Bacterial delivery vehicle containing a tracer nucleic acid sequence

Abstract

The present disclosure generally relates to genetically labeled bacterial delivery vehicles, which contain unique tracer nucleic acid sequences (referred to herein as "tracers") for detecting and / or quantifying the presence of two or more different bacterial delivery vehicles in a mixture of vehicles. The present disclosure relates to methods in which the bacterial delivery vehicles are detected by, for example, using primers that bind to sequences in the unique tracers for multiple amplification cycles. Such methods can be advantageously used for quality control to detect and quantify mixtures of bacterial delivery vehicles in pharmaceutical compositions.

Description

Technical Field

[0001] The present disclosure generally relates to genetically labeled bacterial delivery vehicles, which contain unique tracer nucleic acid sequences (referred to herein as "tracers") for detecting and / or quantifying the presence of two or more different bacterial delivery vehicles in a mixture of vehicles. The present disclosure relates to methods in which bacterial delivery vehicles are detected by, for example, performing multiple amplification cycles using primers that bind to sequences in the unique tracers. Such methods can be advantageously used for quality control to detect and quantify mixtures of bacterial delivery vehicles in pharmaceutical compositions.

[0002] background

[0003] Bacterial delivery vehicles, such as packaged phagemids, are bacteriophage-derived particles consisting of a DNA nucleic acid payload of interest packaged in a bacteriophage-derived capsid. The capsid is the primary host range determinant, and bacterial delivery vehicles are subject to host range restrictions similar to those of bacteriophages, so that different bacterial delivery vehicles with complementary host ranges can be combined in a multivalent final drug product (a drug product with multiple target cell specificities) to achieve clinical efficacy. Therefore, methods using bacteriophage-based bacterial delivery vehicles as antimicrobial agents may rely on cocktail formulations, in which a variety of phages with different host ranges are combined and administered to subjects as a mixture to maximize clinical efficacy by targeting the maximum number of clinically relevant bacterial strains. In this case, different bacterial delivery vehicles of the final composition mixture have different capsids with different host ranges and / or binding specificities, while containing the same DNA or different DNA (see Figure 1 ).

[0004] From a regulatory perspective, it is necessary to characterize the composition of a drug product before it is administered to a subject. Of note, for drug products composed of a mixture of different drug products, the presence and amount of each drug product in the final product must be confirmed. For example, the presence and amount of each bacterial delivery vehicle within a pharmaceutical composition used to treat a subject must be evaluated in the final product and meet the specifications set for the drug. Therefore, for regulatory purposes, methods are needed to detect the presence and amount of different bacterial delivery vehicles within a pharmaceutical composition.

[0005] Overview

[0006] The present disclosure generally relates to methods for genetically marking bacterial delivery vehicles for use in detecting the presence of two or more different (e.g., structurally dissimilar) bacterial delivery vehicles (referred to herein as "multivalent mixtures of bacterial delivery vehicles") within a sample. Each of the different bacterial delivery vehicles can be dissimilar, for example, by their different bacterial cell binding abilities and / or their different host ranges and / or by containing different nucleic acid payloads within the vehicle. More specifically, the present disclosure relates to methods in which the bacterial delivery vehicle to be detected contains a desired nucleic acid payload that additionally contains a unique tracer that can be detected, for example, by performing amplification cycles. This method can be advantageously used for quality control of pharmaceutical compositions containing a mixture of multivalent bacterial delivery vehicles.

[0007] In one aspect, a bacterial delivery vehicle is provided, wherein the bacterial delivery vehicle is modified to bind to a target cell (such as a bacterial cell) and comprises a nucleic acid payload having a unique tracer embedded within the nucleic acid payload. In another aspect, a multivalent mixture of bacterial delivery vehicles is provided, comprising two or more different bacterial delivery vehicles, wherein each bacterial delivery vehicle comprises a nucleic acid payload having a unique tracer nucleic acid sequence.

[0008] In one embodiment, each of the different bacterial delivery vehicles in the multivalent mixture comprises the same nucleic acid payload except having a unique tracer associated with the same payload. In another embodiment, each of the different bacterial delivery vehicles in the multivalent mixture comprises a different nucleic acid payload having a unique tracer associated with each of the different payloads. The unique tracer is connected to the nucleic acid payload of the package so that the related bacterial delivery vehicle (referred to herein as "homologous bacterial delivery vehicle") of the DNA nucleic acid payload of the packaged marker can be identified and quantified.

[0009] In some embodiments, the tracer comprises a stretch of homology of no more than 20 nucleotides to the DNA of the bacterial production strain and / or the DNA of the target bacterial cell.

[0010] Preferably, the tracer comprises a barcode. In particular, the tracer may comprise a constant region and a barcode. In particular, the tracer may comprise a barcode flanked on each side by a constant region. The length of the barcode and / or the constant region may be between 25-50 nucleic acids.

[0011] The tracer may be embedded in a non-coding region or a coding region. In embodiments where the tracer is embedded in a coding region, the tracer may comprise altered codon usage but encode a protein with an unchanged amino acid sequence.

[0012] In some embodiments, the bacterial delivery vehicle included in the multivalent mixture is a bacteriophage-derived scaffold.

[0013] Provide a method for detecting and / or quantifying the bacterial delivery medium in a multivalent mixture of a bacterial delivery medium by detecting a unique tracer associated with the presence of a specific bacterial delivery medium. The method includes performing amplification cycles using primers that bind to the nucleic acid sequence in the tracer sequence to detect and optionally quantify the steps of each bacterial delivery medium in the multivalent mixture of the bacterial delivery medium. Alternatively or in addition, the method may include performing amplification cycles using primers that bind to the nucleic acid sequence in the tracer sequence to detect and optionally quantify the total bacterial delivery medium in the multivalent mixture of the bacterial delivery medium. This amplification method includes, for example, PCR, qPCR, ddPCR, LCR, FISH or NGS.

[0014] In addition, a method for detecting and tracking a bacterial delivery vehicle after a multivalent mixture of a bacterial delivery vehicle is given to a subject, wherein each bacterial delivery vehicle comprises a nucleic acid payload with a unique tracer. The method includes a step of detecting and quantifying each of different bacterial delivery vehicles in a sample derived from a subject by, for example, using a primer combined with a nucleic acid sequence in a tracer for amplification cycles. The amplification of a specific tracer sequence is then associated with the presence of a specific bacterial delivery vehicle in a test sample. Alternatively or in addition, the method may include a step of detecting and optionally quantifying the total bacterial delivery vehicle in a sample derived from the subject by using a primer combined with a unique tracer nucleic acid sequence for a plurality of amplification cycles. This amplification method includes, for example, PCR, qPCR, ddPCR or NGS.

[0015] In the methods of the present invention, the unique tracer may have a constant region to which a primer may bind to initiate an amplification reaction, and thus the method may include detecting and optionally quantifying each bacterial delivery vehicle by amplifying the tracer using a primer that binds within the constant region of the tracer sequence. Optionally, the unique tracer may further comprise a variable sequence to which a primer may bind for amplification, and the method may further include using the primer that binds to the variable sequence for a different amplification reaction or a second amplification reaction of the amplification method.

[0016] The unique tracer may comprise a variable region to which primers may bind for amplification, and thus the method may comprise detecting and optionally quantifying each bacterial delivery vehicle by amplifying the tracer using primers that bind within the variable region of the tracer sequence.

[0017] In the methods of the present invention, each bacterial delivery vehicle may contain a nucleic acid payload having the same sequence except for the tracer. Alternatively, each bacterial delivery vehicle may contain a nucleic acid payload having a different sequence and a different tracer associated with each different payload.

[0018] Preferably, the tracer comprises a stretch of homology of no more than 20 nucleotides to the DNA of the bacterial production strain and / or to the DNA of the target bacterial cell.

[0019] In the methods of the invention, the tracer may comprise a barcode. In particular, the tracer may comprise a constant region and a barcode, and more particularly a barcode flanked by constant regions on each side. Preferably, the length of the barcode and / or constant region is between 25-50 nucleic acids.

[0020] In the methods of the invention, the tracer may be embedded in a non-coding region or a coding region. In embodiments where the tracer is embedded in a coding region, the tracer may comprise altered codon usage but encode a protein with unchanged amino acids.

[0021] The present invention also provides a bacterial delivery vehicle as defined above, ie a bacterial delivery vehicle comprising a nucleic acid payload having a tracer nucleic acid sequence, and a pharmaceutical composition comprising the multivalent mixture of the present invention.

[0022] The present invention also relates to a bacterial delivery vehicle or pharmaceutical composition of the present invention for use in treating a disease or disorder caused by bacteria. Preferably, the disease or disorder caused by bacteria is selected from infections caused by bacteria, metabolic disorders (such as obesity and diabetes) and conditions involving bacteria in the human microbiome. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to better understand the subject matter disclosed herein and to illustrate how it can be carried out in practice, embodiments will now be described by way of non-limiting examples with reference to the accompanying drawings. With specific reference to the drawings, it is emphasized that the details shown are by way of example and for the purpose of illustrative discussion of embodiments of the invention.

[0025] Figure 1 Demonstrating the advantages of a mixture of phagemid particles containing a unique DNA tracer in their DNA nucleic acid payload in the context of pharmaceutical applications.

[0026] Figure 2 Design and implementation of DNA tracers within noncoding DNA sequences that characterize the DNA nucleic acid payload.

[0027] Figure 3 Describe the design and implementation of DNA within a synonymous coding DNA sequence for a DNA nucleic acid payload.

[0028] Figure 4 Depicted is a representation of the codon possibilities for the 10 amino acid segment AA40-49 in the TEM-1 β-lactamase example.

[0029] Figure 5 Schematic diagram showing the plasmid backbone pAK272B, the location of the barcode region and the corresponding primers.

[0030] Figure 6 The copy number of each plasmid detected per μl from different plasmid mixtures each containing a different barcode is represented.

[0031] Figure 7 Represents the copy number of each plasmid detected in the plasmid mixture extracted from bacteria transduced in vivo.

[0032] Details

[0033] The present disclosure generally relates to methods for genetically marking bacterial delivery vehicles having desired structural characteristics for use in detecting the presence of two or more different bacterial delivery vehicles within a multivalent mixture of delivery vehicles. More specifically, the present disclosure relates to methods in which the bacterial delivery vehicle to be detected comprises a desired nucleic acid payload of interest that additionally contains a unique tracer nucleotide sequence that can be detected by performing amplification cycles.

[0034] In one aspect, a bacterial delivery vehicle is provided, wherein the bacterial delivery vehicle has a desired structural feature, such as specific target cell binding and / or host range, and comprises a nucleic acid payload having an embedded unique tracer nucleic acid sequence. In another aspect, a multivalent mixture of bacterial delivery vehicles is provided, comprising two or more different bacterial delivery vehicles, wherein each bacterial delivery vehicle comprises a nucleic acid payload having a unique tracer nucleic acid sequence.

[0035] Bacterial delivery vehicles provided herein make it possible to transfer nucleic acid payloads encoding proteins or nucleic acids of interest into desired target bacterial host cells. The bacteria targeted by the bacterial delivery vehicle can be any bacteria present in a mammalian organism. It can be any commensal, symbiotic or pathogenic bacteria of a microbial community or microbiome. The microbial community can include a variety of bacterial species, any of which can be targeted according to the present disclosure. In some embodiments, the genus and / or species of the targeted bacterial cell can depend on the type of bacteriophage used to prepare the bacterial delivery vehicle. For example, some bacteriophages show tropism to specific host bacterial species or preferentially target specific host bacterial species. Other bacteriophages do not show this tropism and can be used to target endogenous bacterial cells of many different genera and / or species. In a preferred embodiment, the target bacterial host cell is a cell of a microbial community. In a more preferred embodiment, the target bacterial host cell is a cell of a skin microbial community, an intestinal microbial community, a lung microbial community, and an oral microbial community.

[0036] The term "delivery vehicle" as used herein refers to any means that allows the nucleic acid payload to be transferred to bacteria. There are several types of delivery vehicles included by the present invention, including, but not limited to, bacteriophage scaffolds, viral scaffolds, chemical-based delivery vehicles (e.g., cyclodextrins, calcium phosphates, cationic polymers, cationic liposomes), protein-based or peptide-based delivery vehicles, lipid-based delivery vehicles, nanoparticle-based delivery vehicles, non-chemical-based delivery vehicles (e.g., conversion, electroporation, sonoporation, optical transfection), particle-based delivery vehicles (e.g., gene guns, magnetic transfection, puncture infection (impalefection), particle bombardment, cell penetrating peptides) or donor bacteria (conjugation). The present invention also includes any combination of delivery vehicles. Delivery vehicles can refer to bacteriophage-derived scaffolds and can be obtained from natural, evolved or designed capsids. In some embodiments, the delivery vehicle is a nucleic acid payload because bacteria naturally have the ability to absorb nucleic acid payloads from the environment on their own. In some embodiments, the bacterial delivery vehicle is a bacteriophage-derived particle consisting of a DNA nucleic acid payload of interest packaged in a bacteriophage-derived capsid.

[0037] Bacteriophage-derived particles can be prepared from bacterial viruses. Bacteriophage-derived particles can be prepared from bacterial viruses. Bacterial viruses are selected to enable the introduction of nucleic acid payloads into targeted bacteria.

[0038] Bacterial viruses are preferably bacteriophages. Bacteriophages are obligate intracellular parasites that reproduce in bacteria by incorporating part or all of the host biosynthetic machinery. The phage genome has a variety of sizes and shapes (e.g., linear or circular). The diameter size range of most phages is 24-200 nm. The phage contains nucleic acid (i.e., genome) and protein, and can be wrapped by a lipid membrane. Depending on the phage, the nucleic acid genome can be DNA or RNA, and can exist in a circular or linear form. The size of the phage genome varies from phage to phage. The genome size of the simplest phage is only a few thousand nucleotides, while the genome of a more complex phage can contain more than 100,000 nucleotides, and in rare cases more than 1,000,000. The number and amount of various proteins in the phage particle can vary from phage to phage.

[0039] Optionally, the bacteriophage is selected from the following Caudovirales based on the taxonomy of Krupovic et al., Arch Virol, 2015:

[0040] - Myoviridae (such as, but not limited to, the following genera: Cp220 virus, Cp8 virus, Ea214 virus, Felixo1 virus, Moogle virus, Susp virus, Hp1 virus, P2 virus, Kay virus, P100 virus, Silvia virus, Spo1 virus, Tsarbomba virus, Twort virus, Cc31 virus, Jd18 virus, Js98 virus, Kp15 virus, Moon virus, Rb49 virus, Rb69 virus, S16 virus, Schizot4 virus, Sp18 virus, T4 virus, Cr3 virus, Se1 virus, V5 virus, Abouo virus, Agate virus, Agrican357 virus, Ap22 virus, Arv1 virus, B4 virus, Bastille virus virus, Bc431 virus, Bcep78 virus, Bcepmu virus, Biquarta virus, Bxz1 virus, Cd119 virus, Cp51 virus, Cvm10 virus, Eah2 virus, El virus, Hapuna virus, Jimmer virus, Kpp10 virus, M12 virus, Machina virus, Martha virus, Msw3 virus, Mu virus, Myohalo virus, Nit1 virus, P1 virus, Pakpuna virus, Pbuna virus, Phikz virus, Rheph4 virus, Rsl2 virus, Rsluna virus, Secunda5 virus, Sep1 virus, Spn3 virus, Svuna virus, Tg1 virus, Vhml virus, and Wph virus),

[0041] - Podoviridae (such as, but not limited to, the following genera: Fri1 virus, Kp32 virus, Kp34 virus, Phikmv virus, Prado virus, Sp6 virus, T7 virus, Cp1 virus, P68 virus, Phi29 virus, Nona33 virus, Pocj virus, Tl2011 virus, Bcep22 virus, Bpp1 virus, Cba41 virus, Dfl12 virus, Ea92 virus, Epsilon15 virus, F116 virus, G7c virus, Jwalpha virus, Kf1 virus, Kpp25 virus, Lit1 virus, Luz24 virus, Luz7 virus, N4 virus, Nonana virus, P22 virus, Page virus, Phieco32 virus, Prtb virus, Sp58 virus, Una961 virus and Vp5 virus),

[0042] - Siphoviridae (such as, but not limited to, the following genera: Cam virus, Lika virus, R4 virus, Acadian virus, Cooper virus, Pg1 virus, Pipefish virus, Rosebush virus, Brujita virus, Che9c virus, Hawkeye virus, Plot virus, Jersey virus, K1g virus, Sp31 virus, Lmd1 virus, Una4 virus, Bongo virus, Rey virus, Butters virus, Charlie virus, Redi virus, Baxter virus, Nymphadora virus, Bignuz virus, Fishburne virus, Phayonce virus, Kp36 virus, Rogue1 virus, Rtp virus, T1 virus, Tls virus, Ab18 virus, Amigo virus, Anatole virus, Andromeda virus, Attis virus, Barnyard virus, Bernal13 virus, Biseptima virus, Bron virus, C2 virus, C5 virus, Cba181 virus, Cbast virus, Ceci virus, Che8 virus, Chi virus, Cjw1 virus, Corndog virus, Cronus virus, D3112 virus, D3 virus, Decurro virus, Demosthenes virus, Doucette virus, E12 5 virus, Eiau virus, Ff47 virus, Gaia virus, Giles virus, Gordon virus, Gordtnk virus, Harrison virus, Hk578 virus, Hk97 virus, Jenst virus, Jwx virus, Kellezio virus, Korra virus, L5 virus, lambda virus, Laroye virus, Liefie virus, Marvin virus, Mudcat virus, N15 virus, Nonag virus, Np1 virus, Omega virus, P12002 virus, P12024 virus, P23 virus, P70 virus, Pa6 virus, Pamx74 virus, Patience disease virus, Pbi1 virus, Pepy6 virus, Pfr1 virus, Phic31 virus, Phicbk virus, Phieta virus, Phifel virus, Phijl1 virus, Pis4a virus, Psa virus, Psimuna virus, Rdjl virus, Rer2 virus, Sap6 virus, Send513 virus, Septima3 virus, Seurat virus, Sextaec virus, Sfi11 virus, Sfi21dt1 virus, Sitara virus, Sk1 virus, Slash virus, Smoothie virus, Soups virus, Spbeta virus, Ssp2 virus, T5 virus, Tank virus,Tin2 virus, Titan virus, Tm4 virus, Tp21 virus, Tp84 virus, Tria virus, Trigintaduo virus, Vegas virus, Vendetta virus, Wbeta virus, Wildcat virus, Wizard virus, Woes virus, Xp10 virus, Ydn12 virus, and Yua virus), and,

[0043] - Ackermannviridae (such as but not limited to the following genera: Ag3 virus, Limestone virus, Cba120 virus and Vi1 virus).

[0044] Optionally, the bacteriophage is not part of the order Caudata, but is from a family with an unspecified order, such as, but not limited to, Tectiviridae (such as the following genera: Alphatectivirus, Betatectivirus), Corticoviridae (such as the following genera: Corticovirus), Inoviridae (such as the following genera: Fibrovirus, Habenivirus, Inovirus, Lineavirus, Plectrovirus, Saetivirus, Vespertiliovirus), Cystoviridae (such as the following genera: Cystovirus), Leviviridae (such as the following genera: Allolevivirus, Levivirus), Microviridae (e.g. the following genera: α3 microvirus, G4 microvirus, Phix174 microvirus, Bdellomicrovirus, Chlamydiamicrovirus, Spiromicrovirus) and Plasmaviridae (e.g. the following genus: Plasmavirus).

[0045] Optionally, the bacteriophage targets Archaea and is not part of the order Caudoviridae, but is from a family with an unspecified order, such as, but not limited to, Ampullaviridae, FuselloViridae, Globuloviridae, Guttaviridae, Lipothrixviridae, Pleolipoviridae, Rudiviridae, Salterprovirus, and Bicaudaviridae.

[0046] A non-exhaustive list of bacterial genera and their known host-specific bacterial viruses is presented in the following paragraphs. Synonyms and spelling variants are indicated in brackets. Homophones are repeated as often as possible (e.g., D, D, d). Unnamed phages are indicated by "NN" next to their genus, and their numbers are given in brackets.

[0047] Bacteria of the genus Actinomyces can be infected by the following phages: Av-I, Av-2, Av-3, BF307, CTl, CT2, CT3, CT4, CT6, CT7, CT8 and 1281.

[0048] Bacteria of the genus Aeromonas can be infected by the following phages: AA-I, Aeh2, N, PMl, TP446, 3, 4, 11, 13, 29, 31, 32, 37, 43, 43-10T, 51, 54, 55R.1, 56, 56RR2, 57, 58, 59.1, 60, 63, Aehl, F, PM2, 1, 25, 31, 40RR2.8t, (synonym = 44R), ((synonym = 44RR2.8t), 65, PM3, PM4, PM5 and PM6.

[0049] Bacillus bacteria can be infected by the following phages: A, aizl, Al-KI, B, BCJAl, BCl, BC2, BLLl, BLl, BP142, BSLl, BSL2, BSl, BS3, BS8, BS15, BS18, BS22, BS26, BS28, BS31, BS104, BS105, BS106, BTB, B1715V1, C, CK-I, Coll, Co rl, CP-53, CS-I, CSi, D, D, D5, entl, FP8, FP9, FSi, FS2, FS3, FS5, FS8, FS9, G, GH8, GT8, GV-I, GV-2, GT-4, g3, gl2, gl3, gl4, gl6, gl7, g21, g23, g24, g29, H2, kenl, KK-88, Kuml, Kyul, J7W-1, LP52, (Synonym = LP-52), L7, Mexl, MJ-I, mor2, MP-7, MP10, MP12, MP14, MP15, Neol, N°2, N5, N6P, PBCl, PBLA, PBP1, P2, Sa, SF2, SF6, Shal, Sill, SP02, (Synonym = ΦSPP1), SPβ, STI, STi, SU-Il, t, TbI, Tb2, Tb5, TbIO, Tb26, Tb51, Tb53, Tb55, Tb7 7. Tb97, Tb99, Tb560, Tb595, Td8, Td6, Tdl5, TgI, Tg4, Tg6, Tg7, Tg9, TgIO, TgIl, T gl3, Tgl5, Tg21, Tinl, Tin7, Tin8, Tinl3, Tm3, Tocl, Togl, toll, TP-I, TP-10vir, TP-15c, TP-16c, TP-17c, TP-19, TP35, TP51, TP-84, Tt4, Tt6, type A, type B, type C, type D, type E, T 3. VA-9, W, wx23, wx26, Yunl, α, γ, pl l,, med-2, T. μ-4, 3T, 75. lO5、(Synonym= lO5), IA, IB, 1-97A, 1-97B, 2, 2, 3, 3, 3, 5, 12, 14, 20, 30, 35, 36, 37, 38, 41C, 51, 63, 64, 138D, I, II, IV, NN-Bacillus (13), alel, AR1, AR2, AR3, AR7, AR9, Bace-11, (Synonyms = 11), Bastille, BLl, BL2, BL3, BL4, BL5, BL6, BL8, BL9, BP124, BS28, BS80, Ch, CP-51, CP-54, D-5, darl, denl, DP-7, entl , FoSi, FoS2, FS4, FS6, FS7, G, gall, γ, GEl, GF-2, GSi, GT-I, GT-2, GT-3, GT-4, GT-5, GT-6, GT-7, GV-6, gl5, 19, 110, ISi ,K,MP9,MP13,MP21,MP23,MP24,MP28,MP29,MP30,MP32,MP34,MP36,MP37,MP39,MP40,MP41,MP43,MP44,MP45,MP47,MP 50. NLP-I, No.l, N17, N19, PBSl, PKl, PMBl, PMB12, PMJl, S, SPOL, SP3, SP5, SP6, SP7, SP8, SP9, SPlO, SP-15, SP50, (Synonym = SP-50), SP82, SST, subl, SW, Tg8, Tgl2, Tgl3, Tgl4, thul, thuΛ, thuS, Tin4, Tin23, TP-13, TP33, TP50, TSP-I, V type, VI type, V, Vx, β22, e. NR2, 25. 63, 1, 1, 2, 2C, 3NT, 4, 5, 6, 7, 8, 9, 10, 12, 12, 17, 18, 19, 21, 138, III, 4 (B. megateriwn), 4 (B. sphaericus), AR13, BPP-10, BS32, BS107, Bl, B2, GA-I, GP-10, GV-3, GV-5, g8, MP20, MP27, MP49, Nf, PP5, PP6, SF5, Tgl8, TP-I, Versailles, 15. 29, 1-97, 837 / IV, mϊ-Bacillus (1), BatlO, BSLlO, BSLI l, BS6, BSI l, BS16, BS23, BSlOl, BS102, gl8, morl, PBLl, SN45, thu2, thu3, TmI, Tm2, ​​TP-20, TP21, TP52, type F, type G, type IV, HN-BacMus (3), BLE, (synonym = θc), BS2, BS4, BS5, BS7, B10, B12, BS20, BS21, F, MJ-4, PBA12, AP50, AP50-04, AP50-11, AP50-23, AP50-26, AP50-27 and Bam35. The following Bacillus-specific phages were defective: DLP10716, DLP-11946, DPB5, DPB12, DPB21, DPB22, DPB23, GA-2, M, No. IM, PBLB, PBSH, PBSV, PBSW, PBSX, PBSY, PBSZ, phi, SPa, type 1, and μ.

[0050] Bacteriodes bacteria can be infected by the following phages: crAss-phage, ad I2, Baf-44, Baf-48B, Baf-64, Bf-I, Bf-52, B40-8, Fl, βl, Al, BrOl, BrO2, 11, 67.1, 67.3, 68.1, mt-Bacteroides (3), Bf42, Bf71, HN-Bdellovibrio (1) and BF-41.

[0051] Bacteria of the genus Bordetella can be infected by the following phages: 134 and NN-Bordetella (3).

[0052] Bacteria of the genus Borrelia can be infected by the following bacteriophages: NN-Borrelia (1) and NN-Borrelia (2).

[0053] Bacteria of the genus Brucella can be infected by the following phages: A422, Bk, (synonym = Berkeley), BM29, FOi, (synonym = FOl), (synonym = FQl), D, FP2, (synonym = FP2), (synonym = FD2), Fz, (synonym = Fz75 / 13), (synonym = Firenze 75 / 13), (synonym = Fi), Fi, (synonym = Fl), Fim, (synonym = FIm), (synonym = Fim), FiU, (synonym = FlU), (synonym = FiU), F2, (synonym = F2), F3, (synonym = F3), F4, (synonym = F4), F5, (synonym = F5), F6, F7, (synonym = F7), F25, (synonym = F2 =£25), F25U, (Synonym = F25u), (Synonym = F25U), (Synonym = F25V), F44, (Synonym - F44), F45, (Synonym = F45), F48, (Synonym = F48), I, Im, M, MC / 75, M51, (Synonym = M85), P, (Synonym = D), S708, R, Tb, (Synonym = TB), (Synonym = Tbilisi), W, (Synonym = Wb), (Synonym = Weybridge), X, 3, 6, 7, 10 / 1, (Synonym = 10), (Synonym = F8), (Synonym = F8), 12m, 24 / 11, (Synonym = 24), (Synonym = F9), (Synonym = F9), 45 / 111, (synonym = 45), 75, 84, 212 / XV, (synonym = 212), (synonym = Fi0), (synonym = FlO), 371 / XXIX, (synonym = 371), (synonym = Fn), (synonym = Fl l) and 513.

[0054] Bacteria of the genus Burkholderia can be infected by the following phages: CP75, NN-Burkholderia (1) and 42.

[0055] Campylobacter bacteria can be infected by the following phages: C, NTCC12669, NTCC12670, NTCC12671, NTCC12672, NTCC12673, NTCC12674, NTCC12675, NTCC12676, NTCC12677, NTCC12678, NTCC12679, NTCC12680, NTCC12681, NTCC12682, NTCC12683, NTCC12684, 32f, 111c, 191, NN-Campylobacter (2), Vfi-6, (synonym = V19), VfV-3, V2, V3, V8, V16, (synonym = Vfi-1), V19, V20 (V45), V45, (synonym = V-45) and NN-Campylobacter spp. (1).

[0056] Bacteria of the genus Chlamydia can be infected by the following bacteriophages: Chpl.

[0057] Bacteria of the genus Clostridium can be infected by the following phages: CAK1, CA5, Ca7, CEβ, (synonym = 1C), CEγ, Cld1, c-n71, c-203 Tox-, DEβ, (synonym = ID), (synonym = lDt0X+), HM3, KM1, KT, Ms, NAl, (synonym = Naltox+), PA135Oe, Pfό, PL73, PL78, PL81, Pl, P50, P5771, P19402, lCt0X+, 2Ct0X\ 2D3 (synonym = 2Dt0X+), 3C, (synonym = 3Ctox+), 4C, (synonym = 4Ct0X+), 56, III-l, NN-Clostridium (61), NBlt0X+, αl, CA1, HMT, HM2, PFl5 P-23, P-46, Q-05, Q-oe, Q-16, Q-21, Q-26, Q-40, Q-46, S111, SA02, WA01, WA03, Wm, W523 ,80,C,CA2,CA3,CPTl,CPT4,cl,c4,c5,HM7,H11 / A1,H18 / Ax,FWS23,Hi58ZA1,K2ZA1,K2 1ZS23, ML, NA2t0X; Pf2, Pf3, Pf4, S9ZS3, S41ZA1, S44ZS23, α2, 41, 112ZS23, 214 / S23, 233 / Ai, 234 / S23, 235 / S23, II-1, II-2, II-3, NN-Clostridium (12), CA1, F1, K, S2, 1, 5 and NN-Clostridium (8).

[0058] Bacteria of the genus Corynebacterium can be infected by the following phages: CGK1 (defective), A, A2, A3, A101, A128, A133, A137, A139, A155, A182, B, BF, B17, B18, B51, B271, B275, B276, B277, B279, B282, C, capi, CCl, CG1, CG2, CG33, CL31, Cog, (synonym = CG5), D, E, F, H, HI, hqi, hq2, 11ZH33, Ii / 31, J, K, K, (synonym = Ktox"), L, L, (synonym = Ltox+), M, MC-I, MC-2, MC-3, MC-4, MLMa, N, O, ovi, ov2, ov3, P, P, R, RP6, RS29, S, T, U, UB1, ub2, UH1, UH3, uh3, uh5, uh6, β, (synonym = βtox+), βhv64, βvir, γ, (synonym = γtoχ-), γl9, δ, (synonym = δ'ox+), p, (synonym = ptoχ-), Φ9, 984, Omega, IA, 1 / 1180, 2, 2 / 1180, 5 / 1180, 5ad / 9717, 7 / 4465, 8 / 4465, 8ad / 10269, 10 / 9253, 13Z9253, 15 / 3148, 21 / 9253, 28, 29, 55, 2747, 2893, 4498 and 5848.

[0059] Bacteria of the genus Enterococcus are infected by the following phages: DF78, Fl, F2, 1, 2, 4, 14, 41, 867, Dl, SB24, 2BV, 182, 225, C2, C2F, E3, E62, DS96, H24, M35, P3, P9, SB101, S2, 2BII, 5, 182a, 705, 873, 881, 940, 1051, 1057, 21096C, NN-Enterococcus (1), PEl, Fl, F3, F4, VD13, 1, 200, 235 and 341.

[0060] Bacteria of the genus Erysipelothrix can be infected by the following bacteriophage: NN-Erysipelothrix (1).

