] Genetically comparing the unknown phage types in the environmental sample with known phage types enables us to isolate the known gene types.

[0108] In one embodiment, a mutant phage is provided in which genes of interest are added and unwanted genes are deleted. Together with the non-coding regions, the mutant phage is a genetic platform carrying at least two unique open reading frames (ORFs).

[0109] These unique ORFs can be used to add genes of interest. Referring to Figure 2 , the genomic complement is divided into fragments that have overlapping portions with adjacent fragments obtained by PCR amplification. Foreign genes are inserted into the respective fragments. Using homologous recombination methods, the fragments are joined together using a bacterial cell extract that contains the necessary components to ligate the fragments together by homology into a continuous fragment. The phage can be resurrected from the fully assembled genome by cell-free translation. The method involves mixing selected DNA with a non-toxic cell extract of Escherichia coli along with amino acids and energy, and the transcription and translation proteins and enzymes in the extract drive the expression of the DNA, resulting in the production of phages.

[0110] In various aspects, the mutant phage is a genetic platform carrying four unique open reading frames (ORFs).

[0111] In one embodiment, the first ORF can be used to insert attachment genes for bacteria. In one aspect, the attachment genes can be selected from, but not limited to, the following proteins:

[0112] · DNA-binding phage protein of Enterobacteriaceae (>CP007523.1: 3585236-3586111 Salmonella enterica subsp. enterica, serovar Typhimurium str. CDC 2011K-0870, complete genome) SEQ ID No:125

[0113] · DNA-binding phage protein (>CP002910.1: 3892390-3893265 Klebsiella pneumoniae KCTC 2242, complete genome) SEQ ID No:126

[0114] · DNA-binding protein (>CM000724.1: 300852-301217 Bacillus cereus BDRD-ST26 chromosome, whole-genome shotgun sequencing) SEQ ID No:127

[0115] · Phage DNA-binding transcriptional regulator (>CP003678.1: c575894-575136 Enterobacter cloacae subsp. dissolvens SDM, complete genome) SEQ ID No:128

[0116] · Phage ssDNA-binding protein (>CP009983.1: 941901-942146 Vibrio parahaemolyticus strain FORC_008 chromosome 2, complete sequence) SEQ ID No:129

[0117] · DNA-binding protein (>CM000749.1: 288493-288840 Bacillus thuringiensis, T04001 chromosome, whole-genome shotgun sequencing) SEQ ID No:130

[0118] · Phage nucleotide-binding protein (>CP006620.1: c2486999-2486259 Enterococcus faecalis Aus0085, complete genome) SEQ ID No:131

[0119] · DNA-binding protein phage P4 (>AE005174.2: 318190-318450 Escherichia coli O157:H7 str. EDL933 genome) SEQ ID No:132

[0120] · CP4-6 prophage; putative DNA-binding transcriptional regulator (>HG738867.1: c269405-268512 Escherichia coli str. K-12 substr. MC4100 complete genome) SEQ ID No:133

[0121] · DNA-binding protein (Chromosome 1 of Pseudomonas pseudoalcaligenes K96243, complete sequence) SEQ ID No:134

[0122] · Putative DNA-binding phage protein (>AL590842.1:c1239408-1238512 Yersinia pestis CO92 complete genome) SEQ ID No:135

[0123] · Putative DNA-binding phage protein (>AL590842.1:1235071-1235391 Yersinia pestis CO92 complete genome) SEQ ID No:136

[0124] · Putative phage-related DNA-binding protein (>BX950851.1:4152092-4152508 Erwinia carotovora subsp. SCRI1043, complete genome) SEQ ID No:137

[0125] In one embodiment, the second ORF is used to insert a gene encoding a protein that can be used to overcome bacterial host defenses.

[0126] For example, the second ORF can be used to introduce enzymatic functions to counter bacterial defenses. On the one hand, the second ORF can be used to add an intracellular lysin gene and / or a biofilm-degrading gene.

[0127] In an embodiment, the intracellular lysin gene is selected from:

[0128] · PP1 phage intracellular lysin, SEQ ID No:138, which is similar to Escherichia coli phage B2: 93% identical and 100% query coverage, accession number: MG581355; Enterobacter phage JL1: 92% identical and 100% query coverage, accession number: JX865427; Shigella phage EP23: 91% identical and 100% query coverage, accession number: JN984867; Suda bacteriophage: 91% identical and 100% query coverage, accession number: GQ502199;

[0129] · PP2 phage intracellular lysin, SEQ ID No:139, which is similar to Escherichia coli phage phiLLS: 99% identical and 100% query coverage, accession number: KY677846; Salmonella phage Stp1: 98% identical and 100% query coverage, accession number: KY775453; Salmonella phage SP01: 98% identical and 100% query coverage, accession number: KY114934; T5 phage-like fork 29: 97% identical and 100% query coverage, accession number: MF431732;

[0130] · The endolysin of phage PP3, SEQ ID No: 140, which is 99% identical and has 100% query coverage to Enterobacter phage ATK48, accession number: KT184310; Shigella phage SHSML-52-1: 99% identical and 100% query coverage, accession number: KX130865; Escherichia coli phage APCEc01: 99% identical and 100% query coverage, accession number: KR422352.1; Escherichia coli O157 typing phage 6: 98% identical and 100% query coverage, accession number: KP869104; Shigella phage Shf125875: 98% identical and 100% query coverage, accession number: KM407600; Shigella phage phi25-307: 98% identical and 100% query coverage, accession number: MG589383; Klebsiella phage vB_Kpn_F48: 73% identical and 98% query coverage, accession number: MG746602;

