Conjugates and uses thereof

Abstract

The present invention relates to a conjugate formed by a cell penetrating peptide vector linked to a therapeutic molecule, wherein the peptide vector is defined by a specific domain and the therapeutic molecule is a nucleic acid formed by trinucleotide repeats. The present invention further relates to the use of such a conjugate in a method of treatment or as a medicament, in particular in the treatment of trinucleotide repeat disorders such as myotonic dystrophy (DM1).

Description

Technical Field

[0001] The present invention relates to conjugates of peptide vectors and therapeutic molecules, wherein the peptide vector is defined by a specific structural domain and the therapeutic molecule is a nucleic acid formed by trinucleotide repeats. The invention further relates to the use of such conjugates in therapeutic methods or as medicaments, in particular in the treatment of trinucleotide repeat disorders such as myotonic dystrophy (DM1). Background Art

[0002] Nucleic acid therapeutics are genomic medicines with the potential to transform human healthcare. Research has shown that these therapies can be applied across a wide range of disease areas. In particular, the application of antisense oligonucleotide-based approaches to modulate mRNA expression has become an ideal therapeutic approach at the forefront of precision medicine.

[0003] However, the therapeutic development of these promising antisense therapies has been hampered by insufficient cellular penetrance and poor distribution characteristics.

[0004] Therefore, there is an urgent need to improve the delivery of antisense oligonucleotides to provide more effective therapies for genetic diseases such as devastating trinucleotide repeat disorders.

[0005] A trinucleotide repeat disorder is a genetic disease characterized by an abnormally high number of repeats of a specific sequence of three nucleotides in genomic DNA, also known as a trinucleotide repeat expansion. A trinucleotide repeat expansion is a specific type of microsatellite repeat, commonly referred to as a microsatellite expansion. Typically, in a normal, healthy subject, there is a threshold number of repeats above which the disease develops. This threshold number varies for different diseases and affected genes. Often in these diseases, the number of repeats can indicate the severity of the disease. Generally, a higher number of repeats indicates more severe manifestations of the disease. Repeat number can also be used to predict the age of onset of a disease, with a higher number of repeats indicating an earlier onset.

[0006] Currently, there are 14 known trinucleotide repeat disorders that affect humans. These disorders can be grouped in a variety of ways, such as based on the location of the trinucleotide repeat in the gene, whether it is in a protein-coding ORF; in an exon; or in an untranslated region. Alternatively, they can be grouped by the sequence of the triplet repeat. In many trinucleotide disorders, the triplet repeat is "CAG" and encodes glutamine, a group of disorders commonly referred to as polyglutamine disorders. However, trinucleotide repeats with other sequences are known and can be grouped as non-polyglutamine repeat disorders.

[0007] One trinucleotide disorder known as a non-polyglutamine repeat disorder is myotonic dystrophy type 1 (DM1). DM1 is caused by the presence of a trinucleotide repeat, "CTG," in the 3' UTR of the DMPK gene. The normal number of repeats in this gene ranges from 5 to 34. With more than 34 repeats, some disease symptoms may develop, while with more than 50 repeats, the disease becomes severe.

[0008] DM1 and other trinucleotide repeat disorders typically affect the neuromuscular system and currently have no effective treatments.

[0009] While the use of antisense oligonucleotides that can bind to repeat regions and disrupt splicing or translation has been theoretically proposed and demonstrated in vitro, the difficulty in delivering these molecules into affected cells has hampered their use as therapeutic agents. This is the case for several genetic diseases, including trinucleotide repeat disorders.

[0010] The use of viruses as delivery vehicles has been proposed, but their use is limited due to the immunotoxicity and potential carcinogenicity of viral coat proteins. Alternatively, a variety of non-viral delivery vehicles have been developed, of which peptides have shown the most promise due to their small size, targeting specificity, and ability to deliver large biological cargoes transcapillary. The ability of several peptides to penetrate cells alone or with biological cargo has been reported.

