Application of phenylalanyl-tRNA synthetase α subunit in the treatment of non-Hodgkin's lymphoma

Abstract

This invention discloses the use of the phenylalanyl-tRNA synthetase α subunit in the treatment of non-Hodgkin's lymphoma. Experiments have demonstrated that reducing or increasing the expression level of FARSA in non-Hodgkin's lymphoma cell lines can effectively regulate the cell cycle and proliferation of tumor cells. This invention provides a new target for the treatment of non-Hodgkin's lymphoma.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to the application of phenylalanyl-tRNA synthetase alpha subunit (FARSA for short) in the treatment of non-Hodgkin's lymphoma. Background Art

[0002] Aminoacyl-tRNA synthetases (aaRSs) are enzymes that recognize their corresponding amino acids and catalyze the binding of amino acids to the corresponding tRNA, playing a crucial role in protein synthesis and translation. While aaRSs are generally highly conserved throughout evolution, structural studies have revealed that vertebrate aaRSs, compared to bacteria, possess novel specialized domains at the N- or C-termini of their core structures. Furthermore, a complex aminoacyl-tRNA synthetase complex consisting of nine aaRSs and three accessory proteins has been discovered in higher eukaryotes. These evolutionarily specific domains and complexes, in addition to assisting aaRSs in their classical functions, may also contribute to a wide range of eukaryotic life processes. Research over the past two decades has demonstrated that aaRSs are a multifunctional class of proteins involved in a wide range of physiological and pathological processes. aaRSs have been reported to regulate cell growth and differentiation, cytokine activity, RNA splicing, and angiogenesis. They also regulate tumor cell proliferation, apoptosis, and metastasis, making them key factors in tumorigenesis. Analysis of genomic and transcriptome sequencing data from cancer and normal tissues revealed abnormal expression of multiple aaRSs in different cancer tissue types, further confirming that aaRSs may play specific roles in tumorigenesis, either promoting or inhibiting tumor development and progression. Phenylalanyl tRNA synthetase (PheRS, also known as FARS) is a typical heteromeric tetramer composed of two α subunits (FARSA) and two β subunits (FARSB). In addition to facilitating protein synthesis, the α and β subunits each have distinct functions. FARSA and FARSB have been found to exhibit distinct transcriptional profiles in different cancer types. However, the role of FARSA in lymphoma has not been reported.

[0003] Lymphoma is a malignant tumor that originates in the lymph nodes and lymphoid tissues of the hematopoietic system. According to the World Health Organization, the annual incidence of lymphoma is increasing by 7.5%, with a rapid increase in recent years. Based on their pathological characteristics, lymphoma is primarily divided into two categories: Hodgkin's lymphoma and non-Hodgkin's lymphoma. Current data suggest that Hodgkin's lymphoma generally responds well to treatment, with a high cure rate. Non-Hodgkin's lymphoma, on the other hand, is a highly heterogeneous group of malignant lymphoproliferative disorders and is one of the most common malignant tumors in men in my country. The definitive cause of lymphoma remains unknown, but it may be related to genetics, pathogen infection, immune abnormalities, and environmental pollution. Due to changes in lifestyle, increased environmental pollution, dietary adjustments, increased stress, and an aging population, the incidence of lymphoma has increased significantly in recent years, making it a major cancer that poses a serious threat to the health of the Chinese population. Currently, the mainstay of treatment for lymphoma is chemotherapy or radiotherapy. Immunotherapy may also be used in conjunction with treatment for patients with better financial resources or clear treatment indications. During treatment, chemotherapy and radiotherapy, due to their cytotoxicity, can simultaneously kill tumor cells and toxicize normal cells. This can cause patients to experience varying degrees of side effects during chemotherapy and radiotherapy, leading to a general decline in their quality of life and even forced discontinuation of treatment due to intolerance, severely impacting efficacy and disease outcome. Immunotherapy primarily involves cell therapy and antibody therapy. This treatment approach primarily activates the body's own immune response to kill tumor cells by increasing tumor antigenicity and regulating tumor immune escape. While it has been helpful in the treatment of non-aggressive non-Hodgkin's lymphoma, the prognosis for patients with relapsed or refractory non-Hodgkin's lymphoma after initial treatment remains poor. Therefore, given the limitations of current tumor treatments and the inherent heterogeneity of individual patients, there is an urgent need to develop specific targets for the treatment of non-Hodgkin's lymphoma. Summary of the Invention

[0004] Based on the existing technology, the present invention provides the use of a phenylalanyl-tRNA synthetase α subunit (FARSA) expression regulator in the treatment of non-Hodgkin's lymphoma.