[0131] · The endolysin of phage PP7, SEQ ID No: 141, which is 95% identical and has 100% query coverage to Salmonella phage ST11, accession number: MF370225; Salmonella phage Meda: 95% identical and 100% query coverage, accession number: MH586731; Salmonella phage Si3: 95% identical and 100% query coverage, accession number: KY626162; Escherichia coli phage EC6: 95% identical and 100% query coverage, accession number: JX560968; phage Felix 01: 95% identical and 100% query coverage, accession number: AF320576; Enterobacter phage KhF2: 94% identical and 100% query coverage, accession number: KT184314; Salmonella virus VSe102: 94% identical and 100% query coverage, accession number: MG251392; Salmonella phage Mushroom: 94% identical and 100% query coverage, accession number: KP143762; Staphylococcus phage SA1: 94% identical and 100% query coverage, accession number: GU169904; Escherichia coli O157 typing phage 15: 94% identical and 100% query coverage, accession number: KP869113; Citrobacter phage Mijalis: 83% identical and 99% query coverage, accession number: KY654690; Shigella phage Sf14: 82% identical and 99% query coverage, accession number: MF327003;

[0132] · The endolysin of phage PP11, SEQ ID No: 142, which is similar to Enterobacter phage HK578: 79% identity and 97% query coverage, accession number: JQ086375; Escherichia coli phage Sloth: 78% identity and 97% query coverage, accession number: KX534339; Escherichia coli phage Envy: 78% identity and 97% query coverage, accession number: KX534335;

[0133] · The endolysin of Enterobacter cloacae A1S1 phage SEQ ID No: 143.

[0134] In one embodiment, the biofilm-degrading genes and the glycocalyx-degrading agents are selected from:

[0135]

[0136]

[0137] For example, the second ORF can be used to introduce antibacterial proteins used in the template for bacterial lysis. On the one hand, the exemplary protein is a bacterial cell wall degrading agent for degrading Staphylococcus aureus (>ENA|JQ066320|JQ066320.1 Staphylococcus aureus strain JP1 Psmβ1 (psmβ1) and Psmβ2 (psmβ2) genes, complete cds). SEQ ID No: 144.

[0138] In other aspects, the second ORF can be used to introduce enzymes that target key linking chemical bonds (amide, ester, and glycolytic bonds) found in the bacterial cell wall. Examples include:

[0139] · M20 family peptidase [uncultured bacterium], accession number AHZ45606 (uncultured bacterium, >KF835382.1: c34024-32630 uncultured bacterium clone SZR5 genomic sequence) SEQ ID No: 145;

[0140] · Lipase (uncultured bacterium accession number AHZ45613 >KF835383.1: 7038-8066 uncultured bacterium clone WZR9 genomic sequence) SEQ ID No: 146;

[0141] · Peptidase M56 ([uncultured bacterium] accession number AHZ45657 uncultured bacterium clone WZR18 genomic sequence (>KF835385.1: c14123-13038 uncultured bacterium clone WZR18 genomic sequence) SEQ ID No: 147;

[0142] · Another example is the uncultured bacterium clone HOAb112C long-chain fatty acid CoA ligase gene ([uncultured bacterium] DBSOURCE accession number KF955286.1) SEQ ID No:148;

[0143] · The Bombyx mori BmGloverin1 mRNA of gloverin-like protein 1, complete accession number AB190863 SEQ ID No:149;

[0144] · The Bombyx mori BmGloverin2 mRNA of gloverin-like protein 2, complete accession number AB190864 SEQ ID No:150;

[0145] · The Bombyx mori BmGloverin3 mRNA of gloverin-like protein 3, accession number AB190865 SEQ ID No:151; and

[0146] · The Bombyx mori BmGloverin3 mRNA of gloverin-like protein 4, accession number AB190866 SEQ ID No:152.

[0147] According to one embodiment, a method for generating a mutant phage is provided, the method comprising inactivating at least one attachment gene in a selected phage, the selected phage being isolatable from phages in the environment. The method further comprises inserting one or more heterologous nucleic acid sequences into the selected phage, including one or more attachment genes. The one or more inserted attachment genes are different from the inactivated native attachment gene and are selected for their specificity for a selected bacterium to generate a mutant phage. In some embodiments, the provision of the selected attachment gene expands the range of possible host cells (i.e., bacteria) beyond the natural pairing relationship.

[0148] According to one embodiment, a method for generating a mutant phage is provided, the method comprising inactivating at least one attachment gene in a selected phage, the selected phage being isolatable from phages in the environment. The method further comprises inserting a first heterologous nucleic acid sequence into the selected phage, the first heterologous nucleic acid sequence comprising a first open reading frame encoding a first specific attachment gene. The first specific attachment gene is different from the inactivated attachment gene and is selected for its specificity for the selected bacterium to generate a mutant phage.

[0149] In another embodiment, the method further includes inserting a second heterologous nucleic acid sequence into a second open reading frame, encoding a gene that can be used to overcome bacterial defenses. In some aspects, the gene used to overcome bacterial defenses can be a biofilm-degrading gene, a glycocalyx-degrading gene, a gene encoding an antibacterial protein, and a gene for an enzyme that disrupts the bacterial cell wall, thereby generating a mutant phage. In one aspect, the first open reading frame also encodes a second specific attachment gene that is different from the first specific attachment gene.

[0150] In some embodiments, the method inactivates all attachment genes from a selected phage. In some aspects, the step of inactivating includes generating an inactivating mutation in at least one native attachment gene. In some aspects, the inactivating mutation is a point mutation.

[0151] According to an embodiment, there is provided an antimicrobial composition for disinfecting or decontaminating a surface. In some aspects, the antimicrobial composition comprises the disclosed mutant phage.

[0152] According to an embodiment, there is provided a method for decontaminating a surface suspected of containing bacteria. In some aspects, the bacteria are infectious or non-infectious bacteria. The method includes applying the disclosed antimicrobial composition comprising the disclosed mutant phage to the surface. In various aspects, an amount thereof is effective to decontaminate at least substantially or all of the surface contaminated with bacteria.

[0153] In some aspects, the surface is a biological surface (animal or plant).