[0011] For many years, cell-penetrating peptides have been conjugated to antisense oligonucleotides (especially charge-neutral phosphorodiamidate morpholino oligomers (PMOs) and peptide nucleic acids (PNAs)) to enhance the cellular delivery of such oligonucleotide analogs by effectively carrying them across the cell membrane to their pre-mRNA targets in the nucleus. It has been shown that PMO therapeutics conjugated to certain arginine-rich peptides (referred to as P-PMOs or peptide-PMOs) can effectively penetrate into relevant cells.

[0012] In particular, PNA / PMO internalization peptides (Pips) have been developed, which are arginine-rich CPPs consisting of two arginine-rich sequences separated by a short central hydrophobic sequence. These "Pip" peptides were designed to improve serum stability while maintaining high levels of exon skipping, initially achieved by attaching them to PNA cargo. Other derivatives of these peptides were designed as conjugates of PMOs, and after systemic administration in mice, they were shown to lead to systemic treatment of skeletal muscle and, importantly, the heart in a DMD model.

[0013] Although these carrier peptides are effective, their associated toxicity hinders their therapeutic application.

[0014] Alternative carrier peptides with a single arginine-rich domain, such as R6Gly, have also been generated. These peptides have been used to produce peptide conjugates of antisense oligonucleotides with reduced toxicity, but these conjugates exhibit low efficacy compared to the Pip peptide.

[0015] Furthermore, nearly all carrier peptides have been developed for the treatment of DMD. Peptides with a hydrophobic core domain have been shown to be particularly active in DMD. However, the use of such carrier peptides in other neuromuscular diseases with different etiologies and pathologies has not been investigated.

[0016] Therefore, currently available carrier peptides have not proven suitable for use in conjugates with nucleic acid therapeutics for the treatment of genetic disorders, particularly diseases caused by different pathologies, such as trinucleotide repeat disorders.

[0017] A challenge in the field of carrier peptide technology is to uncouple efficacy and toxicity. The inventors of the present invention have now identified, synthesized and tested conjugates comprising improved carrier peptides with specific structures covalently linked to therapeutic nucleic acids for the treatment of trinucleotide disorders that address at least this problem. Summary of the Invention

[0018] According to a first aspect of the present invention, there is provided a conjugate comprising: a peptide carrier covalently linked to a therapeutic molecule;

[0019] wherein the peptide vector has a total length of 40 amino acids or less and comprises: two or more cationic domains, each cationic domain comprising at least 4 amino acid residues and one or more hydrophobic domains, each hydrophobic domain comprising at least 3 amino acid residues, wherein the peptide vector does not contain artificial amino acid residues;

[0020] And wherein the therapeutic molecule comprises a nucleic acid, wherein the nucleic acid comprises a plurality of trinucleotide repeats.

[0021] According to a second aspect of the present invention, there is provided a conjugate according to the first aspect for use as a medicament.

[0022] According to a third aspect of the present invention, there is provided a method of treating a disease in a subject, the method comprising: administering to the subject an effective amount of the conjugate according to the first aspect.

[0023] According to a fourth aspect of the present invention, there is provided a conjugate according to the first aspect for use in preventing or treating a trinucleotide repeat disorder.

[0024] According to a fifth aspect of the present invention, there is provided a method for preventing or treating a trinucleotide repeat disorder in a subject, the method comprising: administering to the subject an effective amount of the conjugate according to the first aspect.

[0025] According to a sixth aspect of the present invention, there is provided a pharmaceutical composition comprising the conjugate according to the first aspect.

[0026] In one embodiment of the second, third, fourth or fifth aspect, the conjugate is comprised in a pharmaceutical composition.

[0027] Other features and embodiments of the present invention will now be described in the following headings. Unless otherwise expressly stated, any feature can be combined with the above aspects or other features herein in any compatible combination. Individual features are not limited to any particular embodiment. The section headings used herein are for organizational purposes only and should not be interpreted as limiting the subject matter described.