[0005] The present invention discovered the correlation between FARSA and non-Hodgkin's lymphoma, providing a new target for the treatment of non-Hodgkin's lymphoma.

[0006] The technical solutions of the present invention are as follows:

[0007] The use of FARSA in the preparation of a drug for treating non-Hodgkin's lymphoma, wherein the amino acid sequence thereof is shown in SEQ ID No. 1, and the nucleotide sequence thereof is shown in SEQ ID No. 2.

[0008] A drug and / or pharmaceutical composition capable of treating non-Hodgkin's lymphoma, wherein the active ingredient is a substance that regulates the expression of FARSA protein, wherein the amino acid sequence of FARSA protein is shown in SEQ ID No. 1.

[0009] A medicine and / or pharmaceutical composition capable of treating non-Hodgkin's lymphoma, comprising a FARSA protein having an amino acid sequence as shown in SEQ ID No. 1.

[0010] A medicine and / or pharmaceutical composition capable of treating non-Hodgkin's lymphoma, comprising a substance regulating the expression level of FARSA protein.

[0011] The regulatory substances referred to in the present invention include substances that inhibit or activate the activity of FARSA protein, substances that reduce or increase the content of FARSA protein, substances that silence, knock out or overexpress FARSA protein, FARSA Substances that either inhibit or activate genes FARSA Gene expression substances.

[0012] The present invention relates to the use of a substance that regulates the expression amount of FARSA (i.e., a FARSA expression regulator) in the preparation of a pharmaceutical product for preventing and treating non-Hodgkin's lymphoma.

[0013] The present invention encompasses one or more methods of modulating FARSA expression comprising contacting a cell with one or more modulators effective to modulate FARSA expression.

[0014] The present invention includes a method for inhibiting the proliferation of non-Hodgkin's lymphoma tumor cells using a FARSA expression regulator, the use of a FARSA expression regulator in inhibiting the proliferation of non-Hodgkin's lymphoma tumor cells, and the use of a FARSA expression regulator in preparing a pharmaceutical composition or a kit for inhibiting the proliferation of non-Hodgkin's lymphoma tumor cells.

[0015] The present invention includes designing, screening and preparing active substances for preventing or treating non-Hodgkin's lymphoma and pharmaceutical compositions containing the active substances, with FARSA protein or its expression regulatory sequence as targets.

[0016] In the application or product of the present invention, the amino acid sequence of the FARSA protein is SEQ ID No. 1 in the sequence table, FARSA The nucleotide sequence of the gene is SEQ ID No. 2 in the sequence listing.

[0017] The present invention reduces FARSA protein expression in non-Hodgkin's lymphoma cell lines by infecting them with a FARSA RNA interference lentivirus. The cell cycle and cell proliferation of cell lines with reduced FARSA expression and control cell lines with unchanged expression were examined. The results showed that infection with the RNA interference lentivirus reduced FARSA protein expression by approximately 50%-70%, increased cell proliferation in cells with reduced FARSA expression, and an increase in the proportion of cells in the S phase of the cell cycle.

[0018] The present invention increases FARSA protein expression by infecting non-Hodgkin's lymphoma cell lines with a FARSA-overexpressing lentivirus. The cell cycle and cell proliferation of cell lines with increased FARSA expression and control cell lines with unchanged expression were then examined. The results showed that infection with the FARSA-overexpressing virus increased FARSA protein expression by 2-3 times, reduced proliferation of cells with increased FARSA expression, decreased the proportion of cells in the S phase of the cell cycle, and increased the proportion of cells in the G2-M phase.

[0019] The present invention demonstrates that regulating the expression of FARSA in human non-Hodgkin's lymphoma cells can regulate the proliferation and cell cycle changes of tumor cells, affecting the growth of tumor cells, and providing a new target for the treatment of non-Hodgkin's lymphoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the Western Blot detection result of FARSA protein in human non-Hodgkin's lymphoma cells stably transfected with RNA interference;

[0021] In the figure, the first row uses FARSA polyclonal antibody as the primary antibody to detect FARSA, and the second row uses beta-Actin monoclonal antibody as the primary antibody to detect internal reference beta-Actin. KD Representative stably transfected non-Hodgkin's lymphoma cells Jeko-1 / FARSA KD ;FARSA KD-Con Representative control cells Jeko-1 / FARSA KD-Con .