[0154] According to an embodiment, there is provided a method for producing a specific mutant phage gene product. In various aspects, there is provided a method for eliminating or substantially eliminating microbial contaminants (infectious or non-infectious bacteria), the method comprising: obtaining one or more lytic enzymes produced by the disclosed mutant phage and applying the one or more lytic enzymes to the bacterial contaminants. In certain aspects, the elimination is accomplished without prior phage infection of the microbial contaminants, thus resulting in the outcome of lysis from without.

[0155] All publications and patents mentioned in this specification are incorporated herein by reference to the extent as if each individual publication or patent was specifically and individually indicated to be incorporated by reference.

[0156] For purposes of illustration and description of the present invention, the foregoing description of the present invention and certain representative embodiments and details have been given. It is not intended to be exhaustive of the present invention or to limit the present invention to the precise forms disclosed. Modifications and variations will be apparent to those skilled in the art without departing from the scope of the present invention.

[0157] Examples

[0158] Example 1 - Isolation of Phages

[0159] Samples were collected from sewers and waste, environmental soil, and animal feces and purified for phage isolation. The purified samples were then screened to determine the presence of phages against specific bacteria. The procedures and methods for isolating phages from water samples were adapted from Bonilla et al. (2016) and Bourdin et al. (2014); the methods for solid and soil samples were adapted from Sillankorva (2018), Pausz et al. (2009), and Van Twest & Kropinski (2009).

[0160] Solid samples were rehydrated with sterile water for at least 1 hour to allow phages to disperse. The samples were then centrifuged to remove solid matter and large particles, and the supernatant was collected. The centrifuged environmental samples and water samples were then further processed and purified using a filter (0.2 μM) to remove bacteria and smaller unwanted particles. The filtered samples could be further concentrated using filter tubes or stored at 4 °C for future use.

[0161] The filtered samples were then tested against bacterial strains of interest using the agar overlay plaque assay technique (Kropinski et al., 2009). The filtered environmental samples and the selected bacterial strains were inoculated into a liquid agar overlay and mixed. It was then poured onto an agar culture plate (depending on the bacterial species) and allowed to harden. The plate was then incubated overnight (conditions depending on the bacterial species), and plaques against the selected species were observed the next day. Plaques containing phages were then picked and further processed by 3 rounds of subsequent plaque assay overlays to purify the selected phages.

[0162] Using the above methods, a large number (hundreds) of EV samples were collected and tested for their suitability for template development. The functional and structural genes of each EV sample were characterized and subjected to integration testing (described in detail below). Candidate phages with low-copy-number lytic genes were identified, as well as structural and functional genes that allow lysis of Gram-negative and Gram-positive bacteria. The selected phage named PP8 was sequenced, and its gene structure and function were studied as described below. PP8 was selected because it has the required genes. Although it also has lysogenic genes, these genes were replaced with ORFs.

[0163] Example 2 - Platform Development

[0164] Using the environmental sample EV31 / PP8, after phage isolation, we purified the genomic material with the PureLink Viral DNA / RNA Purification Kit. The full-length genome was amplified (see sequences EV31 for EV31 / full / F / PYESIL and EV31 / full / R / PYESIL), which had 30 bp homology with the pYESIL Sapphire vector. PCR amplification was performed using Phusion High-Fidelity DNA Polymerase (modified with touchdown technology for primer annealing, starting at 69 °C and decreasing by 0.5 °C per cycle). The PCR products were separated on an agarose gel, and the bands were excised, extracted, and assembled. The resulting construct EV31pYES (unmodified) allowed for genetic modification of EV31 and determination of the mutant function of the phage rescue-based system.

[0165] Example 3 - Full-Length Genome Assembly

[0166] Briefly, the following provides a method for genetic manipulation of yeast (Kluyveromyces lactis and Pichia pastoris) cells to include T7 DNA (deoxyribonucleic acid)-dependent RNA (ribonucleic acid) polymerase transcription from Escherichia coli phage T7, and then express the phage in yeast. Also provided is a method for genetic manipulation of yeast (Kluyveromyces lactis and Pichia pastoris) cells to include transcriptional components from bacteria (Escherichia coli) and RNA (ribonucleic acid) polymerase (P) within the yeast, and then express the phage in yeast.

[0167] See Figure 3 , the genomic complement was divided into fragments that overlapped with adjacent fragments obtained by PCR amplification. The foreign gene was inserted into the respective fragments. The fragments were combined into a full-length genome by homologous recombination methods, and a yeast-based plasmid (as an additional PCR fragment) was ligated to the T7 promoter within the yeast strain Pichia pastoris. The stable plasmid under the control of the T7 promoter drives phage resurrection after induction of Pichia pastoris containing T7 RNA polymerase, and then the cells were lysed using enzymatic and mechanical means to release fully formed phage particles.

[0168] Homologous recombination of EV31pYes (unmodified) with the pYESIL vector was achieved by using 100 ng of each PCR product and transforming it into chemically competent yeast cells. Combine the pYESIL vector (100 ng) and EV31 (100 ng). Add the competent yeast cells and mix gently, then add 600 μl of polyethylene glycol (PEG) and lithium acetate (LiAc) solution, and mix gently. Incubate the mixture at 30 °C for 30 minutes, inverting at 10-minute intervals. Immediately after incubation, add 35.5 μl of dimethyl sulfoxide (DMSO), mix by inverting, and heat shock at 42 °C for 20 minutes (occasionally inverting). Then centrifuge the tubes at 200 - 400 xg for 5 minutes, discard the supernatant, and resuspend the cell pellet in 1 ml of sterile 0.9% sodium chloride (NaCl). Visualization of the transformation can be achieved by spreading 100 μl onto a selective agar plate (medium without tryptophan) and incubating at 30 °C for 3 days. Colony PCR screening can determine the presence of positive transformants. Homologous recombination was achieved by standard cloning techniques to render the Saccharomyces cerevisiae strain 5150 chemically competent. Briefly, using the Gietz and Schiestl 2007 protocol, a spread plate of single yeast colonies was generated from the stock and incubated overnight at 30 °C. The next day, 50 μl equivalents of cells were scraped and washed in a tube with 1 ml of sterile nuclease-free water, then spun at 13,000 xg for 0.5 minutes. The following were added to the cell pellet in order: 240 μl of PEG-3350 (50% w / v), 36 μl of LiAc (1 M), 50 μl of single-stranded carrier DNA (2 mg / ml porcine sperm), and 34 μl of plasmid-nuclease-free water mixture (<1 μg plasmid). It was gently vortexed and incubated at 42 °C for 20 - 180 minutes (time depends on the strain). For EV31, 45 minutes was used. After transformation, it was spun at 13,000 xg for 0.5 minutes, then the supernatant was removed, and the pellet was resuspended in 1 ml of sterile nuclease-free water. The mixture was spread onto a selective medium plate, yeast synthetic dropout medium without uracil, and incubated at 30 °C for 3 - 4 days. Colony-PCR screening was used for verification of the clones.

