Oligonucleotides and RNA-targeted site-specific editing methods

Abstract

An oligonucleotide is provided that can induce adenosine deaminase 1-specific editing activity. The oligonucleotide is used to induce site-specific editing of a target RNA, including: a first oligonucleotide that determines the target RNA; and a second oligonucleotide connected to the 5' side of the first oligonucleotide. The first oligonucleotide consists of: a target corresponding nucleotide residue corresponding to the adenosine residue in the target RNA; an oligonucleotide of 10 to 24 residues, which is connected to the 3' side of the target corresponding nucleotide residue and has a base sequence complementary to the target RNA; and an oligonucleotide of 3 to 6 residues, which is connected to the 5' side of the target corresponding nucleotide residue and has a base sequence complementary to the target RNA. The second oligonucleotide has a residue number of 2 to 10, forms a complementary chain with the target RNA, and the complementary chain contains at least one mismatched base.

Description

Technical Field

[0001] The present invention relates to a method for site-specific editing of oligonucleotides and target RNA. Background Art

[0002] With the development of genome editing technology, a method of controlling life phenomena by modifying the genetic information that serves as the blueprint of an organism, that is, the DNA information in cells, has begun to be used in the medical and drug development fields as a disease treatment method. Since DNA is a constant molecule in cells, the DNA modification effect will remain permanently in the target cell or target organism. On the other hand, RNA is a transient genetic information molecule. Therefore, modifying RNA information can give the target organism a temporary rather than permanent genetic information modification effect.

[0003] As an RNA modification technology, for example, International Publication No. 2016 / 097212 discloses an oligonucleotide construct for site-specific editing of nucleotides in a target RNA sequence, the oligonucleotide construct comprising: a targeting portion comprising an antisense sequence complementary to a portion of the target RNA; and a recruitment portion, which is present in cells and can be combined with an RNA editing entity capable of nucleotide editing for recruitment. For another example, International Publication No. 2017 / 010556 discloses a method for introducing site-specific RNA mutations, which is to act on a complex of a double-stranded specific adenosine deaminase (ADAR) on a target RNA and a target editing guide RNA.

[0004] As adenosine deaminase with RNA editing activity, ADAR1 and ADAR2 isoforms are known, and these are considered to be expressed in a cell type-specific manner in vivo. For example, it has been studied that ADAR1 is hardly present in human skeletal muscle cells. On the other hand, it has been studied that ADAR2 is hardly present in human bone marrow cells. In addition, it is generally believed that ADAR1 is more present in human cells. Summary of the invention

[0005] Problem that the invention aims to solve

[0006] It can be considered that if the editing activity of isoform-specific ADAR1 can be induced, cell-specific RNA can be edited. Moreover, more efficient RNA editing can be performed in human cells. Therefore, one object of the present invention is to provide an oligonucleotide that can induce ADAR1-specific editing activity.

[0007] Solutions to the problem

[0008] The specific scheme for solving the problem is as follows, and the present invention includes the following aspects. The first aspect is an oligonucleotide for inducing site-specific editing of a target RNA, the oligonucleotide comprising: a first oligonucleotide for determining the target RNA; and a second oligonucleotide connected to the 5' side of the first oligonucleotide. The first oligonucleotide consists of: a target corresponding nucleotide residue corresponding to the adenosine residue in the target RNA; an oligonucleotide of 10 to 24 residues, which is connected to the 3' side of the target corresponding nucleotide residue and has a base sequence complementary to the target RNA; and an oligonucleotide of 3 to 6 residues, which is connected to the 5' side of the target corresponding nucleotide residue and has a base sequence complementary to the target RNA. The number of residues of the second oligonucleotide is 2 to 10, forming a complementary chain with the target RNA. The complementary chain formed by the second oligonucleotide contains at least one mismatched base.

[0009] The second aspect is a method for site-specific editing of a target RNA, comprising: contacting the oligonucleotide and the target RNA in the presence of adenosine deaminase 1.

[0010] Effects of the Invention

[0011] According to the present invention, an oligonucleotide capable of inducing ADAR1-specific editing activity can be provided. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 Schematic diagram showing a complex consisting of a target RNA and a target editing guide RNA.

[0013] Figure 2 A diagram showing the results of target RNA editing analysis in vitro.

[0014] Figure 3 Schematic diagram showing a complex consisting of a target RNA and a target editing guide RNA.

[0015] Figure 4 A diagram showing the results of target RNA editing analysis in vitro.

[0016] Figure 5A Schematic diagram showing a complex consisting of a target RNA and a target editing guide RNA.

[0017] Figure 5B Schematic diagram showing a complex consisting of a target RNA and a target editing guide RNA.

[0018] Figure 6 A diagram showing the results of in vitro editing analysis of target RNA.

[0019] Figure 7 A diagram showing the results of target RNA editing analysis in cultured cells.

[0020] Figure 8 Graphs showing changes in luminescence intensity caused by target RNA editing in cultured cells.

[0021] Fig. 9 A diagram showing the results of target RNA editing analysis in cultured cells.

[0022] Fig.10 Graphs showing changes in luminescence intensity caused by target RNA editing in cultured cells.

[0023] Fig.11A Schematic diagram showing a complex consisting of a target RNA and a target editing guide RNA.

[0024] Fig. 11B Schematic diagram showing a complex consisting of a target RNA and a target editing guide RNA.

[0025] Fig.12 A diagram showing the results of in vitro editing analysis of various target RNAs.

[0026] Fig.13A Schematic diagram showing a complex consisting of a target RNA and a target editing guide RNA.

[0027] Fig. 13B Schematic diagram showing a complex consisting of a target RNA and a target editing guide RNA.

[0028] Fig.14 A diagram showing the results of in vitro editing analysis of target RNA.

[0029] Fig.15 A diagram showing the results of in vitro editing analysis of target RNA.

[0030] Fig.16 A diagram showing the results of in vitro editing analysis of target RNA. DETAILED DESCRIPTION

[0031] Hereinafter, the embodiments of the present invention will be described in detail. However, the embodiments described below are for embodying the technical concept of the present invention and schematically illustrate oligonucleotides, and the present invention is not limited to the oligonucleotides described below.

[0032] Target editing guide RNA

[0033] An oligonucleotide for inducing site-specific editing of a target RNA (hereinafter, also referred to as a target editing guide RNA) comprises: a first oligonucleotide that determines the target RNA; and a second oligonucleotide connected to the 5' side of the first oligonucleotide. The first oligonucleotide is composed of: a target corresponding nucleotide residue corresponding to the adenosine residue in the target RNA; an oligonucleotide of 10 to 24 residues, which is connected to the 3' side of the target corresponding nucleotide residue and has a base sequence complementary to the target RNA; and an oligonucleotide of 3 to 6 residues, which is connected to the 5' side of the target corresponding nucleotide residue and has a base sequence complementary to the target RNA. The second oligonucleotide has a residue number of 2 to 10, and forms a complementary chain with the target RNA, and the complementary chain contains at least one mismatched base.

[0034] On the 5' side of the first oligonucleotide that determines the target RNA, the oligonucleotide can specifically induce the editing activity of ADAR1, and the oligonucleotide includes a short second oligonucleotide that can form a complementary chain containing at least one mismatched base with the target RNA. It can be considered that this is because, for example, the presence of mismatched bases is conducive to the recruitment of ADAR1, but hinders the recruitment of ADAR2.

[0035] In the target editing guide RNA of the present embodiment, the length is shorter than that of the conventional target editing guide RNA, so the manufacturing cost is simply reduced. In addition, since chemical synthesis is easy to perform, in addition to the method of introducing the target editing guide RNA into the cell by gene expression, the method of directly introducing the chemically synthesized target editing guide RNA into the cell is also easy to implement. At the same time, existing artificial nucleic acids used in nucleic acid drug development, etc. can also be applied to target editing guide RNA. Furthermore, by improving the intracellular decomposition resistance, improving the cell introduction efficiency, etc., a more functional target editing guide RNA can be provided. Furthermore, the target editing guide RNA is composed of the minimum number of residues required for editing induction, so that off-target editing at positions other than the adenosine residues that are editing targets can be suppressed while maintaining the specificity for the target RNA.