[0061] Bacteria of the genus Escherichia can be infected by the following phages: BW73, B278, D6, D108, E, E1, E24, E41, FI-2, FI-4, FI-5, HI8A, Ffl8B, i, MM, Mu, (synonym = mu), (synonym = MuI), (synonym = Mu-I), (synonym = MU-I), (synonym = MuI), (synonym = μ), 025, PhI-5, Pk, PSP3, Pl, PlD, P2, P4 (defective), Sl, W , K13, R73 (defective type), 1. 2. 7. 92, ψ (defective), 7 A, 8 , 9 , 15 (deficient), 18, 28-1, 186, 299, HH-Escherichia (2), AB48, CM, C4, C16, DD-VI, (synonym = Dd-Vi), (synonym = DDVI), (synonym = DDVi), E4, E7, E28, FI1, FI3, H, H1, H3, H8, K3, M, N, ND-2, ND-3, ND4, ND-5, ND6, ND-7, Ox-1 (synonym = OX1), (synonym = HF), Ox-2 (synonym = 0x2), (synonym = 0X2), Ox-3, Ox-4, Ox-5, (synonym = 0X5), Ox-6, (synonym = 66F), (synonym = 66t), (Synonym = 66t-)5 0111, PhI-I, RB42, RB43, RB49, RB69, S, SalI-I, Sal-2, Sal-3, Sal-4, Sal-5, Sal-6, TC23, TC45, TuII*-6, (Synonym = TuII*), TuIP-24, TuII*46, TuIP-60, T2, (Synonym = ganuTia), (Synonym = γ), (Synonym = PC), (Synonym = PC), (Synonym = T-2), (Synonym = T2), (Synonym = P4), T4, (Synonym = T-4), (Synonym = T4), T6, T35, αl, 1, IA, 3, (Synonym = Ac3), 3A, 3T+, (Synonym = 3), (Synonym = Ml), 5 、(Synonyms= 5), 9266Q, CFO103, HK620, J, K, KlF, m59, no. A, no. E, no. 3, no. 9, N4, sd, (synonym = Sd), (synonym = SD), (synonym = Sa)3 (synonym = sd), (synonym = SD), (synonym = CD), T3, (synonym = T-3), (synonym = T3), T7, (synonym = T-7), (synonym = T7), WPK, W31, ΔH, C3888, K3, K7, K12, V-1, Φ04-CF, Φ05, Φ06, Φ07, 1. 1.2. 20. 95. 263, 1092、 1. ll、(Synonym= W), Ω8, 1, 3, 7, 8, 26, 27, 28-2, 29, 30, 31, 32, 38, 39, 42, 933W, NN-Escherichia coli (1), Esc-7-11, AC30, CVX-5, Cl, DDUP, ECl, EC2, E21, E29, Fl, F26S, F27S, Hi, HK022, HK97, (Synonym = ΦHK97), HK139, HK253, HK256, K7, ND-I, no.D, PA-2, q, S2, Tl, (Synonym = α), (Synonym = P28), (Synonym = TI), (Synonym = Tx), T3C, T5, (Synonym = T-5), (Synonym = T5), UC-I, w, β4, γ2, λ (Synonym = λ), (synonym = Φλ), ΦD326, γ、Φ06、Φ7、Φ10、 80, χ, (synonym = χi), (synonym = χ)、(Synonyms= χi), 2, 4, 4A, 6, 8A, 102, 150, 168, 174, 3000, AC6, AC7, AC28, AC43, AC50, AC57, AC81, AC95, HK243, KlO, ZG / 3A, 5, 5A, 21EL, H19-J, 933H, O157 typing phage 1-16, JES-2013, 121Q, 172-1, 1720a-02, ADB-2, AKFV33, av-05, bV_EcoS_AHP42, bV_EcoS_AHP42, bV_EcoS_ACP24, bV_EcoS_AKS96, CBA120.

[0062] Bacteria of the genus Fusobacterium were infected by the following phages: NN-Fusobacterium (2), fv83-554 / 3, fv88-531 / 2, 227, fv2377, fv2527, and fv8501.

[0063] Bacteria of the genus Haemophilus are infected by the following phages: HP1, S2 and N3.

[0064] Bacteria of the genus Helicobacter are infected by the following phages: HP1 and ^^-Helicobacter (1).

[0065] Bacteria of the genus Klebsiella are infected by the following phages: AIO-2, KI4B, Kl6B, Kl9, (synonym = K19), Kl14, Kl15, Kl21, Kl28, Kl29, KI32, Kl33, Kl35, Kl106B, Kl171B, Kl181B, Kl832B, AIO-I, AO-I, AO-2, AO-3, FC3-10, K, Kl1, (synonym = KIl), Kl2, (synonym = K12), Kl3, (synonym = K13), (synonym = Kl 70 / 11), Kl4, (synonym = K14), Kl5, (synonym = K15), Kl6, (synonym = K16), Kl7, (synonym = K17), Kl8, (Synonym = K18), Kl19, (Synonym = K19), Kl27, (Synonym = K127), Kl31, (Synonym = K131), Kl35, Kl171B, II, VI, IX, CI-I, Kl4B, Kl8, Kl11, Kl12, Kl13, Kl16, Kl17, Kl18, Kl20, Kl22, Kl23, Kl24, Kl26, Kl30, Kl34, Kl106B, KIi65B, Kl328B, KLXI, K328, P5046, 11, 380, III, IV, VII, VIII, FC3-11, Kl2B, (Synonym = K12B), Kl25, (Synonym = K125), Kl42B, (Synonym = K142), (Synonym = K142B), Kl181B, (Synonym = K181), (Synonym = K1181B), Kl765 / !, (Synonym = K1765 / 1), Kl842B, (Synonym = K1832B), Kl937B, (Synonym = K1937B), Ll, 28, 7, 231, 483, 490, 632 and 864 / 100.

[0066] Bacteria of the genus Lepitospira are infected by the following phages: LE1, LE3, LE4, and ~NN-Leptospira (1).

[0067] Bacteria of the genus Listeria are infected by the following phages: A511, 01761, 4211, 4286, (synonym = BO54), A005, A006, A020, A500, A502, A511, A118, A620, A640, B012, B021, B024, B025, B035, B051, B053, B054, B055, B056, B101, B110, B545, B604, B653, C707, D441, HSO47, H10G, H8 / 73, H19, H21, H43, H46, H107, H108, H11 lO, H163 / 84, H312, H340, H387, H391 / 73, H684 / 74, H924A, PSA, U153, MLUP5, (synonym = P35), 00241, 00611, 02971A, 02971C, 5 / 476, 5 / 911, 5 / 939, 5 / 11302, 5 / 11605, 5 / 11704, 184, 575, 633, 699 / 694, 744, 900, 1090, 1317, 1444, 1652, 1806, 1807, 1921 / 959, 1921 / 11367, 1921 / 11500, 1921 / 11566, 1921 / 12460, 1921 / 12582, 1 967, 2389, 2425, 2671, 2685, 3274, 3550, 3551, 3552, 4276, 4277, 4292, 4477, 5337, 5348 / 11363, 5348 / 11646, 5348 / 12430, 5348 / 12434, 10072, 11355C, 11711A, 12029, 12981, 13441, 90666, 90816, 93253, 907515, 910716, and NN-Listeria (15).

[0068] Bacteria of the genus Morganella are infected by the following phages:47.

[0069] Bacteria of the genus Mycobacterium are infected by the following phages: 13, AG1, ALi, ATCC11759, A2, B.C3, BG2, BK1, BK5, butyricum, BI, B5, B7, B30, B35, Clark, CI, C2, DNAIII, DSP1, D4, D29, GS4E, (synonym = GS4E), GS7, (synonym = GS-7), (synonym = GS7), IPa, lacticola, Legendre, Leo, L5, (synonym = ΦL-5), MC-I, MC-3, MC-4, minetti, MTPHI l, Mx4, MyF3P / 59a, phlei, (synonym = phlei 1), phlei 4, Polonus II,rabinovitschi,smegmatis,TM4,TM9,TMlO,TM20,Y7,YlO, 630, IB, IF, IH, 1 / 1, 67, 106, 1430, Bl, (synonym = Bol), B24, D, D29, FK, FS, HP, Polonus I, Roy, Rl, (synonym = Rl-Myb), (synonym = Ri), 11, 31, 40, 50, 103a, 103b, 128, 3111-D, 3215-D, and NN-Mycobacterium (1).

[0070] Bacteria of the genus Neisseria are infected by the following phages: Group I, Group II, and NP1.

[0071] Bacteria of the genus Nocardia were infected by the following phages: MNP8, NJ-L, NS-8, N5 and TtiN-Nocardia.

[0072] Bacteria of the genus Proteus were infected by the following phages: Pm5, 13vir, 2 / 44, 4 / 545, 6 / 1004, 13 / 807, 20 / 826, 57, 67b, 78, 107 / 69, 121, 9 / 0, 22 / 608, 30 / 680, PmI, Pm3, Pm4, Pm6, Pm7, Pm9, PmIO, PmI l, Pv2, πl, m, 7 / 549, 9B / 2, 10A / 31, 12 / 55, 14, 15, 16 / 789, 17 / 971, 19A / 653, 23 / 532, 25 / 90 9. 26 / 219, 27 / 953, 32A / 909, 33 / 971, 34 / 13, 65, 5006M, 7480b, VI, 13 / 3a, Clichy 12.π2600, χ7, 1 / 1004, 5 / 742, 9, 12, 14, 22, 24 / 860, 2600 / D52, Pm8 and 24 / 2514.

[0073] Bacteria of the genus Providencia are infected by the following phages: PL25, PL26, PL37, 9211 / 9295, 9213 / 921 Ib, 9248, 7 / R49, 7476 / 322, 7478 / 325, 7479, 7480, 9000 / 9402 and 9213 / 921 Ia.

[0074] Bacteria of the genus Pseudomonas are infected by the following phages: PfI, (synonyms = Pf-I), Pf2, Pf3, PP7, PRRl, 7s, im-Pseudomonas (1), AI-I, AI-2, B 17, B89, CB3, Col 2, Col 11, Col 18, Col 21, C154, C163, C167, C2121, E79, F8, ga, gb, H22, K1, M4, N2, Nu, PB-I, (synonyms = PBl), pfl6, PMN17, PPl, PP8, Psal, PsPl, PsP2, PsP3, PsP4, PsP5, PS3, PS17, PTB80, PX4, PX7, PYOl, PYO2, PYO5, PYO6, PYO9, PYOlO, PYO13, PYO14, PYO16, PYO18, PYO19, P YO20, PYO29, PYO32, PYO33, PYO35, PYO36, PYO37, PYO38, PYO39, PYO41, PYO42, PYO45, PYO47, PYO48, PYO64, PYO69, PYO103, PlK, SLPl, SL2, S2, UNL-I, wy, Yai, Ya4, Yan, BE, CTX, C17, KZ, (synonym = ΦKZ), -LT, Φmu78, NZ, PLS-1, ST-1, W-14, -2、1 / 72、2 / 79、3、3 / DO、4 / 237、5 / 406、6C、6 / 6660、7、7v 7 / 184, 8 / 280, 9 / 95, 10 / 502, 11 / DE, 12 / 100, 12S, 16, 1, 24, 25F, 27, 31, 44, 68, 71, 95, 109, 188, 337, 352, 4, ΗN-inducible residue(23), A856, B26, CI-I, CI-2, C5, D, gh-1, Fl 16, HF, H90, K5, K6, Kl 04 K109 K166 K267 N4 N5 O6N-25P PE69 Pf PPN25 PPN3 5, PPN89, PPN91, PP2, PP3, PP4, PP6, PP7, PP8, PP56, PP87, PPl 14. PP206, PP207, PP306, PP651, Psp231a, Pssy401, Pssy9220, psi, PTB2, PTB2 0, PTB42, PXl, PX3, PXlO, PX12, PX14, PYO70, PYO71, R, SH6, SH133, tf, Ya5, Ya7. BS、ΦKf77、 -MC、ΦmnF82、 PLS27、 PLS743. S-1, 1, 2, 2, 3, 4, 5, 6, 7, 7, 8, 9, 10, 11, 12, 12B, 13, 14, 15, 14, 15, 16, 17, 18, 19, 20, 20, 21, 21, 22, 23, 23, 24, 25, 31, 53, 73, 119x, 145, 147, 170, 267, 284, 308, 525, NN-Pseudomonas (5), af, A7, B3, B33, B39, BI-I, C22, D3, D37, D40, D62, D3112, F7, FlO, g, gd, ge, gξ Hwl2, Jb 19. KFl, L°, OXN-32P, O6N-52P, PCH-I, PC13-1, PC35-1, PH2, PH51, PH93, PH132, PMW, PM13, PM57, PM61, PM62, PM63, PM69, PM105, PMl 13. PM681, PM682, PO4, PPl, PP4, PP5, PP64, PP65, PP66, PP71, PP86, PP88, PP92, PP401, PP711, PP8 91. Pssy41, Pssy42, Pssy403, Pssy404, Pssy420, Pssy923, PS4, PS-IO, Pz, SDl, SLl, SL3, SL5, SM, C5, Cl l, Cl l-1, C13, C15, MO, X. O4, ll. 240, 2, 2F, 5, 7m, 11, 13, 13 / 441, 14, 20, 24, 40, 45, 49, 61, 73, 148, 160, 198, 218 ,222,236,242,246,249,258,269,295,297,309,318,342,350,351,357-1,400 -1, HN-Pseudomonas (6), G101, M6, M6a, L1, PB2, Pssy15, Pssy4210, Pssy4220, PYO12, PYO34, PYO49, PYO50, PYO51, PYO52, PYO53, PYO57, PYO59, PYO200, PX2, PX5, SL4, O3, O6 and 1214.

[0075] Bacteria of the genus Rickettsia are infected by the following phages: NN-Rickettsia.

[0076] Bacteria of the genus Salmonella are infected by the following phages: b, Beccles, CT, d, Dundee, f, FeIs 2, GI, GUI, GVI, GVIII, k, K, i, j, L, 01, (Synonym = 0-1), (Synonym = O1), (Synonym = OI), (Synonym = 7), 02, 03, P3, P9a, P10, Sab3, Sab5, SanlS, Sanl7, SI, Taunton, ViI, (Synonym = ViI), 9, imSalmonella (1), NI, N-5, N-IO, N-17, N-22, 11, 12, 16-19, 20.2, 36, 449C / C178, 966A / C259, a, BAOR, e, G4, GUI, L, LP7, M, MG40, N-18, PSA68, P4, P9c, P22, (Synonym = P22), (Synonym = PLT22), (Synonym = PLT22), P22al, P22-4, P22-7, P22-11, SNT-I, SNT-2, SP6, Villi, ViIV, ViV, ViVI, ViVII, Worksop, Sj5, ε34, 1, 37, 1(40), (Synonyms = l

[40] ), 1, 422, 2, 2.5, 3b, 4, 5, 6, 14(18), 8, 14(6,7), 10, 27, 28B, 30, 31, 32, 33 ,34,36,37,39,1412,SNT-3,7-11,40.3,c,C236,C557,C625,C966N,g,GV,G5,Gl 73, h, IRA, Jersey, MB78, P22-1, P22-3, P22-12, Sabl, Sab2, Sab2, Sab4, Sanl, San2, San3, San4, San6, San7, San8, San9, Sanl3, Sa nl4, Sanl6, Sanl8, Sanl9, San20, San21, San22, San23, San24, San25, San26, SasLl, SasL2, SasL3, SasL4, SasL5, SlBL, SII, ViII, l, 1, 2, 3a, 3al, 1010, Ym-Salmonella (1), N-4, SasL6 and 27.

[0077] Bacteria of the genus Serratia are infected by the following phages: A2P, PS20, SMB3, SMP, SMP5, SM2, V40, V56, ic, ΦCP-3, ΦCP-6, 3M, 10 / 1a, 20A, 34CC, 34H, 38T, 345G, 345P, 501B, SMB2, SMP2, BC, BT, CW2, CW3, CW4, CW5, Lt232, L2232, L34, L.228, SLP, SMPA, V.43, σ, CWl, ΦCP6-1, ΦCP6-2, ΦCP6-5, 3T, 5, 8, 9F, 10 / 1, 2OE, 32 / 6, 34B, 34CT, 34P, 37, 41, 56, 56D, 56P, 6OP, 61 / 6 , 74 / 6, 76 / 4, 101 / 8900, 226, 227, 228, 229F, 286, 289, 290F, 512, 764a, 2847 / 10, 2847 / 1Oa, L.359 and SMBl.

[0078] Bacteria of the genus Shigella are infected by the following phages: Fsa, (synonym = a), FSD2d, (synonym = D2d), (synonym = W2d), FSD2E, (synonym = W2e), fv, F6, f7.8, H-Sh, PE5, P90, SfII, Sh, SHm, SHrv, (synonym = HIV), SHvi, (synonym = HVI), SHVvm, (synonym = HVIII), SKγ66, (synonym = γ66), (synonym = yββ), (synonym = γ66b), SKm, (synonym = SIIIb), SKw, (synonym = Siva), (synonym = IV), SIC™, (synonym = SIVA), (synonym = SIVA. IVA)、SKvi、(Synonym = KVI)、(Synonym = Svi)、(Synonym = VI)、SKvm、(Synonym = Svm)、(Synonym = VIII)、SKVΠIA、(Synonym = SvmA)、(Synonym = VIIIA)、STvi、STK、STx1、STxn、S66、W2、(Synonym = D2c)、(Synonym = D20)、 1. IVb 3-SO-R, 8368-SO-R, F7, (Synonym = FS7), (Synonym = K29), FlO, (Synonym = FSlO), (Synonym = K31), I1, (Synonym = α), (Synonym = FSa), (Synonym = Kl 8), (Synonym = α), I2, (Synonym = a), (Synonym = K19), SG33, (Synonym = G35), (Synonym = SO-35 / G), SG35, (Synonym = SO-55 / G), SG3201, (Synonym = SO-3201 / G), SHn, (Synonym = HII), SHv, (Synonym = SHV), SHx, SHX, SKn, (Synonym = K2), (Synonym = KII), (Synonym = Sn), (Synonym = =SsII), (Synonym = II), SKrv, (Synonym = Sm), (Synonym = SsIV), (Synonym = IV), SK1Va, (Synonym = Swab), (Synonym = SsIVa), (Synonym = IVa), SKV, (Synonym = K4), (Synonym = KV), (Synonym = SV), (Synonym = SsV), (Synonym = V), SKx, (Synonym = K9), (Synonym = KX), (Synonym = SX), (Synonym = SsX), (Synonym = X), STV, (Synonym = T35), (Synonym = 35-50-R), STvm, (Synonym = T8345), (Synonym = 8345-SO-SR), W1, (Synonym = D8), (Synonym = FSD8), W2a, (Synonym = D2A), (Synonym = FS2a), DD-2, Sf6, FSi, (Synonym = Fl), SF6, (Synonym = F6), SG42, (Synonym = SO-42 / G), SG3203, (Synonym = SO-3203 / G), SKF12, (Synonym = SsF12), (Synonym = F12), (Synonym = F12), STn, (Synonym = 1881-SO-R), γ66, (Synonym = γ66a), (Synonym = Ssγ66), 2, BIl, DDVII, (synonym = DD7), FSD2b, (synonym = W2B), FS2, (synonym = F2), (synonym = F2), FS4, (synonym = F4), (synonym = F4), FS5, (synonym = F5), (synonym = F5), FS9, (synonym = F9), (synonym = F9), FI l, P2-S0-S, SG36, (synonym = SO-36 / G), (synonym = G36), SG3204, (synonym = SO-3204 / G), SG3244, (synonym = SO-3244 / G), SHi, (synonym = HI), SHvπ, (synonym = HVII), SHK, (synonym = HIX), SHx1, SHxπ, (synonym = HXn), SKI, KI, (synonym = S1), (Synonym = SsI), SKVII, (Synonym = KVII), (Synonym = Svπ), (Synonym = SsVII), SKIX, (Synonym = KIX), (Synonym = S1x), (Synonym = SsIX), SKXII, (Synonym = KXII), (Synonym = Sxn), (Synonym = SsXII), STi, STffl, STrv, STVi, STvπ, S70, S206, U2-S0-S, 3210-SO-S, 3859-SO-S, 4020-SO-S, 3. 5. 7. 8. 9. 10. ll. 13. 14. l8, SHm, (synonym = Hπi), SHχi, (synonym = HXt) and SKxI, (synonym = KXI), (synonym = Sχi), (synonym = SsXI), (synonym = XI).

[0079] Bacteria of the genus Staphylococcus are infected by the following phages: A, EW, K, Ph5, Ph9, PhIO, Phl3, Pl, P2, P3, P4, P8, P9, PlO, RG, SB-i, (synonym = Sb-I), S3K, Twort, ΦSK311, 812, 06, 40, 58, 119, 130, 131, 200, 1623, STC1, (synonym = stcl), STC2, (synonym = stc2), 44AHJD, 68, ACl, AC2, A6 "C", A9 "C", b581, CA-1, CA-2, CA-3, CA-4, CA-5, D1 l, L39x35, L54a, M42, N1, N2, N3, N4, N5, N7, N8, N10, Ni l, N12, N13, N14, N16, Ph6, Ph12, Ph14, UC-18, U4, U15, S1, S2, S3, S4, S5, X2, Z1, B5-2, D, ω, 11, (Synonym = ll), (Synonym = P11-M15), 15, 28, 28A, 29, 31, 31B, 37, 42D, (Synonym = P42D), 44A, 48, 51, 52, 52A, (Synonym = P52A), 52B, 53, 55, 69, 71, (Synonym = P71), 71A, 72, 75, 76, 77, 79, 80, 80α, 82, 82A, 83 A, 84, 85, 86, 88, 88A, 89, 90, 92, 95, 96, 102, 107, 108, 111, 129-26, 130, 130A, 155, 157, 1 57A, 165, 187, 275, 275A, 275B, 356, 456, 459, 471, 471A, 489, 581, 676, 898, 1139, 1154A, 1259, 1314, 1380, 1405, 1563, 2148, 2638A, 2638B, 2638C, 2731, 2792A, 2792B, 2818, 2835 , 2848A, 3619, 5841, 12100, AC3, A8, AlO, A13, b594n, D, HK2, N9, N15, P52, P87, Sl, S6, Z4, RE, 3A, 3B, 3C, 6, 7, 16, 21, 42B, 42C, 42E, 44, 47, 47A5 47C, 51, 54, 54x1, 70, 73, 75, 78, 81, 82, 88, 93, 94, 101, 105, 110, 115, 129 / 16, 174, 594n, 1363 / 14, 2460, and mS-Staphylococcus (1).

[0080] Bacteria of the genus Streptococcus are infected by the following phages: EJ-1, NN-Streptococcus (1), a, C1, FL0Ths, H39, Cp-1, Cp-5, Cp-7, Cp-9, Cp-10, AT298, A5, a10 / J1, a10 / J2, a10 / J5, a10 / J9, A25, BTI l, b6, CA1, c20-1, c20-2, DP-1, Dp-4, DT1, ET42, e10, FA101, FEThs, Fκ, FKK101, FKL10, FKP74, FKH, FLOThs, Fy101, fl, F10, F20140 / 76, g, GT-234, HB3, (Synonyms = HB-3), HB-623, HB-746, M102, O1205, O1205, PST, PO, Pl, P2, P3, P5, P6, P8, P9, P9, P12, P13, P14, P49, P50, P51, P52, P53, P54, P55, P56, P57, P58, P59, P64, P67, P69, P71, P73, P75, P76, P77, P82, P83, P88, sc, sch, sf, SfIl 1, (Synonym = SFiI l), (Synonym = SFill), (Synonym = ΦSfil l), (Synonym = Sfil l), sfil9, (Synonym = SFil9), (Synonym = SFil9), (Synonym = Sfil9), Sfi21, (Synonym = SFi21), (Synonym = SFi21), (Synonym = Sfi21), ST0, STX, st2, ST2, ST4, S3, (Synonym = S3), s265, Φ17, 42, Φ57, 80. 81. 82. 83. 84. 85. 86. 87. 88. 89. 90. 91. 92. 93. 94. 95. 96. 97. 98. 99. 100, 10l、 1O2, 227, Φ7201, ωl, ω2, ω3, ω4, ω5, ω6, ω8, ωlO, 1, 6, 9, 1OF, 12 / 12, 14, 17SR, 19S, 24, 50 / 33, 50 / 34, 55 / 14, 55 / 15, 70 / 35, 70 / 36, 71 / ST15, 71 / 45, 71 / 46, 74F, 79 / 37, 79 / 38, 80 / J4, 80 / J9, 80 / ST16, 80 / 15, 80 / 47, 80 / 48, 101, 103 / 39, 103 / 40, 121 / 41, 121 / 42, 123 / 43, 123 / 44, 124 / 44, 337 / ST17 and mStreptococcus (34).

[0081] Bacteria of the genus Treponema are infected by the following bacteriophages: NN-Trepona (1).

[0082] Bacteria of the genus Vibrio are infected by the following phages: CTXΦ, fs, (synonym = si), fs2, Ivpf5, Vfl2, Vf33, VPIΦ, VSK, v6, 493, CP-Tl, ET25, κ, K139, Labol,)XN-69P, OXN-86, O6N-21P, PB-I, P147, rp-1, SE3, VA-I, (synonym = VcA-I), VcA-2, VP1, VP2, VP4, VP7, VP8, VP9, ​​VP10, VP17, VP18, VP19, X29, (synonym = 29 d'Herelle), t, ΦHAWI-1, ΦHAWI-2, ΦHAWI-3, ΦHAWI-4, ΦHAWI-5, ΦHAWI-6, ΦHAWI-7, XHAWI-8, ΦHAWI-9, ΦHAWI-10, ΦHCl-1, ΦHC1-2, ΦHC1-3, ΦHC1-4, ΦHC2-1, >HC 2-2, ΦHC2-3, ΦHC2-4, ΦHC3-1, ΦHC3-2, ΦHC3-3, ΦHD1S-1, ΦHD1S-2, ΦHD2S-1, ΦHD 2S-2, ΦHD2S-3, ΦHD2S-4, ΦHD2S-5, ΦHDO-1, ΦHDO-2, ΦHDO-3, ΦHDO-4, ΦHDO-5, ΦHD O-6, ΦKL-33, ΦKL-34, ΦKL-35, ΦKL-36, ΦKWH-2, ΦKWH-3, ΦKWH-4, ΦMARQ-1, ΦMARQ -2, ΦMARQ-3, ΦMOAT-1, ΦO139, ΦPEL1A-1, ΦPEL1A-2, ΦPEL8A-1, ΦPEL8A-2, ΦPEL8 A-3, ΦPEL8C-1, ΦPEL8C-2, ΦPEL13A-1, ΦPEL13B-1, ΦPEL13B-2, ΦPEL13B-3, ΦPEL 13B-4, ΦPEL13B-5, ΦPEL13B-6, ΦPEL13B-7, ΦPEL13B-8, ΦPEL13B-9, ΦPEL13B-10, VP143, VP253, Φ16, l38, 1- II, 5, 13, 14, 16, 24, 32, 493, 6214, 7050, 7227, II, (synonym = II group), (synonym == 2), V, VIII, ~m-Vibrio (13), KVP20, KVP40, nt-1, O6N-22P, P68, el, e2, e3, e4, e5, FK, G, I, K, nt-6, Nl, N2, N3, N4, N5, O6N-34P, OXN-72P, OXN-85P, OXN-100P, P, Ph-I, PL163 / 10, Q, S, T, 92, 1-9, 37, 51, 57, 70A-8, 72A-4, 72A-10, 110A-4, 333, 4996, I (synonym = Group I), III (synonym = Group III), VI, (synonym = A-Saratov), ​​VII, IX, X, HN-Vibrio (6), pAl, 7, 7-8, 70A-2, 71A-6, 72A-5, 72A-8, 108A-10, 109A-6, 109A-8, l lOA-1, 110A-5, 110A-7, hv-1, OXN-52P, P13, P38, P53, P65, P108, Pill, TP13 VP3, VP6, VP12, VP13, 70A-3, 70A-4, 70A-10, 72A-1, 108A-3, 109-B1, 110A-2, 149, (Synonyms = l49), IV, (synonym = Group IV), NN-Vibrio (22), VP5, VP11, VP15, VP16, α1, α2, α3a, α3b, 353B and HN-Vibrio (7).

[0083] Bacteria of the genus Yersinia are infected with the following phages: H, HI, H-2, H-3, H-4, Lucas110, Lucas 303, Lucas 404, YerA3, YerA7, YerA20, YerA41, 3 / M64-76, 5 / G394-76, 6 / C753-76, 8 / C239-76, 9 / F18167, 1701, 1710, PST, 1 / F2852-76, D'Herelle, EV, H, Kotljarova, PTB, R, Y, YerA41, YerO3-12, 3, 4 / C1324-76, 7 / F783-76, 903, 1 / M6176 and Yer2AT.