[0169] Figure 4 Titration of PP8 after resurrection from the genetic template is shown.

[0170] Figure 5 A graphical representation depicting the gene locations of EV31 / PP8 is shown, and Figure 6The detailed nucleotide sequence of the entire genome is provided, showing the sense strand (SEQ ID NO:1), the antisense strand of the complementary sequence (SEQ ID NO:2), and the sequences of the proteins encoded therein (SEQ ID NO:3-124) as well as restriction endonuclease sites. Figure 7 A specific description of the EV31 / PP8 molecule and protein with annotations is shown.

[0171] Example 4 - Clone Verification by Colony PCR

[0172] Screening of positive transformants (colonies growing on plates) was carried out as follows. Single yeast colonies were inoculated into 15 μl of lysis buffer. In separate tubes, 5 μl of each mixture was transferred and stored at 4°C until ready for large-scale growth of positive colonies. The remaining 10 μl of cell suspension was boiled at 95°C for 5 minutes and then immediately placed on ice, 40 μl of nuclease-free water was added and mixed. 0.5 μl of the lysate was added to each PCR reaction with a total volume of 50 μl and visualized by agarose gel electrophoresis. The result gel of PP8 DNA digestion is as Figure 8 shown.

[0173] Example 5 - Development of Unique ORF

[0174] Using the PP8 template, mutant phages were generated. Point mutations were introduced using homologous recombination to remove the native attachment protein.

[0175] Gene disruption 14452 - 13316 (tail protein):

[0176] >PP8-F1F

[0177] ACAAATAGTGAAGAGATAAACCAGGTTGAGCAAG SEQ ID No:185

[0178] >PP8-tail-mut-R

[0179] TTGACGTTGAATCTGGAGTCGATAGGTGCGACAGGTTACCAATGG SEQ ID No:186

[0180] >PP8-tail-mut-F

[0181] GTCGCACCTATCGACTCCAGATTCAACGTCAAGGTCTCACC SEQ ID No:187

[0182] >PP8-F1R

[0183] TTCCAAGACGGATTCGAACCGTCACTAGTACAAGG SEQ ID No:188

[0184] Gene disruption 14823 - 14446 (tail protein):

[0185] >PP8-F1F

[0186] ACAAATAGTGAAGAGATAAACCAGGTTGAGCAAG SEQ ID No:185

[0187] >PP8-hyp1-mut-R

[0188] TTAATGATGTTATCTCGATAACGTCGACATGGAGACTCAGTAAATGG SEQ ID No:189

[0189] >PP8-hyp1-mut-F

[0190] TCTCCATGTCGACGTTATCGAGATAACATCATTAAGGTTGTACC SEQ ID No:190

[0191] >PP8-F1R

[0192] TTCCAAGACGGATTCGAACCGTCACTAGTACAAGG SEQ ID No:188

[0193] Gene disruption 16522 - 17937 (tail protein):

[0194] >PP8-F1F

[0195] ACAAATAGTGAAGAGATAAACCAGGTTGAGCAAG SEQ ID No:185

[0196] >PP8-hyp2-mut-R

[0197] TTGAATAAACCGTTATCGCCTTCTTAAAGCAACCTGTATTGCGTTCTGC SEQ ID No:191

[0198] >PP8-hyp2-mut-F

[0199] TGCTTTAAGAAGGCGATAACGGTTTATTCAACAAACCCTCATTTCATTG SEQ ID No:192

[0200] >PP8-F1R

[0201] TTCCAAGACGGATTCGAACCGTCACTAGTACAAGG SEQ ID No:188

[0202] Gene disruption 34777 - 37020 (tail protein):

[0203] >PP8-F3F

[0204] TTCTTAAGGAGGGTTATGAATGTGTTATACAGG SEQ ID NO:158

[0205] >PP8-tape-mut-R

[0206] TCTGTGTAGTTCGGCCAACTGTAGTGTGCGAATGATGCAGCGAACATTC SEQ ID No:193

[0207] >PP8-tape-mut-F

[0208] TTCGCACACTACAGTTGGCCGAACTACACAGATACCATGAAGCAGTACTC SEQ ID No:194

[0209] >PP8-F3R

[0210] GTGGTAAGGTAAGGTATGGAAGGATGGCAGTAG SEQ ID NO:167

[0211] The mutant phages may include four ORFs: ORF 1 is located at position 46090; ORF 2 is located at position 73195; ORF 3 is located at position 19991; ORF 4 is located at position 60431.

[0212] Three EV31 mutant constructs, EV31(ORF1), EV31(ORF2), and EV31(ORF1 / 2), were generated using the modified primers EV31 / 0RF1 / F and EV31 / ORF1 / R for ORF1 (between nucleotides 46,090 and 46,091) and EV31 / ORF2 / F and ORF2 / R for ORF 2 (between nucleotides 73,195 and 73,196), and cell-free cloning. In the construct of ORF2, the native binding domain was first removed from EV31, and a multi-restriction enzyme cassette was added. This cassette was then used to add a new bacterial binding domain.