[0022] Figure 2 This is the result diagram of Example 2;

[0023] Figure A shows the cell cycle distribution of RNA interference stably transformed human non-Hodgkin's lymphoma cells detected by flow cytometry, including G0-G1, S and G2-M phases; Figure B shows the statistical analysis of the results of three repeated flow cytometry experiments, and the values ​​in the figure represent the percentage of G0-G1, S and G2-M phases in the entire cell cycle. KDRepresentative stably transfected non-Hodgkin's lymphoma cells Jeko-1 / FARSA KD ;FARSA KD-Con Representative control cells Jeko-1 / FARSA KD-Con ; * indicates p value less than 0.05, ** indicates p value less than 0.001.

[0024] Figure 3 This is the result diagram of Example 3;

[0025] Figure A shows the proliferation of RNA interference-stable human non-Hodgkin's lymphoma cells detected by flow cytometry. Edu-positive cells are cells in the proliferation phase. Figure B shows the statistical analysis of the results of three repeated flow cytometry experiments, using the control cell line Jeko-1 / FARSA KD-Con The data are normalized with the unit "1" for comparison. KD Representative stably transfected non-Hodgkin's lymphoma cells Jeko-1 / FARSA KD ;FARSA KD-Con Representative control cells Jeko-1 / FARSA KD-Con ; * indicates p value less than 0.05, ** indicates p value less than 0.001.

[0026] Figure 4 This is the Western Blot detection result of FARSA protein in FARSA-overexpressing non-Hodgkin's lymphoma cells;

[0027] In the figure, the first row uses FARSA polyclonal antibody as the primary antibody to detect FARSA, and the second row uses beta-Actin monoclonal antibody as the primary antibody to detect internal reference beta-Actin. OE Representative FARSA-overexpressing non-Hodgkin's lymphoma cells Jeko-1 / FARSA OE ;FARSA OE-Con Representative of its control cells Jeko-1 / FARSA OE-Con .

[0028] Figure 5 This is the result diagram of Example 5;

[0029] Figure A shows the cell cycle distribution of FARSA-overexpressing human non-Hodgkin's lymphoma cells detected by flow cytometry, including G0-G1, S and G2-M phases. Figure B shows the statistical analysis of the results of three repeated flow cytometry experiments. The values ​​in the figure represent the percentages of G0-G1, S and G2-M phases in the entire cell cycle. OE Representative FARSA-overexpressing non-Hodgkin's lymphoma cells Jeko-1 / FARSA OE;FARSA OE-Con Representative of its control cells Jeko-1 / FARSA OE-Con ; * indicates p value less than 0.05.

[0030] Figure 6 This is the result diagram of Example 6;

[0031] Figure A shows the proliferation of RNA interference-stable human non-Hodgkin's lymphoma cells detected by flow cytometry. Edu-positive cells are cells in the proliferation phase. Figure B shows the statistical analysis of the results of three repeated flow cytometry experiments, using the control cell line Jeko-1 / FARSA OE-Con The data are normalized with the unit "1" for comparison. OE Representative FARSA-overexpressing non-Hodgkin's lymphoma cells Jeko-1 / FARSA OE ;FARSA OE-Con Representative of its control cells Jeko-1 / FARSA OE-Con ; * indicates p value less than 0.05. DETAILED DESCRIPTION

[0032] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples, unless otherwise specified, are conventional methods. The experimental materials used in the following examples, unless otherwise specified, were purchased from conventional biochemical reagent companies.

[0033] The experiments in the following examples were performed in triplicate, and the results are presented as mean ± standard deviation. Statistical analysis was performed using a t-test. * indicates a p-value less than 0.001.

[0034] The human non-Hodgkin's lymphoma cell line Jeko-1 in the following examples was purchased from the Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences, and was confirmed by cell STR identification.

[0035] The shRNA lentivirus LV-FARSA-RNAi, FARSA overexpression lentivirus LV-FARSA (73641-1), and the corresponding negative control lentivirus (which does not affect FARSA expression) described in the following examples are all products of Shanghai GeneCare Gene Co., Ltd. The mature antisense strand sequence of the shRNA lentivirus LV-FARSA-RNAi is: AATGACCGACACGTTCTCGGG; the primers used to obtain the target gene fragment for the FARSA overexpression lentivirus are: FARSA (73641-1)-p1: GAGGATCCCCGGGTACCGGTCGCCACCATGGCGGATGGTC, and FARSA (73641-1)-p2: TCCTTGTAGTCCATACCGGTCGCAGCCTCCTGTGTGGGAGGGG.