[0084] More preferably, the bacteriophage is selected from the group consisting of Salmonella virus SKML39, Shigella virus AG3, Dickeya virus Limestone, Dickeya virus RC2014, Escherichia virus CBA120, Escherichia virus PhaxI, Salmonella virus 38, Salmonella virus Det7, Salmonella virus GG32, Salmonella virus PM10, Salmonella virus SFP10, Salmonella virus SH19, Salmonella virus SJ3, Escherichia virus ECML4, Salmonella virus Marshall, Salmonella virus Maynard, Salmonella virus SJ2, Salmonella virus ST ML131, Salmonella virus ViI, Erwinia virus Ea2809, Klebsiella virus 0507KN21, Serratia virus IME250, Serratia virus MAM1, Campylobacter virus CP21, Campylobacter virus CP220, Campylobacter virus CPt10, Campylobacter virus IBB35, Campylobacter virus CP81, Campylobacter virus CP30A, Campylobacter virus CPX, Campylobacter virus NCTC12673, Erwinia virus Ea214, Erwinia virus M7, Escherichia virus AYO145A, Escherichia virus EC6, Escherichia virus HY02, Escherichia virus Escherichia virus JH2, Escherichia virus TP1, Escherichia virus VpaE1, Escherichia virus wV8, Salmonella virus FelixO1, Salmonella virus HB2014, Salmonella virus Mushroom, Salmonella virus UAB87, Citrobacter virus Moogle, Citrobacter virus Mordin, Escherichia virus SUSP1, Escherichia virus SUSP2, Aeromonas virus phiO18P, Haemophilus virus HP1, Haemophilus virus HP2, Pasteurella virus F108, Vibrio virus K139, Vibrio virus κ , Burkholderia virus phi52237, Burkholderia virus phiE122, Burkholderia virus phiE202, Escherichia virus 186, Escherichia virus P4, Escherichia virus P2, Escherichia virus Wphi, Mannheimia virus PHL101, Pseudomonas virus phiCTX, Ralstonia virus RSA1, Salmonella virus Fels2, Salmonella virus PsP3, Salmonella virus SopEphi, Yersinia virus L413C, Staphylococcus virus G1, Staphylococcus virus G15, Staphylococcus virus JD7,Staphylococcus virus K, Staphylococcus virus MCE2014, Staphylococcus virus P108, Staphylococcus virus Rodi, Staphylococcus virus S253, Staphylococcus virus S25-4, Staphylococcus virus SA12, Listeria virus A511, Listeria virus P100, Staphylococcus virus Remus, Staphylococcus virus SA11, Staphylococcus virus Stau2, Bacillus virus Camphawk, Bacillus virus SPO1, Bacillus virus BCP78, Bacillus virus TsarBomba, Staphylococcus virus Twort, Enterococcus virus phiEC24C, Lactobacillus (Lactobacillus s) virus Lb338-1, Lactobacillus virus LP65, Enterobacter virus PG7, Escherichia virus CC31, Klebsiella virus JD18, Klebsiella virus PKO111, Escherichia virus Bp7, Escherichia virus IME08, Escherichia virus JS10, Escherichia virus JS98, Escherichia virus QL01, Escherichia virus VR5, Enterobacter virus Eap3, Klebsiella virus KP15, Klebsiella virus KP27, Klebsiella virus Matisse, Klebsiella virus Miro, Citrobacter virus Merlin, Citrobacter virus Moo n, Escherichia virus JSE, Escherichia virus phi1, Escherichia virus RB49, Escherichia virus HX01, Escherichia virus JS09, Escherichia virus RB69, Shigella virus UTAM, Salmonella virus S16, Salmonella virus STML198, Vibrio virus KVP40, Vibrio virus nt1, Vibrio virus ValKK3, Escherichia virus VR7, Escherichia virus VR20, Escherichia virus VR25, Escherichia virus VR26, Shigella virus SP18, Escherichia virus AR1, Escherichia virus C40, Escherichia virus E112, Escherichia virus ECML134 , Escherichia virus HY01, Escherichia virus Ime09, Escherichia virus RB3, Escherichia virus RB14, Escherichia virus T4, Shigella virus Pss1, Shigella virus Shfl2, Yersinia virus D1, Yersinia virus PST, Acinetobacter virus 133, Aeromonas virus 65, Aeromonas virus Aeh1, Escherichia virus RB16, Escherichia virus RB32, Escherichia virus RB43, Pseudomonas virus 42, Cronobacter virus CR3, Cronobacter virus CR8, Cronobacter virus CR9,Cronobacter virus PBES02, Pectobacterium virus phiTE, Cronobacter virus GAP31, Escherichia virus 4MG, Salmonella virus SE1, Salmonella virus SSE121, Escherichia virus FFH2, Escherichia virus FV3, Escherichia virus JES2013, Escherichia virus V5, Brevibacillus virus Abouo, Brevibacillus virus Davies, Bacillus virus Agate, Bacillus virus Bobb, Bacillus virus Bp8pC, Erwinia virus Deimos, Erwinia virus Ea 35-70, Erwinia virus RAY, Erwinia virus Simmy50, Erwinia virus SpecialG, Acinetobacter virus AB1, Acinetobacter virus AB2, Acinetobacter virus AbC62, Acinetobacter virus AP22, Arthrobacter virus ArV1, Arthrobacter virus Trina, Bacillus virus AvesoBmore, Bacillus virus B4, Bacillus virus Bigbertha, Bacillus virus Riley, Bacillus virus Spock, Bacillus virus Troll, Bacillus virus Bastille, Bacillus virus CAM003, Spore Bacillus virus Bc431, Bacillus virus Bcp1, Bacillus virus BCP82, Bacillus virus BM15, Bacillus virus Deepblue, Bacillus virus JBP901, Burkholderia virus Bcep1, Burkholderia virus Bcep43, Burkholderia virus Bcep781, Burkholderia virus BcepNY3, Xanthomonas virus OP2, Burkholderia virus BcepMu, Burkholderia virus phiE255, Aeromonas virus 44RR2, Mycobacterium virus Alice, Mycobacterium virus Bxz1, Mycobacterium Genus virus Dandelion, Mycobacterium virus HyRo, Mycobacterium virus I3, Mycobacterium virus Nappy, Mycobacterium virus Sebata, Clostridium virus phiC2, Clostridium virus phiCD27, Clostridium virus phiCD119, Bacillus virus CP51, Bacillus virus JL, Bacillus virus Shanette, Escherichia virus CVM10, Escherichia virus ep3, Erwinia virus Asesino, Erwinia virus EaH2, Pseudomonas virus EL, Halomonas virus HAP1, Vibrio virus VP882, Brevibacillus virus Jimmer,Brevibacillus virus Osiris, Pseudomonas virus Ab03, Pseudomonas virus KPP10, Pseudomonas virus PAKP3, Sinorhizobium virus M7, Sinorhizobium virus M12, Sinorhizobium virus N3, Erwinia virus Machina, Arthrobacter virus Brent, Arthrobacter virus Jawnski, Arthrobacter virus Martha, Arthrobacter virus Sonny, Edwardsiella virus MSW3, Edwardsiella virus PEi21, Escherichia virus Mu, Shigella virus SfMu, Halobacterium Virus phiH, Bacillus virus Grass, Bacillus virus NIT1, Bacillus virus SPG24, Aeromonas virus 43, Escherichia virus P1, Pseudomonas virus CAb1, Pseudomonas virus CAb02, Pseudomonas virus JG004, Pseudomonas virus PAKP1, Pseudomonas virus PAKP4, Pseudomonas virus PaP1, Burkholderia virus BcepF1, Pseudomonas virus 141, Pseudomonas virus Ab28, Pseudomonas virus DL60, Pseudomonas virus DL68, Pseudomonas virus F8, Pseudomonas virus JG024, Pseudomonas virus KPP12, Pseudomonas virus LB L3, Pseudomonas virus LMA2, Pseudomonas virus PB1, Pseudomonas virus SN, Pseudomonas virus PA7, Pseudomonas virus phiKZ, Rhizobium virus RHEph4, Ralstonia virus RSF1, Ralstonia virus RSL2, Ralstonia virus RSL1, Aeromonas virus 25, Aeromonas virus 31, Aeromonas virus Aes12, Aeromonas virus Aes508, Aeromonas virus AS4, Stenotrophomonas virus IME13, Staphylococcus virus IPLAC1C, Staphylococcus virus SEP1, Salmonella virus SPN3US, Bacillus virus 1, Geobacillus virus GBSV1, Yersinia virus R1RT, Yersinia virus TG1, Bacillus virus G, Bacillus virus PBS1, Microcystis virus Ma-LMM01, Vibrio virus MAR, Vibrio virus VHML, Vibrio virus VP585, Bacillus virus BPS13, Bacillus virus Hakuna, Bacillus virus Megatron, Bacillus virus WPh, Acinetobacter virus AB3, Acinetobacter virus Abp1, Acinetobacter virus Fri1, Acinetobacter virus IME200,Acinetobacter virus PD6A3, Acinetobacter virus PDAB9, Acinetobacter virus phiAB1, Escherichia virus K30, Klebsiella virus K5, Klebsiella virus K11, Klebsiella virus Kp1, Klebsiella virus KP32, Klebsiella virus KpV289, Klebsiella virus F19, Klebsiella virus K244, Klebsiella virus Kp2, Klebsiella virus KP34, Klebsiella virus Kp V41, Klebsiella virus KpV71, Klebsiella virus KpV475, Klebsiella virus SU503, Klebsiella virus SU552A, Pantoea virus Limelight, Pantoea virus Limezero, Pseudomonas virus LKA1, Pseudomonas virus phiKMV, Xanthomonas virus f20, Xanthomonas virus f30, Xylella virus Prado, Erwinia disease Escherichia virus Era103, Escherichia virus K5, Escherichia virus K1-5, Escherichia virus K1E, Salmonella virus SP6, Escherichia virus T7, Kluyvera virus Kvp1, Pseudomonas virus gh1, Prochlorococcus virus PSSP7, Synechococcus virus P60, Synechococcus virus Syn5, Streptococcus virus Cp1, Streptococcus virus Bacillus virus Cp7, Staphylococcus virus 44AHJD, Streptococcus virus C1, Bacillus virus B103, Bacillus virus GA1, Bacillus virus phi29, Kurthia virus 6, Actinomyces virus Av1, Mycoplasma virus P1, Escherichia virus 24B, Escherichia virus 933W, Escherichia virus Min27, Escherichia virus PA28, Escherichia virus Stx2 II, Shigella virus 7502Stx, Shigella virus POCJ13, Escherichia virus 191, Escherichia virus PA2, Escherichia virus TL2011, Shigella virus VASD, Burkholderia virus Bcep22, Burkholderia virus Bcepil02, Burkholderia virus Bcepmigl, Burkholderia virus DC1, Bordetella virus BPP1, Burkholderia virus BcepC6B, Cellulophaga virus Cba41, Cellulophaga virus Cba172, Dinoroseobacter virus DFL12, Erwinia virus Ea9-2, Erwinia virus Frozen, Escherichia virus phiV10,Salmonella virus Epsilon15, Salmonella virus SPN1S, Pseudomonas virus F116, Pseudomonas virus H66, Escherichia virus APEC5, Escherichia virus APEC7, Escherichia virus Bp4, Escherichia virus EC1UPM, Escherichia virus ECBP1, Escherichia virus G7C, Escherichia virus IME11, Shigella virus Sb1, Achromobacter (Achromobacter bacter) virus Axp3, Achromobacter virus JWAlpha, Edwardsiella virus KF1, Pseudomonas virus KPP25, Pseudomonas virus R18, Pseudomonas virus Ab09, Pseudomonas virus LIT1, Pseudomonas virus PA26, Pseudomonas virus Ab22, Pseudomonas virus CHU, Pseudomonas virus LUZ24, Pseudomonas virus PAA2, Pseudomonas virus PaP3, Pseudomonas Pseudomonas virus PaP4, Pseudomonas virus TL, Pseudomonas virus KPP21, Pseudomonas virus LUZ7, Escherichia virus N4, Salmonella virus 9NA, Salmonella virus SP069, Salmonella virus BTP1, Salmonella virus HK620, Salmonella virus P22, Salmonella virus ST64T, Shigella virus Sf6, Bacillus virus Page, Bacillus virus Palmer, Spore Bacillus virus Pascal, Bacillus virus Pony, Bacillus virus Pookie, Escherichia virus 172-1, Escherichia virus ECB2, Escherichia virus NJ01, Escherichia virus phiEco32, Escherichia virus Septima11, Escherichia virus SU10, Brucella virus Pr, Brucella virus Tb, Escherichia virus Pollock, Salmonella virus FSL SP-058, Salmonella virus FSL SP-076, Helicobacter virus 1961P, Helicobacter virus KHP30, Helicobacter virus KHP40, Hamiltonella virus APSE1, Lactococcus virus KSY1, Phormidium virus WMP3, Phormidium virus WMP4, Pseudomonas virus 119X, Roseobacter virus SIO1, Vibrio virus VpV262, Vibrio virus VC8, Vibrio virus VP2, Vibrio virus VP5, Streptomyces virus Amela, Streptomyces virus phiCAM, Streptomyces virus Aaronocolus, Streptomyces virus Caliburn, Streptomyces virus Danzina, Streptomyces virus Hydra, Streptomyces virus Izzy, Streptomyces virus Lannister,Streptomyces virus Lika, Streptomyces virus Sujidade, Streptomyces virus Zemlya, Streptomyces virus ELB20, Streptomyces virus R4, Streptomyces virus phiHau3, Mycobacterium virus Acadian, Mycobacterium virus Baee, Mycobacterium virus Reprobate, Mycobacterium virus Adawi, Mycobacterium virus Bane1, Mycobacterium virus BrownCNA, Mycobacterium virus Chrisnmich, Mycobacterium virus Cooper, Mycobacterium virus JAMal, Mycobacterium virus Nigel, Mycobacterium virus Stinger, Mycobacterium virus Vincen zo, Mycobacterium virus Zemanar, Mycobacterium virus Apizium, Mycobacterium virus Manad, Mycobacterium virus Oline, Mycobacterium virus Osmaximus, Mycobacterium virus Pg1, Mycobacterium virus Soto, Mycobacterium virus Suffolk, Mycobacterium virus Athena, Mycobacterium virus Bernardo, Mycobacterium virus Gadjet, Mycobacterium virus Pipefish, Mycobacterium virus Godines, Mycobacterium virus Rosebush, Mycobacterium virus Babsiella, Mycobacterium virus Brujita, Mycobacterium virus Che 9c, Mycobacterium virus Sbash, Mycobacterium virus Hawkeye, Mycobacterium virus Plot, Salmonella virus AG11, Salmonella virus Ent1, Salmonella virus f18SE, Salmonella virus Jersey, Salmonella virus L13, Salmonella virus LSPA1, Salmonella virus SE2, Salmonella virus SETP3, Salmonella virus SETP7, Salmonella virus SETP13, Salmonella virus SP101, Salmonella virus SS3e, Salmonella virus wksl3, Escherichia virus K1G, Escherichia virus K1H, Escherichia virus K1ind1, Escherichia Genus virus K1ind2, Salmonella virus SP31, Leuconostoc virus Lmd1, Leuconostoc virus LN03, Leuconostoc virus LN04, Leuconostoc virus LN12, Leuconostoc virus LN6B, Leuconostoc virus P793, Leuconostoc virus 1A4, Leuconostoc virus Ln8, Leuconostoc virus Ln9, Leuconostoc virus LN25, Leuconostoc virus LN34, Leuconostoc virus LNTR3, Mycobacterium virus Bongo, Mycobacterium virus Rey, Mycobacterium virus Butters, Mycobacterium virus Michelle, Mycobacterium virus Charlie,Mycobacterium virus Pipsqueaks, Mycobacterium virus Xeno, Mycobacterium virus Panchino, Mycobacterium virus Phrann, Mycobacterium virus Redi, Mycobacterium virus Skinnyp, Gordonia virus BaxterFox, Gordonia virus Yeezy, Gordonia virus Kita, Gordonia virus Zirinka, Gordonia virus Nymphadora, Mycobacterium virus Bignuz, Mycobacterium virus Brusacoram, Mycobacterium virus Donovan, Mycobacterium virus Fishburne, Mycobacterium virus Jebek s, Mycobacterium virus Malithi, Mycobacterium virus Phayonce, Enterobacter virus F20, Klebsiella virus 1513, Klebsiella virus KLPN1, Klebsiella virus KP36, Klebsiella virus PKP126, Klebsiella virus Sushi, Escherichia virus AHP42, Escherichia virus AHS24, Escherichia virus AKS96, Escherichia virus C119, Escherichia virus E41c, Escherichia virus Eb49, Escherichia virus Jk06, Escherichia virus KP26, Escherichia virus Rogue1, Escherichia virus ACGM12, Escherichia virus Rtp 、Escherichia virus ADB2、Escherichia virus JMPW1、Escherichia virus JMPW2、Escherichia virus T1、Shigella virus PSf2、Shigella virus Shfl1、Citrobacter virus Stevie、Escherichia virus TLS、Salmonella virus SP126、Cronobacter virus Esp2949-1、Pseudomonas virus Ab18、Pseudomonas virus Ab19、Pseudomonas virus PaMx11、Arthrobacter virus Amigo、Propionibacterium virus Anatole、Propionibacterium virus B3、Bacillus virus Andromeda、Bacillus disease Blastoid, Bacillus virus Curly, Bacillus virus Eoghan, Bacillus virus Finn, Bacillus virus Glittering, Bacillus virus Riggi, Bacillus virus Taylor, Gordonia virus Attis, Mycobacterium virus Barnyard, Mycobacterium virus Konstantine, Mycobacterium virus Predator, Mycobacterium virus Bernal13, Staphylococcus virus 13, Staphylococcus virus 77, Staphylococcus virus 108PVL, Mycobacterium virus Bron, Mycobacterium virus Faith1, Mycobacterium virus Joedirt,Mycobacterium virus Rumpelstiltskin, Lactococcus virus bIL67, Lactococcus virus c2, Lactobacillus virus c5, Lactobacillus virus Ld3, Lactobacillus virus Ld17, Lactobacillus virus Ld25A, Lactobacillus virus LLKu, Lactobacillus virus phiLdb, Cellulophagus virus Cba121, Cellulophagus virus Cba171, Cellulophagus virus Cba181, Cellulophagus virus ST, Bacillus virus 250, Bacillus virus IEBH, Mycobacterium virus Ardmore, Mycobacterium virus Avani, Mycobacterium virus Boomer, Mycobacterium virus Che8, Mycobacterium Virus Che9d, Mycobacterium virus Deadp, Mycobacterium virus Dlane, Mycobacterium virus Dorothy, Mycobacterium virus Dotproduct, Mycobacterium virus Drago, Mycobacterium virus Fruitloop, Mycobacterium virus Gumbie, Mycobacterium virus Ibhubesi, Mycobacterium virus Llij, Mycobacterium virus Mozy, Mycobacterium virus Mutaforma13, Mycobacterium virus Pacc40, Mycobacterium virus PMC, Mycobacterium virus Ramsey, Mycobacterium virus Rockyhorror, Mycobacterium virus SG4, Mycobacterium virus Sha una1, Mycobacterium virus Shilan, Mycobacterium virus Spartacus, Mycobacterium virus Taj, Mycobacterium virus Tweety, Mycobacterium virus Wee, Mycobacterium virus Yoshi, Salmonella virus Chi, Salmonella virus FSLSP030, Salmonella virus FSLSP088, Salmonella virus iEPS5, Salmonella virus SPN19, Mycobacterium virus 244, Mycobacterium virus Bask21, Mycobacterium virus CJW1, Mycobacterium virus Eureka, Mycobacterium virus Kostya, Mycobacterium virus Porky, Mycobacterium virus Pumpkin, Mycobacterium virus Sirduracell, Mycobacterium virus Toto, Mycobacterium virus Corndog, Mycobacterium virus Firecracker, Rhodobacter virus RcCronus, Pseudomonas virus D3112, Pseudomonas virus DMS3, Pseudomonas virus FHA0480, Pseudomonas virus LPB1, Pseudomonas virus MP22, Pseudomonas virus MP29, Pseudomonas virus MP38, Pseudomonas virus PA1KOR, Pseudomonas virus D3, Pseudomonas virus PMG1, Arthrobacter virus Decurro, Gordonia virus Demosthenes,Gordonia virus Katyusha, Gordonia virus Kvothe, Propionibacterium virus B22, Propionibacterium virus Doucette, Propionibacterium virus E6, Propionibacterium virus G4, Burkholderia virus phi6442, Burkholderia virus phi1026b, Burkholderia virus phiE125, Edwardsiella virus eiAU, Mycobacterium virus Ff47, Mycobacterium virus Muddy, Mycobacterium virus Gaia, Mycobacterium virus Giles, Arthrobacter virus Captnmurica, Arthrobacter virus Gordon, Gordonia virus GordTnk2, Paenibacillus ( Paenibacillus) virus Harrison, Escherichia virus EK99P1, Escherichia virus HK578, Escherichia virus JL1, Escherichia virus SSL2009a, Escherichia virus YD2008s, Shigella virus EP23, Sodalis virus SO1, Escherichia virus HK022, Escherichia virus HK75, Escherichia virus HK97, Escherichia virus HK106, Escherichia virus HK446, Escherichia virus HK542, Escherichia virus HK544, Escherichia virus HK633, Escherichia virus mEp234, Escherichia virus mEp 235, Escherichia virus mEpX1, Escherichia virus mEpX2, Escherichia virus mEp043, Escherichia virus mEp213, Escherichia virus mEp237, Escherichia virus mEp390, Escherichia virus mEp460, Escherichia virus mEp505, Escherichia virus mEp506, Brevibacillus virus Jenst, Achromobacter virus 83-24, Achromobacter virus JWX, Arthrobacter virus Kellezzio, Arthrobacter virus Kitkat, Arthrobacter virus Bennie, Arthrobacter virus DrRobert, Arthrobacter virus Glenn, Arthrobacter virus HunterDa lle, Arthrobacter virus Joann, Arthrobacter virus Korra, Arthrobacter virus Preamble, Arthrobacter virus Pumancara, Arthrobacter virus Wayne, Mycobacter virus Alma, Mycobacter virus Arturo, Mycobacter virus Astro, Mycobacter virus Backyardigan, Mycobacter virus BBPiebs31, Mycobacter virus Benedict, Mycobacter virus Bethlehem, Mycobacter virus Billknuckles, Mycobacter virus Bruns, Mycobacter virus Bxb1, Mycobacter virus Bxz2, Mycobacter virus Che12,Mycobacterium virus Cuco, Mycobacterium virus D29, Mycobacterium virus Doom, Mycobacterium virus Ericb, Mycobacterium virus Euphoria, Mycobacterium virus George, Mycobacterium virus Gladiator, Mycobacterium virus Goose, Mycobacterium virus Hammer, Mycobacterium virus Heldan, Mycobacterium virus Jasper, Mycobacterium virus JC27, Mycobacterium virus Jeffabunny, Mycobacterium virus JHC117, Mycobacterium virus KBG, Mycobacterium virus Kssjeb, Mycobacterium virus Kugel, Mycobacterium virus L5, Mycobacterium virus Mycobacterium virus Lesedi, Mycobacterium virus LHTSCC, Mycobacterium virus lockley, Mycobacterium virus Marcell, Mycobacterium virus Microwolf, Mycobacterium virus Mrgordo, Mycobacterium virus Museum, Mycobacterium virus Nepal, Mycobacterium virus Packman, Mycobacterium virus Peaches, Mycobacterium virus Perseus, Mycobacterium virus Pukovnik, Mycobacterium virus Rebeuca, Mycobacterium virus Redrock, Mycobacterium virus Ridgecb, Mycobacterium virus Rockstar, Mycobacterium virus Saintu s, Mycobacterium virus Skipole, Mycobacterium virus Solon, Mycobacterium virus Switzer, Mycobacterium virus SWU1, Mycobacterium virus Ta17a, Mycobacterium virus Tiger, Mycobacterium virus Timshel, Mycobacterium virus Trixie, Mycobacterium virus Turbido, Mycobacterium virus Twister, Mycobacterium virus U2, Mycobacterium virus Violet, Mycobacterium virus Wonder, Escherichia virus DE3, Escherichia virus HK629, Escherichia virus HK630, Escherichia virus λ, Arthrobacter virus Laroye, Mycobacterium virus H alo, Mycobacterium virus Liefie, Mycobacterium virus Marvin, Mycobacterium virus Mosmoris, Arthrobacter virus Circum, Arthrobacter virus Mudcat, Escherichia virus N15, Escherichia virus 9g, Escherichia virus JenK1, Escherichia virus JenP1, Escherichia virus JenP2, Pseudomonas virus NP1, Pseudomonas virus PaMx25, Mycobacterium virus Baka, Mycobacterium virus Courthouse, Mycobacterium virus Littlee, Mycobacterium virus Omega, Mycobacterium virus Optimus, Mycobacterium virus Thibault,Polaribacter virus P12002L, Polaribacter virus P12002S, Nonlabens virus P12024L, Nonlabens virus P12024S, Thermus virus P23-45, Thermus virus P74-26, Listeria virus LP26, Listeria virus LP37, Listeria virus LP110, Listeria virus LP114, Listeria virus P70, Propionibacterium virus ATCC29399BC, Propionibacterium virus ATCC29399BT, Propionibacterium virus Attacne, Propionibacterium virus Keiki, Propionibacterium virus Propionibacterium virus Kubed, Propionibacterium virus Lauchelly, Propionibacterium virus MrAK, Propionibacterium virus Ouroboros, Propionibacterium virus P91, Propionibacterium virus P105, Propionibacterium virus P144, Propionibacterium virus P1001, Propionibacterium virus P1.1, Propionibacterium virus P100A, Propionibacterium virus P100D, Propionibacterium virus P101A, Propionibacterium virus P104A, Propionibacterium virus PA6, Propionibacterium virus Pacnes201215, Propionibacterium virus PAD20, Propionibacterium virus PAS50, Propionibacterium virus PHL009M11, Propionibacterium virus PHL025M00, Propionibacterium virus PHL037M02, Propionibacterium virus PHL041M10, Propionibacterium virus PHL060L00, Propionibacterium virus PHL067M01, Propionibacterium virus PHL070N00, Propionibacterium virus PHL071N05, Propionibacterium virus PHL082M03, Propionibacterium virus PHL092M00, Propionibacterium virus PHL095N00, Propionibacterium virus PHL111M01, Propionibacterium virus PHL112N00, Propionibacterium virus PHL113M01, Propionibacterium virus PHL114L00, Propionibacterium virus PHL116M00, Propionibacterium virus Bacillus virus PHL117M00, Propionibacterium virus PHL117M01, Propionibacterium virus PHL132N00, Propionibacterium virus PHL141N00, Propionibacterium virus PHL151M00, Propionibacterium virus PHL151N00, Propionibacterium virus PHL152M00, Propionibacterium virus PHL163M00, Propionibacterium virus PHL171M01, Propionibacterium virus PHL179M00, Propionibacterium virus PHL194M00, Propionibacterium virus PHL199M00, Propionibacterium virus PHL301M00, Propionibacterium virus PHL308M00, Propionibacterium virus Pirate,Propionibacterium virus Procrass1, Propionibacterium virus SKKY, Propionibacterium virus Solid, Propionibacterium virus Stormborn, Propionibacterium virus Wizzo, Pseudomonas virus PaMx28, Pseudomonas virus PaMx74, Mycobacterium virus Patience, Mycobacterium virus PBI1, Rhodococcus virus Pepy6, Rhodococcus virus Poco6, Propionibacterium virus PFR1, Streptomyces virus phiBT1, Streptomyces virus phiC31, Streptomyces virus TG1, Caulobacter virus Karma, Caulobacter virus Mag neto, Bacillus virus phiCbK, Bacillus virus Rogue, Bacillus virus Swift, Staphylococcus virus 11, Staphylococcus virus 29, Staphylococcus virus 37, Staphylococcus virus 53, Staphylococcus virus 55, Staphylococcus virus 69, Staphylococcus virus 71, Staphylococcus virus 80, Staphylococcus virus 85, Staphylococcus virus 88, Staphylococcus virus 92, Staphylococcus virus 96, Staphylococcus virus 187, Staphylococcus virus 52a, Staphylococcus virus 80alpha, Staphylococcus virus CNPH82, Staphylococcus virus EW, Staphylococcus virus IPLA5, Staphylococcus virus IPLA7 , Staphylococcus virus IPLA88, Staphylococcus virus PH15, Staphylococcus virus phiETA, Staphylococcus virus phiETA2, Staphylococcus virus phiETA3, Staphylococcus virus phiMR11, Staphylococcus virus phiMR25, Staphylococcus virus phiNM1, Staphylococcus virus phiNM2, Staphylococcus virus phiNM4, Staphylococcus virus SAP26, Staphylococcus virus X2, Enterococcus virus FL1, Enterococcus virus FL2, Enterococcus virus FL3, Lactobacillus virus ATCC8014, Lactobacillus virus phiJL1, Pediococcus virus cIP1 , Aeromonas virus pIS4A, Listeria virus LP302, Listeria virus PSA, Methanobacterium virus psiM1, Roseobacter virus RDJL1, Roseobacter virus RDJL2, Rhodococcus virus RER2, Enterococcus virus BC611, Enterococcus virus IMEEF1, Enterococcus virus SAP6, Enterococcus virus VD13, Streptococcus virus SPQS1, Mycobacterium virus Papyrus, Mycobacterium virus Send513, Burkholderia virus KL1, Pseudomonas virus 73, Pseudomonas virus Ab26, Pseudomonas virus Kakheti25,Escherichia virus Cajan, Escherichia virus Seurat, Staphylococcus virus SEP9, Staphylococcus virus Sextaec, Streptococcus virus 858, Streptococcus virus 2972, Streptococcus virus ALQ132, Streptococcus virus O1205, Streptococcus virus Sfi11, Streptococcus virus 7201, Streptococcus virus DT1, Streptococcus virus phiAbc2, Streptococcus virus Sfi19, Streptococcus virus Sfi21, Paenibacillus virus Diva, Paenibacillus virus Hb10c2, Paenibacillus virus Rani, Paenibacillus virus Shelly, Paenibacillus virus Sitara, Paenibacillus Virus Willow, Lactococcus virus 712, Lactococcus virus ASCC191, Lactococcus virus ASCC273, Lactococcus virus ASCC281, Lactococcus virus ASCC465, Lactococcus virus ASCC532, Lactococcus virus Bibb29, Lactococcus virus bIL170, Lactococcus virus CB13, Lactococcus virus CB14, Lactococcus virus CB19, Lactococcus virus CB20, Lactococcus virus jj50, Lactococcus virus P2, Lactococcus virus P008, Lactococcus virus sk1, Lactococcus virus Sl4, Bacillus virus Slash, Bacillus virus Stahl, Bacillus virus Staley , Bacillus virus Stills, Gordonia virus Bachita, Gordonia virus ClubL, Gordonia virus OneUp, Gordonia virus Smoothie, Gordonia virus Soups, Bacillus virus SPbeta, Vibrio virus MAR10, Vibrio virus SSP002, Escherichia virus AKFV33, Escherichia virus BF23, Escherichia virus DT57C, Escherichia virus EPS7, Escherichia virus FFH1, Escherichia virus H8, Escherichia virus slur09, Escherichia virus T5, Salmonella virus 118970sal2, Salmonella virus Shiv ani, Salmonella virus SPC35, Salmonella virus Stitch, Arthrobacter virus Tank, Tsukamurella virus TIN2, Tsukamurella virus TIN3, Tsukamurella virus TIN4, RcSpartan, RcTitan, Mycobacterium virus Anaya, Mycobacterium virus Angelica, Mycobacterium virus Crimd, Mycobacterium virus Fionnbarth, Mycobacterium virus Jaws, Mycobacterium virus Larva, Mycobacterium virus Macncheese, Mycobacterium virus Pixie, Mycobacterium virus TM4,Bacillus virus BMBtp2, Bacillus virus TP21, Geobacillus virus Tp84, Staphylococcus virus 47, Staphylococcus virus 3a, Staphylococcus virus 42e, Staphylococcus virus IPLA35, Staphylococcus virus phi12, Staphylococcus virus phiSLT, Mycobacterium virus 32HC, Rhodococcus virus RGL3, Paenibacillus virus Vegas, Gordonia virus Vendetta, Bacillus virus Wbeta, Mycobacterium virus Wildcat, Gordonia virus Twister6, Gordonia virus Wizard, Gordonia virus Hotorobo, Gordonia virus Mon ty, Gordonia virus Woes, Xanthomonas virus CP1, Xanthomonas virus OP1, Xanthomonas virus phil7, Xanthomonas virus Xop411, Xanthomonas virus Xp10, Streptomyces virus TP1604, Streptomyces virus YDN12, Alphaproteobacteria virus phiJl001, Pseudomonas virus LKO4, Pseudomonas virus M6, Pseudomonas virus MP1412, Pseudomonas virus PAE1, Pseudomonas virus Yua, Pseudoalteromonas virus PM2, Pseudomonas virus phi6, Pseudomonas virus phi8, Pseudomonas virus phi12, Pseudomonas virus phi13, Pseudomonas virus phi2954, Pseudomonas virus phiNN, Pseudomonas virus phiYY, Vibrio virus fs1, Vibrio virus VGJ, Ralstonia virus RS603, Ralstonia virus RSM1, Ralstonia virus RSM3, Escherichia virus M13, Escherichia virus I22, Salmonella virus IKe, Acholeplasma virus L51, Vibrio virus fs2, Vibrio virus VFJ, Escherichia virus If1, Propionibacterium virus B5, Pseudomonas virus Pf1, Pseudomonas disease Virus Pf3, Ralstonia virus PE226, Ralstonia virus RSS1, Spiroplasma virus SVTS2, Stenotrophomonas virus PSH1, Stenotrophomonas virus SMA6, Stenotrophomonas virus SMA7, Stenotrophomonas virus SMA9, Vibrio virus CTXphi, Vibrio virus KSF1, Vibrio virus VCY, Vibrio virus Vf33, Vibrio virus VfO3K6, Xanthomonas virus Cf1c, Spiroplasma virus C74, Spiroplasma virus R8A2B, Spiroplasma virus SkV1CR23x, Escherichia virus FI, Escherichia virus Qbeta, Escherichia virus BZ13,Escherichia virus MS2, Escherichia virus alpha3, Escherichia virus ID21, Escherichia virus ID32, Escherichia virus ID62, Escherichia virus NC28, Escherichia virus NC29, Escherichia virus NC35, Escherichia virus phiK, Escherichia virus St1, Escherichia virus WA45, Escherichia virus G4, Escherichia virus ID52, Escherichia virus Talmos, Escherichia virus phiX174, Bdellovibrio virus MAC 1. Bdellovibrio virus MH2K, Chlamydia virus Chp1, Chlamydia virus Chp2, Chlamydia virus CPAR39, Chlamydia virus CPG1, Spiroplasma virus SpV4, Acholeraplasma virus L2, Pseudomonas virus PR4, Pseudomonas virus PRD1, Bacillus virus AP50, Bacillus virus Bam35, Bacillus virus GIL16, Bacillus virus Wip1, Escherichia virus phi80, Escherichia virus RB42, Escherichia virus T2, Escherichia Escherichia virus T3, Escherichia virus T6, Escherichia virus VT2-Sa, Escherichia virus VT1-Sakai, Escherichia virus VT2-Sakai, Escherichia virus CP-933V, Escherichia virus P27, Escherichia virus Stx2phi-I, Escherichia virus Stx1phi, Escherichia virus Stx2phi-II, Escherichia virus CP-1639, based on Escherichia virus BP-4795, Escherichia virus 86, Escherichia virus Mi n27, Escherichia virus 2851, Escherichia virus 1717, Escherichia virus YYZ-2008, Escherichia virus EC026_P06, Escherichia virus ECO103_P15, Escherichia virus ECO103_P12, Escherichia virus ECO111_P16, Escherichia virus ECO111_P11, Escherichia virus VT2phi_272, Escherichia virus TL-2011c, Escherichia virus P13374, Escherichia virus Sp5.

[0085] In one embodiment, the bacteriophage-derived particle targets E. coli and comprises a capsid of a bacteriophage selected from the group consisting of: BW73, B278, D6, D108, E, E1, E24, E41, FI-2, FI-4, FI-5, HI8A, Ffl8B, i, MM, Mu, 025, PhI-5, Pk, PSP3, Pl, PlD, P2, P4, Sl, W , K13, 1. 2. 7、 92, 7 A, 8 , 9 , 18, 28-1, 186, 299, ΗH-Escherichia (2), AB48, CM, C4, C16, DD-VI, E4, E7, E28, FIl, FI3, H, Hl, H3, H8, K3, M, N, ND-2, ND-3, ND4, ND-5, ND6, ND-7, Ox-I, Ox-2, Ox-3, Ox-4, Ox-5, Ox-6, PhI-I, RB42, RB43, RB49, RB69, S, SaI-I, Sal-2, Sal-3, Sal-4, Sal-5, Sal-6, TC23, TC45, TuII*-6, TuIP-24, TuII*46, TuIP-60, T2, T4, T6, T35, αl, 1, IA, 3, 3A, 3T+, 5 , 9266Q, CFO103, HK620, J, K, KlF, m59, no. A, no. E, no. 3, no. 9, N4, sd, T3, T7, WPK, W31, ΔH, C3888, K3, K7, K12, V-1, Φ04-CF, Φ05, Φ06, Φ07, l, l.2, 20, 95, 263, lO92, l, ll, Ω8, 1, 3, 7, 8, 26, 27, 28-2, 29, 30, 31, 32, 38, 39, 42, 933W, NN-Escherichia (1), Esc-7-11, AC30, CVX-5, Cl, DDUP, ECl, EC2, E21, E29, Fl, F26S, F27S, Hi, HK022, HK97, HK139, HK253, HK256, K7, ND-I, PA-2, q, S2, Tl, ), T3C, T5, UC-I, w, β4, γ2, λ, ΦD326, γ, Φ06, Φ7, Φ10, 80, χ, 2, 4, 4A, 6, 8A, 102, 150, 168, 174, 3000, AC6, AC7, AC28, AC43, AC50, AC57, AC81, AC95, HK243, KlO, ZG / 3A, 5, 5A, 21EL, H19-J and 933H.

[0086] Copy Origin

[0087] Origins of replication known in the art have been derived from species-specific plasmid DNA (e.g., CoIE1, R1, pT181, pSC101, pMB1, R6K, RK2, p15a, etc.), from bacterial viruses (e.g., X174, M13, F1 and P4) and identified from bacterial chromosomal replication origins (e.g., oriC).

[0088] In one embodiment, the nucleic acid payload (preferably a plasmid) used in the present invention comprises a bacterial origin of replication that is functional in the targeted bacterium.

[0089] Alternatively, the nucleic acid payload (preferably a plasmid) used in the present invention does not contain any functional bacterial replication origin or contains a replication origin that is inactive in the targeted bacteria. Therefore, once the nucleic acid payload is introduced into the bacteria by the bacterial viral particle, it cannot replicate on its own.