[0213] Perform homologous recombination and insertion simultaneously using restriction digestion. For restriction digestion, the enzyme TspRI allows insertion into the multiple cloning site (MCS). In one example, the ORF is located at position 19991 in the 3ev31 / pp8 sequence. In this example, the insertion of the MCS is accomplished by using TspRI. Once the MCS is inserted, the insertion of the selected attachment gene can be achieved by using the restriction enzyme sites within the MCS. Example of an MCS for ORF3: GCCGGCAGTGGATCCCCGGGGAAGATATTC SEQ ID NO:153. This MCS carries the enzyme sites for NaeI, TspRI, XmnI, SmaI. The primers for adding the MCS at position 19991 are: EV31 ORF3 primer f GCTACACTGCTGAGA SEQ ID NO:154; EV31 ORF3 primer r TCTCAGCAGTGTAGC SEQ ID NO:155.

[0214] The fourth ORF is located at position 60431 in ev31 / pp. In this example, the insertion of the MCS will be accomplished by using TspRI. Once the MCS is inserted, the insertion of the selected attachment gene can be achieved by using the restriction enzyme sites within the MCS. The primers for adding the MCS to position 60431 are: EV31 ORF4 primer f CATCAGATGCTGG SEQ ID NO:156; EV31 ORF4 primer r CCAGCATCTGATG SEQ ID NO:157.

[0215] Example 6 - Integration

[0216] Analysis of the EV31 / PP8 genome revealed that the possible lysogenic genes are located at 60351 - 62336. Mutate the gene by generating an ORF at the 60431 (ORF4) site. Once the lysogenic gene is inactivated, we perform integration studies to ensure that integration does not occur. The results are shown in Figure 9a and Figure 9b .

[0217] Under conditions that promote integration, it was confirmed that PP8 lacks the ability to integrate. Gel electrophoresis photographs identified integration events demonstrated by the phage (phage induction control), which were determined by polymerase chain reaction (PCR) of whole bacterial cells. If the phage genetic material is integrated into a purified (phage particle - free) bacterial colony, the corresponding primer set for each phage will give a positive PCR signal (right panel; lane 5). In contrast, PP8 was unable to integrate into the bacterial host cells, as shown by the absence of a positive signal for the PP8 sequence in the photograph (left panel; lanes 5 - 7).

[0218] Create conditions for integration

[0219] Prepare a fresh overnight culture of the bacterial host (E. coli C) from a glycerol stock in Luria - Bertani (LB) liquid medium. Once saturated, dilute the culture (1:100) in fresh LB medium supplemented with 2 mM CaCl2 and incubate until the OD 600 is 0.6. Spread a mixture of the host (100 μL E. coli C) and the phage (100 μL, multiplicity of infection of 5) in 3 mL of melted soft agar onto a pre - dried LB agar plate. After overnight incubation, pick three colonies from each plate, re - streak onto fresh LB - agar plates, and incubate overnight for three rounds. Inoculate the purified colonies (free of contaminating phage particles) into LB - 2 mM CaCl2 medium and incubate overnight.

[0220] Analyze potential integration events

[0221] Set up, according to the manufacturer's recommendations, a polymerase chain reaction (PCR) master mix of DNA polymerase (Promega) and primers for each phage to be evaluated. Add 5 μL from each overnight culture into their respective PCR reactions. The cycling conditions were altered to include boiling of whole - cell for the initial denaturation phase (95 °C, 10 min) and an annealing temperature of 59 °C. Run 5 μL of the completed PCR reaction on a 1% agarose gel, stain, and visualize under ultraviolet (UV) light. The results are shown in Figure 9a and 9b .

[0222] Example 7 - Insertion of ORF1 into the SP5 attachment protein (between 46,090 and 46,091)

[0223] Using PP8, we developed an MRSA - specific PP8 - binding phage by using the PP8 template. We removed the native attachment gene and added the attachment protein SP5 at the ORF 1 position (between 46,090 and 46,091) using homologous recombination. The primer sets used for this homologous recombination were:

[0224] 1. Primer set for the PP8 fragment (in bold) and primer set for 5′ homologous recombination with the SP5 gene (underlined)

[0225] >PP8 - F3F

[0226]

[0227] >PP8 - SP5 - R

[0228]

[0229] 2. Amplification of SP5 (underlined):

[0230] >SP5-F

[0231] ATGTACAAAATAAAAGATGTTGAAACGAG SEQ ID NO:161

[0232] >SP5-R

[0233] CACCCCTTAATTAAATAAAGTGTATTAGGGTC SEQ ID NO:162

[0234] 3. Primer set for homologous recombination of the PP8 fragment (in bold) and the SP5 gene (underlined) at the 3′ end

[0235] >PP8-SP5-F

[0236]

[0237] >PP8-F3R

[0238]

[0239] The inserted sequence (MRSA attachment protein SR5) is shown in SEQ ID NO:168.

[0240] Example 8 - Efficacy of the phage against MRSA

[0241] We tested the novel PP8(SP5) phage of the present invention against samples 1 to 6 from MRSA-infected patients. These samples 1 to 6 were samples from clinically isolated MRSA-positive patients. The overview of the method is as Figure 10 shown, and the results are as Figure 11 and 12 shown. Patient samples 1, 2, 4, 5, and 6 were lysed using PP8(SR5). Only a partial binding curve was shown for patient sample 3, indicating that the binding specificity might not be sufficient to provide a 100% lysis rate. The positive control was the PP8 phage with SA attachment sites.

[0242] After sequence analysis of patient sample 3, a new binding site was discovered by sequence analysis and blast search for the attachment site.

[0243] Example 9 - Insertion of ORF1 into the SP6 attachment protein (between 46,090 and 46,091)

[0244] We also generated the PP8 SR6 mutant and tested it against Staphylococcus aureus. The results are as Figure 13 shown.