[0036] Target editing guide RNA, for example, induces site-specific editing of the target RNA by specifically recruiting ADAR1 in the ADAR that catalyzes target editing into the target RNA. ADAR is an enzyme that converts adenosine residues in double-stranded RNA into inosine residues by hydrolytic deamination reaction, and is widely present in mammalian cells. Since the structure of inosine residues is similar to that of guanosine residues, inosine residues are translated into guanosine residues when translating RNA information, thereby editing the RNA information. If such RNA editing occurs in the amino acid-encoding portion, amino acid substitutions will occur even if there is no DNA mutation in the genome, and the function of the target gene can be controlled.

[0037] When the target editing guide RNA is introduced into mammalian cells, ADAR1 present in the cells can be specifically recruited to the target RNA, thereby inducing site-specific editing of the target RNA.

[0038] The target editing guide RNA of the present embodiment can induce ADAR1-specific editing activity. ADAR1 specificity means, for example, in vitro, the ratio of the editing induction activity of ADAR1 to the editing induction activity of ADAR2 is greater than 1, preferably 1.5 or more, 2 or more, or 5 or more. It should be noted that the editing induction activity of ADAR1 and ADAR2 is evaluated under the following conditions. When the HTR2C RNA (serotonin 2C receptor mRNA precursor) known to be edited by adenosine deaminase is respectively subjected to editing reactions, the concentrations of ADAR1 and ADAR2 are adjusted to show that the A site of ADAR1 is about 30% and the D site of ADAR2 is about 90% of the editing ratio. In addition, in In Cell, the ADAR1 expression plasmid and ADAR2 expression plasmid constructed using the same expression vector are transfected into cells for expression under the same conditions, which means that the editing induction efficiency of ADAR1 to the same target editing site is higher.

[0039] The first oligonucleotide contained in the target editing guide RNA determines the target RNA. The target RNA is not particularly limited, as long as it contains adenosine residues as the editing object, and can be any of cellular RNA and viral RNA, usually a protein-encoding mRNA precursor or mRNA. The editing site in the target RNA can be present in an untranslated region, a splicing region, an exon, an intron, or any region that affects the stability, structure or function of the RNA. In addition, the target RNA may also contain mutations that should be modified or changed. Alternatively, the target RNA may also be an RNA that has mutated to encode its sequence as an expression type different from the natural type.

[0040] The target RNA is preferably a protein encoding RNA, and the encoded proteins may specifically include: serotonin receptors, glutamate receptors, membrane potential-dependent potassium channels, STAT3, NFkBIA, MAPK14 and other phosphorylated proteins involved in signal transduction.

[0041] Target editing guide RNA can be applied to the treatment of genetic diseases, for example. Genetic diseases include: cystic fibrosis, leukoderma, alpha-1 antitrypsin deficiency, Alzheimer's disease, amyotrophic lateral sclerosis, asthma, beta-thalassemia, CADASIL syndrome, Charcot-Marie-Tooth disease, chronic obstructive pulmonary disease (COPD), distal spinal muscular atrophy (DSMA), Duchenne / Becker muscular dystrophy, dystrophic epidermolysis bullosa, epidermolysis bullosa (Epidermolysis), Fabry disease, Leiden factor V-related disease, familial adenoma, polyposis, galactosemia, Gaucher disease, glucose-6-phosphate dehydrogenase deficiency, hemophilia, hereditary hemochromatosis, Hunter syndrome, Huntington disease, Haller syndrome, inflammatory bowel disease (IBD), hereditary multiple aggregation syndrome, congenital amaurosis, Lesch-Nyhan syndrome Syndrome, Lynch syndrome, Marfan syndrome, mucopolysaccharidosis, muscular dystrophy, myotonic dystrophy type I and II, neurofibromatosis, NieMann-Pick disease types A, B and C, NY-eso1-related pancreatic cancer, Parkinson's disease, Peutz-Jeghers syndrome, phenylketonuria, Pompe disease, primary ciliary body disease, prothrombin mutation-related diseases such as prothrombin G20210A mutation, pulmonary hypertension, retinitis pigmentosa, Sandhoff disease, severe combined immunodeficiency syndrome (SCID), sickle cell anemia, spinal muscular atrophy, Stargardt disease, Tay-sachs disease, Usher syndrome, X-linked immunodeficiency, various forms of cancer (e.g., BRCA1 and 2-related breast cancer, ovarian cancer, etc.), etc.

[0042] The first oligonucleotide is composed of the following: a target corresponding nucleotide residue in the target RNA corresponding to the adenosine residue as the editing target; a 3' side oligonucleotide of 10 to 24 residues, which is connected to the 3' side of the target corresponding nucleotide residue and has a base sequence complementary to the corresponding sequence of the target RNA; and a 3' side oligonucleotide of 3 to 6 residues, which is connected to the 5' side of the target corresponding nucleotide residue and has a base sequence complementary to the corresponding sequence of the target RNA. The oligonucleotides respectively connected to the 5' side and the 3' side of the target corresponding nucleotide residue form a double strand with the target RNA, and the whole forms a complementary strand (hereinafter, also referred to as the first complementary strand), thereby determining the target RNA and the editing target site in the target RNA. Among them, the complementary base sequence, in addition to the base sequence that forms the Watson-Crick type base pair, also includes a base sequence that forms a thermodynamically stable non-Watson-Crick type wobble base pair such as a GU base pair.

[0043] The target corresponding nucleotide residue is a nucleotide residue corresponding to the adenosine residue as the editing target, such as a cytidine residue, a uridine residue, an adenosine residue, or a derivative of these residues. The target corresponding nucleotide residue is preferably a base that does not form a base pair with the adenosine residue as the editing target, more preferably a cytidine residue or a derivative thereof, and further preferably a cytidine residue.

[0044] In the first oligonucleotide, the number of residues of the oligonucleotide having a base sequence complementary to the target RNA and linked to the 3' side of the target corresponding nucleotide residue is 10 to 24, preferably 11 to 12 or 13, and preferably 22 to 20, 18 to 16 or 15. When the number of residues is within the range, the specificity for ADAR1 tends to be further improved.

[0045] In the first oligonucleotide, the oligonucleotide connected to the 3' side of the target corresponding nucleotide residue may have a complementary base sequence that does not contain mismatched bases relative to the target RNA. In this case, it is preferred that the target RNA is not connected to a guanosine residue at the 5' side of the adenosine residue as the editing target. That is, in the case where the base connected to the 5' side of the adenosine residue as the target RNA editing target is an adenosine residue, a cytidine residue or a uridine residue, in the first oligonucleotide, the oligonucleotide connected to the 3' side of the target corresponding nucleotide residue preferably has a complementary base sequence that does not contain mismatched bases relative to the target RNA.

[0046] In the first oligonucleotide, the oligonucleotide connected to the 3' side of the target corresponding nucleotide residue may contain a base that is non-complementary to the base sequence of the target RNA. For example, in a target RNA in which a guanosine residue is connected to the 5' side of an adenosine residue as an editing target, the editing-inducing activity may be reduced. However, even in this case, the editing-inducing activity can be improved by having a base sequence containing a base that is non-complementary to the guanosine residue in the first oligonucleotide. The base that is non-complementary to the guanosine residue can be, for example, a guanosine residue. That is, if the target RNA is connected to a guanosine residue on the 5' side of an adenosine residue as an editing target, the target editing guide RNA for the target RNA can be connected to a guanosine residue on the 3' side of the target corresponding nucleotide residue.

[0047] In the first oligonucleotide, the number of residues of the oligonucleotide linked to the 5' side of the target corresponding nucleotide residue and having a base sequence complementary to the target RNA is 3 to 6, preferably 3 to 5, 3 to 4 or 3. When the number of residues is within the above range, the specificity for ADAR1 tends to be further improved.

[0048] The second oligonucleotide forms a complementary chain (hereinafter also referred to as the second complementary chain) containing one or more mismatched bases with the target RNA. The number of residues of the second oligonucleotide is more than 2 and less than 10 or more than 4 and less than 8. The number of residues of the second oligonucleotide is, for example, more than 3, preferably more than 4 or more than 5, and for example, less than 10, preferably less than 9, less than 8 or less than 7. When the number of residues is within the range, editing induction tends to be further enhanced. The number of mismatched bases in the second complementary chain is, for example, less than 3, preferably 1.

[0049] The mismatched bases in the second complementary chain can form mismatched base pairs, or they can come from the following nucleotide residues, which are inserted into at least one of the target RNA or the second oligonucleotide that forms a complete complementary chain. The mismatched bases preferably come from nucleotide residues inserted into the complete complementary chain, and more preferably from nucleotide residues inserted into the target RNA side of the complete complementary chain. This will further enhance the editing induction. Among them, the mismatched base pair refers to a combination of two corresponding bases in the target RNA and the second oligonucleotide that will not form a stable base pair.