[0090] In one embodiment, the origin of replication on the nucleic acid payload to be packaged (preferably a plasmid) is inactive in the targeted bacteria, meaning that the origin of replication is not functional in the bacteria targeted by the bacterial viral particle, thereby preventing unwanted payload replication.

[0091] In one embodiment, the nucleic acid payload, preferably a plasmid, comprises a bacterial origin of replication functional in bacteria for production of bacterial viral particles.

[0092] Bacteria-specific origin of replication

[0093] Plasmid replication depends on the cis and trans determinants of host enzymes and plasmid control. For example, the determinants that some plasmids have are all recognized in almost all Gram-negative bacteria, and all work correctly in every host during replication initiation and regulation. Other plasmids only have this ability in some bacteria (Kues, U and Stahl, U 1989 Microbiol Rev 53:491-516).

[0094] Plasmids replicate by three general mechanisms, theta-type, strand displacement, and rolling circle (reviewed by Del Solar et al. 1998 Microhio and Molec Biol. Rev 62:434-464), initiated from an origin of replication that contains sites required for interaction with plasmid and / or host encoded proteins.

[0095] The origin of replication used on the nucleic acid payload (preferably a plasmid) for use in the present invention can be of medium copy number, such as the ColE1 ori from pBR322 (15-20 copies per cell) or the R6K plasmid (15-20 copies per cell), or can be of high copy number, such as the pUC oris (500-700 copies per cell), the pGEM oris (300-400 copies per cell), the pTZ oris (>1000 copies per cell), or the pBluescript oris (300-500 copies per cell).

[0096] In one embodiment, the bacterial origin of replication is selected from ColE1, pMB1 and variants (pBR322, pET, pUC, etc.), p15a, ColA, ColE2, pOSAK, pSC101, R6K, IncW (pSa, etc.), IncFII, pT181, P1, F IncP, IncC, IncJ, IncN, IncP1, IncP4, IncQ, IncH11, RSF1010, CloDF13, NTP16, R1, f5, pPS10, pC194, pE194, BBR1, pBC1, pEP2, pWVO1, pLF1311, pAP1, pWKS1, pLS1, pLS11, pUB6060, pJD4, pIJ101, pSN22, pAMbe ta1, pIP501, pIP407, ZM6100(Sa), pCU1, RA3, pMOL98, RK2 / RP4 / RP1 / R68, pB10, R300B, pRO1614, pRO160 0, pECB2, pCM1, pFA3, RepFIA, RepFIB, RepFIC, pYVE439-80, R387, phasyl, RA1, TF-FC2, pMV158 and pUB113.

[0097] More preferably, the bacterial origin of replication is an Escherichia coli origin of replication selected from the following: ColE1, pMB1 and variants (pBR322, pET, pUC, etc.), p15a, ColA, ColE2, pOSAK, pSC101, R6K, IncW (pSa, etc.), IncFII, pT181, P1, F IncP, IncC, IncJ, IncN, IncP1, IncP4, IncQ, IncH11, RSF1010, CloDF13, NTP16, R1, f5, pPS10.

[0098] More preferably, the bacterial origin of replication is selected from the group consisting of pC194, pE194, BBR1, pBC1, pEP2, pWVO1, pLF1311, pAP1, pWKS1, pLS1, pLS11, pUB6060, pJD4, pIJ101, pSN22, pAMbeta1, pIP501, pIP407, ZM6100(Sa), pCU1, RA3, pMOL98, RK2 / RP4 / RP1 / R68, pB10, R300B, pRO1614, pRO1600, pECB2, pCM1, pFA3, RepFIA, RepFIB, RepFIC, pYVE439-80, R387, phasyl, RA1, TF-FC2, pMV158 and pUB113.

[0099] Even more preferably, the bacterial origins of replication are ColE1 and p15a.

[0100] In one embodiment, the bacterial origin of replication is functional in Propionibacterium and Cutibacterium, more specifically Propionibacterium freudenreichii and Cutibacterium acnes, and is selected from pLME108, pLME106, p545, pRGO1, pZGX01, pPG01, pYS1, FRJS12-3, FRJS25-1, pIMPLE-HL096PA1, A_15_1_R1.

[0101] Bacteriophage replication origin

[0102] The payloads of the present invention may comprise a phage origin of replication, which can initiate replication of the payload along with complementation of the complete phage genome for subsequent encapsidation into a different capsid.

[0103] The bacteriophage origin can also be engineered to function as a bacterial origin of replication without the need for packaging any phage particles.

[0104] The bacteriophage origin of replication contained in the payload of the present invention may be any origin of replication found in bacteriophage.

[0105] Preferably, the phage replication origin may be the following wild-type or non-wild-type sequences: M13, f1, X174, P4, λ, P2, 186, λ-like, HK022, mEP237, HK97, HK629, HK630, mEP043, mEP213, mEP234, mEP390, mEP460, mEPx1, mEPx2, phi80, mEP234, T2, T4, T5, T7, RB49, phiX174, R17, PRD1 Pl-like, P2-like, P22, P22-like, N15 and N15-like bacterial phages.

[0106] More preferably, the phage replication origin is selected from M13, f1, Origin of replication for phage X174, P4 and λ.

[0107] In a specific embodiment, the bacteriophage origin of replication is a P4 origin of replication.

[0108] In a specific embodiment, the phage replication origin is from a Propionibacterium phage: BW-like phage such as Doucette, B22, E6, G4, BV-like phage such as Anatole, E1, B3, BX-like phage such as PFR1 and PFR2, filamentous B5 phage, BU-like phage (acne skin bacillus phage).

[0109] The bacteria targeted by the bacteriophage-derived particles can be any bacteria present in a mammalian organism, a plant or the environment. It can be any commensal, symbiotic or pathogenic bacteria of the microbiota or microbiome.

[0110] The microbiome may contain a variety of endogenous bacterial species, any of which may be targeted according to the present disclosure. In some embodiments, the genus and / or species of the targeted endogenous bacterial cells may depend on the type of bacteriophage used to prepare the bacterial viral particles. For example, some bacteriophages exhibit tropism for or preferentially target specific host bacterial species. Other bacteriophages do not exhibit such tropism and can be used to target endogenous bacterial cells of many different genera and / or species.

[0111] Examples of bacterial cells include, but are not limited to, cells from bacteria of the genus Yersinia sp. ( Yersinia spp. ), Escherichia species, Klebsiella species ( Klebsiella spp. ), Acinetobacter species ( Acinetobacter spp. ), Bordetella species (Bordetella spp. ), Neisseria species ( Neisseria spp. ), Aeromonas species ( Aeromonas spp. ), Francisella species ( Franciesella spp. ), Corynebacterium species ( Corynebacterium spp. ), Citrobacter species ( Citrobacter spp. ), Chlamydia species ( Chlamydia spp. ), Haemophilus species ( Hemophilus spp. ), Brucella species ( Brucella spp. ), Mycobacterium species ( Mycobacterium spp. ), Legionella species ( Legionella spp. ), Rhodococcus species ( Rhodococcus spp. ), Pseudomonas species ( Pseudomonas spp. ), Helicobacter species ( Helicobacter spp. ), Vibrio species ( Vibrio spp. ), Bacillus species ( Bacillus spp. ), Erysipelothrix species ( Erysipelothrix spp. ), Salmonella species ( Salmonella spp. ), Streptomyces species ( Streptomyces spp. ), Streptococcus species ( Streptococcus spp. ), Staphylococcus species ( Staphylococcus spp. ), Bacteroides species ( Bacteroides spp. ), Prevotella species ( Prevotella spp. ), Clostridium species ( Clostridium spp. ), Bifidobacterium species ( Bifidobacterium spp. ), Clostridium species, Brevibacterium species ( Brevibacterium spp. ), Lactococcus species ( Lactococcus spp. ), Leuconostoc species ( Leuconostoc spp. ), Actinobacillus species ( Actinobacillus spp. ), Selenomonas species ( Selnomonas spp. ), Shigella species ( Shigella spp. ), Zymomonas species ( Zymonas spp. ), Mycoplasma species ( Mycoplasma spp. ), Treponema species ( Treponema spp. ), Leuconostoc species, Corynebacterium species, Enterococcus species ( Enterococcus spp. ), Enterobacter species ( Enterobacter spp. ), Thermococcus species ( Pyrococcus spp. ), Serratia species ( Serratia spp. ), Morganella species ( Morganella spp. ), Micromonas species (Parvimonas spp. ), Fusobacterium species ( Fusobacterium spp. ), Actinomycetes species ( Actinomyces spp. ), Porphyromonas species ( Porphyromonas spp. ), Micrococcus species ( Micrococcus spp. ), Bartonella species ( Bartonella spp. ), Borrelia species ( Borrelia spp. ), Brucella species ( Brucelia spp. ), Campylobacter species ( Campylobacter spp. ), Chlamydophilia spp ., Dermatobacterium species ( Cutibacterium spp .), Propionibacterium species ( Propionibacterium spp .), Gardnerella species ( Gardnerella spp. ), Ehrlichia species ( Ehrlichia spp. ), Haemophilus species ( Haemophilus spp. ), Leptospira species ( Leptospira spp. ), Listeria species ( Listeria spp. ), Mycoplasma species, Nocardia species ( Nocardia spp. ), Rickettsia species ( Rickettsia spp. ), Ureaplasma species ( Ureaplasma spp .), Lactobacillus species ( Lactobacillus spp .), Faecalibacterium species ( Faecalibacterium spp. ), Ruminococcus species ( Ruminococcus spp. ) and mixtures thereof.

[0112] Thus, the bacteriophage-derived particles can target (eg, specifically target) bacterial cells from any one or more of the aforementioned bacterial genera to specifically deliver a payload of the invention.

[0113] Preferably, the targeted bacteria can be selected from Yersinia species, Escherichia species, Klebsiella species, Acinetobacter species, Pseudomonas species, Helicobacter species, Vibrio species, Salmonella species, Streptococcus species, Staphylococcus species, Bacteroides species, Clostridium species, Shigella species, Enterococcus species, Enterobacter species, Listeria species, Dermatobacter species, Propionibacterium species, Fusobacterium species, Porphyromonas species and Gardnerella species.

[0114] In some embodiments, the bacterial cells of the present invention are anaerobic cells (e.g., cells that do not require oxygen for growth). Anaerobic cells include facultative anaerobic cells, such as (but not limited to) Escherichia coli, Shewanella Oneida ( Shewanella oneidensis ), Gardnerella vaginalis ( Gardnerella vaginalis) and Listeria. Anaerobic cells also include obligate anaerobic cells, such as Bacteroides, Clostridium, Dermatobacterium, Propionibacterium, Fusobacterium, and Porphyromonas species. In the human body, anaerobic bacteria are most commonly found in the gastrointestinal tract. In some specific embodiments, the targeted bacteria are therefore the bacteria most commonly found in the gastrointestinal tract. Bacteriophages used to prepare bacterial viral particles, and then bacterial viral particles, can be targeted (e.g., specifically targeted) to anaerobic cells according to their specificity profiles known to those skilled in the art to specifically deliver plasmids.

[0115] In some embodiments, the targeted bacterial cell is selected from Bacteroides thetaiotaomicron ( Bacteroides thetaiotaomicron ), Bacteroides fragilis ( Bacteroides fragilis )、Bacteroides dissimilari ( Bacteroides discordant ), Bacteroides vulgaris ( Bacteroides vulgaris ), Clostridium perfringens ( Clostridium leptum ), Clostridium sphaeroides ( Clostridium coccoides ), Staphylococcus aureus ( Staphylococcus aureus ), Bacillus subtilis ( Bacillus subtilis ), Clostridium butyricum ( Clostridium butyricum ), Brevibacterium lactofermentum ( Brevibacterium lactofermentum ), Streptococcus agalactiae ( Streptococcus agalactiae ), Streptococcus lactis ( Lactococcus lactis ), Leuconostoc lactis ( Leuconostoc lactis ), Actinobacillus actinomycetemcomitans ( Actinobacillus actinobycetemcomitans ), cyanobacteria ( cyanobacteria ), Escherichia coli, Helicobacter pylori ( Helicobacter pylori ), Selenomonas ruminantum ( Selnomonas ruminantium ), Shigella sonnei ( Shigella sonnei ), Zymomonas mobilis ( Zymomonas mobili ), Mycoplasma mycoides ( Mycoplasma mycoides ), Treponema denticola ( Treponema denticola ), Bacillus thuringiensis ( Bacillus Thuringian ), Staphylococcus lugdunensis ( Staphylococcus lugdunensis ), Leuconostoc spp. Leuconostoc oenos ), dry Corynebacterium ( Corynebacterium xerosis )、Lactobacillus plantarum( Lactobacillus plantarum ), Lactobacillus rhamnosus ( Lactobacillus rhamnosus )、Lactobacillus casei( Lactobacillus casei )、Lactobacillus acidophilus( Lactobacillus acidophilus ), Enterococcus faecalis ( Enterococcus faecalis ), Bacillus coagulans ( Bacillus coagulans ), Bacillus cereus ( Bacillus cereus )、Bacillus japonicus( Bacillus popillae), Synechocystis ( Synechocystis ) strain PCC6803 , Bacillus liquefacti Bacillus liquefaciens )、Thermococcus spp. Pyrococcus abyssi ), Selenomonas nominans 、Lactobacillus hilarii( Lactobacillus Hilgard's ), wild Streptococcus ( Streptococcus ferus )、Lactobacillus pentosus( Lactobacillus penitent ), Bacteroides fragilis, Staphylococcus epidermidis ( Staphylococcus epidermidis ), Streptomyces chromogenes ( Streptomyces phaechromogenes ), Streptomyces ghanaensis ( Streptomyces ghanaensis ), Klebsiella pneumoniae ( Klebsiella pneumoniae ), Enterobacter cloacae ( Enterobacter cloacae ), Enterobacter aerogenes ( Enterobacter aerogenes ), Serratia marcescens ( Serratia marcescens ), Morganella morganii ( Morganella morganii ) and Citrobacter freundii ( Citrobacter freundii ), Propionibacterium freudenreichii ( Propionibacterium freudenreichii ), Pseudomonas aeruginosa ( Pseudomonas aeruginosa ), Micromonas parvum ( Parvimonas micra ), Prevotella intermedia ( Prevotella intermedia ), Fusobacterium nucleatum ( Fusobacterium nucleatum ), Prevotella nigra ( Prevotella nigrescens ), Israeli Actinomycetes ( Actinomyces israelii ), Porphyromonas endodontis ( Porphyromonas endodontalis gingivalis ( Porphyromonas gingivalis ), Micrococcus luteus ( Micrococcus luteus )、Bacillus megaterium ( Bacillus megaterium ), Aeromonas hydrophila ( Aeromonas hydrophila ), Aeromonas caviae ( Aeromonas guinea pig ), Bacillus anthracis ( Bacillus anthracis ), Bartonella henselae ( Bartonella hens ), Bartonella quinquefasciatus ( Bartonella Quintana ), Bordetella pertussis ( Bordetella whooping cough ), Borrelia burgdorferi ( Borrelia burgdorferi ), Borrelia garinii ( Borrelia garinii ), Borrelia ebstroliberica Borrelia afzelii ), Borrelia relapsingii ( Recurrent Borrelia ), Brucella abortus ( Brucella abortion ), Brucella canis ( Brucella canis )、Brucella melitensis( Brucella from Malta ), Brucella suis ( Brucella his jejuni ( Campylobacter jejuni), Campylobacter coli ( Campylobacter coli ), Campylobacter fetus ( Campylobacter fetus ), Chlamydia pneumoniae ( Chlamydia pneumoniae ), Chlamydia trachomatis ( Chlamydia trachomatis ), Chlamydia psittaci ( Chlamydophila psittaci ), Clostridium botulinum ( Clostridium botulinum ), Clostridium difficile ( Clostridium difficult ), Clostridium perfringens ( Clostridium perfringens ), Clostridium tetani ( Clostridium tetanus )、Corynebacterium diphtheriae( Corynebacterium diphtheria acnes (formerly Propionibacterium acnes ( Propionibacterium acnes )), Ehrlichia canis ( Ehrlichia canis chaffeensis ( Ehrlichia chaffeensis ), Enterococcus faecium ( Enterococcus faecium ), Francisella tularensis ( Francisella tularensis ), Haemophilus influenzae ( Haemophilus influenzae ), Legionella pneumophila ( Legionella pneumophila ), Leptospira interrogans ( Leptospira interrogans ), Leptospira santalensis Leptospira santarosai ), Leptospira veseri ( Leptospira weilii ), Leptospira noguchi ( Leptospira noguchii ), Listeria monocytogenes ( Listeria monocytogenes ), Mycobacterium leprae ( Mycobacterium leprae ), Mycobacterium tuberculosis ( Mycobacterium tuberculosis ), Mycobacterium ulcerans ( Mycobacterium ulcerans ), Mycoplasma pneumoniae ( Mycoplasma pneumonia ), Neisseria gonorrhoeae ( Neisseria gonorrhoeae ), Neisseria meningitidis ( Neisseria meningitides ), Nocardia asteroides ( Nocardia asteroids ), Rickettsia rickettsii ( Rickettsia rickettsia ), Salmonella Enteritidis ( Salmonella enteritidis ), Salmonella Typhi ( Salmonella typhi ), Salmonella paratyphi ( Salmonella paratyphi ), Salmonella typhimurium ( Salmonella typhimurium ), Shigella flexneri ( Shigella flexnerii ), Shigella dysenteriae ( Shigella dysenteriae ), Staphylococcus saprophyticus ( Staphylococcus saprophyticus ), Streptococcus pneumoniae ( Streptococcus pneumoniae pyogenes ( Streptococcus pyogenes ), Gardnerella vaginalis, Streptococcus viridans ( Streptococcus viridans ), Treponema pallidum ( Treponema pallidum ), Ureaplasma urealyticum ( Ureaplasma urealyticum ), Vibrio cholerae ( Vibrio cholera ), Vibrio parahaemolyticus ( Vibrio parahaemolyticus ), Yersinia pestis ( Yersinia pestis ), Yersinia enterocolitica ( Yersinia enterocolitica ), Yersinia pseudotuberculosis ( Yersinia pseudotuberculosis ), Actinobacillus baumannii ( Actinobacter baumanii ), Pseudomonas aeruginosa and mixtures thereof, preferably the bacteria of interest are selected from Escherichia coli, Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii ( Acinetobacter baumanii ), Pseudomonas aeruginosa, Enterobacter cloacae and Enterobacter aerogenes and mixtures thereof.

[0116] In some embodiments, the targeted bacterial cell is selected from the genus Anaerobic Coryneformis ( Anaerotruncus ), anaerobic Acetobacter spp. Acetanaerobacterium ), Polyacetic acid bacteria ( Acetitomaculum ), Acetovibrio ( Acetivibrio ), Anaerobic cocci ( Anaerococcus ), Anaerobic Bacillus ( Anaerofilum ), Anaerosinus , anaerobic Corynebacterium ( Anaerostipes ), Anaerobic Glutathione ( Anaerovorax ), Butyrivibrio ( Butyrivibrio ), Clostridium, Capraecoccosis ( Capracoccus ), Dehalogenobacterium Dehalobacter ), Listeria monocytogenes ( Dialister ), Dorsalbacillus ( Dorea ), Enterococcus ( Enterococcus ), Ethanobacterium spp. Ethanoligenens ) 、 Faecalibacterium 、 Fusobacterium, Tenuibacterium Gracilibacter ) 、 Guggenheimella、Hespellia、 Trichobacterium Lachnobacterium ) 、 Lachnospiraceae Lachnospira ) 、 Lactobacillus 、 Leuconostoc, Megamonas ( Megamonas ), Moyala Moryella ), Mitsuoka Mitsuokella ), Protobacterium ( Oribacterium ), Acetobacter spp. Oxobacter ), Papillary rods ( Papillibacter ), Propiospirillum ( Proprionispira ), Pseudomonas butyricivibrio ( Pseudobutyrivibrio ), Pseudomycobacterium Pseudoramibacter ), Roseburia ( Roseburia ), Ruminococcus, Sarcina ( Package ), Seinosella ( Seinonella ), Shotworthia spp. Shuttleworthia ), Bacillus sp. Sporobacter ), Spore Fungus ( Sporobacterium ), Streptococcus, rare micrococcus ( Subdoligranule ), Intertrophococcus ( Syntrophococcus ), Thermotolerant Bacillus ( Thermobacillus ), Zurichobacterium spp. Turbid bacteria ), Weissella ( Weissella ), Clostridium, Bacteroides, Ruminococcus ( Ruminococcus ), Faecalibacterium, Treponema, Phascolarctobacterium ( Phascolarctobacterium ), Megasphaera ( Megasphere ), Faecalibacterium, Bifidobacterium, Lactobacillus, Sutterella ( Sutterella ) and Prevotella spp.

[0117] In other embodiments, the targeted bacterial cell is selected from Achromobacter xylosoxidans ( Achromobacter xylose oxidizing agent ), fermentative amino acid cocci ( Acidaminococcus fermentans ), Enteroaminoacoccus ( Acidaminococcus intestine ), Acidaminococcus species ( Acidaminococcus sp. ), Acinetobacter baumannii ( Acinetobacter baumannii ), Acinetobacter junii ( Acinetobacter junii )、Acinetobacter lofi Acinetobacter lwoffii ), Actinobacillus capsulatus ( Actinobacillus capsulatus ), Actinomyces naeslundii ( Actinomyces naeslundii ), Actinomyces neuregulinus ( Actinomyces neuii ), Actinomycetes odontolyticus ( Actinomyces odontolytic ), Actinomyces rosenbergii subspecies ( Actinomyces radingae ), liquid-producing Adler Kreutzeria ( Adlercreutzia equilifaciens )、Aeromicrobium Marseilles( Aeromicrobium massiliense ), Bacillus actinomycetemcomitans ( Aggregatibacter actinomycetemcomitans ), Akkermansia muciniphila ( Akkermansia mucinophile )、Ocean Algae-eating Fungi( Marine alligator gar finnsellae Common grebe finegolds ), Allelobacterium candidum ( Indistinct Alistipes )、Also bacillus stenospermum ( Common grebe helpless ), Allelobacterium angonis Alistipes onderdonkii ), Allelobacterium rotundum ( Common grebe putrefaction senegal Alistipes senegalensis ), Bacillus sabdariffa ( Common grebe Shahi ), Allebacterium timonei Alistipes timonensis ), O. oxyscardi Alloscardovia omnicolens ), Anaerobic Bacillus multiendosporum ( Anaerobacter polyendosporus ), hydrogen-producing anaerobic rods ( Anaerobic hydrogen forming ), hydrogen-producing anaerobic cocci ( Anaerobacterium hydrogen ), Anaerobic coccus provocateurs ( Anaerococcus prevotii ), Anaerobic Coccus senegalenica ( Anaerococcus senegalensis ), fecal anaerobic rod-shaped bacteria ( Anaerofustis suffocatus ), Anaerobic Corynebacterium faecalis ( Anaerobic feces ), Anaerobic Corynebacterium butyricum ( Anaerostipes hadrus ), anaerobic cocci ( Anaerotruncus colihominis ), Thiamine-degrading Bacillus thiamine ( Aneurinibacillus aneurysmal ), Bacillus licheniformis ( Bacillus licheniformis ), Bacillus massilioanorexic , Marseille Senegal Bacillus ( Bacillus massiliosenegalensis ), Bacillus simplex ( Bacillus simplex )、Bacillus smithii( Bacillus smithii ), Bacillus subtilis, Bacillus thuringiensis ( Bacillus thuringiensis ), Bacillus timonene ( Bacillus timonensis )、Bacteroides xylanolyticus ( Bacteroides xylanisolvens ), Bacteroides acidophilus ( Bacteroides acidificis ), Bacteroides faecalis ( Bacteroides faeces ), Bacteroides polytrichum ( Bacteroides hairy ), Bacteroides cellulolyticus ( Bacteroides cellulolyticus ), Bacteroides clarithromyces ( Bacteroides clarus ), Bacteroides faecalis ( Bacteroides coprocola ), Bacteroides coprophilus ( Bacteroides coprophilus ), Bacteroides thoracis ( Bacteroides dorei ), Bacteroides elsdenii ( Bacteroides eggerthii ), Bacteroides faecalis ( Bacteroides dung )、Bacteroides aureus( Bacteroides finegoldii )、Fluorobacterium fluoride ( Bacteroides flux ), Bacteroides fragilis, Bacteroides gallinarum ( Bacteroides fowleri ), intestinal Bacteroides ( Bacteroides intestinal ), Bacteroides nosei ( Bacteroides nordii ), Bacteroides oleifera ( Bacteroides full of olives ), Bacteroides ovatus ( Bacteroides ovatus )、Bacteroides pectinophilus ( Bacteroides pectinophile )、Bacteroides vulgaris ( Bacteroides plebeius ), Bacteroides saranii ( Bacteroides saltpeter ), Bacteroides salyersii ( Bacteroides salyersiae ), Bacteroides species ( Bacteroides sp. ), Bacteroides faecalis ( Bacteroides suffocatus ), Bacteroides thetaiotaomicron, Bacteroides monomorpha ( Bacteroides uniformis ), Bacteroides vulgaris, Bacteroides xylanolyticus, Bacteroides pectinophilus ATCC 、Barnesella intestinalis( Barnesiella intestinohumanis ), Bavaria serrata ( Bavariicoccus seileri ), Bifidobacterium adolescentis ( Bifidobacterium adolescentis ), Bifidobacterium angularis ( Bifidobacterium angular )、Bifidobacterium animalis( Bifidobacterium animalum ), Bifidobacterium bifidum ( Bifidobacterium bifidum ), Bifidobacterium breve ( Bifidobacterium breve ), Bifidobacterium microtiformis ( Bifidobacterium catenulatum ), Bifidobacterium dentate ( Bifidobacterium dentium ), Bifidobacterium gallicum ( Bifidobacterium gallicum ), Bifidobacterium longum ( Bifidobacterium longum ), Bifidobacterium pseudocatenulatum ( Bifidobacterium pseudocatenulatum ), Bifidobacterium faecalis ( Bifidobacterium spp. ), Bilophila voroni Bilophila wadsworthia ), Blautia feces ( Blautia faeces ), Blautia henselae ( Blautia hansenii ), hydrogenotrophic Blautia ( Blautia hydrogenotrophica ), Blautia lutschii ( Clay clay ), Blautia ovata ( I am dying. ), production of Blautia ( Blueberry products ), Blautia wesleyi ( Blautia wexlerae ), Brachymonas aphids ( Brachymonas chironomi ), Brevibacterium senegalenicae ( Brevibacterium senegalensis ), B. formate-requiring Bryantella formexigens ), butyrate-producing bacteria ( butyrate-producing bacterium ), Butyricoccus pullorum ( Butyricicoccus pullicaecorum ), viral Ricinus ( Butyricimonas virosa ), Butyrivibrio spike Butyrivibrio crossotus ), Butyrivibrio fibrinolyticus ( Butyrivibrio fibrisolvens ), Calcobacillus faecalis ( Caldicoprobacter faecalis ), Campylobacter concise Campylobacter concinnatus jejuni, Campylobacter Uppsala ( Campylobacter upsaliensis )、Streptozobacter mitsuokaensis ( Catenibacterium mitsuokai ), Cefixime dacillin ( Cedecea davisae ), Cellulomonas massiliense ( Cellulomonas massiliensis), Bacillus sordellii ( Cetobacterium somerae ), Citrobacter braakii ( Citrobacter braakii ), Citrobacter freundii, Citrobacter pasteurianus ( Citrobacter pasteurii ), Citrobacter species ( Citrobacter sp. ), Citrobacter youngii ( Citrobacter youngae ), Evicocobacter avium ( Cloacibacillus evryensis ), Clostridiales bacteria ( Clostridiales bacteria ), Clostridium difficile ( Clostridium difficile ), Clostridium asparagineum ( Clostridium asparagiforme ), Clostridium barretteii ( Clostridium bartlettii ), Clostridium boliviensis ( Clostridium boliviensis ), Clostridium baumannii ( Clostridium boltea ), Clostridium hasslerii ( Clostridium hathawayi ), Clostridium heraniosum ( Clostridium of Iran ), Clostridium heinrichii ( Clostridium hylemonae ), Clostridium perfringens ( Clostridium leptum ), Clostridium methylpentosaceum ( Clostridium methylpentosum ), Clostridium perfringens ( Clostridium nexile ), Clostridium difficile ( Clostridium orbiscindens ), Clostridium difficile ( Clostridium ramosum ), Clostridium scintillans ( Clostridium splitting ), Clostridium species, Clostridium species, Clostridium spiralis ( Clostridium spiroforme ), Clostridium sporogenes ( Clostridium sporogenes ), symbiotic Clostridium ( Clostridium symbiosum ), Collinsella aerogenes ( Collinsella aerofaciens ), Collinsella enterica serovars ( Collinsella intestinalis ), Collinsella faecalis ( Collinsella dung beetle ), Collinsella tanaka ( Collinsella tanakaei ), Bacillus moniliformis ( Coprobacillus cateniformis ), Faecalibacterium fastidiosa Coprobacter fastidiosa ), Coprococcus acutissima ( Coprococcus catus ), Accompanying Coccus ( Coprococcus comesus ), regular coccobacillus ( Coprococcus eutact ), Corynebacterium ammoniagenes ( Corynebacterium ammoniagenes ), Amycolic acid bacillus ( Corynebacterium amycolatum ), Corynebacterium pseudodiphtheriae ( Corynebacterium pseudodiphtheria acnes Cutibacterium acnes ), human skin bacteria ( Dermabacter of man ), Copenhagen desulfurizing bacteria ( Desulfitobacterium hafniense ), Desulfovibrio fairfieldii ( Desulfovibrio fairfieldensis )、Desulfovibrio lazia ( Desulfovibrio lazy ), Listeria monocytogenes succinici ( Dialister succinatiphilus), Dilmobacteria fastidious Dilemma annoying ), Dorsal bacteria ( Dorea ant-producing ), Dorea longum ( Golden long-chain ), Dysgonomonas capnocytophagoides , Zymomonas jiadeyingensis ( Dysgonomonas I was glad. ), Zymomonas mosseri ( Dysgonomonas mossii ), Edwardsiella tarda ( Edwardsiella slow ), Eggerthella tarda ( Eggerthella lenta ), Tower-Eisenbergia ( Eisenbergiella tayi ), Marseille Huge bacteria( Enorma of Marseilles ), Enterobacter aerogenes ( Enterobacter aerogenes ), Enterobacter aureus ( Enterobacter asburiae )、E. coli ( Enterobacter carcinogen ), Enterobacter cloacae, Enterobacter massiliense ( Enterobacter massiliensis ), Enterococcus pyogenes ( Enterococcus casseliflavus ), enterococci durable ( Enterococcus durans ), Enterococcus faecalis, Enterococcus faecium, Enterococcus flavus ( Enterococcus yellowing ) Enterococcus fowleri ), Enterococcus species ( Enterococcus sp. ), Vibrio nigra ( Enterovibrio nigricans ), Erysipelothrix rhizogenes ( Erysipelatoclostridium branched ), Escherichia coli, Escherichia species ( Escherichia sp. ), Eubacterium dimorphus ( Eubacterium two-faced ), Eubacterium elongatum ( Eubacterium dolichum ), Eubacterium hallii ( Eubacterium hallii ), Eubacterium mucilaginosa ( Eubacterium slime ), Eubacterium truncatum ( Eubacterium ramulus ), Eubacterium rectale ( Eubacterium rectale ), Eubacterium inermis ( Eubacterium siraeum ), Eubacterium convexogastricum ( Eubacterium ventrally )、Exicobacterium marinum( Marine microbacterium )、Exiguobacterium spp. Small bacterium waves ), see Faecalibacterium Faecalibacterium cf. ), Faecalibacterium prausnitzii ( Faecalibacterium of Prausnitz ), cylindrical dung bean fungus ( Faecalitalea cylindroides ), Pasteurella ferromonas ( Ferrimonas Balearic ), Finegoldia Finegoldia magna), Flavobacterium field ( Flavobacterium from Daejeon ), Flavobacterium prausnitzii ( Flavonifractor of the lungs ), Streptobacillus saccharolyticus ( Fusicatenibacter saccharivorans ), Fusobacterium gambiense ( Fusobacterium gonidiaformans )、Fusobacterium mortis ( Fusobacterium deadly ), Fusobacterium necroticum ( Fusobacterium necrophorum ), Fusobacterium nucleatum, Fusobacterium periodonticum ( Fusobacterium periodontal ), Fusobacterium species ( Fusobacterium sp. ), Fusobacterium ulcerans ( Fusobacterium ulcerans ), Fusobacterium variabilis ( Fusobacterium varius )、Duck-derived Gallinaceus( Gallibacterium duck )、Formic acid budding bacteria ( Ant-like gemmiger ), Gordonia pameleea ( Gordonibacter pamelaea ), Hafnia alvei Hafnia canal ), Helicobacter bilirubin ( Helicobacter biliary ), Helicobacter bilirubin ( Helicobacter pylori ), Helicobacter canadensis ( Helicobacter Canadian ), Helicobacter canis ( Helicobacter canis ), Helicobacter pylori ( Helicobacter pylori ), Helicobacter pylori ( Helicobacter macaque ), Helicobacter pylori ( Helicobacter pametensis ), Helicobacter pylori ( Helicobacter pylori ), Helicobacter pylori, Helicobacter rodentium ( Helicobacter rodentium ), Helicobacter pylori ( Helicobacter winghamensis )、Marseillariella Herbaspirillum from Massilia ), Holdermanella dimorphus ( Holdemanella biformis ), Holdemania filiformis , Haldemannia tenuissima Holdemania filiformis ), Holdermanella massiliense ( Hold'em from Marseille ), Holdemanella tenuissima, Hungatella hathawayi , Enterobacter Butleri ( Intestinibacter bartlettii ), butyric acid producing Enterobacter ( Intestinimonas butyriciproducens ), Klebsiella oxytoca ( Klebsiella oxytoca ), Klebsiella pneumoniae, Coxetia masai ( Kurtia from Marseille )、Lachnospirillum Lachnospira pectinoschiza ), Lactobacillus acidophilus, Lactobacillus amyloliquefaciens ( Lactobacillus amylolyticus )、Lactobacillus animalis( Lactobacillus animalis ), Lactobacillus antralis ( Lactobacillus antrum ), Lactobacillus brevis ( Lactobacillus brevis ), Lactobacillus buchneri ( Lactobacillus Buchner's ), Lactobacillus casei, Lactobacillus curvature ( Lactobacillus curvatus ), Lactobacillus delbrueckii ( Lactobacillus delbrueckii )、Lactobacillus fermentum( Lactobacillus fermentum )、Lactobacillus gasseri ( Lactobacillus gasseri )、Lactobacillus helveticus( Lactobacillus helveticus ), Lactobacillus hilarii, Lactobacillus iners ( Lactobacillus inert ), Lactobacillus intestinalis ( Lactobacillus intestinalis ), Lactobacillus johnsonii ( Lactobacillus johnsonii ), Lactobacillus murinus ( Lactobacillus murineus ), Lactobacillus paracasei ( Lactobacillus paracasei ), Lactobacillus plantarum, Lactobacillus reuteri ( Lactobacillus reuteri ), Lactobacillus rhamnosus, Lactobacillus rumenicus ( Lactobacillus rumen )、Lactobacillus sakei( Lactobacillus sakei ), Lactobacillus salivarius ( Lactobacillus salivarius ), Lactobacillus ernalis ( Lactobacillus ultunensis ), vaginal lactobacillus ( Lactobacillus vaginalis ), Lactobacillus plantarum subsp. Lactobacillus plantarum subsp. ), Leuconostoc mesenteroides ( Leuconostoc mesenteroides ), Leuconostoc pseudomesenteroides ( Leuconostoc pseudomesenteroid ), Listeria monocytogenes ( Listeria grayi ), Listeria innocua ( Listeria harmless ), Granulomatous Mannoea ( Mannheimia granulomatis ), Bryantia marvin ( Marvinbryantia formatexigens ), Megamonas monomorpha ( Megamonas funicularis ), Megamonas maxima ( Megamonas hypermegale ), Methanobacterium smithii ( Methanobrevibacter smithii ), Methanobacterium smithii Fl ( Methanobrevibacter smithii Fl ), Micrococcus luteus, aerobic denitrifying Micromycobacterium ( Aerodenitrifying microorganisms ), Glechoma longituba Mitsuokella jalaludinii )、Polyacidobacteria( Mitsuokella multacida ), Mollicutesales bacteria ( Mollicutes bacteria ),intestinal Murimonas bacteria( Intestinal worms ), Neisseria macaques ( Neisseria macaques ), alkaliphilic nitrile-degrading bacteria ( Nitriliruptor alkaliphilus ), Bacillus marseilles ( Oceanobacillus massiliensis )、Black odor bacteria ( Odoribacter woolly ), Odorbaminobacterium viscerae ( Odoribacter splanchnicus ), Ornithobacterium rhinotracheitis ( Ornithobacterium rhinotracheale ), Oxalobacter formigenes ( Oxalobacter formigenes ), Paenibacillus barronii ( Paenibacillus barengoltzii ), Paenibacillus chitinilyticus ( Paenibacillus chitinolytic), Paenibacillus splendens ( Paenibacillus lautus )、Paenibacillus spp. Paenibacillus motobuensis ), Paenibacillus senegalensis ( Paenibacillus senegalensis ), Bacillus spores Sarcina ( Paenispora bag of garbage ), Parabacteroides dissimilari ( Parabacteroids discordant ), Parabacteroides gordonii ( Parabacteroides goldsteinii ), Parabacteroides gordonii ( Parabacteroides gordonii ), Parabacteroides johnsonii ( Parabacteroides johnsonii ), Parabacteroides faecalis ( Parabacteroides murdae ), Parapus xylanophilus ( Paraprevotella xylaniphila ), Parasutterella excrementihominis , Micromonas parvum, Pediococcus acidilactici ( Pediococcus lactic acid ), Clostridium difficile ( Peptoclostridium difficile ), Peptophilus Hallei ( Peptoniphilus harei ), Peptophila obesa ( Peptoniphilus obesi ), Peptiphila senegalenica ( Peptoniphilus senegalensis ), Peptiphila timonei ( Peptoniphilus timonensis ), Pseudomonas succinici ( Phascolarctobacterium succinatutens ), Porphyromonas insaccharolyticus ( Porphyromonas asaccharolytic ), Porphyromonas veononis , Prevotella pasteurianum Barony of Prevotella ), Prevotella diversifolia ( Prevotella bivia ), Prevotella faecalis ( Prevotella copri ), Prevotella odonta Dental prevotella ), Prevotella rainbowi ( Prevotella micans ), Prevotella polysaccharidophila ( Prevotella multisaccharivorax ), oral Prevotella ( Oral thrush salivarius ( Prevotella saliva ), Prevotella faecalis ( Prevotella scatcorea ), Euoral Prevotella ( Prevotella veroralis ), Propionibacterium acnes, Propionibacterium acnes, Propionibacterium vulgaris ( Propionibacterium avidum ), Propionibacterium freudenreichii, Propionibacterium lymphotropum ( Propionimicrobium lymphophil )、Proteus mirabilis( Miraculous Proteus ), Proteus penefacultatus ( Proteus penneri ) ATCC , Providencia alcaligenes ( Alkalizing Providence ), Providencia rettgeri ( Providence rettgeri ), Providencia ragi ( Providence rusticus ), Providencia stuartii ( Providence of Stuart ), Pseudomonas aeruginosa ( Pseudoflavonifractor hairy ), Pseudomonas aeruginosa ( Pseudomonas aeruginosa ), Pseudomonas aureus ( Pseudomonas luteola ), Ralstonia pekinensis ( Ralstonia pickettii ), Rheinheimerella Rheinheimera perlucida ), Rheinheimerella texas ( Rheinheimera texasensis )、Columba lycopersicum( Riemerella columbina ), Ivory Coast Rombutsiella Romboutsia lituseburensis ), Roseburia faecalis ( Roseburia faeces ), Roseburia intestinalis ( Intestinal roseburia ), Roseburia glucosaccharovora Roseburia inulinivorans ), Ruminococcus bicyclicus ( Ruminococcus bicirculans ), Ruminococcus brucei ( Ruminococcus bromii ), Ruminococcus spp.( Ruminococcus callidus ), Ruminococcus chapacis ( Ruminococcus champanellensis ), fecal rumenococci ( Ruminococcus faeces ), Ruminococcus virulens ( Ruminococcus gnavus ), Ruminococcus yogurt ( Ruminococcus lactaris ovale), Ruminococcus ovale ( Ruminococcus obeum ), Ruminococcus species ( Ruminococcus sp. ), Ruminococcus species, Ruminococcus contortus ( Ruminococcus torques ) and Sarcina ventriculosa ( Stomach load ), Enterobacteriaceae ( Sellimonas intestinalis ), Senegal anaerobic bacteria ( Senegalmassilia anaerobica ), Shigella sonnei, Snaeckia pyriformis ( Slack pear-shaped ), Staphylococcus epidermidis, Staphylococcus lentus ( Staphylococcus lentus ), Staphylococcus nepalensis ( Staphylococcus nepalensis ), Staphylococcus pseudintermedius ( Staphylococcus pseudintermediaus ), Staphylococcus xylosus ( Staphylococcus xylose ), Stenotrophomonas maltophilia ( Stenotrophomonas maltophilia ), Streptococcus agalactiae, Streptococcus anginosus ( Streptococcus pneumoniae ), Streptococcus australis ( Streptococcus australis ), Streptococcus equi ( Streptococcus cavalli ), Streptococcus brevicornis ( Streptococcus castoreum ), Streptococcus opossum ( Streptococcus didelphis ), Streptococcus equi Streptococcus equine ), Streptococcus gordonii ( Streptococcus gordonii ), Streptococcus henryi ( Streptococcus henryi ), porcine vaginal streptococci ( Streptococcus hyovaginalis ), Streptococcus infantis ( Streptococcus infantis ), Streptococcus infantum ( Streptococcus infantis ), Streptococcus luteus ( Streptococcus lutetensis ), Streptococcus gerbilus ( Streptococcus merionis ), Streptococcus mitis ( Streptococcus milius), Streptococcus mutans ( Streptococcus mutans ), oral streptococci ( Oral Streptococcus ), Streptococcus ovis ( Streptococcus ovis ), Streptococcus parasanguinis ( Streptococcus parasanguinis ), Streptococcus multivitamin B ( Streptococcus pluronicum ), Streptococcus suis ( Streptococcus porcine ), Streptococcus pyogenes, Streptococcus salivarius ( Streptococcus salivarius ), cousin Streptococcus ( Streptococcus sobrinus ), Streptococcus thermophilus ( Streptococcus thermophilus ), Streptococcus Torhoutii ( Streptococcus thoraltensis ), Streptomyces albus ( Streptomyces albus ), Micrococcus rare ( Variable subdoligranule ), Succinicomonas hebeyi ( Succinate hippie ), Sutterella parvirubra , Waldersartella Sutterella wadsworthensis ), glycerol utilizing Tyrosporum tyrosinum ( Terrisporobacter glycolicus ), Mayumbetera Terrisporobacter Mayombei ), Organic-feeding Deep-sea Bacillus ( Thalassobacillus devorans ), Timoneycetes senegal ( Timonella senegalensis )、Urea bacillus( Blood fluke ), unknown genus and species ( unknown sp ), unknown species, Campylobacter cambrianus ( Varibaculum cambriense ), Veillonella atypical ( Veillonella atypical )、Veillonella dispar ( Veillonella dispar )、Wei Rong bacteria ( Veillonella little girl cincinnati Vibrio cincinnatiensis ), Halobacillus halodendron ( Virgibacillus salt-loving ), Weissella mesenteroides ( Weissella paramesenteroides ) and Weissella mesenteroides ( Weissella paramesenteroides ) ATCC .