[0028] "Peptide carrier" as referred to throughout the text refers to a peptide suitable for transporting a molecule conjugated thereto into a cell, ie a cell penetrating peptide. The terms "cell penetrating peptide" and "peptide carrier" and "peptide" are used interchangeably throughout the text.

[0029] An "X" is always used to denote any form of the artificial, synthetically prepared amino acid aminocaproic acid.

[0030] "B" is used throughout to represent the naturally occurring but non-genetically encoded amino acid beta-alanine.

[0031] Acetylation of the relevant peptide is indicated throughout by "Ac".

[0032] "Hyp" is used throughout to denote the naturally occurring but non-genetically encoded amino acid hydroxyproline.

[0033] Amino acid residues are always represented in upper case letters according to the relevant genetic code according to the generally accepted alphabetical amino acid code

[0034] "Artificial" amino acids or residues mentioned herein refer to any non-natural amino acids and include synthetic amino acids, modified amino acids (e.g., sugar-modified amino acids), non-natural amino acids, artificial amino acids, spacers, and non-peptide-bonded spacers. For the avoidance of doubt, in the context of the present invention, aminocaproic acid (X) is an artificial amino acid. For the avoidance of doubt, β-alanine (B) and hydroxyproline (Hyp) are naturally occurring and are therefore not artificial amino acids in the context of the present invention, but natural amino acids. Artificial amino acids can include, for example, 6-aminocaproic acid (X), tetrahydroisoquinoline-3-carboxylic acid (TIC), 1-(amino)cyclohexanecarboxylic acid (Cy), and 3-azetidine carboxylic acid (Az), 11-aminoundecanoic acid.

[0035] "Cationic" as referred to herein refers to an amino acid or domain of amino acids that has an overall positive charge at physiological pH.

[0036] "Arginine-rich" or "histidine-rich" means that at least 40% of the cationic domain is formed by said residues.

[0037] As referred to herein, "hydrophobic" refers to an amino acid or a domain of amino acids that has the ability to repel water or does not mix with water. DETAILED DESCRIPTION

[0038] The present invention is based on the discovery that conjugating specific peptide vectors to nucleic acids suitable for preventing and treating trinucleotide repeat disorders allows the nucleic acids to effectively penetrate target cells and bind to target trinucleotide repeat expansions present in genes of affected subjects. This activity reduces the levels of repeat expansion transcripts and / or proteins present in the cells, thereby blocking their pathological interaction with the cellular splicing machinery, normalizing splicing, and improving the subject's physiological condition.

[0039] Advantageously, the peptide vectors described herein appear to increase the ability of therapeutic nucleic acids to resist degradation, penetrate target cells, and reach target trinucleotide repeats to provide treatment. Furthermore, the conjugates of the present invention have much lower toxicity than conjugates formed using known peptide vectors. Thus, the conjugates provide a means of effectively delivering nucleic acid therapies for trinucleotide repeat disorders while remaining non-toxic to the subject.

[0040] The inventors believe that this is the first time that any peptide vector with a hydrophobic core has been shown to be effective in treating neuromuscular diseases outside the scope of DMD. Previous studies have focused on using peptide vectors to deliver therapeutic agents for the treatment of DMD. The pathology of DMD is completely different from that of trinucleotide repeat disorders. In particular, DMD involves active muscle degeneration and muscle conversion (muscle turnover) and repair, including inflammation, while trinucleotide repeat disorders such as myotonic dystrophy type 1 (DM1) involve muscle dysfunction without obvious degeneration. The inventors of the present invention believe that peptide vectors interact with muscle membranes to allow effective delivery of therapeutic molecules, and therefore, the membrane types they interact with differ greatly between degenerative muscles and non-degenerative muscles (i.e., between DMD and trinucleotide repeat disorders). In contrast to degenerative diseases such as DMD, in DM1, the muscle membrane is not destroyed, so it is expected that the conjugate will be inhibited from penetrating into muscle tissue and will be more difficult to achieve. However, based on the data provided herein, peptide vectors not only show for the first time that they can be effectively delivered to non-degenerative muscles to treat DM1, but also unexpectedly show that they are more effective for DM1 than DMD.