[0036] The amino acid sequence of FARSA in the following examples is SEQ ID No. 1 in the sequence listing, and the encoding gene sequence is SEQ ID No. 2 in the sequence listing, both of which are derived from the NCBI database.

[0037] The cell culture conditions in the following examples were all: culturing in RPMI-1640 medium containing 10% FBS in a T-25 gas permeable cell culture flask at 37° C. and 5% CO 2 .

[0038] The experimental method for lentiviral cell infection in the following examples is as follows: 1×106 cells were plated in a six-well plate, 3 ml of RPMI-1640 medium containing 10% FBS was added to each well, and the cells were incubated in a 37°C, 5% CO2 cell culture incubator. After 1 hour, the cells were removed, 50 μl of the virus solution was added, and the cells were centrifuged at 2500 rpm for 1 hour at room temperature. The cells were then transferred to a T-25 ventilated cell culture flask and incubated in a 37°C, 5% CO2 cell culture incubator for another 24 hours.

[0039] The stable cell line screening method described in the following examples is as follows: After lentiviral infection, the culture medium is removed from the cells and the cells are resuspended in 10 ml of fresh RPMI-1640 medium containing 10% FBS. The cells are then cultured in a 37°C, 5% CO2 incubator. After 48 hours, the cells in the T-25 flask are transferred to a T-75 vented cell culture flask and supplemented with 10 ml of fresh RPMI-1640 medium containing 10% FBS. After 24 hours, the culture medium is removed and replaced with 20 ml of fresh culture medium to resuspend the cells. 1 μg / ml puromycin is added to screen the cell lines. The culture medium is changed every 2-3 days for 10-14 days.

[0040] The cell cycle detection method in the following examples is as follows: the test cells were cultured in 6-well plates in 3 mL of RPMI-1640 medium containing 10% fetal bovine serum (FBS) at a cell density of 1×10 6 Cells were harvested 48 hours later. After washing with PBS, the cells were fixed with 70% anhydrous ethanol for 1 hour. The ethanol was removed and 1 ml of PI / RNase Staining Buffer (Biosciences, USA) was added. The cells were incubated in the dark at room temperature for 15 minutes before analysis using flow cytometry and analysis using FlowJo software.

[0041] The following examples used the BeyoClick™ EdU Cell Proliferation Detection Kit from China Biotech. The assay method was as follows: The test cells were cultured in 3 mL of RPMI-1640 medium containing 10% fetal bovine serum (FBS) in 6-well plates at a cell density of 1×10 6 Cells were fixed with 4% paraformaldehyde and permeabilized in PBS with 0.1% Triton X-100 after washing. After washing again, a reaction activator containing a fluorescent indicator was added and the cells were reacted in the dark at room temperature for 30 minutes. After washing, the cells were resuspended in PBS and analyzed by flow cytometry. The results were analyzed using FlowJo software.

[0042] The method for extracting total protein in the following examples is as follows: collect cells by centrifugation at 90 g for 5 minutes, wash twice with pre-chilled 1× PBS buffer, add 150-300 μl RIPA lysis buffer, lyse on ice for 30 minutes, and centrifuge at 12,000 rpm for 10 minutes at 4°C; aspirate the supernatant and quantify the protein using the Pierce BCA method; and take 10 μg of total protein for Western blot analysis.

[0043] The specific method of Western blot detection in the following embodiment is as follows: (1) Electrophoresis and membrane transfer: The protein sample to be tested is subjected to SDS-PAGE electrophoresis at a voltage of 80V for 30 minutes. After the dye front enters the separation gel, the voltage is increased to 120V and the electrophoresis is continued for about 1-1.5 hours until the bromophenol blue reaches the bottom of the separation gel. After the electrophoresis is completed, the separated protein sample is transferred to a PVDF membrane by electrotransfer at 400mA for 2 hours. (2) Blocking the membrane: The PVDF membrane is washed with PBS-T solution (1× PBS buffer with 2 ml Tween-20, and the volume is adjusted to 1L) for 10-15 minutes. The PVDF membrane is placed in a PBS-T solution containing 5% BSA and blocked at room temperature for 1 hour. (3) Immunohistochemical hybridization: First, perform primary antibody incubation. Dilute the FARSA (molecular weight 58KDa) antibody purchased from Abcam, USA (or the beta-Actin antibody purchased from Cell Signaling Technology, USA) at a dilution of 1:1000 in PBS-T solution and incubate with the PVDF membrane on a shaker in a cold room at 4°C overnight. Wash the membrane with 5 ml PBS-T solution for 10 minutes, and repeat 3 times. Then perform secondary antibody incubation. Dilute the goat anti-rabbit IgG antibody conjugated with horseradish peroxidase at a dilution of 1:5000 in PBS-T solution and incubate with the PVDF membrane on a shaker at room temperature for about 45 minutes. Wash the membrane with 5 ml PBS-T solution for 10 minutes, and repeat 3 times. (4) ECL reagent color development: Use the ECL protein hybridization detection kit (BioRad, USA) and perform color development on the PVDF membrane according to the operating instructions.