[0118] In other embodiments, the targeted bacterial cells are those commonly found in the skin microbiota and are preferably selected from Acetobacter farreri ( Acetobacter farinalis ), Acetobacter applei ( Acetobacter malorum ), Acetobacter oleans ( Acetobacter orleanensis ), Acetobacter sicerae , Achromobacter anxious 、Achromobacter denitrificans Achromobacter denitrificans ), Achromobacter martensii ( Achromobacter marplatensis ), rare colorless bacteria ( Achromobacter spanius ), Achromobacter xylosoxidans subsp. xylosoxidans ( Achromobacter xylosoxidans subsp. xylosoxidans), Acidobacterium konjac ( Acidovorax konjacii ), Acidophages rhizogenes ( Acidovorax root ), Acinetobacter johnsonii ( Acinetobacter johnson's ), Actinomycetes citrinum ( Actinomadura citrifolia ), Actinomycetes cyanobacterium ( Actinomadura aerulea ), Actinomyces fibrosus ( Actinomadura fibrosa ), Actinomycetes fusca Madura ( Actinomadura fulvescens ), Actinomadura jiaoheensis , Actinomyces luteus ( Actinomadura luteofluorescens ), Actinomycetes mexicana ( Actinomadura mexicana ), Actinomycetes nitrite-producing Madura Actinomadura nitritigenes ), Actinomyces verrucosporum ( Actinomadura verrucosospora ), Actinomyces yumamadura ( Actinomadura yumaensis ), Actinomycetes odontolyticus, Atypical actinomycetes ( Actinomycetospora atypical ), Actinomycetospora corticicola 、Actinomyces rhizogenes Actinomycetospora rhizophila ), Actinospora lishiri Actinomycetospora from Rishiri ), Aeromonas australis ( Aeromonas australiensis ), Aeromonas zooxanthellae ( Aeromonas of beasts ), Aeromonas bivalviae ( Aeromonas bivalve ), Aeromonas anguillarum ( Aeromonas prison ), Aeromonas mineralophilus ( Aeromonas eucrenophila ), Aeromonas hydrophila subsp. hydrophila ( Aeromonas hydrophila subsp. hydrophilic ), Aeromonas ichthyosaurianus ( Aeromonas piscicola ), Aeromonas boydii ( Aeromonas popoffii ), Aeromonas rivolii ( Aeromonas rivuli ), Aeromonas salmonicida subsp. Aeromonas salmonicida subsp. pectinolytic ), Aeromonas salmonicida subsp. smithii ( Aeromonas salmonicida subsp. smithy ), Amaricoccus kaplicensis , Verona sewer bacteria ( Amaricoccus veronensis ), Aganoamidobacterium ( Aminobacter aganoensis ), Cyclosporin Aminobacterium ( Aminobacter ciceronei ), Aminobacter lissarensis 、Niigata aminobacterium ( Aminobacter Niigata ), Campylobacter thetaiotaomicron ( Ancylobacter polymorphus ), Bacillus flavus anaerobicus Yunnan subspecies ( Anoxybacillus flavithermus subsp. of Yunnan )、Air-growing water microbes ( Aquamicrobe air-filled ), Transitional Protothecoides ( Archangium gephyra ), Transitional Protothecoides ( Archangium gephyra ), Protocystis parvum ( Archangel Michael )、Purple Saccharomyces cerevisiae( Archangel violet ), Arthrobacter Arthrobacter viscous ), Bacillus anthracis, Bacillus australis ( Bacillus australis ), Bacillus sp. Bacillus drentensis ), Bacillus mycoides ( Bacillus mycoides ), Bacillus pseudomycoides ( Bacillus pseudomycoides ), Bacillus pumilus ( Bacillus pumilus ), Bacillus safranchii ( Bacillus wise )、Bacillus dysenteriae ( Bacillus vallismortis ), Bosella sulfur-oxidizing Bosea thiooxidant ), Bradyrhizobium huanghuaihaiensis ( Bradyrhizobium huanghuaihaiense ), Bradyrhizobia soybean ( Bradyrhizobium japonicum ), Brevundimonas aurantiaca ( Brevundimonas aurantiaca ), Brevundimonas intermedius ( Brevundimonas intermedia ), Burkholderia aspalathi , Burkholderia choica , Burkholderia cordobensis , widespread Burkholderia Burkholderia diffusa ), Burkholderia insulsa , Burkholderia cerevisiae Burkholderia rhynchosiae ), Burkholderia tumefaciens ( Burkholderia terrestris ), Burkholderia udeis , Gavinbutiacus Buttiauxella gaviniae ), soil sludge monocytogenes ( Earthworms gingivalis ( Capnocytophaga gingivalis )、Dinghushan Chitinophage ( Chitinophaga dinghuensis )、Chryseobacterium glutamicum ( Chryseobacterium gleum ), Chryseobacterium chlororaphis ( Chryseobacterium greenlandense )、Jeju Island Chryseobacterium ( Chryseobacterium jejuense )、Chryseobacterium ichthyobacterium( Chryseobacterium fish ), Chryseobacterium spp. Chryseobacterium sediment ), Chryseobacterium trout , Chryseobacterium urealyticum ( Chryseobacterium ureolyticum ), Chryseobacterium vietnamense ( Chryseobacterium Vietnamese ), Corynebacterium spp. Corynebacterium accolens ), nonfermenting Corynebacterium lipophilum subsp. Corynebacterium afermentans subsp. lipophilic )、Corynebacterium microti ( Corynebacterium smallest ), Corynebacterium Sundsvall ( Corynebacterium sundsvallense ), metal-resistant copper-greedy bacteria ( Copper-seeking metal-during )、Nantong copper-loving bacteria ( Cupriavidus nantongensis )、Insecticidal copper bacteria ( Copper-hungry killer ), Copper-eyed pampas 、Yeoncheon copper-grasping bacteria ( Copper-loving Yeoncheon-si ), Bacillus brevis ( Curtobacterium flaccumfaciens ), epidermis of hirudine Devospasella Epidermidihrudinis devosia ), Riboflavin Devosella ( Riboflavin devotion ), Riboflavin Devosella ( Riboflavin devotion ), yellow bacillus ( Diaphorobacter oryzae ), alkaliphilic Dietzia Dietzia psychralcaliphila )、Adhesive Sword Fungus( Sticking stick )、American sword mushroom( American Ensifer ), Enterococcus odoratus ( Enterococcus malodorous ), Enterococcus pseudoavium ( Enterococcus pseudoavium ), Enterococcus vegetativeus ( Enterococcus from Viikki )、Xiangfang Enterococcus( Enterococcus xiangfangensis ), Erwinia rhubarb ( Erwinia rhapontic ), Halophilic Roseobacterium ( Falsirrhodobacter halotolerans ), Flavobacterium Araucanian 、Flavobacterium fructicola Flavobacterium frigidimaris ), Gluconobacter freundii ( Gluconobacter frateurii ), Gluconobacter thailandensis ( Gluconobacter thailicus ), Gordonia alkanovora Gordonia alkanivorans ), Halomonas marinum ( Halomonas aquamarina ), Halomonas axialis ( Halomonas axialensis ), Halomonas australis ( Halomonas meridiana ), Halomonas oleifera ( Halomonas olivaria ), Halomonas songnensis ( Halomonas songnenensis ), Halomonas variabilis ( Halomonas variabilis ), Chlorospira chlorophylla ( Herbaspirillum chlorophenolic ), Spirillum freisensis Herbaspirillum frisingense ), Herbaspirillum hiltneri , Herbaspirillum huttiense subsp. putei 、Portuguese Spirillum Herbaspirillum lusitanum ), Hermionema Fontica ( Herminiimonas fonticola ), Hydrogenophage intermedia ( Hydrogenophaga intermedia ), Xanthocytosporium Hydrogenophaga pseudoflava ), Klebsiella oxytoca, Ostreella sucrose ( Kosakonia sugar ), Lactobacillus delbrueckii subsp. bulgaricus ( Lactobacillus delbrueckii subsp. Bulgarian ), Lactobacillus humus ( Lactobacillus modestisalitolerans ), Lactobacillus plantarum subsp. argentulatus ( Lactobacillus plantarum subsp. argentoratensis )、Lactobacillus xiangfang( Lactobacillus xiangfangensis ), rosellii rechivanieri ( Lechevalieria rose-colored), Lentzia microti Lentzia albida californianum ( Lent Californian )、Leuconostoc carnosus( Leuconostoc carnosum ), Leuconostoc citrinum ( Leuconostoc lemon ), Leuconostoc gelidum subsp. gasicomitatum , Leuconostoc mesenteroides subsp. suionicum , Xanthomonas tidalis ( Estuarine Luteimonas ), anti-biolytic bacillus ( Lysobacter antibiotic ), Korean Lysobacterium ( Lysobacter koreensis ), Lysobacter oryzae ( Lysobacterium oryzae )、Magnetospirillum moscowii( Magnetospirillum moscoviense ), Marinomonas Alcaraz , Halomonas primimolye Marinomonas primoryensis )、Golden Marseilles( Marseille gold )、Jeju Island Marseilles ( Fasting Massilia ), Marseilles Massilia kyonggiensis ), Timoney Marseilles The helmsmen of Marseilles ), Bradyrhizobium spp. ( Mesorhizobium acaciae ), Qingsheng Mesorhizobium ( Mesorhizobium qingshengii ), Mesorhizobium juvenileum ( Mesorhizobium Shona ), Methylobacterium unicolor ( Methylobacterium haplocladii ), Methylobacterium sylvestris ( Methylobacterium platani ), Methylobacterium pseudosasicola , Methylobacterium Zatman's , Microbacterium oxydans Microbacterium oxidans ), Micromonas chaiyaphum Micromonospora from Chaiyaphum ), Micromonospora bronze Micromonospora chalcea ), Micromonospora citrinum ( Micromonospora citrifolia ), Micromonospora hippocampi ( Micromonospora coxensis ), Micromonospora aculeatus ( Micromonospora echinofusca ), Halophilic Micromonospora ( Micromonospora halophyta ), Micromonospora kangleipakensis 、Marine micromonas Micromonospora maritima ), Micromonospora nigra ( Micromonospora nigra ), Micromonospora crimsonii ( Micromonospora purple-chromogenic ), Micromonospora rhizospherica ( Micromonospora rhizosphaerae ), Micromonospora sanleci Micromonospora saelicesensis ), Microbacterium subterraneum ( Subterranean microrod ), Microbacterium zambiense ( Microvirga zambiensis ), Mycobacterium alvei ( Mycobacterium alveolus ), Mycobacterium avium subsp. silvosporum ( Mycobacterium avium subsp. silvaticum), Mycobacterium Columbianum ( Mycobacterium colombiense ), concept Mycobacterium ( Mycobacterium conceptionensis ), concept Mycobacterium ( Mycobacterium conceptionensis ), Mycobacterium mallei ( Mycobacterium farcinogens ), Mycobacterium fortuitum subsp. fortuitum ( Mycobacterium fortuitum subsp. fortuitum ), Mycobacterium archaea ( Mycobacterium goodii ), Mycobacterium insubricum , Mycobacterium from Lazzaro 、Mycobacterium neogoldensis ( Mycobacterium neoaurum ), Mycobacterium new orleans ( Mycobacterium new orleansense ), Mycobacterium aube Mycobacterium obuense ), exogenous mycobacteria ( Mycobacterium peregrinum ), Mycobacterium saopaulensis , Mycobacterium septicemia ( Mycobacterium septicum ), Mycobacterium serratii ( Mycobacterium setense ), Mycobacterium smegmatis ( Mycobacterium smegmatis ), Neisseria flavescens ( Neisseria subflava )、Nocardia lijiangensis( Nocardia lijiangensis ), Nocardia thailandica ( Nocardia thaitica ), Neosphingobacterium bahaimense ( Novosphingobium barchaimii )、Neosphingobacterium spp. Neosphingobium lindaniclastic )、Neosphingobacterium spp. Novosphingobium lindaniclasticum ), Neosphingobacterium maturae ( Novosphingobium mathurense ), Ochrobacterium pseudogrigionum ( Ochrobacterium pseudo-Grignon ), Oxalicibacterium solurbis , Paraburkholderia grisea Paraburkholderia glathei ), Burkholderia terrestris ( Paraburkholderia humi ), Burkholderia parabenazinica ( Paraburkholderia phenazinium ), Burkholderia paraphytogenes ( Paraburkholderia phytofirmans ), Paraburkholderia sordidicola , Burkholderia parasolensis ( Paraburkholderia terricola ), Paraburkholderia xenovorans , Paracoccus laeviglucosivorans , Paenibacillus ginseng Patulibacter ginsengiterrae ), Red Polymorpha ( Polymorphospora rubra ), Porphyromonas aeruginosa in swimming pools ( Porphyrobacter colymbii jejuni ( Prevotella jejuni ), Prevotella melaninogenica ( Prevotella melaninogenica acnes subsp. longum ( Propionibacterium acnes subsp. elongatum ), Proteus vulgaris ( Proteus common ), Providencia ragi, Pseudomonas agarophilus ( Pseudoalteromonas agarivorans ), Pseudoalteromonas atlanticum ( Pseudoalteromonas atlantica ), Pseudoalteromonas paraguayansis ( Pseudoalteromonas paragorgicola ), Pseudomonas aegypti ( Pseudomonas asplenii ), Pseudomonas asiatica ( Pseudomonas asuensis ), Pseudomonas benzophagous ( Pseudomonas benzenivorans ), Pseudomonas cannabinoides ( Pseudomonas cannabina ), Pseudomonas lividans ( Pseudomonas cissicola ), Pseudomonas frostbite ( Pseudomonas congelans ), Pseudomonas connerii ( Pseudomonas costantiniii ), Pseudomonas sphaerocephala ( Pseudomonas ficus erectae ), Pseudomonas Fredericksburg ( Pseudomonas from Frederiksberg ), Gram-negative Pseudomonas ( Pseudomonas graminis ), Pseudomonas jejuni ( Pseudomonas jessenii ), Korean Pseudomonas ( Pseudomonas koreensis ), Korean Pseudomonas ( Pseudomonas koreensis ), Pseudomonas kunmingensis ( Pseudomonas kunmingensis ), Pseudomonas marginale ( Pseudomonas marginalis ), Pseudomonas mycoides ( Pseudomonas moldy ) and Pseudomonas ginseng ( Pseudomonas panacis ), Pseudomonas aeruginosa ( Pseudomonas plecoglossicida ), Pseudomonas sphaeroides ( Pseudomonas poae ), Pseudomonas pseudoalcaligenes ( Pseudomonas pseudoalcaligenes ), Pseudomonas putida ( Pseudomonas putida ), Pseudomonas helveticus ( Pseudomonas reinekei ), Rhizospheric Pseudomonas ( Pseudomonas rhizosphaerae ), Pseudomonas seleniipraecipitans 、Pseudomonas yinchengensis( Pseudomonas umsongensis ), Pseudomonas zhaodongensis ( Pseudomonas zhaodongensis ), Pseudonocardia alaninophila ( Pseudonocardia alaniniphila ), Pseudonocardia ammoniaoxidans ( Pseudonocardia ammonia oxidizer ), Pseudonocardia autotrophica ( Pseudonocardia autotrophica )、Pseudonocardia gongjuensis( Pseudonocardia kongjuensis ), Pseudonocardia yunnanensis ( Pseudonocardia yunnanensis ), soil pseudo-red bacteria ( Pseudorhodoferax solei ), Pseudomonas ohtaensis ( Pseudoxanthomonas Daejeon ), Pseudomonas indica ( Pseudoxanthomonas indica ), Pseudomonas kaohsiungensis ( Pseudoxanthomonas kaohsiungensis ), Psychrobacterium aquaticum ( Psychrobacter aquaticus ), Psychrobacterium arcticum ( Psychrobacter arcticus ), fast-growing psychrophilic bacteria ( Psychrobacter celer ), Psychrobacterium marinum ( Psychrobacter marincola ), Psychrobacterium maritima Psychrobacter nivimaris ), Okhotsk Psychrophilic Bacillus ( Psychrobacter okhotskensis), Okhotsk Psychrophilic Bacillus ( Psychrobacter Okhotsk ), Psychrobacter piscatorii , Psychrobacterium pulmonaryis ( Psychrobacter lung )、Ginsenoside Proteus( Ramlibacter ginsenosidimutans ), Rheinheimerella japonicum ( Rheinheimer Japanese ), from Muenzenberg Rheinheimerella Rheinheimera muenzenbergensis ), soil Rheinheimerella ( Rheinheimera solei ), Tangshan Rheinheimerella ( Rheinheimera tangshanensis ), Rheinheimerella texas ( Rheinheimera texasensis ), Rheinheimerella tilapia ( Rheinheimer tilapia ), Rhizobium alaomii ( Rhizobium alamii ), Rhizobium azibense , Rhizobium binae , field rhizobia ( Rhizobium daejeonense ), endophytic rhizobia ( Endophytic Rhizobium ), Rhizobium erythri Rhizobium etli ), Rhizobium fabaefolium ( Rhizobium bean ), Rhizobium freirei 、Rhizobium gallicum Rhizobium gallicum )、Loess Rhizobium ( Rhizobium loessense ), Rhizobium rootstock , Taibaishan Rhizobium ( Rhizobium taibaishanense ), Rhizobium glutamicum ( Rhizobium valley ), Cowpea Rhizobium ( Rhizobium of vineyards ), Cowpea Rhizobium ( Rhizobium of vineyards )、Yangling Rhizobium( Rhizobium yanglingense ), Rhodococcus bycol ( Rhodococcus baikonurensis ), Rhodococcus enclensis , Rhodoferax saidenbachensis , Rickettsia canadensis ( Rickettsia Canadian ), Heilongjiang Rickettsia ( Rickettsia heilongjiangensis ), Vernorickettsia ( Rickettsia honei ), Rickettsia laotii ( Rickettsia raoultii ), aquatic rose-colored semi-photosynthetic bacteria ( Roseateles aquaticus ), aquatic rose-colored semi-photosynthetic bacteria ( Roseateles aquaticus ), Salmonella enterica subsp. Salmonella enterica subsp. greetings ), Serratia marcescens ( Serratia farm ), Serratia marcescens ( Serratia myotis ), Serratia vascularis ( Serratia of the bat ), Shewanella tidalis ( Shewanella estuarine ), Shewanella decoloris ( Shewanella discoloration), Sphingobacterium spp. Sphingobium amiense ), Sphingobium baderi , Sphingobium barthaii , Sphingobacterium chlorfenapyr Sphingobium chlorophenolicum ), copper-resistant sphingobacterium ( Sphingobium cupriresistens ), Czech Sphingomonas ( Sphingobium czechense )、Sphingobacterium avium( Sooty Sphingobium ), Sphingobacterium indica ( Sphingobium indica ), Sphingobacterium indica ( Sphingobium indica ), Sphingobacterium sojae Japanese Sphingobium ), lactose-assimilating sphingobacterium ( Sphingobium lactosutens ), Sphingomonas dokshimaensis ( Sphingomonas dokdonensis ), Sphingomonas pseudohaemophilus ( Sphingomonas pseudosanguinis ), Sphingobacterium chilensis ( Sphingopyx Chilean ), Sphingobacterium freiburgii ( Sphingopyxis fribergensis ), Sphingobacterium granulosum ( Sphingopyxis granule ), Sphingobacterium indica ( Sphingopyxis indica ), Sphingobacterium wittfloria ( Sphingopyxis witflariensis ), Staphylococcus aureus , Staphylococcus aureus subsp. aureus ( Staphylococcus aureus subsp. golden ), Staphylococcus epidermidis, Staphylococcus aureus subsp. neomyciniferum ( Staphylococcus hominis subsp. novobiosepticus ), Staphylococcus nepalensis, Staphylococcus saprophyticus bovis ( Staphylococcus saprophyticus subsp. cattle ), Staphylococcus sciuri subsp. carnosus ( Staphylococcus scurius subsp. carnatic ), Streptomyces nigrocyanus ( Streptomyces blue-green ), Streptomyces canariensis ( Streptomyces canarius ), Streptomyces carbomeris ( Streptomyces let's catch ), Streptomyces caucasus ( Streptomyces ciscaucasicus ), Streptomyces grisea Streptomyces grayish-reddish ), Streptomyces olivinevinus ( Streptomyces olivaceoviridis ), Streptomyces panacyracides 、Streptomyces rubrum Streptomyces phaeopurpureus ), Streptomyces pseudovenezuelae ( Streptomyces pseudovenezuelae ), Streptomyces resistant to Streptomyces resistomycificus ), sediment Tan Tianwei bacteria ( Tianweitania sediment ), Tsukamurella microvariata ( Tsukamurella poor metabolism )、Guangxi Greedy Fungus( Variovorax guangxiensis ), Alkaliphilic Vogelsella Vosges alkaliphile ), Xanthomonas aeruginosa ( Xanthomonas arboricola ), Xanthomonas sphaeroides ( Xanthomonas axonopods ), Xanthomonas cassavaensis ( Xanthomonas cassavae ), Xanthomonas cucumerinoides ( Xanthomonas squash ), Xanthomonas thunbergii ( Xanthomonas cynarae ), Xanthomonas euphorbia ( Xanthomonas bladder-sparing ), Xanthomonas fragariae ( Xanthomonas fragariae ), Xanthomonas gasseri ( Xanthomonas gardener ), Xanthomonas aeruginosa ( Xanthomonas perforans ), Xanthomonas pisum ( Xanthomonas piscifolia ), Xanthomonas populus ( Xanthomonas populi ), Xanthomonas vasicola 、 Aerobic heterotrophic bacteria ( Xenophilus aerolated ), Yersinia nurmii 、Weak oligotrophic bacteria ( Defective abiotrophy ), Lysinococcus Aminolytic acidophilus )、Acinetobacter guangdongensis( Acinetobacter guangdongensis )、Acinetobacter parvum( Acinetobacter small ), Acinetobacter radioresistance ( Radioresistant Acinetobacter ), Acinetobacter spp. Acinetobacter soli ), Acinetobacter variabilis ( Acinetobacter variabilis ), Actinomyces Cardiffensis ( Actinomyces cardiffensis )、Actinomyces dentata( Actinomyces dentalis ), European Actinomycetes ( Actinomyces europaeus ), Actinomyces gordonii ( Actinomyces gerencseriae ), Actinomyces graminearum ( Actinomyces graevenitzii ), Actinomycetes abalone ( Actinomyces haliotis ), Actinomyces johnsonii ( Actinomyces johnsonii )、Actinomyces marseilles( Actinomyces massiliensis ), Actinomyces meyeri ( Actinomyces meyeri ), Actinomyces meyeri ( Actinomyces meyeri ), Actinomyces naeslundii, Actinomyces nitrogena subsp. Actinomyces neuii subsp. ducked ), Actinomycetes dentolyticus, Actinomycetes oralis ( Actinomyces mouth ), Zurich Actinomycetes ( Actinomyces turicensis ), Actinomycetospora corticicola , Actinobacillus stutzeri ( Actinotignum schaalii ), Aeromonas korovii ( Aerococcus christensenii )、Ureaplasma urea Urinary aerococcus )、Yellow Aeromicrobium( Aeromicrobium yellow )、Aeromicrobium Marseilles( Aeromicrobe from Massilia )、Tamra Aeromicrobacteria( Aeromicrobium tamlense ), Aeromonas samana ( Aeromonas sharma ), Bacillus agglutinans ( Aggregatibacter aphrophilus ), Bacillus inergens ( Aggregatibacter segnis ), Agrobacterium glabrata ( Agrococcus baldri)、White Bacillus formaldehyde-eating bacteria ( Albibacter methylovorans ), Alcaligenes faecalis subsp. faecalis ( Alcaligenes faecalis subsp. fecal ), Psychrophila rafaelii ( Algoriphagus ratkowskyi ), Bacillus oleifera ( Alkalibacterium olivepovliticus ), marine surface community alkali bacillus ( Alkalibacterium pelagium ), marine surface community alkali bacillus ( Alkalibacterium pelagium ), Prevotella lavavaiensis ( Alloprevotella rava ), metal-resistant Bacillus Alsobacter metallidurans ), Amaricoccus kaplicensis , Verona sewer bacteria ( Amaricoccus veronensis ), hydrogen-producing anaerobic cocci, lactolytic anaerobic cocci ( Anaerobacterium lactolytic ), Anaerobic Murdochococcus ( Anaerococcus murdochii ), anaerobic cocci ( Anaerococcus octavius ), Anaerobic cocci of Provo, Anaerobic cocci of vagina ( Anaerococcus vaginalis ), Bacillus citrinum ( Aquabacterium citratiphilum )、Oilwater Bacillus( Aquabacterium oil )、Oilwater Bacillus( Aquabacterium oil )、Aquabacterium parvum( Aquabacterium small ), tert-butyl alcohol decomposing bacteria ( Aquincola tertiary carbonis ), Arcobacter cerevisiae ( Arcobacter venerupis ), Arsenicoccus boeri ( Arsenicicoccus bolidensis ), Arthrobacter russicus 、 Sticky notes eccentric ), Atopobium deltae 、Very small strange bacteria ( Atopobium minor ), Pseudomonas gingivalis ( Atopobium cracks ), Vaginal bacteria ( Atopobium vaginae ), Aureomonas Altamira ( Aureimonas altamirensis ), Erythrochromogenes ( Aureimonas rubiginosa )、Yan fungus( Azospira oryzae ), Azospirillum oryzae ( Azospirillum rice ), Bacillus circulans ( Bacillus circulating ), Bacillus sp. Bacillus drentensis ), Bacillus fastidiosa ( Bacillus fastidious ), Bacillus lehense Bacillus lehensis ), marine sediment Bacillus ( Bacillus oceanic ), Rhizobacterium Rhizosphaera Bacillus ), Vibrio stolpeii ( Bacteriovorax stolpii ), Bacteroides coagulans ( Bacteroides coagulans ), Bacteroides fragilis, Bacteroides ovale, Bacteroides faecalis, Bacteroides monomorpha, Bacteroides vulgaris, Bdellovibrio phagocytophilum ( Bdellovibrio bacteriovorous )、Exotic Bdellovibrio ( Bdellovibrio exovorus ), Bielnapus moabensis ( Belnapia Moabite ), soil B. Belnapia sole ), Blautia henselae, Blautia ovata, Blautia weissneri, Bosella lathyris ( Bosea lathyri ), Brachybacterium fresconis , Brevibacterium muris Brachybacterium muris )、Breibacterium ammonialyticum( Brevibacterium ammoniolyticum )、Brexibacterium casei( Brevibacterium casei ), Brevibacterium epidermidis ( Brevibacterium epidermidis ), Brevibacterium iodineum ( Brevibacterium iodine ), Brevibacterium fulvurum ( Brevibacterium luteolum ), Brevibacterium sparserum ( Brevibacterium paucivorans ), Brevibacterium pine moth ( Brevibacterium pityocampae ), Brevibacterium sanguineus ( Brevibacterium sanguinis ), Brevundimonas albigilva , Brevundimonas diminuta ( Brevundimonas diminuta ), Brevundimonas vancanneytii , Land sludge monas ( Caenimonas of land ), Indian calidiformis ( Calidifontibacter indicus ), Campylobacter concise, Campylobacter tenuissima ( Campylobacter gracilis ), Campylobacter hominis ( Campylobacter hominis ), Campylobacter rectum ( Campylobacter rectus ), Campylobacter showa ( Campylobacter showae urealyticum ( Campylobacter ureolyticus gingivalis, Capnocytophaga leadbetteri 、Capnocytophaga chrysogenum Capnocytophaga ochracea ), Capnocytophaga sputumigenica ( Capnocytophaga sputigena )、Cirrhobacterium spp. Human cardiobacterium ), Cardiomycetes valvularis ( Cardiobacterium valves ), Carnobacterium spp. Carnobacterium divergens ), disease Catto bacteria ( Catonella disease ), Caulobacter henselae ( Caulobacter henricii )、Underground cavity bacteria ( Little horse underground ), Xylanolyticum cellulomonas ( Cellulomonas xylanilytica ), Vibrio vulgaris ( Cellvibrio vulgaris ), Chitinomonas formosanus ( Chitinimonas taiwanensis ) Chryseobacterium arachidis )、Chryseobacterium daqinghuense ( Chryseobacterium daecheongense )、Chryseobacterium follicularis( Chryseobacterium formosense )、Chryseobacterium follicularis( Chryseobacterium formosense )、Chryseobacterium chlororaphis( Chryseobacterium greenlandense )、Chryseobacterium indologenes ( Chryseobacterium indologenes)、Chryseobacterium ichthyobacterium( Chryseobacterium fish )、Chryseobacterium salsa ( Chryseobacterium rigui ), Chryseobacterium solani ( Chryseobacterium nightshade ), Taklimakan Chryseobacterium ( Chryseobacterium taklimakanense ), Chryseobacterium urealyticum ( Chryseobacterium ureolyticum ), Chryseobacterium urealyticum ( Chryseobacterium ureolyticum ), Chryseobacterium zeae ( Chryseobacterium zeae ), Chryseobacterium aureum ( Chryseomicrobium aureum ), Bacillus abalone ( Cloacibacterium haliotis ), Cloacibacterium normanense , Norman Pipe bacillus Cloacibacterium normanense ), Collinsella aerogenes, Comamonas denitrificans ( Comamonas denitrifying ), Comamonas terrestris ( Comamonas terrigena ), crowded Corynebacterium, nonfermenting Corynebacterium lipophilum subsp. Corynebacterium afermentans subsp. lipophilic ), Corynebacterium ammoniagenes, Corynebacterium amycoticum, Corynebacterium aureum ( Corynebacterium aurimucosum ), Corynebacterium aureum ( Corynebacterium aurimucosum ), Corynebacterium coyle ( Corynebacterium coyleae ), Corynebacterium durum Corynebacterium durum ), Corynebacterium Freiburg ( Corynebacterium Freiburg ), Corynebacterium glaucum ( Corynebacterium glaucum ), Corynebacterium glycyrrhizicum ( Corynebacterium glyciniphilum )、Corynebacterium iminei ( Corynebacterium imitans ), Corynebacterium jejuni ( Corynebacterium jeikeium ), Corynebacterium jejuni ( Corynebacterium jeikeium ), Corynebacterium kojicianum ( Corynebacterium kroppenstedtii ), Lipophilic yellow Corynebacterium ( Corynebacterium lipophilic yellow ), Corynebacterium massiliense ( Corynebacterium massiliense ), Corynebacterium mastitidis ( Corynebacterium mastitis ), Corynebacterium martensii ( Corynebacterium matruchotii ), Corynebacterium microti, Corynebacterium mucosum ( Corynebacterium mucifaciens ), Corynebacterium ferretti Corynebacterium weasels ), mycelial Corynebacterium ( Corynebacterium mycetoides ), Corynebacterium pyruvate-producing ( Corynebacterium pyruviciproducens ), Corynebacterium simulans ( Corynebacterium simulans ), Corynebacterium spp. Corynebacterium singular ), sputum Corynebacterium ( Corynebacterium sputum ), Corynebacterium suicordis , Corynebacterium tuberculosis ( Corynebacterium tuberculostearicum ), Corynebacterium tuberculosis ( Corynebacterium tuberculostearicum ), Corynebacterium ureicelerivorans , Corynebacterium variotii ( Corynebacterium variabilis ), Koch's cyanobacterium subsp. cyanobacteria ( Couchioplanes caeruleus subsp. caeruleus ), metal-resistant copper-greedy bacteria ( Copper-seeking metal-during ), Bacillus brevis ( Curtobacterium herbarium ), excitatory Dechloromonas ( Dechloromonas agitata ), Deinococcus actinosclerus 、Deinococcus Antarctica Deinococcus antarcticus ), Deinococcus sludge ( Deinococcus caeni ), Deinococcus figi ( Deinococcus ficus ), Deinococcus thermophilus ( Deinococcus geothermalis ), Deinococcus radiodurans ( Deinococcus radiodurans ), Deinococcus urumqiensis ( Deinococcus wulumuqiensis ), Xinjiang Deinococcus ( Deinococcus xinjiangensis ), human skin bacteria ( Dermabacter of man ), vaginal dermatobacterium ( Dermabacter vaginalis ), Dermestococcus nishinomiya( Dermacoccus nishinomiyaensis )、Undetermined Deku bacteria ( Uncertain desemzia )、Rosobacterium deserticola ( Desertibacter roseus ), Listeria monocytogenes The unpopular dialer ), Listeria monocytogenes ( Dialister microaerophilus ), Listeria monocytogenes propioni Dialister propionificaciens ), Dietzia aurantiaca ( Dietzia aurantiaca ), Dietzia chinensis Dietzia cercidiphylli ), Dietzia dioica ( Dietzia timorensis ), Dietzia dioica ( Dietzia timorensis ), Korean Dokshila bacteria ( Dokdonella koreensis ), Korean Dokshila bacteria ( Dokdonella koreensis ), Lazy and cunning cocci ( Dolosigranulus lazy )、Eikenella corrosa( Eikenella corrodens ), Elizabeth Millipore Elizabethkingia miricola )、Ersterella maritima( Elstera littoralis ), Bacillus brevis ( Empedobacter brevis ), Air-sac aquatic bacteria ( Enhydrobacter airbag )、Xiangfang Enterobacter( Enterobacter xiangfangensis ), Enterococcus aquimarinus ( Enterococcus aquamarinus ), Enterococcus faecalis, Enterococcus oleifera ( Enterococcus olivaceae ), Erwinia rhubarb, Eubacterium fastidiosa ( Eubacterium electigens )、Eubacterium scaly Eubacterium infirm ), Eubacterium rectum, Eubacterium occultum ( Eubacterium saphenum ), Eubacterium sulcatum ( Eubacterium sulci ), Exiguobacterium mexicana ( Exiguobacterium mexicanum ), Facklamia tabacinasalis 、Halophilic Roseobacterium Falsirrhodobacter halotolerans), Fingoldia spp., Hirudinobacterium epidermidis ( Flavobacterium skin-like ), lindane-resistant Flavobacterium Flavobacterium lindanitolerans ), Resistant Flavobacterium ( Flavobacterium resistant ), Freundliella capsulatum ( Friedmanniella capsulata ), Fusobacterium nucleatum subsp. polymorphum ( Fusobacterium nucleatum subsp. polymorphic ), Gemini cocci ( Twin hemolytic ), Gemini cocci ( The twin of measles ), Gemini coccus canis ( Twin Palatine ), Gemini cocci ( Blood twin ), Bacillus aquaticus ( Gemmobacter aquaticus ), Bacillus sphaeroides ( Gemmobacter sene ), Gordonia jinhuaensis ( Gordonia jinhuaensis ), Gordonia coli ( Gordonia kroppenstedtii ), Gordonia polyisoprenosum ( Gordonia polyisoprenivore ), Gordonia polyisoprenosum ( Gordonia polyisoprenivorans ), adjacent to particle Streptococcus ( Granulicatella adiacens ), Streptococcus elongatus ( Granulicatella elegans ), Haemophilus parainfluenzae ( Haemophilus parainfluenzae ), Haemophilus sputum Haemophilus sputum ), Sulfide mineralizing bacteria ( Halomonas sulfididaeris )、Orange Smoothia sphaeroides( Herpetosiphon aurantiacus )、Extended hydrocarbon-eating bacteria ( Hydrocarbon-eating glutton )、Haihaiyuan bacteria( Idiom of the sea )、Anopheles davidianus( Anopheles Janibacter )、Hoy Janus Janibacter hoylei )、Indian Janus( Janibacter indicus )、Mud two-sided fungus ( Janibacter slimy )、Gua Liangmian Shen Mushroom( Janibacter melon ), Halophilic Seafood Coccus ( Jeotgalicoccus halophilus ), Jonquetella anthropi , Kaistia geumhonensis , Denitrifying Kingella ( Kingella denitrificans ), Kingella oralis ( Kingella oral ), Klebsiella oxytoca, Nourella aeruginosa ( Knoellia aerolata ), peaceful place Noursella Knoellia locipacati ), Atrial Cook bacteria ( Black Kocuria ), Cook bacteria ( Kocuria carnivorous ), Kochnerella kirschniki ( Kocuria kristinae )、Palmeresurus palustris( Marsh Kocuria )、Turpan Kukko bacteria ( Kocuria turfanensis ), Anaerobic Bacillus thunbergii ( Lachnoanaerobaculum saburreum ), Anaerobic Bacillus thunbergii ( Lachnoanaerobaculum saburreum )、Lactobacillus crispatus( Lactobacillus curly ), Lactobacillus iners, Lactococcus lactis subsp. lactis ( Lactococcus lactis subsp. lactis ), Lactococcus lactis subsp. lactis ( Lactococcus lactis subsp. lactis )、Lactococcus piscine( Lactococcus fish )、Jeju Island Microlithospermum ( Lapillicoccus jejuensis ), L. mirabilis ( Lautropy wonderful ), Legionella Belliae Legionella beliardensis ), Buccal Leptotrichia ( Leptotrichia oral ), Goodfellow's ciliate ( Leptotrichia goodfellowii ), Leptotrichia herxovii ( Leptotrichia Hofstadium ), Leptotrichia hongkongensis ( Leptotrichia hongkongensis ), Leptotrichia sabralinarum ( Leptotrichia Shahi ), Leptotrichia terreniformis ( Leptotrichia trevisanii ), Leptotrichia wadeii ( Leptotrichia wadei ) Luteimonas terricola ), Lysinibacillus spinulosus ( Lysinibacillus fusiform ), Lysobacterium spongiosum ( Lysobacter spongiicola ), Xinjiang Lysobacterium Lysobacterium from Xinjiang ), Macrococcus caseilyticus ( Macrococcus caseolyticus )、Pocheon Marble Fungus( Marmoricola pocheonensis )、Slag marble carving fungus( Slag marble ), alkali-resistant Marseille bacteria ( Massilia alkalitolerans ), alkali-resistant Marseille bacteria ( Massilia alkalitolerans )、Golden Marseilles( Golden Massilia )、Folded Marseilles( Folded Massilia ), Timoney Marseille, Megamon from Rupel , Thermus silvanus Meiothermus silvanus ), Methylobacterium danssonii ( Methylobacterium dankookense )、Methylobacterium coelicolor( Methylobacterium goesingense )、Methylobacterium coelicolor( Methylobacterium goesingense ), Methylobacterium isbiliense 、Methylobacterium salsa Methylobacterium jeotgali ), Methylobacterium oxalicum ( Methylobacterium oxalidis ), Methylobacterium sylvestris, Methylobacterium pseudosasicola , Methylophilus univus Methyloversatilis universalis ), Microbacterium spp. Leaf microbacterium ), Microbacterium hydrothermosus ( Hydrothermal microbacterium ), Microbacterium hydrothermosus ( Hydrothermal microbacterium ), Lactobacillus ( Lactic acid bacteria ), Lactobacillus ( Lactic acid bacteria ), Microbacterium levangensis ( Microbacterium laevaniformans )、Microbacterium palustris ( Microbacterium paludicola )、Microbacterium petroleum ( Microbacterium petroleum ), Microbacterium sphaeroides ( Microbacterium phyllosphaera ), Microbacterium resistant ( Resistant microbacterium ), Micrococcus Antarctica ( Micrococci Antarctic ), Micrococcus cohnii ( Micrococcus cohnii ), Micrococcus aureus ( Micrococcus flavus ), Micrococcus lyrae ( Micrococcus lylae ), Micrococcus terrestris ( Micrococcus terreus )、Orange Moon Mushroom( Orange-colored microlunatus ), Glycogenous White Frost Fungus ( Micropruina glycogenica ), Microbacterium aeruginosa ( Microwire aerating ), Microbacterium aeruginosa ( Microwire aerating ), Microbacterium subterraneum, Microbacterium cowpea ( Microvine vine ), Microbacterium zambiense ( Microvirga zambiensis ), aerobic denitrifying microbacterium ( Aerodenitrifying microorganisms ), Clostridium difficile ( Mogibacterium timid ), Moraxella atlantica ( Moraxella atlantae ), Moraxella catarrhalis ( Moraxella catarrhalis ), Morganella morganii subsp. morganii ( Morganella morganii subsp. Morgan ), Psychrotolerant Morganella ( Morganella psychrotolerans ), Murdochia saccharolytica ( Murdochiella asaccharolytica ), Mycobacterium asiatica ( Mycobacterium asiaticum ), Mycobacterium truncatum ( Mycobacterium chubuense ), Mycobacterium saffronii ( Mycobacterium crocinum ), Mycobacterium caddisefii ( Mycobacterium gadium ), Mycobacterium Holsteine ​​( Mycobacterium holsaticum ), Mycobacterium spp. Iranica Mycobacterium iranicum ) Mycobacterium longobardum , Mycobacterium neogoldensis, Mycobacterium neogoldensis, Mycobacterium aubu, Succinic acid-negative cocci ( Negativococcus succinicivorans ), Neisseria bacilliformis ( Neisseria bacilliform ), oral Neisseria ( Oral Neisseria ), dry Neisseria ( Neisseria sicca ), Neisseria flavescens, Nesterenko aihuensis ( Nesterenkonia lacusekhoensis ), rhizospheric Nesterenko Nesterenkonia rhizosphaerae ), Nevskiya persephone , Nevarrinella Nevsky branched )、Niabaea yanshanensis( Niabella yanshanensis ), Snow bacteria of the moisture , Nocardia nivarensis ( Nocardia niwae ), Nocardia thailandica, Nocardia agarophilus ( Nocardioides agariphilus ), diluted Nocardia ( Nocardioides dilutus ), Ganghwa Island Nocardia ( Nocardioid from Ganghwa ), and Nocardia species ( Nocardioides hwasunensis ), Nocardia spp. Nocardioides nanhaiensis ), sediment Nocardia ( Nocardioides sediments ), Nosocomiicoccus ampullae 、New Grass Spirillum Soft Asphalt Noviherbaspirillum malthae ), cotton neosphingobacterium, rose neosphingobacterium ( Neosphingobium rosea ), Ochrobacterium rhizosphericum ( Ochrobacterium rhizospheres gingivalis ( Olsenella uli ), Ornithine Microbacterium ( Ornithinimicrobium wall )、Ornithine Microbacterium Tianjin ( Ornithinimicrobium tianjinense )、Land rice koji fungus ( Oryzobacter of land ), Ottoella beijingensis ( Ottowia beijingensis ) Paenalcaligenes Suwon ), Paenibacillus agarophilus ( Paenibacillus agaridevorans ), Paenibacillus rubrum ( Paenibacillus phoenicis )、Bacillus xylanolyticus ( Paenibacillus xylanexedens ), Paecilomyces yongeii ( Paludibacterium yongnupense )、Pantotrichum cypripedium( Cypripedium pantoea ), Parabacteroides distichous, and Burkholderia androstegia ( Paraburkholderia andropogonis ), Paracoccus alkaliphilus ( Paracoccus alcaliphilus ), Paracoccus angustifolia ( Paracoccus angustifolia ), Paracoccus kocurii ( Paracoccus kocurii ), Paracoccus laeviglucosivorans 、Paracoccus sediments Paracoccus sediment ), Paracoccus swainsonii ( Paracoccus sphaerophysae ), Paracoccus jirovecii ( Paracoccus yes ), Micromonas parvum, Parviterribacter multiflagellate , Paenibacillus ginseng Patulibacter ginseng land ), aquatic soil bacteria ( Pedobacter aquaticus ) and Ginseng Soil Bacillus ( Pedobacterium ginseng only )、Xixi Soil Bacillus ( Pedobacter xixiisoli ), Peptococcus nigra ( Peptococcus black ), Peptoniphilus coxii , Peptiphila Gorbachev Peptoniphilus gorbachii), Peptophilus Hallei, Peptophilus Kluyveri ( Peptoniphilus koenoeneniae ), Peptophilus lacrimalis ( Peptoniphilus lacrimalis ), anaerobic Peptostreptococcus ( Peptostreptococcus anaerobic ), Peptostreptococcus gastricis ( Peptostreptococcus stomata ), Pseudomonas aeruginosa ( Phascolarctobacterium faecium ), Haemophilus influenzae ( Phenylobacterium haematophilum ), Kunshan phenylbacterium ( Phenylobacterium kunshanense )、Rigouweiduoyuan bacteria( Pluralibacter gergoviae ), Polymorphobacter multimanifer , Porphyromonas benthamiana ( Porphyromonas bennonis ), Porphyromonas endodontics, Porphyromonas gingivalis, Porphyromonas gingivalis canis ( Porphyromonas gingivicanis ), Porphyromonas pastoris ( Porphyromonas pastoris ), Porphyromonas bogonadotrophinus ( Porphyromonas pogonae ), Porphyromonas sordellii ( Porphyromonas somerae ), Povalibacter of grapes 、Prevotella aurantiaca Prevotella aurantiaca ), Prevotella pasteurianum, Prevotella diversiformis, Prevotella buccalis ( Mouth ulcers ), Prevotella buccalis ( Oral thrush ), fecal Prevotella, human Prevotella ( Body hair ), Prevotella dentata ( Prevotella toothpick ), Prevotella spp. Prevotella enoeca ), Prevotella tissue-dwelling Prevotella small talk ), Prevotella intermedia, Prevotella jejuni, Prevotella jejuni, Prevotella punctata ( Spotted Prevotella ), Prevotella melaninogenica, Prevotella melanogenica, Prevotella rainbowi, Prevotella polymorpha ( Prevotella multiformis )、Nanchong Prevotella ( Prevotella nanceiensis ), Prevotella nigra, Prevotella oralis ( Mouth ulcer gingivitis ( Prevotella of the eyes ), Prevotella pallidum ( Prevotella pallens pleuriticum ( Prevotella pleurisy ), Prevotella glycolytica ( Prevotella saccharolytica ), Prevotella salivarius, Prevotella salivarius ( Prevotella shahii ), Prevotella timonene ( Prevotella timonensis ), true oral Prevotella, Propionibacterium acidogenicum ( Propionibacterium acidifaciens acnes subsp. acnes ( Propionibacterium acnes subsp. acne acnes subsp. acnes ( Propionibacterium acnes subsp. acnes acnes subsp. longum ( Propionibacterium acnes subsp. elongated ), Propionibacterium granulosum ( Propionibacterium granulosum ), Lymphotrophic Propionibacterium, Propionibacterium toxoplasminum ( Propionispira arcuata ), Pseudomonas portugalensis ( Pseudokineococcus lusitanus ), Pseudomonas aeruginosa, Pseudomonas chengduensis ( Pseudomonas chengduensis ), Pseudonocardia benzylvorans ( Pseudonocardia benzene-eating ), Pseudorhodoplanes sinuspersici , Haemophilus influenzae Psychrobacter blood )、Ginsenoside Proteus( Ramlibacter ginsenosidimutans ), Rheinheimerella water ( Rheinheimera aquimaris ), Rhizobium apiospermidis ( Rhizobium of the river ), Rhizobia field, Rhizobia rhizobia ( Rhizobium larrymoorei ), Rhizobium rhizoryzae 、Soil Rhizobium( Rhizobium soil ), Taibaishan rhizobium, cowpea rhizobium, liquorice rhodendrobacterium ( Rhodanobacter glycine )、Rhodobacterium vickersii( Rhodobacter veldkampii ), Rhodococcus enclensis 、Rhodococcus spp. Rhodococcus bandage ), Rhodococcus spp.( Rhodococcus fascians ), Rhodovarius lipocyclicus 、Pingtung Riverside Fungus( Rivicola pingtungensis ), Roseburia glucosaccharophyta, Rosenbergiella nectarea 、Aerial Roseomonas Roseomonas aerilata ), Roseomonas aquaticus ( Roseomonas aquatica ), Roseomonas mucilaginosa ( Roseomonas mucosa ), Roseomonas rosea ( Roseomonas rosea ), Roseomonas vinifera ( Roseomonas vinacea ), airborne Roseburia ( Rothia aerea ), Roseburia spp. Bitter gourd ), Roseburia dentata ( Rothia dentocaryosa ), Endophytic Roseburia ( Rothia endophytica ), Roseburia mucilaginosa ( Rothia mucilaginosa ), Roseburia murinus ( Rothia nasimurium ), mesophilic erythrocytes ( Rubellimicrobium mesophilum )、Pink reddish bacteria( Rubellimicrobium roseum ), Rubrobacter bracarensis , Rudaea cellulolytica , active rumen cocci, corn archaea ( Runella zeae ), Saccharopolyspora serrata ( Saccharopolyspora rectivirgula ), Qingdao saltwater coccus ( Salinicoccus qingdaonensis ), Veguskadoviya ( Scardovia wiggsiae ), ginseng soil sediment rod-shaped bacteria ( Sediminibacterium ginsengisoli ), Selenomonas Artemisinin ( Selenomonas Artemis), infection with Selenomonas ( Selenomonas infelix ), Selenomonas putida ( Selenomonas noxis ), Selenomonas sputumigensis ( Selenomonas sputigena ), Shewanella tidalis, Shotworthia satellite ( Shuttleworthia satellis ), Simonsella milleri ( Simonsiella muelleri ), Aeromonas scleroderma ( Skermanella aerolata ), Antimony-resistant Skelmanella ( Skermanella stibiiresistens ), Snaeckeria selaginella ( Slackia exigusa )、Micrococcus Niigata ( Smaragdicoccus niigataensis ), blood red cilia ( Sneathia sanguinegens ), soil Rhodobacterium Solirubrobacter soli ), Sphingobacterium sludge ( Sphingobacterium mud ), Sphingobacterium ohtaensis ( Sphingobacterium daejeonense ), Sphingobacterium spp. Sphingobacterium hotanense ), Sphingobacterium kymogenes ( Sphingobacterium Kyonggi ), Sphingobacterium multivorum ( Sphingobacterium multivorum ), nematicidal Sphingobacillus ( Sphingobacterium nematocida ), Sphingobacterium sphaeroides ( Sphingobacterium spiritivorum ), Ajian Sphingobacterium, Indian Ocean Sphingobacterium ( Sphingobium indica ), lactose-assimilating sphingobacterium ( Sphingomyelophytum breastfeeding ), Sphingobacteria subterranea ( Sphingobium subterraneum ), Sphingomonas tachyphylla ( Sphingomonas abaci ), Sphingomonas tidalis ( Sphingomonas estuarine ), Sphingomonas canadensis ( Sphingomonas canadensis ), Sphingomonas dayongensis ( Sphingomonas daechungensis ), Sphingomonas dokshimaensis ( Sphingomonas dokdonensis ), Sphingomonas spinulosa ( Sphingomyelomonas sea ​​urchin ), Sphingomonas Fontica ( Sphingomonas fonticola ), Sphingomonas Fontica ( Sphingomonas fonticola ), Sphingomonas fowleri ( Sphingomonas formosensis ), Sphingomonas gei , Sphingomonas hantaiensis ( Sphingomonas hankookensis ), Sphingomonas hantaiensis ( Sphingomonas hankookensis ), Sphingomonas koreaensis ( Sphingomonas koreensis ), Sphingomonas kyeonggiensis , Sphingomonas lateraria , Sphingomonas mucosa Sphingomonas mucosissima ), Sphingomonas oligophenolica ( Sphingomonas oligophenolica ), Sphingomonas pseudohaemophila, Sphingomonas sediment-dwelling ( Sphingomonas sediminicola ), Sphingomonas saltingensis ( Sphingomonas yantingensis ), Sphingomonas yunnanensis ( Sphingomonas yunnanensis), Sphingobacterium indica, Spirillum salsa Spirosoma rigui ), mesophilic spore-forming acetobacterium ( Sporacetigenium mesophile ), Myxococcosis Sporocytophaga myxococcoides ), Staphylococcus auris ( Staphylococcus auricularis ), Staphylococcus epidermidis, Staphylococcus epidermidis, Staphylococcus aureus subsp. neomycin septicemia ( Staphylococcus hominis subsp. novobiosepticus ), Staphylococcus lugdunensis ( Staphylococcus lugdunensis ), Staphylococcus petenkofer ( Staphylococcus pettenkoferi ), Korean Stenotrophomonas ( Stenotrophomonas koreensis ), Stenotrophomonas rhizophila ( Stenotrophomonas rhizophilous ), Stenotrophomonas rhizophila ( Stenotrophomonas rhizophila ), Streptococcus agalactiae, Streptococcus canis ( Streptococcus canis ), Streptococcus ridge ( Streptococcus cristatus ), Streptococcus Gordonii, Streptococcus infantis, Streptococcus intermedius ( Streptococcus intermedius ), Streptococcus mutans, Streptococcus oligofermentans ( Streptococcus oligofermentans ), oral streptococci, streptococci ( Streptococcus sanguis ), Streptomyces iconiensis , Streptomyces yanglingensis ( Streptomyces yanglinensis ), Aquatic Bacillus tabrizii ( Aquatic tabrizicola ), Tahibacter mud , Tannerella forsythiae Tannerella forsythia ), Xavier's tepidicella , Tepidimonas fonticaldi , Geococcus luteus ( Yellow terracotta ), Tetrasegococcus flavoscens ( Tessaracoccus flavescens )、Thermus thermophilus ( Thermus thermophilus ), sediment Tan Tianwei bacteria ( Tianweitania sediment ), sediment Tan Tianwei bacteria ( Tianweitian sediment ), Treponema amylovora ( Treponema amylovorum ), Treponema denticola, Treponema lecithinol ( Treponema lecithinolyticum ), Treponema intermedia ( Treponema medium ), Otitis Zurichia coli ( Turicella otitis ), Urebic bacteria, oligocarbapenem-like bacteria ( Undibacterium oligocarbonophile )、Shrimp Water Bacillus ( Shrimp Undibacterium ), salmon roamingococcus ( Vagococcus salmoninarum ), Campylobacter cambrianus ( Varibaculum cambriense ), Vibrio mesenchyma( Vibrio metschnikovii )、Tagetes erecta ( Xanthobacter tagetidis ), aerobic heterotrophic bacteria, arsenic-resistant heterotrophic bacteria ( Xenophilus arseniciresistant )、Orange Cloud Microorganisms( Yellow yamella ), Zimmermanella albicans ( Zimmermannella alba ), Zimmermannii bifidum ( Zimmermannella bifida ) and Sludge-forming bacteria ( Zoogloea mud ).