[0245] Then, we generated a new PP8 strain to attach to and lyse patient sample 3. The PP8(SR5,SR6) mutant was generated using homologous recombination by adding the attachment protein SP6 to ORF 1 of the original PP8 template to generate PP8(SR5,SR6). The primer sets used for this homologous recombination were:

[0246] 1. Primer set for homologous recombination of the PP8 fragment (in bold) and the SP6 gene (underlined) at the 5′ end

[0247] >PP8-F3F

[0248]

[0249] >PP8-SP6-R

[0250]

[0251] 2. Amplification of SP6 (underlined)

[0252] >SP6-F

[0253] ATGTACAAAATAAAAGATGTTGAAACGAG SEQ ID NO:164

[0254] >SP6-R

[0255] TCACCCCTTAATTAAGTAAAGTGTATTAGGGTC SEQ ID NO:165

[0256] 3. Primer set for homologous recombination of the PP8 fragment (in blue) and the SP6 gene (underlined) at the 3′ end

[0257] >PP8-SP6-F

[0258]

[0259] >PP8-F3R

[0260]

[0261] The inserted sequence (MRSA attachment protein SP6) is shown in SEQ ID NO:169.

[0262] The newly generated phage strain was designated PP8(SP5,SP6). We used this new phage in combination with PP8(SP5) to determine whether these two newly modified phages could be used to lyse patient samples 1 to 6. As Figure 14 and 15 shown, the new mutant phages lysed all six patient samples, demonstrating that the addition of the new attachment gene to the PP8 template of the present invention could specifically target bacteria.

[0263] Example 10 - Insertion of the ORF2 endolysin gene (inserted at position 73195 of PP8)

[0264] 1. The PP8 fragment (in bold) and the primer sets for 5′ homologous recombination with the foreign gene (underlined)

[0265] >PP8-F5F

[0266]

[0267] >PP8-endolysin-R

[0268]

[0269] >endolysin-F

[0270] ATGCGATTCAGTGACAACGGTCTAAGATTTACGGCAGC SEQ ID NO:172

[0271] >endolysin-R

[0272] TTATGCTGCGTTACGCCCGATTTTCTCGGCAACGTCC SEQ ID NO:173

[0273] >PP8-endolysin-F

[0274]

[0275] The insertion of the endolysin gene was carried out using common molecular biology techniques. The inserted sequence is shown in SEQ ID NO:176.

[0276] Example 11 - Insertion of the adhesin protein in ORF1 and ORF2

[0277] Homologous recombination in ORF1

[0278] 1. The PP8 fragment (in bold) and the primer sets for 5′ homologous recombination with the foreign gene (underlined).

[0279] >PP8-F3F

[0280]

[0281] >PP8-adhesin_protein-R

[0282]

[0283] 2. Amplification of the foreign gene (underlined)

[0284] >adhesin_protein-F

[0285] ATGTCGCGACTGGCGCAGGATATGAAAAAACTGG SEQ ID NO:178

[0286] >Attachment_protein-R

[0287] TCAATCAGTATACCCGTATACCTGCTC SEQ ID NO:179

[0288] 3. PP8 fragment (in bold) and primer sets for homologous recombination with foreign gene (underlined) at 3′

[0289] >PP8-Attachment_protein-F

[0290]

[0291] >PP8-F3R

[0292] GTGGTAAGGTAAGGTATGGAAGGATGGCAGTAG SEQ ID NO:167

[0293] Homologous recombination in ORF2

[0294] 1. PP8 fragment (in bold) and primer sets for homologous recombination with foreign gene (underlined) at 5′

[0295] >PP8-F5F

[0296] AAGACTCGGAAGAAGGTAGTCACTAAGGAAAGTG SEQ ID NO:170

[0297] >PP8-Attachment_protein-R

[0298]

[0299] 2. Amplification of foreign gene (underlined):

[0300] >Attachment_protein-F

[0301] ATGTCGCGACTGGCGCAGGATATGAAAAAACTGG SEQ ID NO:182

[0302] >Attachment_protein-R

[0303] TCAATCAGTATACCCGTATACCTGCTC SEQ ID NO:183

[0304] 3. PP8 fragment (in bold) and primer sets for homologous recombination with foreign gene (underlined) at 3′

[0305] >PP8-Attachment_protein-F

[0306]

[0307] >PP8-F5R

[0308]

[0309] Example 12 - Development of Phages against Escherichia coli, Salmonella enterica, and Clostridium perfringens

[0310] Sequence analysis was performed on all pathogenic Escherichia coli, Salmonella enterica, and Clostridium perfringens species currently causing mortality in Canadian poultry farms, so that a universal binding domain could be evaluated and generated for use in genetic design of phages that can disrupt these pathogenic bacteria. The process to achieve this goal is as follows:

[0311] 1) Sequence analysis:

[0312] Fecal and other excrement samples were collected from poultry farms in Manitoba for identification of Escherichia coli and Salmonella enterica. Clostridium perfringens samples were provided by industry partners. All these samples were used to isolate pathogenic bacteria and phages (for construction of our phage library) present in Canadian poultry flocks. Once pure cultures of pathogenic bacteria were obtained, the bacteria were sequenced using Illumine Miseq 2000. After analysis of these sequences, the universal attachment regions of each bacterium were obtained. Using Clone Manager genetic software, the conserved attachment regions on the surfaces of various bacterial species were determined, and reverse engineering was performed for the generation of genetic clones that could attach to the conserved bacterial binding domains, as described below.

[0313] 2) Insert the conserved attachment region into a template and propagate in a yeast strain (CP109):

[0314] This ubiquitous attachment construct was subcloned into the disclosed phage template. Infectious phages were generated by transformation and propagation in the yeast strain CP 109, which has the ability to maintain multiple copies of the phage template. This was achieved by two methods:

[0315] a) In vivo transformation and ultimately induction of the phage template in yeast cells, or

[0316] b) In vitro culture using cell extracts of yeast cells.