[0044] Example 1. Construction of a FARSA RNAi Stable Cell Line

[0045] The human non-Hodgkin's lymphoma cell line Jeko-1 was infected with shRNA lentivirus and negative control lentivirus respectively to establish the stable non-Hodgkin's lymphoma cell line Jeko-1 / FARSA KD and control cell line Jeko-1 / FARSA KD-Con , total proteins were extracted, and Western blot analysis was performed using beta-Actin as an internal reference.

[0046] Results: As Figure 1 As shown. Stable recombinant non-Hodgkin's lymphoma cell line Jeko-1 / FARSA established using shRNA lentivirus KD The FARSA protein expression levels in the WT and WT groups were significantly lower than those in the control group Jeko-1 / FARSA KD-Con .

[0047] Example 2: Stable Transfection of Non-Hodgkin's Lymphoma Cell Line Jeko-1 / FARSA KDand control cell line Jeko-1 / FARSA KD-Con Comparison of cell cycle

[0048] Take the stable non-Hodgkin's lymphoma cell line Jeko-1 / FARSA established in Example 1 KD and control cell line Jeko-1 / FARSA KD-Con As test cells, they were cultured in 3 mL of normal culture medium (RPMI-1640 medium containing 10% FBS) in 6-well plates at a cell density of 1×10 6 After 48 hours of culture, cells were harvested and subjected to cell cycle analysis.

[0049] result: Figure 2 A is the stable non-Hodgkin's lymphoma cell line Jeko-1 / FARSA obtained by flow cytometry analysis KD and control cell line Jeko-1 / FARSA KD-Con Cell cycle results diagram; Figure 2 B is the statistical analysis data after three experiments, the control cell line Jeko-1 / FARSA KD-Con The average number of cells in the G0-G1 phase was 52% of the total cell count, the average number of cells in the S phase was 34.3%, and the average number of cells in the G2-M phase was 13.8% of the total cell count; the cell line Jeko-1 / FARSA with low FARSA expression KD The average number of cells in the G0-G1 phase was 46.4% of the total cell count, the average number of cells in the S phase was 42.5% of the total cell count, and the average number of cells in the G2-M phase was 11.1% of the total cell count; Statistical analysis showed that Jeko-1 / FARSA KD and control cell line Jeko-1 / FARSA KD-Co There are significant differences in the distribution of cells in the S and G2-M phases, indicating that regulating the expression of FARSA can affect the cell cycle of non-Hodgkin's lymphoma cells, thereby affecting the growth of tumor cells.

[0050] Example 3: Stable Transfection of Non-Hodgkin's Lymphoma Cell Line Jeko-1 / FARSA KD and control cell line Jeko-1 / FARSA KD-Con Comparison of cell proliferation

[0051] Take the stable non-Hodgkin's lymphoma cell line Jeko-1 / FARSA established in Example 1 KD and control cell line Jeko-1 / FARSA KD-ConAs test cells, they were cultured in 3 mL of normal culture medium (RPMI-1640 medium containing 10% FBS) in 6-well plates at a cell density of 1×10 6 After culturing for 48 hours, cells were harvested and subjected to cell proliferation assay.

[0052] result: Figure 3 A is the stable non-Hodgkin's lymphoma cell line Jeko-1 / FARSA obtained by flow cytometry analysis KD and control cell line Jeko-1 / FARSA KD-Con Result diagram of cell proliferation; Figure 3 B is the statistical analysis data after three experiments, with the control cell line Jeko-1 / FARSA KD-Con The data were normalized with the unit "1" and compared. The cell line Jeko-1 / FARSA KD The cell proliferation number is the control cell line Jeko-1 / FARSA KD-Con The difference was about 1.16 times that of the control group, which was a significant difference. This indicates that regulating the expression of FARSA can affect the proliferation of non-Hodgkin's lymphoma cells, thereby affecting the growth of tumor cells.