[0050] The position of the mismatch base in the second complementary strand is preferably any one of the first to third residues on the 3' side of the target RNA or the 5' side of the first oligonucleotide of the first complementary strand composed of the target RNA and the first oligonucleotide, more preferably the first residue.

[0051] The mismatch base in the second complementary chain can, for example, come from a nucleotide residue inserted into the first residue, which is connected to the 3' side of the target RNA forming the first complementary chain, or it can be a mismatch base pair formed at the first residue, which is the first residue on the 5' side of the first oligonucleotide forming the first complementary chain.

[0052] One form of the target editing guide RNA is that the first oligonucleotide that forms the first complementary chain with the target RNA includes: a cytidine residue as a target corresponding nucleotide residue; an oligonucleotide with 12 to 16 residues, which has a base sequence complementary to the base sequence of the target RNA and is connected to the 3' side of the target corresponding nucleotide residue; and an oligonucleotide with 3 residues, which has a base sequence complementary to the base sequence of the target RNA and is connected to the 5' side of the target corresponding nucleotide residue, wherein the second oligonucleotide includes an oligonucleotide with 4 to 8 residues having a complementary base sequence after the second residue on the 3' side of the target RNA that forms the first complementary chain.

[0053] The nucleotide residues constituting the target editing guide RNA may be natural ribonucleotide residues or non-natural modified nucleotide residues. Modified nucleotide residues include: residues modifying the phosphodiester bond between nucleosides, residues modifying the 2'hydroxyl group of ribose, residues containing intramolecular cross-linked ribose, residues modifying at least one of purine bases and pyrimidine bases, etc. Examples of modifications of the phosphodiester bond portion include, for example, phosphorothioate, methylphosphonate, methylphosphonate, dithioate, phosphoramidate, peptide bond substitution, etc. Examples of modifications of the 2'hydroxyl group of ribose include: 2'-O-methylation, 2'-O-methoxyethylation, 2'-O-aminopropyl (AP) , 2'-fluorination, 2'-O-methylcarbamoylethylation, 3,3-dimethylallylation, deoxyribonucleotidation, etc. Examples of intramolecular cross-linking of ribose include nucleotides cross-linked at the 2' and 4' positions (2', 4'-BNA). 2',4'-BNA includes, for example, locked nucleic acid (α-L-methyleneoxy (4'-CH2-O-2') BNA or β-D-methyleneoxy (4'-CH2-O-2') BNA, ethoxy (4'-(CH2)2-O-2') BNA, ENA), β-D-thio (4'-CH2-S-2') BNA, aminooxy (4'-CH2-ON(R)-2') BNA (R is H or CH3), hydroxyamino ( 4'-CH2-N(R)-O-2')BNA (R is H or CH3), 2',4'-BNACOC, 3'-amino-2',4'-BNA, 5'-methyl BNA, (4'-CH(CH3)-O-2')BNA called cEt-BNA, (4'-CH(CH2OCH3)-O-2')BNA called cMOE-BNA, amide type BNA (4'-C(O)-N(R)-2')BNA (R is H or CH3) called AmNA, etc. Examples of modifications of the base portion include: halogenation; alkylation, such as methylation, ethylation, n-propylation, isopropylation, cyclopropylation, n-butylation, isobutylation, sec-butylation, tert-butylation, cyclobutylation, etc.; hydrogenation; amination; deamination; demethylation, etc.

[0054] Methods for site-specific editing of target RNA

[0055] The site-specific editing method of the target RNA includes: in the presence of adenosine deaminase 1, contacting the target RNA with a target editing guide RNA, which is an oligonucleotide that induces site-specific editing of the target RNA. The target editing guide RNA forms a double strand containing mismatched bases with the target RNA, and by specifically recruiting adenosine deaminase 1, the adenosine residues contained in the target RNA can be site-specifically converted into inosine residues. The site-specific editing method of the target RNA can be performed in vitro or in vivo.

[0056] The site-specific editing method of the target RNA can be performed, for example, by introducing or expressing the above-mentioned target editing guide RNA into a eukaryotic cell having the target RNA. The method of introducing the target editing guide RNA into a eukaryotic cell can be appropriately selected and applied from various methods used in nucleic acid drugs. In addition, by introducing a plasmid capable of expressing the target editing guide RNA into a eukaryotic cell, the target editing guide RNA can be expressed in a eukaryotic cell.

[0057] By applying the site-specific editing method of target RNA using target editing guide RNA to amino acid mutations involved in the functional expression of intracellular proteins such as sugar chain modification sites, phosphorylation sites, and metal coordination sites, a new methodology for temporarily controlling the function of intracellular proteins can be provided. In addition, by popularizing the functional control method of proteins in vivo based on the site-specific editing method of target RNA using target editing guide RNA, it will become a molecular technology that can contribute to the development of research in the field of life sciences.

[0058] Nucleic acid drugs are currently being developed that utilize the inhibition of target protein expression by siRNA or the functional control of target protein by functional RNA called aptamers. However, a drug that can convert the information of mRNA and modify the function of the target protein encoded by mRNA has not yet been found. Therefore, target editing guide RNA is expected to create a new type of nucleic acid drug with unprecedented efficacy.

[0059] For example, nonsense mutation type hereditary diseases are diseases caused by the inability to synthesize the original protein due to the termination codon formed by a point mutation on the gene. Nonsense mutation type hereditary diseases include, for example, muscular dystrophy, multiple sclerosis, Alzheimer's disease, neurological diseases such as nerve tissue degeneration, Parkinson's disease, and cancer. For example, by editing termination codons such as UAA, UAG, and UGA through target editing guide RNA, the use of nucleic acid drugs with unprecedented mechanisms for the above-mentioned diseases is considered. Specifically, for example, it is considered that UAG, which is a termination codon, can be edited to UIG, which is a tryptophan codon, thereby controlling protein synthesis.

[0060] In addition, the following inspiration can be obtained. For example, most of the proteins that play an important role in cells are precisely controlled by phosphorylation / dephosphorylation to turn their functions on / off. Abnormal phosphorylation / dephosphorylation will have a great impact on various diseases including cancer. The phosphorylation sites of proteins can be Tyr, Thr, Ser, etc. By target editing guide RNA, the codons encoding these amino acids are edited to codons encoding other amino acids, thereby inhibiting the phosphorylation of proteins. Specifically, for example, by editing UAC, which is a Tyr codon, to UIC, which is a Cys codon, the phosphorylation of proteins in cells can be controlled.

[0061] In other aspects, the present invention also includes: the use of target editing guide RNA in the manufacture of a pharmaceutical composition for treating a genetic disease, the use of target editing guide RNA in treating a genetic disease, and target editing guide RNA for treating a genetic disease. The treatment subject is, for example, a mammal, including a human. In addition, the treatment subject may also be a non-human animal.

[0062] Example

[0063] Hereinafter, the present invention will be specifically described based on Examples, but the present invention is not limited to these Examples.

[0064] Preparation of adenosine deaminase

[0065] According to the description in the literature (Macbeth, MR. and Bass, BL. Methods Enzymol. 424, 319-331 (2007), FuKuda, M. et al. Sci. Rep. srep 41478 (2017)), a yeast expression system was used to synthesize / purify recombinant hADAR2 and hADAR1p110 to prepare adenosine deaminase. In addition, plasmids (pYES_A_hADAR2p110, pYES_A_hADAR1p110, pYES_A_hADAR1p150) expressing hADAR2, hADAR1p110 and hADAR1p150 were prepared by conventional methods.

[0066] Preparation of template target RNA: Synthesis of Rluc_sRNA

[0067] From psiCHECK TM-2 vector (Promega) was prepared by conventional transcription of Rluc_WT RNA (sequence number 1) to 0.2 nM. Recombinant hADAR2 was added to a final concentration of 1 μM, and incubated at 37°C for 2 hours in editing reaction buffer (20 mM HEPES-KOH (pH 7.5), 2 mM MgCl2, 100 mM NaCl, 0.5 mM DTT, 0.01% TritonX-100, 5% glycerol) for in vitro editing reaction.