[0041] In the data presented herein, the conjugates of the present invention maintain good levels of efficacy and delivery to key target tissues affected by trinucleotide disorders, such as the gastrocnemius and quadriceps femoris skeletal muscles. Furthermore, these conjugates demonstrate improved efficacy compared to previously available carrier peptides when used in the same conjugates. The conjugates of the present invention target mutant CUG amplification-DMPK transcripts to prevent the formation of nuclear foci, thereby preventing the harmful sequestration of MBNL1 splicing factors by nuclear RNA foci, thereby alleviating MBNL1 loss of function that leads to splicing defects in multiple genes and muscle dysfunction.

[0042] This is demonstrated herein by a reduction in the number of foci formed by DMPK transcripts containing the expansion following administration of the conjugates of the invention, and by splicing correction of genes that are typically mis-spliced ​​in DM1 due to reduced availability of MBNL1 sequestered by the trinucleotide repeat expansion transcripts. Specifically, the conjugates presented herein demonstrated 50-90% splicing correction in healthy controls excluding clicn1 exon 7a and mblnl1 exon 5, and including serca exon 22, compared to untreated cells / subjects. This is further demonstrated by an improvement in the physiology of the trinucleotide repeat disorder, as shown herein in a DM1 model, where myotonia in mice was normalized and corrected to the point of complete recovery, even after a single injection of the conjugates described herein.

[0043] Surprisingly, the inventors discovered that the peptide vector used in the conjugate effectively delivers the therapeutic molecule to the nuclear compartment at sufficient concentrations and to nuclear aggregates of the DMPK transcript to allow a favorable stoichiometric interaction with the CUG mutation.

[0044] At the same time, the conjugates of the present invention function effectively in vivo, with reduced clinical signs after systemic injection and lower toxicity observed by measuring biochemical markers. Crucially, the conjugates of the present invention were shown to exhibit surprisingly reduced toxicity compared to previous carrier peptides in the same conjugates after similar systemic injection into mice. As demonstrated herein, the conjugates of the present invention did not cause a significant increase in toxicity markers at therapeutically relevant doses compared to saline, and maintained cell viability, while conjugates using existing peptide carriers showed significant cell death rates. When the conjugates were administered to mice, the mice had a rapid recovery time, which was much faster than after administration of conjugates formed with previously available peptides.

[0045] Thus, the conjugates of the present invention offer improved applicability as safe and effective therapies for human trinucleotide repeat disorders, thereby providing a pathway to treat these otherwise untreatable and devastating diseases.

[0046] Artificial amino acids

[0047] The present invention relates to conjugates comprising a carrier peptide having a specific structure, wherein no artificial amino acid residues are present.

[0048] Suitably, the peptide does not comprise aminocaproic acid residues. Suitably, the peptide does not comprise any form of aminocaproic acid residues. Suitably, the peptide does not comprise 6-aminocaproic acid residues.

[0049] Suitably, the peptide comprises only, and thus consists of, natural amino acid residues.

[0050] Suitably, artificial amino acids commonly used in cell penetrating peptides, such as 6-aminohexanoic acid, are replaced by natural amino acids. Suitably, artificial amino acids commonly used in cell penetrating peptides, such as 6-aminohexanoic acid, are replaced by amino acids selected from β-alanine, serine, proline, arginine, and histidine or hydroxyproline.

[0051] In one embodiment, aminocaproic acid is replaced by beta-alanine. Suitably, 6-aminocaproic acid is replaced by beta-alanine.

[0052] In one embodiment, aminocaproic acid is replaced by histidine. Suitably, 6-aminocaproic acid is replaced by histidine.

[0053] In one embodiment, aminocaproic acid is replaced by hydroxyproline. Suitably, 6-aminocaproic acid is replaced by hydroxyproline.

[0054] Suitably, artificial amino acids commonly used in cell penetrating peptides such as 6-aminohexanoic acid may be replaced with a combination of β-alanine, serine, proline, arginine and any one of histidine or hydroxyproline, suitably, a combination of any one of β-alanine, histidine and hydroxyproline.