[0053] Example 4: Construction of a FARSA overexpressing stable cell line

[0054] use FARSA Overexpression lentivirus was used to infect the human non-Hodgkin's lymphoma cell line Jeko-1 to establish the FARSA overexpression stable non-Hodgkin's lymphoma cell line Jeko-1 / FARSA OE and control cell line Jeko-1 / FARSA OE-Con , total proteins were extracted, and Western blot analysis was performed using beta-Actin as an internal reference.

[0055] Results: As Figure 4 As shown. FARSA Stable non-Hodgkin's lymphoma cell line Jeko-1 / FARSA established by overexpression lentivirus OE The FARSA protein expression levels in the WT and WT mice were significantly higher than those in the control group Jeko-1 / FARSA OE-Con .

[0056] Example 5: FARSA overexpression in the stable non-Hodgkin's lymphoma cell line Jeko-1 / FARSA OE and control cell line Jeko-1 / FARSA OE-Con Comparison of cell cycle

[0057] The FARSA overexpression stable non-Hodgkin's lymphoma cell line Jeko-1 / FARSA established in Example 4 was used to OE and control cell line Jeko-1 / FARSA OE-Con As test cells, they were cultured in 3 mL of normal culture medium (RPMI-1640 medium containing 10% FBS) in 6-well plates at a cell density of 1×10 6 After 48 hours of culture, cells were harvested and subjected to cell cycle analysis.

[0058] result: Figure 5 A is the stably overexpressed non-Hodgkin's lymphoma cell line Jeko-1 / FARSA obtained by flow cytometry analysis OE and control cell line Jeko-1 / FARSA OE-Con Result graph; Figure 5 B is the statistical analysis data after three experiments, the control cell line Jeko-1 / FARSA OE-Con The average number of cells in the G0-G1 phase was 44.7% of the total cell count, the average number of cells in the S phase was 33.2%, and the average number of cells in the G2-M phase was 21.6% of the total cell count; the cell line Jeko-1 / FARSA with high FARSA expression OE The average number of cells in the G0-G1 phase was 46% of the total cell count, the average number of cells in the S phase was 26.9%, and the average number of cells in the G2-M phase was 26.6% of the total cell count; Statistical analysis showed that Jeko-1 / FARSA OE and control cell line Jeko-1 / FARSA OE-Con There are significant differences in the distribution of cells in the S and G2-M phases, indicating that regulating the expression of FARSA can affect the cell cycle of non-Hodgkin's lymphoma cells, thereby affecting the growth of tumor cells.

[0059] Example 6: FARSA overexpression in the stable non-Hodgkin's lymphoma cell line Jeko-1 / FARSA OE and control cell line Jeko-1 / FARSA OE-Con Comparison of cell proliferation

[0060] The FARSA overexpression stable non-Hodgkin's lymphoma cell line Jeko-1 / FARSA established in Example 4 was used to OE and control cell line Jeko-1 / FARSA OE-Con As test cells, they were cultured in 3 mL of normal culture medium (RPMI-1640 medium containing 10% FBS) in 6-well plates at a cell density of 1×10 6After culturing for 48 hours, cells were harvested and subjected to cell proliferation assay.

[0061] result: Figure 6 A is the stably overexpressed non-Hodgkin's lymphoma cell line Jeko-1 / FARSA obtained by flow cytometry analysis OE and control cell line Jeko-1 / FARSA OE-Con Result diagram of cell proliferation; Figure 6 B is the statistical analysis data after three experiments, with the control cell line Jeko-1 / FARSA OE-Con The data were normalized to unit "1" and compared. The cell line Jeko-1 / FARSA OE The cell proliferation number is the control cell line Jeko-1 / FARSA KD-Con The results showed that regulating the expression of FARSA could affect the proliferation of non-Hodgkin's lymphoma cells, thereby affecting the growth of tumor cells.