[0068] The Rluc_WT RNA after the editing reaction was purified by phenol / chloroform extraction and ethanol precipitation. Next, cDNA was synthesized using Primescript Reverse Transcriptase II (TaKaRa) with Rluc_WT_BamR01 primer (sequence number 2). After that, cDNA was amplified by PCR (30 cycles; denaturation: 98°C, 10 seconds; annealing: 55°C, 15 seconds; extension: 68°C, 60 seconds) using Rluc_WT_EcoF01 primer (sequence number 3), Rluc_WT_BamR01 primer (sequence number 2) and PrimeStar GXL DNA polymerase (Polymerase) (TaKaRa). Next, the obtained cDNA was used as insert DNA and cloned into the pUC19 plasmid as described below. After restriction digestion of the insert DNA and pUC19 plasmid at 37°C for 1 hour using EcoRI (TaKaRa) and BamHI (TaKaRa), the respective DNAs were purified by phenol / chloroform extraction and ethanol precipitation. The pUC19 plasmid and insert DNA after restriction digestion were mixed at a molar ratio of 1:3, and a ligation reaction was performed using a DNA Ligation Kit (DNA Ligation Kit) <Mighty Mix> (TaKaRa). The obtained ligation sample was transformed into DH5α, and after culturing overnight at 37°C using an LB agar plate, the plasmid was extracted using a QIAprep Spin Miniprep Kit (QIAGEN). The obtained plasmid DNA was subjected to base sequence analysis, and the sequence of A122 of Rluc_WT mutated to G (Rluc_K41R) and the plasmid DNA in which Rluc_K41R was cloned (pUC19-Rluc_K41R) were obtained.

[0069] Using pUC19-Rluc_K41R as a template, PrimeStar GXL DNA polymerase (TaKaRa) was used to perform the first PCR on the 5' side fragment using Rluc_NheF01 primer (sequence number 4) and RL_W104X_RV primer (sequence number 5), and the first PCR on the 3' side fragment was performed using Rluc_XhoR01 primer (sequence number 6) and RL_W104X_FW primer (sequence number 7) (30 cycles; denaturation: 98°C, 10 seconds; annealing: 55°C, 15 seconds; extension: 68°C, 40 seconds). Next, each PCR product was diluted 100-fold, and a second PCR was performed using Rluc_NheF01 primer and Rluc_XhoR01 primer with PrimeStar GXLDNA polymerase (TaKaRa) (30 cycles; denaturation: 98°C, 10 seconds; annealing: 55°C, 15 seconds; extension: 68°C, 60 seconds), and purified by phenol / chloroform extraction and ethanol precipitation to obtain a DNA with a sequence in which G311 of Rluc_K41R was mutated to A (Rluc_K41R_W104X) (sequence number 10).

[0070] The obtained DNA (Rluc_K41R_W104X) and psiCHECK were performed at 37°C using NheI (TaKaRa) and XhoI (TaKaRa). TM -2 vector (Promega) was subjected to restriction enzyme digestion for 1 hour, and then the respective DNAs were purified by phenol / chloroform extraction and ethanol precipitation. TM -2 vectors were mixed at a molar ratio of 3:1, and a ligation reaction was performed using a DNA Ligation Kit <Mighty Mix> (TaKaRa). The resulting ligation sample was transformed into DH5α and cultured overnight at 37°C using LB agar plates. The selected colonies were cultured overnight at 37°C in LB liquid medium, and the plasmid was extracted using the QIAprep Spin Miniprep Kit (QIAGEN). Afterwards, the sequence of the plasmid obtained by base sequence analysis was confirmed.

[0071] Using the sequence-confirmed plasmid as a template, T7_Rluc_sRNA_F01 primer (sequence number 8), Rluc_sRNA_R01 primer (sequence number 9) and PrimeStar GXL DNA polymerase (TaKaRa) were used to amplify the template DNA for in vitro transcription reaction by PCR (30 cycles (denaturation: 98°C, 10 seconds; annealing: 55°C, 15 seconds; extension: 68°C, 20 seconds)), and purified by phenol / chloroform extraction and ethanol precipitation. Rluc_sRNA (sequence number 11) was obtained by in vitro transcription using the AmpliScribe T7 kit (Epicentre Biotechnologies). The synthesized Rluc_sRNA was excised and purified using a 5% polyacrylamide gel containing 8M urea for subsequent experiments.

[0072] The sequences of Rluc_WT_RNA, Rluc_K41R_W104X and Rluc_sRNA, and the sequences of the primers used above are shown below. It should be noted that the underline in the table indicates the adenosine residue of the editing target.

[0073] Table 1

[0074]

[0075] Table 2

[0076]

[0077] Table 3

[0078]

[0079] (Example 1)

[0080] Oligoribonucleotides AD1-gRNA01 (sequence number 12), AD1-gRNA03 (sequence number 13) and AD1-gRNA04 (sequence number 14) whose sequences are shown below were prepared by conventional methods as target editing guide RNAs (hereinafter sometimes referred to as gRNAs) for the template target RNA (Rluc_sRNA).

[0081] Table 4

[0082] sequence Sequence number AD1-gRNA01 CAGCUCAACCAAGCGGUGAGGUACUUG 12 AD1-gRNA03 CAGCUCAACCAAGCGGUGAGGUAC 13 AD1-gRNA04 CAGCAGCUCAACCAAGCGGUGAGGUAC 14

[0083] (Reference Example 1)

[0084] Based on the description in International Publication No. 2017 / 010556, 5'AS AD-gRNA (sequence number 15; hereinafter sometimes abbreviated as 5'AS) and 3'AS AD-gRNA (sequence number 16; hereinafter sometimes abbreviated as 3'AS) whose sequences are shown below were prepared as target editing guide RNAs for template target RNA (Rluc_sRNA). At the same time, oligoribonucleotides having sequences of the antisense region (ASR) in 5'AS and 3'AS were also prepared by conventional methods (hereinafter, 5'ASR: sequence number 17; 3'ASR: sequence number 18).

[0085] Table 5

[0086]

[0087] exist Figure 1 A conceptual diagram showing a complex formed by a template target RNA and AD1-gRNA01, etc. is shown in FIG. Figure 1 In the complex, the residue of the gRNA corresponding to the adenine residue (A) of the editing target is a cytidine residue (C), thereby forming a mismatch base pair. In addition, there is no corresponding residue on the gRNA side from the adenine residue of the editing target of the template target RNA to the cytidine residue of the 4th residue on the 3' side, presenting a state in which a mismatch base is inserted into the template target RNA.

[0088] Evaluation of editing-inducing activity

[0089] Using the target editing guide RNA prepared above, the editing-inducing activity was evaluated as described below.

[0090] Annealing reaction

[0091] 0.3 μM Rluc_sRNA and 0.9 μM gRNA of Example 1 and Reference Example 1 were heated at 80°C for 3 min in annealing buffer (10 mM Tri-HCl (pH 7.6), 150 mM NaCl) and cooled to 25°C over 15 min.

[0092] In vitro editing reactions

[0093] Assuming that Rluc_sRNA and gRNA completely form a complex through the annealing reaction, the following Rluc_sRNA-gRNA complex concentration is calculated. In the editing reaction buffer (20mM HEPES-KOH (pH7.5), 2mM MgCl2, 100mM NaCl, 0.5mM DTT, 0.01% TritonX-100, 5% glycerol), 12.5nM recombinant hADAR2 or 250nM recombinant hADAR1 was added to the 5nM Rluc_sRNA-gRNA complex, and the editing reaction was performed by incubation at 37°C for 1 hour. It should be noted that when the editing reaction was performed on HTR2C RNA (serotonin 2C receptor mRNA precursor) known to be edited by hADAR2 and hADAR1, the concentrations of hADAR2 and hADAR1 were adjusted so that they each showed the same degree of editing ratio.

[0094] Edit Analysis

[0095] The Rluc_sRNA after the editing reaction was purified by phenol / chloroform extraction and ethanol precipitation, and cDNA was synthesized using Primescript Reverse Transcriptase II (TaKaRa) with Rluc_sRNA_R01 primer (SEQ ID NO. 9). Subsequently, cDNA was amplified by PCR (denaturation: 98°C, 10 seconds; annealing: 55°C, 15 seconds; extension: 68°C, 20 seconds) using Rluc_sRNA_F01 primer (SEQ ID NO. 19), Rluc_sRNA_R01 primer (SEQ ID NO. 9) and PrimeStar GXL DNA polymerase (TaKaRa). The sequence analysis of the obtained cDNA was performed by sequencing reaction using Rluc_sRNA_F01 primer (SEQ ID NO. 19) and Big Dye Terminator v3.1 Cycle Sequence Kit, and analyzed by Applied Biosystem 3500 Genetic Analyzer (Genetic Analyzer) (Thermo Fisher Scientific). Based on the chromatogram obtained by sequencing, the editing ratio (%) was calculated from the peak height ratio (G / (G+A)) of the target site (A311). Figure 2 In addition, the ratio of the editing ratio of hADAR2 to the editing ratio of hADAR1 was calculated from the obtained editing ratio. The results are shown in Table 7.