[0119] In other embodiments, the targeted bacterial cells are those commonly found in the vaginal microbiota and are preferably selected from the group consisting of antiviral Acinetobacter ( Acinetobacter antiviral ), Acinetobacter baumannii, Acinetobacter calcoaceticus ( Acinetobacter calcoaceticus ), Acinetobacter johnsonii, Actinobacillus massiliense ( Actinobaculum from Massilia ), Actinobacillus stutzeri ( Actinobaculum schaalii ), European Actinomycetes, Gram's Actinomycetes ( Actinomyces graevenitzii ), Israeli Actinomycetes, Maier's Actinomycetes, Naessoni's Actinomycetes, New's Actinomycetes, Tooth-soluble Actinomycetes, Zurich Actinomycetes, Urogenital Actinomycetes ( Urogenital Actinomyces ), Actinomycetes viscosus ( Actinomyces viscosus ), Aeromonas kohlii, Aeromonas urea, Aeromonas viridans, Aeromonas anguillarum, Aeromonas salmonicida, Aphidobacterium marseilles ( Afipia massiliensis ), Agrobacterium tumefaciens ( Agrobacterium tumefaciens )、Aquatic psychrophilic bacteria( Algoriphagus aquaticus ), Vibrio vordanense ( Aliivibrio wodanis ), Bacillus finnesii, Differococcus otitidis ( Alliococcic otitis ), Pseudomonas tannerii ( Alloprevotella tanneries ), Omixis scardovya, and epoxide-eating alternating red bacillus ( Altererythrobacter epoxy-divorant ), Oxalate ammoniaphilic bacteria ( Ammoniphilus oxalaticus ), Bacillus amnioticus ( Amnibacterium kyonggiense ), hydrogen-producing anaerobic cocci, lactolytic anaerobic cocci, and Murdoch anaerobic cocci ( Anaerococcus murdochii ), obesity-associated anaerobic cocci ( Anaerococcus obesiensis ), Anaerobic cocci Provo, Anaerobic cocci Tetrasporin ( Anaerococcus tetradius ), vaginal anaerobic cocci, diploid anaerobic cocci ( Anaeroglobus geminatus ), Bacillus pucinus ( Anoxybacillus pushchinoensis ), Aquabacterium microti, Phocidal bacteria ( Arcanobacterium phocae ), Arthrobacter chrysanthemi ( Arthrobacter golden ), non-sticky bacteria, microscopic bacteria ( Atopobium minutum ), Miraculinum microplus, Miraculinum gingivalis ( Atopobium cracks ), vaginal bacteria, Avibacilus gallinarum ( Avibacterium of chickens ), Bacillus acidophilus ( Bacillus acidophilus ), Bacillus atrophaeus ( Bacillus atrophaeus ), Bacillus cereus, Bacillus cereus ( Food bacteria ), Bacillus coahuila ( Bacillus coahuilensis ), Bacillus dashanensis ( Bacillus gaemokensis )、Bacillus methanolicus( Methanolic Bacillus )、Vegetable Bacillus( Bacillus oleronii ), Bacillus pumilus, Bacillus sabdariffa ( Bacillus shackletonii )、Thermotolerant Bacillus( Bacillus sporothermodurans ), Bacillus subtilis, and Bacillus luminescens ( Bacillus Wako ), Bacillus weihenstephensis ( Bacillus weihenstephanensis ), Bacteroides pasteurii ( Bacteroides Barnes ), Bacteroides coagulans, Bacteroides domitilis, Bacteroides faecalis, Bacteroides flexneri ( Bacteroides forsythus ), Bacteroides fragilis, Bacteroides nosei, Bacteroides ovale, Bacteroides salierei, Bacteroides faecalis, Bacteroides monomorpha, Bacteroides vulgaris, Bacteroides xylanolyticus, Bacteroides agglutinans ( Bacteroides zoogleoformans ), Barnesella enterica ( Barnesiella viscericola ), Research Center Hagwanella ( Bhargavaea cecembensis ), Bifidobacterium adolescentis, Bifidobacterium bifidum, Bifidobacterium breve, Bifidobacterium denticulate, Bifidobacterium longum infantis subsp. Bifidobacterium Logum subsp. infantis ), Bifidobacterium longum, Bifidobacterium pseudoschizophyllum, Bifidobacterium scardovii ( Bifidobacterium scardovii ), Bilophila voroni, Hydrogenotrophic Blautia, Blautia ovata ( I am dying. ), producing Blautia, Brevibacterium faecium ( Brachybacterium faecium ), Bradyrhizobium japonicum, Brevibacterium mcbry Brevibacterium mcbrellneri ), Brevibacterium otitidis ( Brevibacterium restlessness ), Brevibacterium paucivorum, Braydactylum lentifolium ( Bulleidia constructed ), the fungus Burkholderia Burkholderia fungi ), Burkholderia phenoliruptix , sugar-degrading and pyrolytic cellulose bacteria ( Caldicellulosiruptor saccharolytic ), Thermomonas formosanus ( Caldimonas taiwanensis ), Campylobacter gracilis, Campylobacter hominis, Campylobacter sputum ( Campylobacter sputum ), Campylobacter urealyticus, Capnocytophaga chrysogenum, Cardiomycetes, Caenorhabditis elegans, Chlamydia trachomatis, Chlamydia abortus ( Chlamydophila abortus ), Chondroitinibacterium crassipes ( Chondromyces robustus )、Chryseobacterium aquatica ( Chryseobacterium aquaticum ), Citrobacter youngii, Cloacibacterium normanense , Clostridium Cavendish Clostridium cavendishii ), Clostridium canis ( Clostridium coli ), Clostridium jejuense ( Clostridium jejuniensis ), Clostridium perfringens, Clostridium difficile, Clostridium sordellii ( Clostridium sordellii ), Clostridium velii ( Clostridium viride), Comamonas terrestris, Corynebacterium congestum, Corynebacterium appendicitis ( Corynebacterium appendices ), Corynebacterium coyle, Corynebacterium glucosidesinolyticum ( Corynebacterium glucuronolyticum ), Corynebacterium glutamicum ( Corynebacterium glutamic ), Corynebacterium jesii, Corynebacterium koreana, Corynebacterium lipophilum, Corynebacterium microti, Corynebacterium mucosum, Corynebacterium nuruki , Corynebacterium pseudogenitalum ( Corynebacterium pseudogenital ), pyruvic acid producing bacteria, odd bacteria, and cordyceps ( Corynebacterium striped ), tuberculosis stearic acid Corynebacterium, dry Corynebacterium, psychrophilic Psychrobacterium ( Cryobacterium psychrophile ), Bacillus brevis, Propionibacterium acnes ( Cutibacterium acnes )、Dermatophagoides vulgaris( Cutibacterium avidum ), Xylan-degrading cellulophagous bacteria ( Xylanolytic Cytophaga ), Deinococcus radiophilus ( Deinococcus radiophilus )、Tsuruhada Delftia Delftia tsuruhatensis )、Desulfovibrio desulfuricans( Desulfovibrio desulfuricans ), turbid Listeria monocytogenes, microaerobic Listeria monocytogenes, pneumogenic Listeria monocytogenes ( Dialister pneumosints ), Listeria monocytogenes, Dichella chrysanthemi ( Dickey chrysanthemums ), Doleella longum, Eggerella tarda, Eggerella catenella ( Eggerthias chain-shaped ), Eikenella corrosa, Aerocystis aquatica, Enterobacter aculeatus, Enterobacter cloacae, Enterococcus avium, Enterococcus durophilus ( Enterococcus durans ), Enterococcus faecalis, Enterococcus faecium, Enterococcus hirae ( Enterococcus hirae ), Erwinia persica ( Erwinia persicina ), Erwinia rhubarb, Erwinia toletana ( Erwinia toletana ), Escherichia coli, Escherichia fergusonii ( Escherichia fergusonii ), Eubacterium breve ( Eubacterium brachy ), Eubacterium fastidious, Eubacterium entangled ( Eubacterium nodatum ), Eubacterium rectum, Eubacterium crypticum, Eubacterium inertia, Eubacterium groove, Eubacterium eugene ( Eubacterium yurii ), Exiguobacterium acetylicum ( Small bacterium acetylene ), Fecalum tarda ( Facklamia langava ), Faecalibacterium prausnitzii, Gingivalis sulci ( Filamentous algae ), Fingoldia grandis, Fusobacterium gibberellin, Fusobacterium nucleatum, Fusobacterium periodonticum, Gardnerella vaginalis, Gemini coccus insaccharoporphyrinus ( Asaccharolytic gemella ), Gemini coccus burgdorferi ( The twin shepherds), hemolytic Gemini cocci, blood Gemini cocci, thermophilic Geobacillus stearothermophilus ( Geobacillus stearothermophilus ), Geobacillus thermophilus ( Geobacillus thermocatenulatus ), Thermoglucosidase Geobacillus ( Geobacillus thermoglucosidasius ), Geobacter grbiciae , Streptococcus elongatus, Haemophilus ducreyi ( Haemophilus ducreyi ), Haemophilus hemolyticus ( Haemophilus haemolyticus ), Haemophilus parahaemolyticus ( Haemophilus parahaemolyticus ), Haemophilus parainfluenzae, Hafnia alvei, Halomonas australis, Halomonas phoceae 、Halomonas spp. Halomonas venusta )、Spirillum spp.( Herbaspirillum slow-moving )、Dark blue purple bacteria ( Janthinobacterium lividum ), Jonquetella anthropi , Klebsiella granulomatosa ( Klebsiella granulomatis ), Klebsiella oxytoca, Klebsiella pneumoniae, Lactobacillus acidophilus, Lactobacillus amylovora ( Lactobacillus amylovorus ), Lactobacillus brevis, Lactobacillus vaginalis ( Lactobacillus coleohominis ), Lactobacillus crispatus, Lactobacillus curvatus, Lactobacillus delbrueckii, Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus helveticus, Lactobacillus iners, Lactobacillus jensenii ( Lactobacillus jensenii ), Lactobacillus johnsonii, Lactobacillus calix ( Lactobacillus kalixensis ), Lactobacillus kumiss-like ( Lactobacillus kefir-making ), Lactobacillus chlortetracycline ( Lactobacillus kimchicus )、Lactobacillus Beishan( Lactobacillus kitasatonis ), Lactobacillus mucosa ( Lactobacillus mucosae )、Lactobacillus bread ( Lactobacillus bread ), Lactobacillus paracasei, Lactobacillus plantarum, Lactobacillus bridges ( Lactobacillus pontis ), Lactobacillus reuteri, Lactobacillus rhamnosus, Lactobacillus salivarius, Lactobacillus elnareus, Lactobacillus vaginalis, Streptococcus lactis, Lactobacillus cheilophilus, Leuconostoc carnosus, Leuconostoc citrinum, Leuconostoc garlicum , Leuconostoc lactis, Leuconostoc mesenteroides, Lysinomonas krib Lysinimonas kribbensis ), Mageeibacillus indolicus 、Oriental Marine Bacillus Maribacter orientalis ), Proteus marinus ( Marinomonas protea )、Conyzomyces islandica ( Insular Marinospirillum ), Massimodium timonei, Giant spherical bacteria ( Megasphaera elsdenii ), Megasphaera micronucleata ( Megasphaera micronuciformis ), Bradyrhizobium spp. Mesorhizobium amorphous ), Methylobacterium fluororesistant Methylobacterium radiotolerans ), Methylobacterium circumflexus ( Methylotenera versatile ), Halophilic Microbacterium ( Microbacterium halophilum), Micrococcus luteus, Microterricola viridarii 、Mobiluncus krusei Mobiluncus curtisii ), Mobiluncus timidus ( Woman's mobile phone ), Clostridium difficile, Glycerol Moorella ( Moorella glycerini ), Moraxella osloensis ( Moraxella osloensis ), Morganella morganii, Moyala indolegenes ( Morel indoligenes ), Murdochia insaccharolytica, Mycoplasma alvei ( Mycoplasma alveoli ), Mycoplasma genitalium ( Mycoplasma genitals ), Mycoplasma hominis ( Human Mycoplasma ), Mycoplasma muris ( Mycoplasma murine ), Mycoplasma salivarius ( Mycoplasma salivarium ), succinate-negative cocci ( Negativococcus succinicivorans ), Neisseria flavus ( Neisseria vulgaris ), Neisseria gonorrhoeae, Neisseria mucosae ( Neisseria mucosa ), Neisseria flavescens, Neisseria fasciola, Neisseria terrestris ( Nevskaya soles ), alkaliphilic nitrile-degrading bacteria ( Nitrile breaker alkaliphile ), Ovisceral Bacillus, Urotrophic Bacillus ( Urethral oligel gingivalis, Bacillus amyloliquefaciens ( Paenibacillus amylolyticus ), Paenibacillus humus ( Paenibacillus humus )、Paenibacillus spp. Paenibacillus pabuli ), Paenibacillus pasadena Paenibacillus pasadenensis ), Paenibacillus pine Paenibacillus pinea ), Paenibacillus robustus ( Paenibacillus validus )、Pantoea agglomerata( Pantoea agglomerans ), Parabacteroides faecalis, Burkholderia dianthus ( Paraburkholderia caryophylli ), Paracoccus yeerii, and Streptomyces abscessus ( Parastreptomyces abscessus ), Micromonas parvum, Pectobacterium brasiliensis ( Pectococcus beetroot )、Carrot soft rot pectin bacteria ( Pectobacterium carotovorum ), Pediococcus acidilactici, ethanol-resistant Pediococcus ( Pediococcus ethanolidurans ), Bacillus thuringiensis ( Pedobacter alluvium ), Wanzhou County Land Bacillus ( Pedobacter wanjuense ), Pseudomonas aquaticus ( Pelomonas aquatica ), black peptococci, non-saccharolytic peptidoglycans ( Peptoniphilus asaccharolyticus ), Gorbach's peptiphilus, Halley's peptiphilus, indolizumab ( Peptoniphilus indolicus ), Peptophilus lacrimalus, Peptophilus marseilles ( Peptoniphilus from Marseille ), anaerobic Peptostreptococcus, Peptostreptococcus Marseilles ( Peptostreptococcus massiliae ), Peptostreptococcus gastricus, Photobacterium stenosus ( Photobacterium angustum ), Photobacterium psychrophilum ( Photobacterium cold-loving ), Photobacterium luminescens ( Photobacterium phosphoreum ), Porphyromonas saccharolyticus, Porphyromonas benjamina, Porphyromonas carinii ( Porphyromonas catoniae ), Porphyromonas endodontics, Porphyromonas gingivalis, Porphyromonas sorneri, Porphyromonas veononis 、Prevotella amniotic fluid Prevotella amnii ), Prevotella pasteurianum, Prevotella bergensis ( Prevotella bergensis ), Prevotella diversa, Prevotella buccalis ( Mouth ulcers ), Prevotella buccalis ( Oral thrush ), Prevotella chromatica ( Prevotella colorans ), fecal Prevotella, human Prevotella, dental Prevotella, dental Prevotella, glycolytic Prevotella ( Prevotella dissident ), Prevotella intermedia, Prevotella louisei ( Prevotella loescheii ), Prevotella marcescens ( Prevotella marshii ), melanogenic Prevotella, rainbow Prevotella, blackening Prevotella, oral Prevotella, pleuritic Prevotella, rumen-dwelling Prevotella ( Prevotella ruminicola ), Prevotella sabdariffa, Prevotella faecalis, Prevotella timonei, Prevotella euorticola, Propionibacterium lymphotrophicum, Proteus mirabilis, Pseudomonas abies ( Pseudomonas abietaniphila ), Pseudomonas aeruginosa, Pseudomonas amygdaloids ( Pseudomonas amygdali ), Pseudomonas aeruginosa ( Pseudomonas nitrogen-forming ), Pseudomonas chlororaphis ( Pseudomonas chlororaphis ), Pseudomonas cuatronensis ( Pseudomonas cuatrocienegasensis ), Pseudomonas fluorescens ( Pseudomonas fluorescens ), Pseudomonas flavescentis ( Pseudomonas fulva ), Pseudomonas flavus ( Pseudomonas lutea ), Pseudomonas moldy, Pseudomonas oleovorans ( Pseudomonas oleivorans ), Pseudomonas orientalis ( Pseudomonas orientalis ), Pseudomonas pseudoalcaligenes, Pseudomonas psychrophilus ( Pseudomonas psychrophila ), Pseudomonas putida, Pseudomonas xanthophylla ( Pseudomonas synxantha ), Pseudomonas syringae ( Pseudomonas syringae ), Pseudomonas thuringiensis ( Pseudomonas tolaasii ), Pseudomonas propionici ( Pseudopropionibacterium propionicum ), Aquatic Rahnella ( Rahnella aquatica ), Ralstonia pekinensis, Ralstonia solanacearum ( Ralstonia nightshade ), Raoultella phytogenes ( Raoultella planticola ), Rhizobacter dauci Rhizobacterium given), Etri Rhizobium, Rhodococcus fasciatus ( Rhodococcus fascians ), Rhodopseudomonas palustris ( Rhodopseudomonas palustris ), intestinal Roseburia, glucosphaeroides Roseburia, mucus Roseburia, Brucella brucella, active Ruminococcus, twisted Ruminococcus, Kadi Haemobacterium ( Sanguibacter keddieii ), salmon-colored sediment rod-shaped bacteria ( Sedimibacterium salmoneum ), Selenomonas bovis ( Selenomonas bovis ), Serratia Fontica ( Serratia fonticola ), Serratia liquefaciens ( Serratia liquefaciens ), Serratia marcescens, Shewanella salinarum ( Shewanella algae ), Shewanella amazonensis ( Shewanella amazonensis ), Shigella boydii ( Shigella boydii ), Shigella sonnei, Snaeckia seldomena, Leptotrichia armunii ( Sneathia of all ), blood red cilia ( Sneathia sanguinegens ), Bacillus morelophilus Solobacterium moorei ) Cellulose Sorangium ), Ami Sphingobacterium, Soybean Sphingobacterium, Yano Sphingobacterium ( Sphingobium yanoikuyae ), Sphingomonas vermifuge ( Sphingomonas wittichii ), Sporosarcina marinum ( Sporosarcina aquamarina ), Staphylococcus aureus, Staphylococcus auris, Staphylococcus capitis ( Staphylococcus aureus ), Staphylococcus epidermidis, Staphylococcus haemolyticus ( Staphylococcus hemolytic ), Staphylococcus aureus ( Staphylococcus aureus ), Staphylococcus lugdunensis, Staphylococcus saprophyticus, Staphylococcus stutzeri ( Staphylococcus schleiferi ), Staphylococcus simianus ( Staphylococcus aureus )、Staphylococcus aureus( Staphylococcus simulans ), Staphylococcus waldenii ( Staphylococcus warneri ), Stenotrophomonas maltophilia ( Stenotrophomonas maltophilia ), Stenoxybacter acetivorans , Streptococcus agalactiae, Streptococcus anginosus, Streptococcus australis, Streptococcus equine enterica, Streptococcus gallolyticus ( Streptococcus gallolytic ), infantile streptococci, intermedius streptococci, lutein streptococci, Streptococcus marimammalum , Streptococcus mitis, Streptococcus mutans, Streptococcus oralis, Streptococcus parasanguinis, Streptococcus sealis ( Streptococcus phocae ), Streptococcus pseudopneumococcus ( Streptococcus pseudopneumoniae ), Streptococcus salivarius, Streptococcus sanguinis, Streptococcus thermophilus, S. waldensis, Tannerella forsythia, Haemophilus aromaticus ( Terrahaemophilus aromaticivorans ), Treponema denticola, Treponema maltophilia ( Treponema maltophilus ), Treponema microtyphi ( Treponema small), Treponema ventriculi ( Treponema vincentii ), Bordetella Trueperella Bernardine ), Otitis Zurichia coli ( Turicella otitis ), Ureaplasma microti ( Ureaplasma parvum ), Ureaplasma urealyticum, Campylobacter cambrianus ( Varibaculum cambriense ), Debate on gluttony ( Variegated paradoxical ), atypical Veillonella, different Veillonella, and Peyer's disease ( Veillonella from Montpellier ), Veillonella parvula, Bacillus prausnitzii ( Virgibacillus proomii )、Bacillus chlororaphis ( Viridibacillus arenosus ), Bacillus avermitilis ( Viridibacillus arvi ), Weissella sinusoidalis ( Weissella cibaria ), soil Weissella ( Weissella soli ), Xanthomonas campestris ( Xanthomonas campestris ), Xanthomonas vesicularis ( Xanthomonas vesicatoria ), Zobellia laminariae and Zoogloea Zoogloea ramigera ).