[0062] The above results indicate that regulating the expression of FARSA in non-Hodgkin's lymphoma cell lines can regulate the cell cycle and cell proliferation, thereby affecting the growth of tumor cells and can serve as a target for the treatment of non-Hodgkin's lymphoma. Sequence Listing <110> Institute of Medical Biology, Chinese Academy of Medical Sciences <120> Application of phenylalanyl-tRNA synthetase α subunit in the treatment of non-Hodgkin's lymphoma <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 508 <212> PRT <213> Artificial sequence <400> 1 Met Ala Asp Gly Gln Val Ala Glu Leu Leu Leu Arg Arg Leu Glu Ala 5 10 15 Ser Asp Gly Gly Leu Asp Ser Ala Glu Leu Ala Ala Glu Leu Gly Met 20 25 30 Glu His Gln Ala Val Val Gly Ala Val Lys Ser Leu Gln Ala Leu Gly 35 40 45 Glu Val Ile Glu Ala Glu Leu Arg Ser Thr Lys His Trp Glu Leu Thr 50 55 60 Ala Glu Gly Glu Glu Ile Ala Arg Glu Gly Ser His Glu Ala Arg Val 65 70 75 80 Phe Arg Ser Ile Pro Pro Glu Gly Leu Ala Gln Ser Glu Leu Met Arg 85 90 95 Leu Pro Ser Gly Lys Val Gly Phe Ser Lys Ala Met Ser Asn Lys Trp 100 105 110 Ile Arg Val Asp Lys Ser Ala Ala Asp Gly Pro Arg Val Phe Arg Val 115 120 125 Val Asp Ser Met Glu Asp Glu Val Gln Arg Arg Leu Gln Leu Val Arg 130 135 140 Gly Gly Gln Ala Glu Lys Leu Gly Glu Lys Glu Arg Ser Glu Leu Arg 145 150 155 160 Lys Arg Lys Leu Leu Ala Glu Val Thr Leu Lys Thr Tyr Trp Val Ser 165 170 175 Lys Gly Ser Ala Phe Ser Thr Ser Ile Ser Lys Gln Glu Thr Glu Leu 180 185 190 Ser Pro Glu Met Ile Ser Ser Gly Ser Trp Arg Asp Arg Pro Phe Lys 195 200 205 Pro Tyr Asn Phe Leu Ala His Gly Val Leu Pro Asp Ser Gly His Leu 210 215 220 His Pro Leu Leu Lys Val Arg Ser Gln Phe Arg Gln Ile Phe Leu Glu 225 230 235 240 Met Gly Phe Thr Glu Met Pro Thr Asp Asn Phe Ile Glu Ser Ser Phe 245 250 255 Trp Asn Phe Asp Ala Leu Phe Gln Pro Gln Gln His Pro Ala Arg Asp 260 265 270 Gln His Asp Thr Phe Phe Leu Arg Asp Pro Ala Glu Ala Leu Gln Leu 275 280 285 Pro Met Asp Tyr Val Gln Arg Val Lys Arg Thr His Ser Gln Gly Gly 290 295 300 Tyr Gly Ser Gln Gly Tyr Lys Tyr Asn Trp Lys Leu Asp Glu Ala Arg 305 310 315 320 Lys Asn Leu Leu Arg Thr His Thr Thr Ser Ala Ser Ala Arg Ala Leu 325 330 335 Tyr Arg Leu Ala Gln Lys Lys Pro Phe Thr Pro Val Lys Tyr Phe Ser 340 345 350 Ile Asp Arg Val Phe Arg Asn Glu Thr Leu Asp Ala Thr His Leu Ala 355 360 365 Glu Phe His Gln Ile Glu Gly Val Val Ala Asp His Gly Leu Thr Leu 370 375 380 Gly His Leu Met Gly Val Leu Arg Glu Phe Phe Thr Lys Leu Gly Ile 385 390 395 400 Thr Gln Leu Arg Phe Lys Pro Ala Tyr Asn Pro Tyr Thr Glu Pro Ser 405 410 415 Met Glu Val Phe Ser Tyr His Gln Gly Leu Lys Lys Trp Val Glu Val 420 425 430 Gly Asn Ser Gly Val Phe Arg Pro Glu Met Leu Leu Pro Met Gly Leu 435 440 445 Pro