[0096] Table 6

[0097] Primers sequence Sequence number Rluc_sRNA_F01 GCTGGACTCCTTCATCAAC 19 Rluc_sRNA_R01 CCAGTCGTGGCCCAC from AG 9

[0098] Table 7

[0099]

[0100] Compared with existing target editing guide RNAs (5'AS, 3'AS), AD1-gRNA showed the same degree of editing-inducing activity against hADAR1. In addition, AD1-gRNA showed specific editing-inducing activity against hADAR1.

[0101] (Example 2)

[0102] Oligoribonucleotides AD1-gRNA03.1 (sequence number 20), AD1-gRNA03.2 (sequence number 21), ADl-gRNA03.3 (sequence number 22) and ADl-gRNA03.4 (sequence number 23) whose sequences are shown below were prepared by conventional methods as target editing guide RNAs for template target RNA (Rluc_sRNA).

[0103] Table 8

[0104] sequence Sequence number AD1-gRNA03.1 CUCAACCAAGCGGUGAGGUAC 20 AD1-gRNA03.2 GCAGCUCAACCAAGCGGUGAGGUAC 21 AD1-gRNA03.3 CAGCAGCUCAACCAAGCGGUGAGGUAC 22 AD1-gRNA03.4 GUUCAGCAGCUCAACCAAGCGGUGAGGUAC 23

[0105] exist Figure 3 A conceptual diagram of a complex formed by template target RNA and AD1-gRNA03, etc. is shown in FIG.

[0106] Evaluation of editing-inducing activity

[0107] The editing-inducing activity of the obtained oligoribonucleotides was evaluated in the same manner as above. Figure 4 and are shown in Table 9. It should be noted that the concentrations of hADAR1 and hADAR2 used in the editing reaction were different from those in Example 1 because a different batch of hADAR1 was used.

[0108] Table 9

[0109]

[0110] It can be seen that the editing-inducing activity and specificity vary depending on the number of residues of the second oligonucleotide in the target editing guide RNA.

[0111] (Example 3)

[0112] The template target RNA was prepared in the same manner as above, wherein the mismatched bases in the template target RNA were changed to A, U and G instead of C. In addition, oligoribonucleotide AD1-gRNA03Gm (SEQ ID NO: 24) whose sequence is shown below was also prepared by a conventional method.

[0113] Table 10

[0114] sequence Sequence number AD1-gRNA03Gm CAGCUCGAACC from GCGGUGAGGUAC 24

[0115] exist Figure 5A and Figure 5B , a conceptual diagram of a complex formed by a template target RNA with a changed mismatched base and AD1-gRNA03, and a complex formed by a template target RNA and AD1-gRNA03Gm. Figure 5B As shown, in the complex formed by the template target RNA and AD1-gRNA03Gm, there are no mismatched bases other than the editing target.

[0116] Evaluation of editing-inducing activity

[0117] The editing-inducing activity of AD1-gRNA03 on template target RNA with changed mismatch bases and the editing-inducing activity of AD1-gRNA03Gm on template target RNA were evaluated in the same manner as above. Figure 6 and are shown in Table 11.

[0118] Table 11

[0119]

[0120] The type of mismatched bases affected the specific editing-inducing activity of hADAR1 to a certain extent. In addition, in AD1-gRNA03Gm without mismatched bases, the specificity for hADAR1 was reduced.

[0121] (Example 4) Evaluation of Editing Inducing Activity in Cultured Cells 1

[0122] Plasmid pcDNA3.1(-)Hygro_ADAR1p110 expressing hADAR1p110 was constructed as described below. In addition, plasmid pcDNA3.1(-)Hygro_ADAR2 expressing ADAR2 was constructed in the same manner.

[0123] The first PCR was performed using pYES / NT_A_ADAR1p110 as a template, using 0.3μM HisADAR2_XbaF01 primer (sequence number 25) and 0.3μM ADAR1-cMyc-lstR01 primer (sequence number 26) under the condition of 3 minutes of extension reaction. The second PCR was performed using 0.3μM HisADAR2_XbaF01 primer (sequence number 25) and 0.3μM cMyc_2nd_HindR01 primer (sequence number 27) with a 100-fold diluted first PCR product as a template, and insert DNA was amplified. The insert DNA and pcDNA3.1(-)Hygro were enzymatically reacted at 37°C for 1 hour using XbaI and HindIII. After purification by phenol / chloroform extraction and ethanol precipitation, 2 μL was added to 20 μL of E. coli DH5α competent cells (TaKaRa) for transformation and cultured overnight in LB ampicillin agar medium. Using the resulting colonies as templates, PCR was performed under the conditions of 2 minutes of extension reaction using 0.3 μM T7proGGG primer (SEQ ID NO. 28) and 0.3 μM BGH reverse primer (SEQ ID NO. 29), and insertion check was performed, and clones that produced amplification products of the target fragment length were liquid cultured. The extracted plasmid was sequenced using 0.165 μM T7proGGG primer, 0.165 μM BGH reverse primer, 0.165 μM ADAR1_seqF01 primer (sequence number 30), 0.165 μM ADAR1_seqF02 primer (sequence number 31) and 0.165 μM ADAR1_seqF03 primer (sequence number 32), and the Big Dye Terminator v3.1 Cycle Sequencing Kit (ABI) was used to perform base sequence analysis.

[0124] Table 12

[0125]

[0126] (A) Cell culture

[0127] HeLa cells were subcultured in a 24-well plate for 48 hours to a size of 5.0 × 10 4 Cells / well. Using X-tremeGENE TM HP DNA transfection reagent (Roche), 50ng of psiCHECK2 TM_Rluc_K41R_W104X, 250ng of pcDNA3.1(-)Hygro_ADAR1p110 or pcDNA3.1(-)Hygro_ADAR2, and 250ng of a plasmid expressing gRNA were transfected. As a plasmid expressing gRNA, a plasmid expressing 5'AS AD-gRNA, AD1-gRNA01 or AD1-gRNA03 was constructed and used in the same manner as Reference Example 2 of International Publication No. 2019 / 111957.

[0128] (B) Editing and parsing methods

[0129] Total RNA was extracted from cells cultured in 24-well plates using Sepasol RNA I Super G (nacalai), treated with recombinant DNase I (TaKaRa), and purified by phenol / chloroform extraction and ethanol precipitation. Reverse transcription using Primescript II reverse transcriptase (TaKaRa), 0.5 μg total RNA, 0.25 μM Oligo (dT) 17 (SEQ ID NO. 33) was performed to amplify cDNA. The first PCR (30 cycles (denaturation: 98°C, 10 seconds; annealing: 55°C, 15 seconds; extension: 68°C, 60 seconds)) was performed using PrimeStar GXL DNA polymerase (TaKaRa), Rluc_F01 primer (SEQ ID NO. 34) and 3'-Adp primer (SEQ ID NO. 35). Using the cDNA of the first PCR product diluted 200 times as a template, PrimeStar GXL DNA polymerase (TaKaRa), Rluc_F01 primer (sequence number 34) and Rluc_R01 primer (sequence number 36) were used to perform the second PCR (30 cycles (denaturation: 98°C, 10 seconds; annealing: 55°C, 15 seconds; extension: 68°C 60 seconds)) to amplify the Rluc fragment. The sequencing reaction was carried out using the Big DyeTerminator v3.1 Cycle Sequence Kit (Cycle Sequence Kit) (Thermo Fisher Scientific) and 0.165μM Rluc_sRNA_F01 primer (sequence number 19), and the analysis was performed using the Applied Biosystems3500 Genetic Analyzer (Thermo Fisher Scientific). Based on the chromatogram obtained by sequencing, the editing ratio (%) was calculated from the peak height ratio (G / (G+A)) of the target site (A311). The results are Figure 7 and are shown in Table 14.