[0317] Regardless of the method used, the advantage of using these methods for propagation is that it avoids classical phage propagation, in which preparations are contaminated with potentially dangerous levels of bacterial endotoxins. These phage production methods eliminate this hurdle because yeast cells are used to culture the phages.

[0318] 3) Determine the ability of the phages to target and infect multiple Escherichia coli, Salmonella enterica, and Clostridium perfringens pathogenic bacterial species

[0319] The phages were growth characterized to ensure proper insertion of the ubiquitin adhesin. Escherichia coli, Salmonella enterica, and Clostridium perfringens were infected, and phage growth was analyzed as described below. Lysis tests were performed to ensure no integration occurred. Cytotoxicity tests were performed to verify the non-toxic extraction method in yeast. The binding ability of the phages has been analyzed, and phage therapy in broiler chickens is ready to be evaluated.

[0320] Example 13 - Generation of mutant PP8 phages targeting Escherichia coli, Salmonella enterica, and Clostridium perfringens

[0321] The method for generating mutant phages including specific binding domains and specific endolysins for Escherichia coli, Salmonella enterica, and Clostridium perfringens using the PP8 phage template is as Figure 16 and 17 shown.

[0322] Specific tail fiber genes and specific endolysin genes belonging to Escherichia coli, Salmonella enterica, and Clostridium perfringens were prepared for insertion into the PP8 phage template. The results of the agarose gel are shown in Figure 18 where:

[0323] Lane 1: Genetic ladder

[0324] Lane 2: Tail fiber for binding Escherichia coli (3398KB)

[0325] Lane 3: Tail fiber of Clostridium (1200KB)

[0326] Lane 4: Tail fiber of Salmonella (497KB)

[0327] Lane 5: Endolysin gene (476KB)

[0328] Lane 6: Endonuclease gene (680KB)

[0329] Lane 7: Endolysin gene (590KB)

[0330] Lane 8: Genetic ladder

[0331] The bands of interest were gel-extracted and cloned into the PP8 phage template to generate three different mutant phages that can bind and lyse Escherichia coli species, Salmonella species, and Clostridium species.

[0332] The engineered mutants generated by inserting genes into the PP8 phage template are as follows.

[0333] Mutant phage name: PP8 - Escherichia coli λ ORF - SEQ ID No. 195

[0334] Source: Enterobacteriophage λ; 48.5 kb linear DNA genome; Genbank#: J02459.1

[0335] Obtained gene:

[0336] ORF 1: R (cell lysis; 158) is located at positions 76594 - 77070 of the PP8 genome (also known as the λR gene)

[0337] ORF 2: J (tail: host specificity; 1132) is located at positions 46090 - 49488 of the PP8 genome (also known as λgpJ)

[0338] Mutant phage name: PP8 - Salmonella typhimurium P22 ORF - SEQ ID No. 196

[0339] Source: Salmonella phage P22; 44.7 kb linear DNA genome; Genbank#: KR296686.1

[0340] Obtained gene:

[0341] ORF 1: SP22_63 (amidase) is located at positions 73693 - 74283 of the PP8 genome (also known as P22 lysin)

[0342] ORF 2: SP22_57 (tail fiber) is located at positions 46090 - 46587 of the PP8 genome (also known as P22 tail tip).

[0343] Mutant phage name: PP8 - Clostridium perfringens CPS2 ORF - SEQ ID No. 197

[0344] Source: Clostridium phage CPS2; 18 kb linear DNA genome; Genbank#: MH248069.1

[0345] Obtained gene:

[0346] ORF 1: CPS2_16 (amidase) is located at positions 74395 - 75075 of the PP8 genome (also known as CPS2 amidase)

[0347] ORF 2: CPS2_9 (tail protein) is located at positions 46090 - 47289 of the PP8 genome (also known as CPS2 tail fiber)

[0348] Name of the mutant phage: Insertion of the PP8 gene - SEQ ID No. 198

[0349] To demonstrate that any tail fiber can be inserted and the replication of the virus can be visually verified rapidly (instead of waiting for plaque formation), we generated such a PP8 phage: two different genes (T7 phage tail fiber and green fluorescent protein (GFP) reporter gene) were inserted into each open reading frame (ORF).

[0350] Source: Expression vector GFPuv - reporter; 3.1 kb circular DNA plasmid; Genbank#: KX980038.1

[0351] Gene obtained:

[0352] ORF 1: Green fluorescent protein (GFP) is located at positions 74857 - 75573 of the PP8 genome (also known as the inserted GFP)

[0353] Source: Enterobacteriophage T7; 39.9 kb linear DNA genome; Genbank#: AY264774.1

[0354] Gene obtained:

[0355] ORF 2: Gene 17 located at positions 46090 - 47751 in the PP8 genome (also known as the inserted tail fiber)

[0356] To confirm the insertion, the mutant PP8 phage was digested, and the results of the agarose gel are shown in Figure 19 , where:

[0357] The first lane: Resurrected GFP PP8 construct

[0358] The second lane: Resurrected PP8 with inserted Escherichia coli tail fiber

[0359] The third lane: Blank

[0360] The fourth lane: Resurrected PP8 with inserted Clostridium tail fiber

[0361] The fifth lane: Resurrected PP8 with inserted Salmonella tail fiber

[0362] Figure 20 The titer of the PP2 / PP8 genetic template with inserted Escherichia coli tail fiber on an Escherichia coli lawn is shown. It can be seen from Figure 20 that using the PP8 genetic template to add a specific 078 Escherichia coli tail fiber binding domain generates phages that can bind and eliminate 078 Escherichia coli.

[0363] Figure 21Shows the titer of the PP8 gene template inserted with the tail fiber of Salmonella typhi strain A3. The revived phage was spotted on the lawn of Salmonella typhimurium. From Figure 21 it can be seen that the addition of a specific Salmonella typhimurium tail fiber binding domain using the PP8 genetic template produces phages that can bind to and clear Salmonella typhimurium.