[0120] In one embodiment, the targeted bacteria is Escherichia coli.

[0121] In one embodiment, the targeted bacteria is P. acnes, more specifically P. acnes associated with acne from phylogroup IA1 or RT4, RT5, RT8, RT9, RT10 or clonal complex group (CC) CC1, CC3, CC4, more specifically ST1, ST3, ST4.

[0122] Thus, the bacteriophage used to prepare the bacterial viral particles, and then the bacterial viral particles, can be targeted (eg, specifically targeted) to bacterial cells from any one or more of the aforementioned bacterial genera and / or species to specifically deliver the payload.

[0123] In one embodiment, the targeted bacteria are pathogenic bacteria. The targeted bacteria may be virulent bacteria.

[0124] The targeted bacterium can be an antibacterial resistant bacterium, preferably selected from the Escherichia coli producing extended-spectrum β-lactamase (ESBL), ESBL Klebsiella pneumoniae, vancomycin-resistant Enterococcus (VRE), methicillin-resistant Staphylococcus aureus (MRSA), multidrug-resistant (MDR) Acinetobacter baumannii, MDR Enterobacter species and combinations thereof. Preferably, the targeted bacterium can be selected from the Escherichia coli strain producing extended-spectrum β-lactamase (ESBL).

[0125] Alternatively, the targeted bacteria may be bacteria of the microbiome of a given species, preferably bacteria of the human microbiome.

[0126] On the one hand, synthetic bacterial delivery vehicles with a desired target host range are provided for transferring nucleic acid payloads of interest to target bacterial cells. The characteristics of synthetic bacterial delivery vehicles can be chimeric receptor binding proteins (RBPs), wherein the chimeric RBP comprises a fusion between the N-terminal domain of the RBP from a lambda-like bacteriophage or a lambda-bacteriophage and the C-terminal domain of a different RBP. It has been demonstrated that a significant portion of a lambda-like RBP (such as an stf protein) can be exchanged with a portion of a different RBP.

[0127] As used herein, receptor binding proteins or RBPs are polypeptides that recognize and optionally bind and / or modify or degrade substrates located on the bacterial outer envelope, such as, but not limited to, bacterial outer membranes, LPS, capsules, protein receptors, channels, structures such as flagella, pili, secretion systems. The substrate can be, but not limited to, any carbohydrate or modified carbohydrate, any lipid or modified lipid, any protein or modified protein, any amino acid sequence, and any combination thereof.

[0128] The present disclosure also provides a synthetic bacterial delivery vehicle characterized by the presence of a modified branched receptor binding multi-subunit protein complex ("branched-RBP"). This delivery vehicle can be used to transfer a nucleic acid payload of interest into a target bacterial cell. The modified branched RBP comprises two or more associated receptor binding proteins derived from a bacteriophage, which associate with each other based on the presence of an interaction domain (ID). The association of one subunit with another can be non-covalent or covalent. Each polypeptide subunit contains an ID that acts as an "anchor" for the association of one subunit RBP with another. In a specific embodiment, the branched RBP may comprise a plurality of RBP subunits, including, for example, two, three, four, etc. subunits.

[0129] For disclosure of recombinant bacterial delivery vehicles, see U.S. Provisional Application Serial Nos. 62 / 849,108, 62 / 849,112, 62 / 802,777, 62 / 771,761, and 62 / 783,258, each of which is incorporated herein in its entirety.

[0130] As used herein, the term "nucleic acid payload" refers to any nucleic acid sequence or amino acid sequence or a combination of the two (such as, but not limited to, peptide nucleic acids or peptide-oligonucleotide conjugates) transferred to bacteria with a delivery vehicle. Preferably, the term "nucleic acid payload" refers to any nucleic acid sequence (such as, but not limited to, peptide nucleic acids or peptide-oligonucleotide conjugates) optionally combined with an amino acid sequence that is transferred to bacteria with a delivery vehicle. The nucleic acid payload is designed to encode a protein or nucleic acid of interest to be transferred to a desired target bacterial host cell. The term "nucleic acid payload" may refer to a plasmid, a vector or a cargo. The nucleic acid payload may be a phagemid or phagemid obtained from a natural, evolved or modified bacteriophage genome. The nucleic acid payload may also be composed only in part of a phagemid or phagemid obtained from a natural, evolved or modified bacteriophage genome. The nucleic acid payload is preferably a nucleic acid sequence packaged in a bacterial delivery vehicle, preferably in a capsid derived from a bacteriophage.

[0131] Described herein are engineered bacterial delivery vehicles having desired target bacterial cell specificity and / or host range, comprising a nucleic acid payload having an embedded unique tracer nucleotide sequence tag. As used herein, a "multivalent mixture of delivery vehicles" refers to a mixture of one or more different or dissimilar bacterial delivery vehicles. Such bacterial delivery vehicles may be different because they have at least one structural feature that distinguishes them from other bacterial delivery vehicles in the mixture. Such structural features include, for example, differences in bacterial cell binding ability and / or host range that may arise, for example, through differences in RBPs expressed in the delivery vehicle. Thus, a multivalent mixture comprises at least two different populations of bacterial delivery vehicles.

[0132] The pharmaceutical or veterinary composition of the present invention comprises a multivalent mixture of bacterial delivery vehicles as defined herein, i.e., comprises at least two different bacterial delivery vehicles, wherein each bacterial delivery vehicle comprises a nucleic acid payload with a unique tracer nucleic acid sequence. The pharmaceutical or veterinary composition can be prepared as a sterile solid composition, which can be suspended using sterile water, saline or other suitable sterile injectable media when administered. The pharmaceutical or veterinary composition of the present invention can be administered orally in the form of a sterile solution or suspension, and the solution or suspension contains other solutes or suspending agents (e.g., sufficient saline or glucose to make the solution isotonic), bile salts, gum arabic, gelatin, sorbitan monooleate, polysorbate 80 (oleate of sorbitol copolymerized with ethylene oxide and its anhydride), etc. The particles of the present invention can also be administered orally in the form of a liquid or solid composition. Compositions suitable for oral administration include solid forms (such as pills, capsules, granules, tablets and powders) and liquid forms (such as solutions, syrups, elixirs and suspensions). Useful forms for enteral administration include sterile solutions, emulsions and suspensions.

[0133] The particles derived from the bacteriophage of the present invention can be dissolved or suspended in a pharmaceutically acceptable liquid vehicle such as water, an organic solvent, a mixture of the two, or a pharmaceutically acceptable oil or fat. The liquid vehicle can contain other suitable pharmaceutical additives, such as solubilizers, emulsifiers, buffers, preservatives, sweeteners, flavoring agents, suspending agents, thickeners, colorants, viscosity modifiers, stabilizers or osmotic regulators. Suitable examples of liquid vehicles for oral and enteral administration include water (partially containing additives as above, such as cellulose derivatives, preferably sodium carboxymethylcellulose solution), alcohols (including monohydric alcohols and polyols, such as diols) and derivatives thereof and oils (such as fractionated coconut oil and peanut oil). For parenteral administration, the vehicle can also be an oily ester, such as ethyl oleate and isopropyl myristate. Sterile liquid vehicles can be used for sterile liquid form compositions for enteral administration. The liquid vehicle for pressurized compositions can be halogenated hydrocarbons or other pharmaceutically acceptable propellants.

[0134] For transdermal administration, the pharmaceutical or veterinary compositions may be formulated as ointments, creams or gels, and penetration may be enhanced with appropriate penetrants or detergents, such as dimethyl sulfoxide, dimethylacetamide and dimethylformamide.

[0135] For transmucosal administration, nasal sprays, rectal or vaginal suppositories can be used. The active compound can be incorporated into any known suppository base by methods known in the art. Examples of such bases include cocoa butter, polyethylene glycol (carbowax), polyethylene sorbitan monostearate, and mixtures of these with other compatible materials to change the melting point or dissolution rate.

[0136] The present invention also relates to a pharmaceutical or veterinary composition of the present invention for use in treating a disease or disorder caused by bacteria. It also relates to a method for treating a disease or disorder caused by bacteria, comprising administering a pharmaceutical or veterinary composition of the present invention to a subject in need of treatment for the disease or disorder. It further relates to the use of a pharmaceutical or veterinary composition of the present invention for the manufacture of a medicament for treating a disease or disorder caused by bacteria.

[0137] In one embodiment, the disease or disorder caused by bacteria can be selected from chronic inflammation of the skin such as acne (acne vulgaris), progressive macular hypopigmentation, abdominal cramps, acute epiglottitis, arthritis, bacteremia, bloody diarrhea, botulism, brucellosis, brain abscess, cardiomyopathy, chancroid, chlamydia, Crohn's disease, conjunctivitis, cholecystitis, colorectal cancer, polyposis, dysbiosis, Lyme disease, diarrhea, diphtheria, duodenal ulcer, endocarditis, erysipelothricosis, enteric fever, fever, glomerulonephritis, gastroenteritis, gastric ulcer, Guillain-Barre syndrome, tetanus, gonorrhea, gingivitis, inflammatory bowel disease ... Enteropathy, irritable bowel syndrome, leptospirosis, leprosy, listeriosis, tuberculosis, Lady Wind syndrome, Legionnaires' disease, meningitis, mucopurulent conjunctivitis, multidrug-resistant bacterial infection, multidrug-resistant bacterial carriage, myocarditis, myonecrosis-gas gangrene, Mycobacterium avium complex, neonatal necrotizing enterocolitis, nocardiosis, hospital infection, otitis, periodontitis, pharyngitis, pneumonia, peritonitis, purpura fever, Rocky Mountain spotted fever, shigellosis, syphilis, sinusitis, sigmoiditis, sepsis, subcutaneous abscess, tularemia, tracheobronchitis, tonsillitis, typhoid fever, ulcerative colitis, urinary tract infection, whooping cough, non-alcoholic fatty liver disease (NASH).

[0138] In another embodiment, the disease or disorder caused by bacteria is an infection caused by bacteria, preferably selected from intestinal infections (such as esophagitis, gastritis, enteritis, colitis, sigmoiditis, proctitis and peritonitis), urinary tract infections, vaginal infections, female upper reproductive tract infections (such as salpingitis, endometritis, oophoritis, myometritis, parametritis and pelvic peritoneal infections), respiratory tract infections (such as pneumonia), intra-amniotic infections, odontogenic infections, endodontic infections, fibrosis, meningitis, bloodstream infections, hospital infections (such as catheter-related infections), hospital-acquired pneumonia, postpartum infections, hospital-acquired gastroenteritis, hospital-acquired urinary tract infections and combinations thereof. Preferably, the infection is caused by bacteria that exhibit antibiotic resistance. In a specific embodiment, the infection is caused by bacteria listed above in the targeted bacteria.

[0139] In another embodiment, the disease or disorder caused by bacteria is a metabolic disorder, such as obesity and diabetes.

[0140] In a specific embodiment, the present invention relates to a pharmaceutical or veterinary composition for treating a condition involving bacteria of the human microbiome (such as inflammatory and autoimmune diseases, cancer, infection or brain disorders). It also relates to a method for treating a condition involving bacteria of the human microbiome, the method comprising administering a pharmaceutical or veterinary composition of the present invention to a subject in need of treatment suffering from the condition. It further relates to the use of the pharmaceutical or veterinary composition of the present invention for the manufacture of a medicament for treating a condition involving bacteria of the human microbiome. In fact, some bacteria of the microbiome can secrete molecules that induce and / or enhance the development of inflammatory or autoimmune diseases or cancer without triggering any infection. More specifically, the present invention also relates to regulating the composition of the microbiome to improve the efficacy of immunotherapy based on, for example, CAR-T (chimeric antigen receptor T) cells, TIL (tumor infiltrating lymphocytes) and Treg (regulatory T cells), also known as suppressive T cells. Modulating the composition of the microbiome to improve the efficacy of immunotherapy may also include the use of immune checkpoint inhibitors well known in the art, such as, but not limited to, PD-1 (programmed cell death protein 1) inhibitors, PD-L1 (programmed death ligand 1) inhibitors, and CTLA-4 (cytotoxic T lymphocyte-associated protein 4).

[0141] Some bacteria in the microbiome can also secrete molecules that affect the brain.

[0142] Therefore, another object of the present invention is a method for controlling the microbiome of a subject, comprising administering in said subject an effective amount of a pharmaceutical composition as disclosed herein.

[0143] In a specific embodiment, the present invention also relates to a method for personalized treatment of an individual in need of treatment of a bacterial infection, comprising: i) obtaining a biological sample from the individual and determining a set of bacterial DNA sequences from the sample; ii) based on the determination of the sequences, identifying one or more pathogenic bacterial strains or species in the sample; and iii) administering to the individual a pharmaceutical composition of the present invention, the pharmaceutical composition being capable of recognizing each pathogenic bacterial strain or species identified in the sample and delivering a packaged payload. The present invention further relates to a) a pharmaceutical or veterinary composition of the present invention for treating a bacterial infection in an individual, or b) the use of a pharmaceutical or veterinary composition of the present invention for the manufacture of a medicament for treating a bacterial infection in an individual, wherein in a) or b), the preparation of the pharmaceutical or veterinary composition comprises: (i) providing a biological sample from the individual and determining a set of bacterial DNA sequences from the sample; ii) based on the determination of the sequences, identifying one or more pathogenic bacterial strains or species in the sample; and iii) preparing a pharmaceutical or veterinary composition of the present invention, the composition being capable of recognizing each pathogenic bacterial strain or species identified in the sample and delivering a packaged payload.

[0144] Preferably, the biological sample comprises both pathological and non-pathological bacterial species, and following administration of the pharmaceutical or veterinary composition of the invention to the individual, the amount of pathogenic bacteria is reduced, but the amount of non-pathogenic bacteria is not reduced, on or in the individual.