[0130] Table 13

[0131]

[0132] (C) Luciferase reporter gene assay

[0133] The Dual-Luciferase Reporter Assay System (Promega) was used. Cell extracts were obtained from cells cultured in a 24-well plate using 100 μL of Passive Lysis Buffer (Promega). 100 μL of LARII was added to 20 μL of the obtained cell extract, and after 60 seconds, the luciferase was detected by GloMax. (R) The luminescence intensity of Firefly luciferase (Fluc) was measured by 20 / 20 Luminometer (Promega). Then, 100 μL Stop&Glo Reagent was added immediately, and the luminescence intensity of Renilla luciferase (Rluc) was measured after 60 seconds. The luminescence intensity was normalized by Fluc. The results are shown in Figure 8 and are shown in Table 14.

[0134] Table 14

[0135]

[0136] It can be seen that even in cells, the target editing guide RNA induces ADAR1-specific RNA editing activity.

[0137] (Example 5) Evaluation of editing-inducing activity in cultured cells 2

[0138] As a gRNA-expressing plasmid, a plasmid expressing AD1-gRNA05 (SEQ ID NO. 37) or AD1-gRNA06 (SEQ ID NO. 38) whose sequence is shown below was constructed and used in the same manner as described above, and the editing induction activity in cultured cells was evaluated in the same manner as in Example 4. Fig. 9 and Fig.10 In addition, Fig.11A and Fig. 11B A conceptual diagram showing a complex formed by the template target RNA and AD1-gRNA05 or AD1-gRNA06 is shown in FIG.

[0139] Table 15

[0140] sequence Sequence number AD1-gRNA05 CAGCTCAACCAAGCGGTGAGGTACTTGTAG 37 AD1-gRNA06 CAGCTCAACCAAGCGGTGAGGTACTTGTAGTGA 38

[0141] Table 16

[0142]

[0143] It can be seen that by extending the first oligonucleotide, the editing-inducing activity in cells is improved without compromising the selectivity for ADAR1.

[0144] (Example 6)

[0145] AcGFP_sRNA02 (sequence number 39) whose sequence is shown below was prepared as a template target RNA in the same manner as described above. Oligoribonucleotide AD1g_03_GFP_A200 (sequence number 40) whose sequence is shown below was prepared by a conventional method as a target editing guide RNA for the template target RNA. The editing-inducing activity of the target editing guide RNA (AD1g_03_GFP_A200) on the template target RNA (AcGFP) was evaluated in the same manner as in Example 1, except that the template target RNA and the target editing guide RNA were changed, and the concentrations of hADAR1 and hADAR2 were changed in the same manner as in Example 2. The results are Fig.12 and Table 21. It should be noted that in the sequence of the template target RNA, the underlined bold text indicates the adenosine residue of the editing target, and the underline indicates the mismatched base. In addition, the ratio of the editing ratio is calculated by subtracting the value of the editing induction activity in the absence of the target editing guide RNA from the editing induction activity in the presence of hADAR1 or hADAR2 and the target editing guide RNA.

[0146] Table 17

[0147]

[0148] (Example 7)

[0149] PINK1_s02 (sequence number 41) whose sequence is shown below was prepared as a template target RNA in the same manner as described above. Oligoribonucleotide AD1g_03_PINK1_A1310 (sequence number 42) whose sequence is shown below was prepared by a conventional method as a target editing guide RNA for the template target RNA. Except for changing the template target RNA and the target editing guide RNA, the editing-inducing activity of the target editing guide RNA (AD1g_03_PINK1_A1310) on the template target RNA (PINK1_s02) was evaluated in the same manner as Example 6. The results are Fig.12 and as shown in Table 21.

[0150] Table 18

[0151]

[0152] (Example 8)

[0153] The SMAD_sRNA (SEQ ID NO. 43) whose sequence is shown below was prepared as a template target RNA in the same manner as described above. The oligoribonucleotide AD1g_03_SMAD4 (SEQ ID NO. 44) whose sequence is shown below was prepared by a conventional method as a target editing guide RNA for the template target RNA. Except for changing the template target RNA and the target editing guide RNA, the editing-inducing activity of the target editing guide RNA (AD1g_03_SMAD4) on the template target RNA (SMAD_sRNA) was evaluated in the same manner as Example 6. The results are Fig.12 and as shown in Table 21.

[0154] Table 19

[0155]

[0156] (Example 9)

[0157] ACTB_s01 (SEQ ID NO. 45) whose sequence is shown below was prepared as a template target RNA in the same manner as described above. Oligoribonucleotide AD1g_03_ACTB (SEQ ID NO. 46) whose sequence is shown below was prepared by conventional methods as a target editing guide RNA for the template target RNA. The editing-inducing activity of the target editing guide RNA (AD1g_03_ACTB) on the template target RNA (ACTB_s01) was evaluated in the same manner as Example 6, except that the template target RNA and the target editing guide RNA were changed. The results were Fig.12 and as shown in Table 21.

[0158] Table 20

[0159]

[0160] Table 21

[0161]

[0162] As shown in the evaluation results of Examples 6 to 9, even if the target RNA is changed, the target editing guide RNA having the second oligonucleotide having a mismatched base can induce ADAR1-specific editing activity.

[0163] (Example 10)

[0164] AD1g_03_RL_A287 (SEQ ID NO. 47) and AD1g_03_RL_A287_GG (SEQ ID NO. 48), target editing guide RNAs for adenosine residues at positions different from those of the editing targets in Example 1, were prepared by conventional methods as target editing guide RNAs for the template target RNA (Rluc_sRNA) in Example 1.

[0165] A guanosine residue is bonded to the 5' side of the adenosine residue that is the editing target in the template target RNA, and AD1g_03_RL_A287 has a cytidine residue as a complementary base to the guanosine residue, and AD1g_03_RL_A287_GG has a guanosine residue as a non-complementary base. As shown below, the adenosine residue that is the editing target in the template target RNA is indicated in bold, and the base sequence that forms a complementary chain with the target editing guide RNA is underlined. Fig.13A A conceptual diagram of a complex formed by the template target RNA (Rluc_sRNA) and AD1g_03_RL_A287 is shown in FIG. Fig. 13B A conceptual diagram of a complex formed by the template target RNA (Rluc_sRNA) and AD1g_03_RL_A287_GG is shown in FIG.

[0166] The editing-inducing activity of target editing guide RNAs (AD1g_03_RL_A287 and AD1g_03_RL_A287_GG) on template target RNA (Rluc_sRNA) was evaluated in the same manner as in Example 6, except that the template target RNA and target editing guide RNA were changed. Figures 14 to 16 And shown in Table 26. Fig.14 The editing-inducing activity of ADAR1 was shown in Fig.15 The editing-inducing activity using ADAR2 is shown in FIG. Fig.16 Tables 2 and 26 show the editing induction activities of ADAR1 and ADAR2 and the ratio of the editing ratio when AD1g_03_RL_A287_GG is used as the target editing guide RNA.

[0167] Table 22

[0168]

[0169] (Example 11)

[0170] AD1g_03_GFP_A196 (SEQ ID NO. 49) and AD1g_03_GFP_A196_GG (SEQ ID NO. 50), i.e., target editing guide RNAs for adenosine residues at positions different from those of the editing target in Example 6, were prepared by conventional methods as target editing guide RNAs for the template target RNA (AcGFP_sRNA02) in Example 6. The editing-inducing activity of the target editing guide RNAs (AD1g_03_GFP_A196 and AD1g_03_GFP_A196_GG) for the template target RNA (AcGFP_sRNA02) was evaluated in the same manner as in Example 6, except that the template target RNA and the target editing guide RNA were changed. The results were Figures 14 to 16 And shown in Table 26.

[0171] Table 23

[0172]

[0173] (Example 12)

[0174] AD1g_03_PINK1_A1411 (SEQ ID NO. 51) and AD1g_03_PINK1_A1411_GG (SEQ ID NO. 52), i.e., target editing guide RNAs for adenosine residues at positions different from those of the editing target in Example 7, were prepared by conventional methods as target editing guide RNAs for the template target RNA (PINK1_s02) in Example 7. The editing-inducing activity of the target editing guide RNAs (AD1g_03_PINK1_A1411 and AD1g_03_PINK1_A1411_GG) for the template target RNA (PINK1_s02) was evaluated in the same manner as in Example 6, except that the template target RNA and the target editing guide RNA were changed. The results were Figures 14 to 16 And shown in Table 26.