[0364] Figure 22 Shows the titer of the PP8 genetic template inserted with the tail fiber of Clostridium perfringens CPS2.

[0365] The revived phage was spotted on the lawn of Clostridium perfringens CPS2. As Figure 22 shown, the addition of a specific Clostridium perfringens CPS2 tail fiber binding domain using the PP8 genetic template produces phages that can bind to and clear Clostridium perfringens CPS2.

[0366] References

[0367] Bonilla,N.,Rojas M.I.,Netto Flores Cruz,G.,Hung,S.H.,Rohwer,F.,Barr,J.J.2016.Phage on tap-a quick and efficient protocol for the preparation ofbacteriophage laboratory stocks.PeerJ.,4,e2261.

[0368] Bourdin,G.,Schmitt,B.,Marvin Guy,L.,Germond,J.E.,Zuber,S.,Michot,L.,Reuteler,G.,Brüssow,H.2014.Amplification and purification of T4-likeescherichia coli phages for phage therapy:from laboratory to pilot scale.ApplEnviron Microbiol.80,1469-1476.

[0369] Kropinski, A.M., Mazzocco, A., Waddell, T.E., Lingohr, E., Johnson, R.P. 2009. Enumeration of bacteriophages by double agar overlay plaque assay. Methods Mol Biol. 501, 69 - 76.

[0370] Pausz, C., Clasen, J.L., Suttle, C.A. 2009. Isolation independent methods of characterizing phage communities 1: strain typing using fingerprinting methods. Methods Mol Biol. 502, 255 - 278.

[0371] Sillankorva, S. 2018. Isolation of Bacteriophages for Clinically Relevant Bacteria. Methods Mol Biol. 1693, 23 - 30.

[0372] Van Twest, R., Kropinski, A.M. 2009. Bacteriophage enrichment from water and soil. Methods Mol Biol. 501, 15 - 21.

[0373] Gasset, M. (2010). Bacteriophage Holins and their Membrane Disrupting Ability, 123–148. https: / / doi.org / 10.1002 / 9780470570548.ch6

[0374] Fischetti, V.A. (2008). Bacteriophage lysins as effective antibacterials. Current Opinion in Microbiology, 11(5), 393–400. https: / / doi.org / 10.1016 / j.mib.2008.09.012

[0375] Borysowski, J., Weber-Dabrowska, B., & Gorski, A. (2006). Bacteriophage Endolysins as a Novel Class of Antibacterial Agents. Experimental Biology and Medicine, 366 - 377. http: / / journals.sagepub.com / doi / 10.1177 / 153537020623100402

Claims

1. A method for engineering a phage, the method comprising: - isolating a phage; - removing all attachment genes from the genome of the phage; - inserting a first unique open reading frame encoding one or more attachment genes and inserting a second unique open reading frame encoding one or more genes for overcoming bacterial defenses; - inserting a non-native attachment gene into the first unique open reading frame, wherein the non-native attachment gene specifically attaches to a selected bacterium; - obtaining an engineered mutant phage; wherein the phage binds to Escherichia coli Lambda (E. coli Lambda), and the attachment gene is the λgpJ gene, the gene for overcoming bacterial defenses is the λR (Lambda R) gene; the nucleotide sequence of the engineered mutant phage is as shown in SEQ ID NO:

195.

2. The method according to claim 1, wherein The removal and the insertion utilize cell-free cloning of the phage.

3. The method according to claim 1, further comprising: Screening for lysogenic genes and inactivating the lysogenic genes.

4. The method according to claim 1, wherein, The selected phage is a phage with a low copy number of lysogenic genes.

5. The method according to claim 1, further comprising: Inserting a second heterologous nucleic acid sequence, which includes a second unique open reading frame encoding a gene for overcoming bacterial defenses.

6. The method according to claim 5, wherein, The second unique open reading frame of the gene for overcoming bacterial defenses includes one or more of a biofilm degradation gene, a glycocalyx degradation gene, a gene encoding an antibacterial protein, or a gene of an enzyme that disrupts the bacterial wall to produce a mutant phage.

7. The method according to claim 6, wherein, The gene of the enzyme that disrupts the bacterial wall is endolysin.

8. The method according to claim 7, wherein, The endolysin includes SEQ ID No: 138; SEQ ID No: 139; SEQ ID No: 140; SEQ ID No: 141; SEQ ID No: 142; or SEQ ID No:

143.

9. The method according to claim 6, wherein, The gene of the enzyme that disrupts the bacterial wall includes SEQ ID No:

144.

10. The method according to claim 6, wherein, The biofilm degradation gene and the glycocalyx degradation gene include one or more of the following: Cathelicidin antimicrobial peptide LL-37; Histatin 3 (HTN3); Nisin; Dispersin B (β-N-acetylglucosaminidase); Endo-1,4-β-glucanase (callulase); Aureolysin; NucB; Serine protease (SspA); LapG protease; Melittin; Endo-1,4-β-mannosidase (manA); or α-amylase.

11. The method according to claim 6, wherein The gene of the enzyme that disrupts the bacterial wall is a gene targeting the linking chemical components in the bacterial cell wall.

12. The method according to claim 11, wherein, The gene targeting the linking chemical components in the bacterial cell wall is selected from SEQ ID No: 145, SEQ ID No: 146, SEQ ID No: 147, SEQ ID No: 149, SEQ ID No: 150, SEQ ID No: 151, SEQ ID No 152.

13. The method according to claim 1, wherein The non-natural attachment genes are attachment gene SP5 and attachment gene SP6.

14. The method according to claim 1, wherein The non-natural attachment genes are selected from SEQ ID No: 125, SEQ ID No: 126, SEQ ID No: 127, SEQ ID No: 128, SEQ ID No: 129, SEQ ID No: 130, SEQ ID No: 131, SEQ ID No: 132, SEQ ID No: 133, SEQ ID No: 134, SEQ ID No: 135, SEQ ID No: 136, or SEQ ID No: 137.

Images