Glu Asn Val Ser Val Ile Ala Trp Gly Leu Ser Leu Glu Arg Pro 450 455 460 Thr Met Ile Lys Tyr Gly Ile Asn Asn Ile Arg Glu Leu Val Gly His 465 470 475 480 Lys Val Asn Leu Gln Met Val Tyr Asp Ser Pro Leu Cys Arg Leu Asp 485 490 495 Ala Glu Pro Arg Pro Pro Pro Thr Gln Glu Ala Ala 500 505 <210> 2 <211> 1811 <211> RNA <213> Artificial sequence <400> 2 ACACTGGAAG GAGTCATGGC GGATGGTCAG GTGGCGGAAC TGCTGCTCCG GCGGCTGGAG 60 GCGTCTGATG GCGGCCTGGA CAGCGCCGAG TTGGCGGCTG AGCTGGGCAT GGAGCACCAG 120 GCGGTGGTGG GCGCCGTGAA GAGCCTTCAG GCGCTGGGCG AGGTCATCGA GGCTGAACTT 180 CGGTCCACCA AGCACTGGGA GCTTACTGCG GAGGGCGAGG AGATTGCCCG GGAGGGCAGC 240 CATGAGGCCC GTGTGTTTCG AAGCATTCCC CCAGAGGGCC TGGCCCAGAG CGAGCTTATG 300 CGACTGCCCA GTGGCAAAGT GGGCTTCAGC AAGGCCATGT CCAACAAGTG GATTCGGGTG 360 GACAAGAGTG CGGCTGACGG GCCCCGGGTG TTCCGAGTGG TGGACAGCAT GGAGGATGAG 420 GTGCAGCGGC GGCTCCAGCT GGTCCGGGGG GGACAGGCTG AGAAGCTGGG GGAGAAGGAG 480 AGGAGCGAGC TGAGGAAGAG GAAGCTGTTG GCTGAAGTGA CTCTGAAGAC CTACTGGGTG 540 AGCAAAGGCA GTGCCTTTAG TACCAGCATC TCCAAGCAAG AGACAGAGCT GAGCCCAGAG 600 ATGATCTCCA GTGGCTCTTG GCGGGACCGG CCCTTCAAGC CCTACAACTT CTTGGCCCAC 660 GGTGTCCTCC CCGACAGCGG CCACCTTCAC CCGCTGCTCA AGGTCCGCTC CCAGTTCCGA 720 CAGATCTTCC TGGAGATGGG GTTCACCGAG ATGCCGACTG ATAACTTCAT TGAGAGCTCC 780 TTCTGGAACT TTGACGCCCT CTTCCAGCCC CAGCAGCACC CAGCCCGTGA CCAGCACGAC 840 ACCTTCTTCC TTCGAGATCC AGCGGAGGCC CTGCAGCTCC CAATGGACTA TGTCCAGCGG 900 GTCAAGCGGA CCCACTCTCA GGGCGGCTAC GGCTCACAGG GGTACAAGTA TAACTGGAAG 960 CTGGACGAGG CCCGGAAAAA CCTACTGCGA ACCCACACCA CATCAGCCAG CGCCCGTGCG 1020 CTCTACCGCC TTGCCCAGAA GAAGCCCTTC ACTCCGGTCA AGTACTTCTC CATCGACCGC 1080 GTATTCCGGA ATGAGACCCT GGACGCCACG CACCTGGCTG AGTTCCACCA GATCGAGGGC 1140 GTGGTGGCGG ATCATGGTCT CACCTTGGGC CACCTCATGG GCGTTCTGCG GGAGTTCTTC 1200 ACCAAGCTGG GTATCACGCA ACTCCGCTTC AAGCCAGCCT ACAACCCATA CACAGAGCCC 1260 AGCATGGAGG TGTTCAGCTA CCACCAAGGC CTGAAGAAGT GGGTGGAGGT CGGAAACTCG 1320 GGGGTCTTCC GTCCAGAGAT GCTGCTGCCC ATGGGGCTTC CCGAGAACGT GTCGGTCATT 1380 GCCTGGGGCC TCTCCCTGGA GCGCCCAACG ATGATCAAAT ATGGCATCAA CAATATCCGG 1440 GAGCTGGTGG GCCACAAGGT GAACCTGCAG ATGGTGTATG ACAGTCCCCT GTGCCGCCTG 1500 GATGCCGAGC CGAGGCCCCC TCCCACACAG GAGGCTGCGT GACATGGGCC ACTCTAGGAC 1560 AGGTCATCCT CCCCGAGTCC CTGCTGCTGC GCTCCTTTGC ATCCCTGGCC AGTGACCTTG 1620 TATTTATGAG GCCTCTGTGA GGCCAGCCCC CACCTTCCTC TTTCCCACCT GTCCCAGGAC 1680 CAGAATCCCA GGGACAGAGG ACTGGGTAGC AGGTTCCTTC TGTTGTCCTG TGTGGTGTGT 1740 CTACTGTGAG GGTGGGCCCT GAGGAGACCT GTGGGCCACC TATTGTCTAA TAAAGTGGGC 1800 AGTTGCCCCC A 1811

Claims

1. Use of a FARSA protein or a FARSA protein-overexpressing lentivirus in the preparation of a drug for treating mantle cell lymphoma, wherein the amino acid sequence of the FARSA protein is shown in SEQ ID No. 1.

Images