[0175] Table 24

[0176]

[0177] (Example 13)

[0178] AD1g_03_SMAD4_A2151 (SEQ ID NO. 53) and AD1g_03_SMAD4_A2151_GG (SEQ ID NO. 54), i.e., target editing guide RNAs for adenosine residues at positions different from those of the editing targets in Example 8, were prepared by conventional methods as target editing guide RNAs for the template target RNA (SMAD_sRNA) in Example 8. The editing-inducing activity of the target editing guide RNAs (AD1g_03_SMAD4_A2151 and AD1g_03_SMAD4_A2151_GG) for the template target RNA (SMAD_sRNA) was evaluated in the same manner as in Example 6, except that the template target RNA and the target editing guide RNA were changed. The results were Figures 14 to 16 And shown in Table 26.

[0179] Table 25

[0180]

[0181] Table 26

[0182]

[0183] like Fig.16 As shown in Table 26, the target editing guide RNA with the second oligonucleotide can induce ADAR1 specific editing activity, wherein the second oligonucleotide has a mismatched base. Fig.14 and Fig.15 As shown, when the target RNA has a guanosine residue on the 5' side of the editing target base, the editing-inducing activity of ADAR1 can be particularly enhanced by introducing a mismatch base G relative to the guanosine residue into the target editing guide RNA.

[0184] The entire disclosure of Japanese Patent Application No. 2019-177118 (filing date: September 27, 2019) is incorporated into this specification by reference. All documents, patent applications, and technical standards described in this specification are incorporated into this specification by reference, to the same extent as if each document, patent application, and technical standard were specifically and individually described as being incorporated by reference. Sequence Listing <110> FREST INC. <120> Oligonucleotides and RNA-targeted site-specific editing methods <130> 675746 <160> 61 <170> PatentIn Version 3.5 <210> 1 <211> 910 <212> RNA <213> artificial sequence <220> <223> Rluc_WT <400> 1 accauggcuu ccaaggugua cgaccccgag caacgcaaac ccaugaucac ugggccucag 60 uggugggcuc gcugcaagca aaugaacgug cuggacuccu ucaucaacua cuaugauucc 120 gagaagcacg ccgagaacgc cguguauuuu cugcauggua acgcugccuc cagcuaccug 180 uggaggcacg ucgugccuca caucgagccc guggcuagau gcaucaucc ugaucugauc 240 ggaaugggua aguccggcaa gagcgggaau ggcucauauac gccuccugga ucacuacaag 300 uaccucaccg cuugguucga gcugcugaac cuuccaaaga aaaucaucuu uguggccac 360 gacugggggg cuugucuggc cuuucacuac uccuacgagc accaagacaa gaucaaggcc 420 aucguccaug cugagagugu cguggacgug aucgaguccu gggacgagug gccugacauc 480 gagaggaua ucgcccugau caagagcgaa gagggcgaga aaauggugcu ugagaauaac 540 uucuucgucg agaccaugcu cccaagcaag aucaugcgga aacuggagcc ugagaguuc 600 cgucgcuacc uggagccauu caaggagaag ggcgagguua gacggcccuac ccucuccugg 660 ccucgcgaga ucccucucgu uaagggaggc aagcccgacg ucguccagau uguccgcaac 720 uacaacgccu accuucgggc cagcgacgau cugccuaaga uguucaucga guccgacccu 780 ggguucuuuu ccaacgcuau ugucgaggga gcuaagaagu ucccuaacac cgaguucgug 840 aaggugaagg gccuccacuu cagccaggag gacgcuccag augaaauggg uaaguacauc 900 aagagcuucg 910 <210> 2 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 2 gaaggatcct tacaggtcct cctctgagat cagcttctgc tc 42 <210> 3 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 3 gcagaattca ccatggcttc caaggtgtac gac 33 <210> 4 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 4 gacgctagca ccatggcttc caaggtgtac gac 33 <210> 5 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Primers <400> 5 cagctcgaac taagcggtga g 21 <210> 6 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 6 gaactcgagt tacaggtcct cctctgagat cagcttctgc tc 42 <210> 7 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Primers <400> 7 ctcaccgctt agttcgagct g 21 <210> 8 <211> 39 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 8 ctaatacgac tcactatagg gctggactcc ttcatcaac 39 <210> 9 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 9 ccagtcgtgg cccacaaag 19 <210> 10 <211> 936 <212> DNA <213> Artificial sequence <220> <223> Rluc_K41R <400> 10 atggcttcca aggtgtacga ccccgagcaa cgcaaacgca tgatcactgg gcctcagtgg 60 tgggctcgct gcaagcaaat gaacgtgctg gactccttca tcaactacta tgattccgag 120 aggcacgccg agaacgccgt gatttttctg catggtaacg ctgcctccag ctacctgtgg 180 aggcacgtcg tgcctcacat cgagcccgtg gctagatgca tcatccctga tctgatcgga 240 atgggtaagt ccggcaagag cgggaatggc tcatatcgcc tcctggatca ctacaagtac 300 ctcaccgctt agttcgagct gctgaacctt ccaaagaaaa tcatctttgt gggccacgac 360 tggggggctt gtctggcctt tcactactcc tacgagcacc aagacaagat caaggccatc 420 gtccatgctg agagtgtcgt ggacgtgatc gagtcctggg acgagtggcc tgacatcgag 480 gaggatatcg ccctgatcaa gagcgaagag ggcgagaaaa tggtgcttga gaataacttc 540 ttcgtcgaga ccatgctccc aagcaagatc atgcggaaac tggagcctga ggagttcgct 600 gcctacctgg agccattcaa ggagaagggc gaggttagac ggcctaccct ctcctggcct 660 cgcgagatcc ctctcgttaa gggaggcaag cccgacgtcg tccagattgt ccgcaactac 720 aacgcctacc ttcgggccag cgacgatctg cctaagatgt tcatcgagtc cgaccctggg 780 ttcttttcca acgctattgt cgagggagct aagaagttcc ctaacaccga gttcgtgaag 840 gtgaagggcc tccacttcag ccaggaggac gctccagatg aaatgggtaa gtacatcaag 900 agcttcgtgg agcgcgtgct gaagaacgag cagtaa 936 <210> 11 <211> 279 <212> RNA <213> Artificial sequence <220> <223> Rluc_sRNA <400> 11 gggcuggacu ccuucaucaa cuacuaugau uccgagaggc acgccgagaa cgccgugauu 60 uuucugcaug guaacgcugc cuccagcuac cuguggaggc acgucgugcc ucacaucgag 120 cccguggcua gaugcaucau cccugaucug aucggaaugg guaaguccgg caagagcggg 180 aauggcucau aucgccuccu ggaucacuac aaguaccuca ccgcuuaguu cgagcugcug 240 aaccuuccaa agaaaaucau cuuugugggc cacgacugg 279 <210> 12 <211> 27 <212> RNA <213> Artificial sequence <220> <223> gRNA <400> 12 cagcucaacc aagcggugagguacuug 27 <210> 13 <211> twenty four <212> RNA <213> Artificial sequence <220> <223> gRNA <400> 13 cagcucaacc aagcggugag guac 24 <210> 14 <211> 27 <212> RNA <213> Artificial sequence <220> <223> gRNA <400> 14 cagcagcuca accaagcggu gagguac 27 <210> 15 <211> 70 <212> RNA <213> Artificial sequence <220> <223> gRNA <400> 15 gguucagcag cucgaaccaa gggguggaau aguauaacaa uaugcuaaau guuguuauag 60 uaucccaccu 70 <210> 16 <211> 69 <212> RNA <213> Artificial sequence <220> <223> gRNA <400> 16 ggguggaaua guauaacaau augcuaaaug uuguuauagu aucccaccua accaagcggu 60 gagguacuu 69 <210> 17 <211> twenty one <212> RNA <213> Artificial sequence <220> <223> ASR <400> 17 gguucagcag cucgaaccaa g 21 <210> 18 <211> twenty two <212> RNA <213> Artificial sequence <220> <223> ASR <400> 18 ggaaccaagc ggugagguac uu 22 <210> 19 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 19 gctggactcc ttcatcaac 19 <210> 20 <211> twenty one <212> RNA <213> Artificial sequence <220> <223> gRNA <400> 20 cucaaccaag cggugaggua c 21 <210> twenty one <211> 25 <212> RNA <213> Artificial sequence <220> <223> gRNA <400> twenty one gcagcucaac caagcgguga gguac 25 <210> twenty two <211> 27 <212> RNA <213> Artificial sequence <220> <223> gRNA <400> twenty two cagcagcuca accaagcggu gagguac 27 <210> twenty three <211> 30 <212> RNA <213> Artificial sequence <220> <223> gRNA <400> twenty three guucagcagc ucaaccaagc ggugagguac 30 <210> twenty four <211> 25 <212> RNA <213> Artificial sequence <220> <223> gRNA <400> twenty four cagcucgaac caagcgguga gguac 25 <210> 25 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 25 gctctagaac catggggggt tctcatc 27 <210> 26 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 26 ctgagatcag cttctgctct actgggcaga gataaaag 38 <210> 27 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 27 cgtaagcttc tacaggtcct cctctgagat cagcttctgc tc 42 <210> 28 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Primers <400> 28 ctaatacgac tccactatag gg 22 <210> 29 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 29 tagaaggcac agtcgagg 18 <210> 30 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 30 gcagcaccag gtgagtttcg 20 <210> 31 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Primers <400> 31 gctcgtgaga tacctgaaca c 21 <210> 32 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 32 gctccgtgtg gagatggcgc 20 <210> 33 <211> 37 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 33 ggccacgcgt cgactagtac tttttttttt ttttttt 37 <210> 34 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 34 ctaatacgac tcactatagg gaccatggct tccaaggtgt ac 42 <210> 35 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 35 ggccacgcgt cgactagtac 20 <210> 36 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Primers <400> 36 ttactgctcg ttcttcagca cg 22 <210> 37 <211> 30 <212> DNA <213> Artificial sequence <220> <223> gRNA <400> 37 cagctcaacc aagcggtgag gtacttgtag 30 <210> 38 <211> 33 <212> DNA <213> Artificial sequence <220> <223> gRNA <400> 38 cagctcaacc aagcggtgag gtacttgtag tga 33 <210> 39 <211> 160 <212> RNA <213> Artificial sequence <220> <223> Template target RNA <400> 39 gggugaaugg ccacaaguuc agcgugagcg gcgagggcga gggcgaugcc accuacggca 60 agcugacccu gaaguucauc ugcaccaccg gcaagcugcc ugugcccugg cccacccugg 120 ugaccacccu gagcuacggc gugcagugcu ucucacgcua 160 <210> 40 <211> twenty four <212> RNA <213> Artificial sequence <220> <223> gRNA <400> 40 cugcacccgc agcucagggu gguc 24 <210> 41 <211> 223 <212> RNA <213> Artificial sequence <220> <223> Template target RNA <400> 41 ggcugaugag agcaucggcc ugcaguugcc cuucagcagc ugguacgugg aucggggcgg 60 aaacggcugu cugauggccc cagagguguc cacggcccgu ccuggcccca gggcagugau 120 ugacuacagc aaggcugaug ccuaggcagu gggagccauc gccuaugaaa ucuucgggcu 180 ugucaauccc uucuacggcc agggcaaggc ccaccuugaa agc 223 <210> 42 <211> 24 <212> RNA <213> Artificial sequence <220> <223> gRNA <400> 42 ucccacgccc aggcaucagc cuug 24 <210> 43 <211> 183 <212> RNA <213> Artificial sequence <220> <223> Template target RNA <400> 43 ggaugaccuu cgucgcuuau gcauacucag gaugaguuuu gugaaaggcu ggggaccgga 60 uuacccaaga cagagcauca aagaaacacc uugcuggauu gaaauucacu uacaccgggc 120 ccuccagcuc cuagacgaag uacuucauac caugccgauu gcagacccac aaccuuuaga 180 cug 183 <210> 44 <211> 24 <212> RNA <213> Artificial sequence <220> <223> gRNA <400> 44 guacuugucc aggagcugga gggc 24 <210> 45 <211> 250 <212> RNA <213> Artificial sequence <220> <223> Template target RNA <400> 45 ggacuuugau ugcacauugu uguuuuuuua auagucauuc caaauaugag augcguuguu 60 acaggaaguc ccuugccauc cuaaaagcca ccccacuucu cucuaaggag aauggcccag 120 uccucuccca aguccacaca ggggagguga uagcauugcu uucguguaaa uuauguaaug 180 caaaauuuuu uuaaucuucg ccuuaauacu uuuuuauuuu guuuuauuuu gaaugaugag 240 ccuucgugcc 250 <210> 46 <211> twenty four <212> RNA <213> Artificial sequence <220> <223> gRNA <400> 46 aaagcaugcc aucaccuccc cugu 24 <210> 47 <211> twenty four <212> RNA <213> Artificial sequence <220> <223> gRNA <400> 47 cuuguaugac ccaggaggcg auau 24 <210> 48 <211> twenty four <212> RNA <213> Artificial sequence <220> <223> gRNA <400> 48 cuuguaugac gcaggaggcg auau 24 <210> 49 <211> twenty four <212> RNA <213> Artificial sequence <220> <223> gRNA <400> 49 acgccgagcc cagggugguc acca 24 <210> 50 <211> twenty four <212> RNA <213> Artificial sequence <220> <223> gRNA <400> 50 acgccgagcc gagggugguc acca 24 <210> 51 <211> twenty four <212> RNA <213> Artificial sequence <220> <223> gRNA <400> 51 aggcgaggcc cccacugccu aggc 24 <210> 52 <211> twenty four <212> RNA <213> Artificial sequence <220> <223> gRNA <400> 52 aggcgaggcc gccacugccu aggc 24 <210> 53 <211> twenty four <212> RNA <213> Artificial sequence <220> <223> gRNA <400> 53 augaagacuc cgucuaggag cugg 24 <210> 54 <211> twenty four <212> RNA <213> Artificial sequence <220> <223> gRNA <400> 54 augaagacuc ggucuaggag cugg 24 <210> 55 <211> 28 <212> RNA <213> Artificial sequence <220> <223> Template target RNA <400> 55 caaguaccuc accgcuuagu ucgagcug 28 <210> 56 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Template target RNA <400> 56 guaccucacc gcuuaguucg agcug 25 <210> 57 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Template target RNA <220> <221> misc_feature <222> (19)..(19) <223> n is a, c, g or u <400> 57 guaccucacc gcuuaguung agcug 25 <210> 58 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Template target RNA <400> 58 guaccucacc gcuuaguucg agcug 25 <210> 59 <211> 31 <212> RNA <213> Artificial sequence <220> <223> Template target RNA <400> 59 cuacaaguac cucaccgcuu aguucgagcu g 31 <210> 60 <211> 34 <212> RNA <213> Artificial sequence <220> <223> Template target RNA <400> 60 ucacuacaag uaccucaccg cuuaguucga gcug 34 <210> 61 <211> 25 <212> RNA <213> Artificial sequence <220> <223> Template target RNA <400> 61 auaucgccuc cuggaucacu acaag 25