[0145] In another specific embodiment, the invention relates to a pharmaceutical or veterinary composition of the invention for improving the effectiveness of a drug.In fact, some bacteria of the microbiome, although not pathogenic themselves, are known to be able to metabolize drugs and modify them into ineffective or harmful molecules.

[0146] In another specific embodiment, the invention relates to in situ bacterial production of any compound of interest, including therapeutic compounds, such as prophylactic and therapeutic vaccines for mammals. The compound of interest can be produced within the targeted bacteria, secreted from the targeted bacteria, or expressed on the surface of the targeted bacteria. In a more specific embodiment, the antigen is expressed on the surface of the targeted bacteria for prophylactic and / or therapeutic vaccination.

[0147] The present invention also relates to non-therapeutic uses of the bacterial delivery particles. For example, the non-therapeutic use may be a cosmetic use or a use for improving the health of a subject, particularly a subject not suffering from a disease. Thus, the present invention also relates to a cosmetic composition or a non-therapeutic composition comprising the bacteriophage-derived particles of the present invention.

[0148] Subjects, Protocol, and Administration

[0149] The subject to be treated by the composition of the present invention is an animal, preferably a mammal, and even more preferably a human. However, the term "subject" may also refer to non-human animals that need treatment, particularly mammals (such as dogs, cats, horses, cows, pigs, sheep, donkeys, rabbits, ferrets, gerbils, hamsters, chinchillas, rats, mice, guinea pigs, and non-human primates, etc.) or non-mammals (such as poultry).

[0150] The human subject can be a prenatal human, a newborn, a child, an infant, a teenager, or an adult of any age.

[0151] In a preferred embodiment, the subject has been diagnosed with or is at risk of developing an infection, disorder and / or disease, preferably due to bacteria. Methods for diagnosing such infections, disorders and / or diseases are well known to those skilled in the art.

[0152] In a particular embodiment, the infection, disorder and / or disease is caused by a bacterium that exhibits resistance to treatment, preferably the infection, disorder or disease is caused by a bacterium that exhibits antibiotic resistance.

[0153] In a specific embodiment, the subject has never received any treatment before being administered the delivery vehicle of the present invention, preferably the payload of the present invention, in particular the payload packaged into the delivery vehicle of the present invention, preferably the plasmid or phagemid packaged into the bacterial virus particle of the present invention, or the pharmaceutical or veterinary composition of the present invention.

[0154] In a specific embodiment, the subject has received at least one line of treatment, preferably several lines of treatment, before being administered the delivery vehicle of the present invention, preferably the payload of the present invention, in particular the payload packaged into the delivery vehicle of the present invention, preferably the plasmid or phagemid packaged into the bacterial virus particle of the present invention, or the pharmaceutical or veterinary composition of the present invention.

[0155] Preferably, the treatment is administered regularly, preferably between daily and monthly, more preferably between daily and biweekly, more preferably between daily and weekly, even more preferably daily. In a specific embodiment, the treatment is administered several times a day, preferably 2 or 3 times a day, even more preferably 3 times a day.

[0156] The duration of treatment with the delivery vehicle of the present invention, preferably the effective load of the present invention, in particular the effective load packaged into the delivery vehicle of the present invention, preferably the plasmid or phagemid packaged into the bacterial virus particle of the present invention, or with the pharmaceutical or veterinary composition of the present invention, preferably includes between 1 day and 20 weeks, more preferably between 1 day and 10 weeks, still more preferably between 1 day and 4 weeks, and even more preferably between 1 day and 2 weeks. In a specific embodiment, the duration of treatment is about 1 week. Alternatively, treatment can continue as long as the infection, disorder and / or disease persists.

[0157] The form, route of administration and dosage of the delivery vehicle of the present invention, preferably the payload of the present invention, in particular the payload packaged into the delivery vehicle of the present invention, preferably the plasmid or phagemid packaged into the bacterial virus particle of the present invention, or the pharmaceutical or veterinary composition of the present invention can be adjusted by a person skilled in the art according to the type and severity of the infection (for example, depending on the bacterial species involved in the disease, disorder and / or infection and its localization in the patient or subject) and the patient or subject, in particular his age, weight, sex and general physical condition.

[0158] In particular, the amount of the delivery vehicle of the present invention, preferably the payload of the present invention, in particular the payload packaged into the delivery vehicle of the present invention, preferably the plasmid or phagemid packaged into the bacterial virus particle of the present invention, or the pharmaceutical or veterinary composition of the present invention to be administered must be determined by standard procedures well known to those of ordinary skill in the art. The appropriate dosage must be determined taking into account the physiological data of the patient or subject (e.g., age, size and weight) and the route of administration so that a therapeutically effective amount is administered to the patient or subject.

[0159] For example, for each administration, the total amount of the delivery vehicle, in particular the payload packaged into the delivery vehicle of the present invention, preferably the plasmid or phagemid packaged into the bacterial virus particle of the present invention, is included in 10 4 -10 15 between delivery vehicles.

[0160] As used herein, "tracer" refers to a nucleic acid sequence associated with, i.e., embedded within, a nucleic acid payload. Tracers serve as bacterial delivery vehicle "identification tags" that can be used to evaluate the presence and / or amount of bacterial delivery vehicles within a multivalent mixture of bacterial delivery vehicles. As disclosed herein, tracers can be embedded within non-coding regions, coding regions, and / or 5' or 3' untranslated regions of a nucleic acid payload.

[0161] The tracer can be any nucleic acid sequence, the detection of which is associated with the presence of a specific bacterial delivery vehicle. Therefore, in the mixture of the present invention, each bacterial delivery vehicle population contains different and unique tracers. The detection of tracer sequences can be achieved using a variety of different detection methods well known to those skilled in the art. In a specific embodiment, the tracer sequence can serve as a binding site for one or more primers, which are designed to be used in conjunction with an amplification program such as a PCR reaction. The tracer can be designed to include a constant region, and the primer can be combined with the constant region to amplify the tracer in the bacterial delivery vehicle mixture. Preferably, the constant region is the same in all tracers of the multivalent mixture. This constant region binding primer can be used to amplify the total of all tracers in the bacterial delivery vehicle mixture. The tracer can be designed to include a variable region, and the primer can be combined with the variable region to amplify the tracer in the bacterial delivery vehicle mixture. The variable region binding primer can be used to identify the specific bacterial delivery vehicle in the mixture. On the one hand, the variable region is located in the barcode.

[0162] One or more rounds of amplification can be performed to identify and / or quantify the bacterial delivery vehicle in the mixture. In a specific embodiment, a mixture of different types of primers can be used in each amplification reaction. For example, primers that only bind to the constant region, primers that only bind to the variable region, and / or primers that overlap with the constant region and the variable region can be used. Alternatively, for the amplification reaction, primers that bind to the constant region and primers that bind to the variable region can be used. Depending on the primers used, the amplification reaction can result in the total amplification of the tracer mixture found in the mixture of the bacterial delivery vehicle. Alternatively, primers can be selected to amplify specific bacterial delivery vehicles in the mixture.

[0163] In a specific embodiment, primers that bind to the constant region of the tracer can be used in a first round of amplification, followed by a subsequent second round of amplification using, for example, primers that bind to the variable region within the tracer to further evaluate the presence of a specific delivery vehicle within the vehicle mixture.

[0164] As described in detail below, one or more features are considered in the design of the tracer sequence for bacterial delivery vehicle identification. Such features include, for example, primer binding site length, melting temperature, and G / C content percentage, each of which can affect, for example, the effectiveness of an amplification reaction. Still further, the tracer should be designed to minimize the growth characteristics of the bacterial delivery vehicle packaging cell line or the target bacterial cell. The tracer should minimize the generation of the delivery vehicle in the packaging cell line. Unexpected restriction enzyme sites should be avoided. Finally, regions homologous to packaging cell DNA, target host DNA, or payload DNA should be avoided in the tracer because such homologous regions can serve as sites for unexpecting homologous recombination.

[0165] In a specific aspect, a multivalent mixture of a bacterial delivery vehicle (e.g., phagemid particles) is provided, containing the same nucleotide nucleic acid payload, except that it contains a unique "tracer" nucleic acid sequence, which is designed in a manner that allows all nucleic acid payloads packaged in the same capsid to have the same associated tracers, and nucleic acid payloads packaged in different capsids to have different associated tracers. The use of such tracers enables the presence and / or relative abundance of each bacterial delivery vehicle in a multivalent mixture of delivery vehicles to be detected by amplification cycles and optionally sequencing. Such amplification methods include, for example, PCR, qPCR, ddPCR, LCR, FISH, or NGS using primers specific for the "tracer" sequence.

[0166] In various aspects, the tracer nucleic acid sequence is embedded within a coding or non-coding DNA sequence, including but not limited to a reporter gene (eg, antibiotic resistance, fluorescent protein), a tag, or a barcode.

[0167] DNA barcoding, first conceptually proposed in 1982 and first implemented in 2003, demonstrated that there is a single DNA locus across all species that can be used to uniquely identify each species and, through comparison and alignment, to draw a more faithful natural taxonomy than other methods (Taylor and Harris, 2012, Mol Ecol Resour. 2012May;12(3):377-88. An emergent science on the brink of irrelevance: a reviewof the past 8 years of DNA barcoding). Although no single “magic bullet” barcode has been found to work across all domains of life, DNA barcodes that have been found to work very well within certain clades, such as mitochondrial cytochrome c oxidase subunit 1 (CO1) in animals or 16S rRNA in bacteria, have been widely used to empirically generate taxonomies or “trees of life” and describe ecosystems (Kress et al., 2015, Trends Ecol Evol, Jan; 30(1):25-35; Taylor and Harris, 2012, Mol Ecol Resour. 2012 May;12(3):377-88).

[0168] The advent of high-throughput DNA sequencing technology in 2005 and the subsequent decline in cost have led to the ubiquity of DNA barcoding beyond species identification: DNA barcoding is now used for 1) genome and chromatin mapping, 2) transcriptomics / RNA-seq, 3) ribosome profiling to analyze protein translation activity, 4) protein engineering (via phage display, mRNA / ribosome display, and yeast two-hybrid screening), 5) DNA-encoded protein libraries, 6) cell surface DNA markers, 7) antibody-DNA conjugates, 8) DNA-encoded small molecule and cyclic peptide libraries, and even 9) nanoparticle-DNA conjugates (Liszczak and Muir, 2019, Angew Chem Int Ed Engl, Mar 22;58(13):4144-4162).

[0169] In one specific non-limiting embodiment, the tracer can be designed for use in a barcoding approach. A "barcode" represents a nucleic acid sequence whose presence correlates with the presence of the bacterial delivery vehicle with which it is associated. In this case, the "barcode" is embedded within the tracer, with flanking sequences (constant regions) on each side. Figure 3 ), which can be used to amplify the barcode sequence (variable region Figure 3 ) to identify and / or quantify the barcode, which in turn indicates the presence and quantity of a specific bacterial delivery vehicle within a multivalent mixture of bacterial delivery vehicles. Using this barcoding method provides a simple and convenient method for using multiple unique tracers (whose presence is associated with the presence of a specific bacterial delivery vehicle within a bacterial delivery vehicle mixture).

[0170] In a specific embodiment, the tracer is embedded in the non-coding region of the DNA in the nucleic acid payload. As used herein, "non-coding region of DNA" is a region comprising a sequence that does not encode proteins. This tracer is introduced into the nucleic acid payload in the following manner, and the nucleic acid payload with the same tracer is packaged into the same bacterial delivery vehicle. Using this tracer nucleic acid sequence (including those containing barcodes), primers specific to the sequence of the adjacent barcode and the sequence in the barcode can be used to confirm the presence and relative abundance of each different bacterial delivery vehicle in the polyvalent bacterial delivery mixture by PCR, qPCR, ddPCR, LCR, FISH or NGS.

[0171] When designing a tracer for a non-coding region of a nucleic acid payload, one or more factors may be considered to design an efficient and effective tracer. On the one hand, the tracer should minimally affect the growth of the packaging cell line used to produce the bacterial delivery vehicle or the production of the bacterial delivery vehicle. Further, the tracer should minimally affect the growth of the targeted bacterial cells.

[0172] The tracer can be designed in a manner that enables detection and quantification of theoretically any number of bacterial delivery vehicles within the vehicle mixture. Such detection can initially be accomplished using common sites, i.e., constant regions, such as those flanking variable regions (e.g., Figure 2 C1 and C2 in ) and serve as targets for primer binding and subsequent amplification (see Figure 2 ). Thus, the use of such a common site allows for the simultaneous co-amplification of many different tracer nucleic acid sequences. In one embodiment, the tracer sequence can also enable the detection of the presence of each specific tracer sequence and thus its associated bacterial delivery vehicle by using the common primer site and / or variable primer site of each construct: V1, V2, ..., Vx, (see Figure 2 ).

[0173] In a preferred embodiment, the tracer can be designed to be used in combination with a variety of different detection methods. This detection method includes using multiple amplification cycles to detect and / or quantify the tracer, thereby resulting in two or more bacterial delivery vehicles in a multivalent mixture of identification and / or quantitative bacterial delivery vehicles. This detection method includes, for example, PCR, qPCR (based on dye / based on probe), ddPCR (based on dye / based on probe), LCR, FISH and / or NGS.

[0174] Additionally, tracers to be used in the disclosed methods and compositions can be designed to have limited secondary structure and optimal melting temperature to enable primer / probe binding to the tracer nucleic acid sequence when using PCR methods such as qPCR / ddPCR / LCR / FISH / NGS detection methods.

[0175] When considering placing a tracer within a nucleic acid payload, the location should be chosen to minimize transcriptional or translational interference with other functional elements of the nucleic acid payload. Ideally, the tracer should lack undesirable restriction sites, and the tracer should be designed to have limited sequence homology (>20nt) to other regions of the nucleic acid payload, packaging cell DNA, or target bacterial host cell DNA. This homology can serve as a substrate for undesirable homologous recombination events.

[0176] In one specific non-limiting embodiment, a DNA barcoding system can be used to identify bacterial delivery vehicles (see Figure 2). The position in the DNA nucleic acid payload that interferes with its function the least selected is the ELF5 insertion site, which is the site of the joint region of the standardized plasmid construct. In such an embodiment, N (N=number) random nucleic acid tracers with certain structural features are generated. In a preferred aspect, the length of the barcode region and the constant region can generally be in the range of 25-50 nucleotides each. The barcode region and the constant region should be long enough and unique enough to allow specific primers to bind to enable PCR amplification (this is a necessary step for each of qPCR, ddPCR and NGS methods) without generating unnecessary secondary amplicons. In a non-limiting example, the selected structural feature includes a tracer with a length of 30 nucleotides, wherein the barcode quantity generated = N, wherein N is 1 or greater, and wherein the GC content is limited to about 60%-70%. The length of the constant region and the barcode is usually determined by the melting temperature (Tm) of the desired primer to be used, and depends on the detection method to be used. Each generated tracer nucleic acid sequence should be checked to detect undesirable restriction sites. In addition, the secondary structure, melting temperature, and sequence homology can be determined so as to minimize the secondary structure, ensure a sufficiently high melting temperature to allow the targeting primer to anneal to the tracer sequence, and minimize the possibility of homologous recombination. Methods for testing the desired structural characteristics of a particular tracer are well known to those skilled in the art. Once a sequence is selected, the tracer nucleic acid, which may include a barcode, is recombinantly or chemically synthesized and cloned into its corresponding position within the non-coding region of the nucleic acid payload.

[0177] Table 1 List of generated example barcodes.

[0178] Barcode number Sequence(F) SEQ ID NO: b1 accaaacgacactcttccggcgaatcgcgc 2 b2 agcaccccttcgcccccgtcctcgtgtgtt 3 b3 agccggaggtaggacaggtgtccgcacagg 4 b4 cgcgatgagatggattcccgaccttccgga 5 b5 cgctcgctgctcataatctgcgggtggcac 6 b6 cggcacgctgtattgtccaagcgccaagca 7 b7 ctgcggacggcggctcgcggttagcccaat 8 b8 gatgacagcggcacacggacacaagcgtca 22 b9 gtcccgtggatggctcgaagcctaaccgag 23 b10 taacacggagagccatcctcagcccgtcag 24 b11 tcctactccaccggcagccttagcgtttgg 25 b12 tgcgcgttcttagcgtgtgagcggcctcga 26

[0179] In a specific embodiment, the tracer nucleic acid sequence comprises a barcode selected from the group consisting of bl-bl2 barcodes as defined in Table 1.

[0180] On the other hand, in the case of considering the use of codons, the tracer nucleic acid sequence can be embedded in the coding region of the nucleic acid payload. Among 64 codons, 3 coding stop codons and 61 coding 20 kinds of standard amino acids. Among 20 kinds of amino acids, only two kinds (Met, Trp) are coded by a unique codon, nine kinds (Asn, Asp, Cys, Gln, Glu, His, Lys, Phe, Tyr) are coded by two unique codons, one (Ile) is coded by three unique codons (similarly, three unique stop codons), five kinds (Ala, Gly, Pro, Thr, Val) are coded by four kinds of unique codons, and three kinds (Arg, Leu, Ser) are coded by six kinds of unique codons. This degeneracy of 18 kinds of standard amino acids (except the stop codon) makes it possible to introduce codon changes into the DNA sequence, so that the difference introduced in the coding sequence still encodes the protein with the same amino acid sequence.

[0181] In a specific embodiment, a coding sequence with altered codon usage is introduced into the nucleic acid payload in such a way that all nucleic acid payloads packaged in the same capsid have the same tracer, and thus nucleic acid payloads packaged in different capsids have different tracers. In this case, both the presence and relative abundance of each bacterial delivery vehicle in the multivalent mixture can be confirmed by PCR, qPCR or ddPCR using primers specific for the tracer nucleic acid sequence.

[0182] In order to design a tracer that is embedded in a protein coding region, one or more structural features may be considered. Such features may include those features that are considered for insertion into the non-coding region of the nucleic acid payload when designing the tracer. The tracer sequence to be inserted into the coding region should be designed to introduce codon changes into the protein coding region so that the differences introduced in the coding region encode proteins with the same amino acid sequence. The tracer should have minimal impact on the efficiency of protein expression or the function of the protein.

[0183] On the one hand, the tracer should minimally affect the growth of the packaging bacterial cells used to produce the bacterial delivery vector and the growth of the targeted bacterial cells. Further, the tracer should minimally affect the production of the bacterial delivery vector within the packaging bacterial cells.

[0184] The tracer for insertion into the coding region can be designed in a way that allows detection and quantification of the bacterial delivery vehicle in a mixture of theoretically any number of such vehicles. Such detection can initially be accomplished using a common site, i.e., a constant region, e.g. Figure 3 C1 and C2, which serve as targets for primer binding and subsequent amplification (see Figure 3). Thus, the use of this common site allows for the co-amplification of many different tracer nucleic acid sequences. In one embodiment, the nucleic acid tracer sequence can also enable the detection of each specific tracer nucleic acid sequence and thus the presence of its associated bacterial delivery vehicle by using one common site and one variable site per construct: V1, V2, ..., Vx, (see Figure 3 ). This variable site can be used in an initial single amplification cycle, or can be used in a second amplification cycle after amplification using the common site.

[0185] Each tracer generated for insertion into the coding region can be checked to detect undesired restriction sites. Additionally, secondary structure, melting temperature, and sequence homology can be evaluated to minimize secondary structure, ensure a sufficiently high melting temperature to allow annealing of the targeting primer to the tracer sequence, and minimize the likelihood of homologous recombination, respectively. Once the tracer sequence is selected, the tracer nucleic acid, which may include a barcode, can be recombinantly or chemically synthesized and cloned into its corresponding position within the non-coding region of the DNA nucleic acid payload.

[0186] In a specific non-limiting embodiment, a tracer system was developed as follows. A tracer sequence to be inserted into the coding DNA sequence (CDS) of the TEM-1 β-lactamase (bla) protein is selected, which is commonly used to confer ampicillin resistance when expressed in cells. For the design of the tracer, a coding region of (X) 10 codons in length is selected from nucleotides 118-147 in the bla CDS. The tracer sequence includes gca-cga-gtg-ggt-tac-atc-gaa-ctg-gat-ctc (SEQ ID NO: 18); it encodes 10 amino acids ARVGYIELDL (SEQ ID NO: 19) at positions 40-49. Within the selected coding region (X), the codons encoding (X) amino acids (or stop codons), methionine (M, Met) and tryptophan (W, Trp) amino acids remain unchanged because these amino acids have one and only one unique codon. In the bla example, none of the selected 10 amino acid segments is M or W, which means that all amino acids have multiple codons that can encode each corresponding amino acid. In the remaining codons / amino acids in region X, each amino acid is registered so that all codons encoding the amino acid are numbered and listed (for example, Ala40: 1) GCT, 2) GCC, 3) GCA, 4) GCG, see Figure 3). All combinations between each codon possibility at each amino acid position within region X are then determined and listed as unique strings within an exhaustive, general list of all possible codon combinations. For example, for the 10 amino acid region AA40-49 in TEM-1 β-lactamase, one possibility represented by numbers corresponding to amino acid positions 40-49 and specific numbers representing each specific possible codon would be {1,1,1,1,1,1,1,1,1,1}, another would be {2,1,1,1,1,1,1,1,1,1,1}, another would be {3,1,1, 1,1,1,1,1,1,1,1}, etc., representing each possible codon at each amino acid position to exhaust possible unique combinations. The above three example representations would correspond to three thirty nucleotide sequences, in which only the first codon (GCT / GCC / GCA, 1 / 2 / 3, corresponding to position AA40, Ala) is different, and the following 27 nucleotides would be used Figure 4 The first possibility at each remaining amino acid in the sequence (thus, CGT / GTT / GGT / TAT / ATT / GAA / CTT / GAT / CTT (SEQ ID NO: 20) to represent the remaining RVGYIELDL (SEQ ID NO: 21)). Then take an exhaustive list of all possible codon combinations (or sometimes just a subset to reduce computing time) and calculate the Hamming distance between each. In the TEM-1 β-lactamase example, there are multiple possible codons for each of the 10 amino acids (A=4, R=6, V=4, G=4, Y=2, I=3, E=2, L=6, D=2, L=6), and given these, the total number of codons that can be generated is the product 4*6*4*4*2*3*2*6*2*6 or 331,776.

[0187] Once designed, check for the presence of undesired restriction sites 50 bp upstream and 50 bp downstream of the 30 bp barcode as well as within the barcode. Only those tracers lacking such restriction sites were selected for use. Additionally, check for the presence of any secondary structure, melting temperature, and sequence homology to minimize secondary structure, ensure that the barcode targeting primer has a sufficiently high melting temperature, and minimize the possibility of homologous recombination, respectively.

[0188] The number of unique codon combinations is selected to correspond to the number of unique members of the bacterial delivery vehicle mixture, such that the maximum Hamming distance (Mohammadi-Kambs M. et al., 2017, ACS Omega. 2017 Apr 30; 2(4): 1302-1308) between each is selected / preferred (so as to both enable unique identification of each member and attempt to minimize the possibility of cross-reactivity / detection in / between the unique members and the unique probes / primers for each member). The selected DNA barcodes are then recombinantly or chemically synthesized and cloned into their corresponding positions within the CDS of the DNA nucleic acid payload.

[0189] In still another aspect, the tracer nucleic acid sequence can be embedded in the 5' or 3' untranslated region (UTR) DNA sequence. The 5' and 3' UTRs are regions on each side of the protein coding sequence (5' and 3' ends, respectively) that are transcribed into mRNA but not translated into protein. In prokaryotes, the 5' UTR is typically much shorter than the 3' UTR (3-10 nucleotides long) and has a greater effect on protein expression than the 3' UTR. The design features of tracers for embedding in the 5' or 3' untranslated regions are similar to those for tracers to be embedded in the non-coding region of the nucleic acid payload.

[0190] Provide a method for detecting and quantifying a bacterial delivery vehicle in a polyvalent bacterial delivery vehicle mixture, wherein each bacterial delivery vehicle in the mixture comprises a nucleic acid payload with a unique tracer, and the method comprises amplification cycles by using a primer bound to a sequence in a tracer sequence, detecting and quantifying the steps of all or each bacterial delivery vehicle in the mixture. As described above, according to the use of primers targeting a constant region and / or a variable region of a tracer, all bacterial delivery vehicles or only a portion thereof can be detected and / or quantified. Therefore, the method enables detection and / or quantification of each bacterial delivery vehicle population contained in a polyvalent mixture and / or all bacterial delivery vehicles contained in the mixture. This mixture of bacterial delivery vehicles comprising a tracer sequence embedded in its nucleic acid payload enables characterization of the final drug product by detecting and quantifying each bacterial delivery vehicle in a polyvalent bacterial delivery vehicle mixture. This method also allows identification and tracking of bacterial delivery vehicles after giving organisms, humans and / or animal models during safety and efficacy clinical studies (shedding, biodistribution). For example, if the presence of a particular tracer sequence is found to be associated with undesirable safety and / or biodistribution profile outcomes, its associated bacterial delivery vehicle can be removed from the bacterial delivery vehicle mixture, thereby making the final drug product safer.

[0191] Also provided is a rapid high throughput screening method for testing the activity of bacterial delivery vehicles against a collection of individual bacterial strains or a mixture of bacterial strains. This screening method provides an effective way to identify desirable bacterial delivery vehicles that are capable of transferring their nucleic acid payloads into specific target bacterial cells in an effective manner.

[0192] Additionally, methods are provided for characterizing the capacity and extent of sequential bacterial delivery following administration of different vehicles over a time dimension (initial transduction with delivery vehicle 1, then allowing a certain amount of time to elapse, followed by subsequent transduction with delivery vehicle 2).

[0193] Further additional methods are provided for characterizing the despeciation targeting of specific bacterial delivery vehicles from a mixture when administered to a complex microbial community of two or more prokaryotic groups, such as (but not limited to) a human microbiome sample.

[0194] In addition, a method for detecting and tracking a bacterial delivery vehicle after administering a multivalent mixture of bacterial delivery vehicles to an organism is provided, wherein each bacterial delivery vehicle comprises a nucleic acid payload having a unique tracer, the method comprising the steps of detecting and quantifying each bacterial delivery vehicle in the mixture by performing amplification cycles using primers that bind to sequences within the tracer and optionally sequencing. Such amplification methods include, for example, PCR, qPCR, ddPCR, or NGS. Example

[0195] Example 1

[0196] Plasmid pAK272B (SEQ ID NO: 1) was modified to include 7 different barcodes (SEQ ID NO: 2 to 8; Figure 5 A single barcode in the pAK272B plasmid (referred to as B1, B2, B3, B4, B5, B6 and B7) was used to generate up to 7 distinguishable plasmid variants, referred to as pB1, pB2, pB3, pB4, pB5, pB6 and pB7. The DNA concentration of each plasmid variant was estimated based on absorbance at 260 nm and used to create an equimolar mixture, aiming to have 1250 copies of each plasmid variant per microliter of mixture. The absolute copy number of each variant in the mixture was then confirmed by droplet digital PCR (ddPCR) experiments. To achieve this, a 20 microliter ddPCR reaction was designed containing 100 nM primers that bind to a common region of the pAK272B plasmid backbone (SEQ ID NO: 9; in Figure 5 ), 100 nM of another primer that specifically binds to a single selected barcode (SEQ ID NOs: 10 to 16; in Figure 5The ddPCR reaction was performed with 8 μl of the barcoded plasmid mix (i.e., approximately 500 copies of each variant per μl of final ddPCR reaction) and a commercially available ddPCR master mix containing polymerase, dNTPs, and DNA dye (QX200 ddPCR EvaGreen Supermix). One reaction was set up for each primer pair specific for an individual barcode, for a total of 7 reactions, plus 7 negative controls in which the plasmid mix was replaced with water. The ddPCR workflow was performed as recommended by the manufacturer. Figure 6 As shown, the number of each barcoded plasmid variant measured was well within the expected order of magnitude (227 copies per microliter, expected to be approximately 500 copies per microliter, i.e., 0.3 log 10 This small difference may be due to the absorbance method used to estimate the initial DNA concentration. Nevertheless, as initially expected, the copy numbers of all seven plasmid variants were found to be similar.

[0197] Example 2

[0198] Four different barcoded versions of plasmid pAK272B were used to identify differences in in vivo delivery rates into target bacteria between the four lambda phage-derived scaffold variants. Each barcoded plasmid was packaged into one lambda phage-derived scaffold variant and the barcoded plasmids were then mixed at 2 x 10 7 100 μl of this mixture was administered to 9 mice colonized with the target strain MG-GFP and the mixture was supplemented by plating 4 μl of 10-fold serial dilutions of resuspended feces (purified to 10 μl) per animal on selective medium containing chloramphenicol (plasmid pAK272B carries the chloramphenicol resistance gene). -5 ) Successfully transduced bacteria were recovered from mouse feces. The entire transduced bacterial population contained within the 4 µl pure fecal sample aliquot was then grown in vitro in the presence of chloramphenicol, and any plasmids present were purified by conventional plasmid miniprep techniques. The absorbance at 260 nm was used to estimate the total DNA concentration, and a reasonable amount of DNA was subjected to ddPCR; this amount was calculated to aim for no more than 80,000 copies per reaction, assuming that all purified and detected DNA corresponded to barcoded plasmids. One reaction was set up with primer pairs specific for each barcode, yielding a total of 4 reactions per initial mouse sample. Figure 7The absolute amount of each barcoded plasmid recovered from transduced bacteria for each experimental mouse (M10 to M18) is shown. The clear abundance of barcode B4 in all nine animals indicates that the lambda phage-derived scaffold variant packaged with this particular plasmid variant is most efficient in terms of delivery to target bacteria in vivo. Other plasmid variants were also detected, but at lower copy numbers, indicating that the corresponding lambda phage-derived scaffolds were delivered with lower efficiency in vivo.

Claims

1. A multivalent mixture of bacterial delivery vehicles comprising at least two different bacterial delivery vehicles, the bacterial delivery vehicles being bacterial phage-derived scaffolds and differing in bacterial cell binding ability and / or host range, wherein each bacterial delivery vehicle comprises a phagemid having an embedded unique tracer, wherein each bacterial delivery vehicle comprises a phagemid having an identical sequence except for the tracer, wherein the tracer comprises a barcode having a length between 25-50 nucleic acids.

2. The multivalent mixture of the bacterial delivery vehicle of claim 1, wherein the tracer is embedded in a non-coding region.

3. The multivalent mixture of the bacterial delivery vehicle of claim 1, wherein the tracer is embedded in the coding region.

4. The multivalent mixture of bacterial delivery vehicles of claim 3, wherein the tracer comprises altered codon usage but encodes a protein with an unchanged amino acid sequence.

5. A method for detecting and / or quantifying bacterial delivery vehicles in a polyvalent bacterial delivery vehicle mixture, wherein the polyvalent bacterial delivery vehicle mixture comprises at least two different bacterial delivery vehicles, wherein the bacterial delivery vehicles are bacterial phage-derived scaffolds and differ in bacterial cell binding ability and / or host range, wherein each bacterial delivery vehicle comprises a phagemid having an identical sequence except for a unique tracer, wherein the method comprises detecting and / or quantifying (i) each bacterial delivery vehicle and / or (ii) the total bacterial delivery vehicle by amplifying the tracer using primers that bind to a unique tracer sequence, wherein the tracer comprises a barcode having a length between 25-50 nucleic acids.

6. A method for detecting and / or quantifying bacterial delivery vehicles after administering a polyvalent bacterial delivery vehicle mixture to a subject, the polyvalent bacterial delivery vehicle mixture comprising at least two different bacterial delivery vehicles, the bacterial delivery vehicles being bacterial phage-derived scaffolds and differing in bacterial cell binding ability and / or host range, wherein each bacterial delivery vehicle comprises a phagemid having an identical sequence except for a unique tracer nucleic acid sequence, the method comprising detecting and / or quantifying (i) each bacterial delivery vehicle and / or (ii) the total bacterial delivery vehicle in a sample derived from the subject by performing multiple amplification cycles using primers that bind to the unique tracer sequence, wherein the tracer comprises a barcode having a length between 25-50 nucleic acids.

7. The method of claim 5 or 6, wherein the tracer is embedded in a non-coding region.

8. The method of claim 5 or 6, wherein the tracer is embedded in the coding region.

9. The method of claim 8, wherein the tracer nucleic acid comprises altered codon usage but encodes a protein having an unchanged amino acid sequence.

10. The method of claim 5 or 6, wherein the detection and quantification of each bacterial delivery vehicle is performed by performing multiple amplification cycles using primers that bind to a unique tracer nucleic acid sequence.

11. A pharmaceutical composition comprising a multivalent mixture of bacterial delivery vehicles, the mixture comprising at least two different bacterial delivery vehicles, the bacterial delivery vehicles being bacterial phage-derived scaffolds and differing in bacterial cell binding ability and / or host range, wherein each bacterial delivery vehicle comprises a phagemid having a unique tracer nucleic acid sequence, wherein each bacterial delivery vehicle comprises a phagemid having the same sequence except for the tracer, wherein the tracer comprises a barcode having a length between 25-50 nucleic acids.

12. The pharmaceutical composition of claim 11, wherein each bacterial delivery vehicle is as defined in any one of claims 1-4.

Images