Claims

1. An oligonucleotide for inducing site-specific editing of a target RNA, the oligonucleotide consisting of: A first oligonucleotide that identifies the target RNA; and A second oligonucleotide, attached to the 5' side of the first oligonucleotide, The first oligonucleotide consists of: a target corresponding nucleotide residue corresponding to an adenosine residue in the target RNA, wherein the target corresponding nucleotide residue is a residue that does not form a base pair with the adenosine residue to be edited; an oligonucleotide of 10 to 24 residues, which is linked to the 3' side of the target corresponding nucleotide residue and has a base sequence complementary to the target RNA; and an oligonucleotide of 3 to 6 residues, which is linked to the 5' side of the target corresponding nucleotide residue and has a base sequence complementary to the target RNA, wherein the first oligonucleotide forms a first complementary strand with the target RNA; The second oligonucleotide has a residue number of 2 to 10 and has a base sequence that forms a second complementary strand with the target RNA; The second oligonucleotide lacks a nucleotide residue corresponding to one mismatched base, and the mismatched base is inserted at the first residue on the 3' side of the target RNA portion constituting the first complementary chain.

2. The oligonucleotide according to claim 1, wherein The second oligonucleotide has 4 to 8 residues.

3. The oligonucleotide according to claim 1 or 2, wherein The first oligonucleotide has 13 or more and 18 or less nucleotide residues linked to the 3′ side of the target-corresponding nucleotide residue.

4. The oligonucleotide according to claim 1 or 2, wherein The first oligonucleotide has three nucleotide residues linked to the 5' side of the target corresponding nucleotide residue.

5. The oligonucleotide according to claim 1 or 2, wherein The site-specific editing is caused by an enzymatic reaction performed by adenosine deaminase 1.

6. The oligonucleotide according to claim 1 or 2, wherein The site-specific editing is specific for ADAR1.

Images