[0055] In one embodiment, the total length of the peptide vector may be 40 or fewer amino acid residues, and the peptide comprises:

[0056] two or more cationic domains, each cationic domain comprising at least 4 amino acid residues; and

[0057] One or more hydrophobic domains, each hydrophobic domain comprising at least 3 amino acid residues;

[0058] At least one of the cationic domains comprises a histidine residue.

[0059] Suitably, at least one of the cationic domains is histidine-rich.

[0060] Suitably, the meaning of histidine-rich is defined herein with respect to the cationic domain.

[0061] Cationic domain

[0062] The present invention relates to a conjugate comprising a short peptide carrier having a specific structure, wherein there are at least two cationic domains of a certain length.

[0063] Suitably, the peptide comprises at most 4 cationic domains, at most 3 cationic domains.

[0064] Suitably, the peptide comprises two cationic domains.

[0065] As defined above, the peptide comprises two or more cationic domains, each cationic domain having a length of at least 4 amino acid residues.

[0066] Suitably, each cationic domain is 4 to 12 amino acid residues in length, suitably 4 to 7 amino acid residues in length.

[0067] Suitably, each cationic domain has a length of 4, 5, 6 or 7 amino acid residues.

[0068] Suitably, each cationic domain is of similar length, suitably, each cationic domain is of the same length.

[0069] Suitably, each cationic domain comprises cationic amino acids, and may also comprise polar and / or non-polar amino acids.

[0070] The non-polar amino acids may be selected from the group consisting of: alanine, beta-alanine, proline, glycine, cysteine, valine, leucine, isoleucine, methionine, tryptophan, phenylalanine. Suitably, the non-polar amino acids have no charge.

[0071] The polar amino acid may be selected from the group consisting of: serine, asparagine, hydroxyproline, histidine, arginine, threonine, tyrosine, glutamine. Suitably, the polar amino acid selected does not have a negative charge.

[0072] The cationic amino acid may be selected from: arginine, histidine, lysine. Suitably, the cationic amino acid has a positive charge at physiological pH.

[0073] Suitably, each cationic domain does not comprise anionic or negatively charged amino acid residues.

[0074] Suitably, each cationic domain comprises an arginine, histidine, beta-alanine, hydroxyproline and / or serine residue.

[0075] Suitably, each cationic domain consists of arginine, histidine, β-alanine, hydroxyproline and / or serine residues.

[0076] Suitably, each cationic domain comprises at least 40%, at least 45%, at least 50% cationic amino acids.

[0077] Suitably, each cationic domain comprises a majority of cationic amino acids. Suitably, each cationic domain comprises at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% cationic amino acids.

[0078] Suitably, each cationic domain has an isoelectric point (pi) of at least 7.5, at least 8.0, at least 8.5, at least 9.0, at least 9.5, at least 10.0, at least 10.5, at least 11.0, at least 11.5, at least 12.0.

[0079] Suitably, each cationic domain has an isoelectric point (pi) of at least 10.0.

[0080] Suitably, each cationic domain has an isoelectric point (pi) of from 10.0 to 13.0.

[0081] In one embodiment, each cationic domain has an isoelectric point (pi) of 10.4 to 12.5.

[0082] Suitably, the isoelectric point of the cationic domain may be calculated at physiological pH by any suitable method available in the art. Suitably, by using IPC (www.isoelectric.org), a web-based algorithm developed by Lukasz Kozlowski, Biol Direct. 2016; 11:55. DOI: 10.1186 / s13062-016-0159-9.

[0083] Suitably, each cationic domain comprises at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 60%, at least 65%, at least 70% arginine and / or histidine residues.

[0084] Suitably, the cationic domain comprises at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 60%, at least 65%, at least 70% arginine residues.

[0085] Suitably, the cationic domain comprises at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 60%, at least 65%, at least 70% histidine residues.

[0086] Suitably, the cationic domain may comprise a total of 1-5 histidine and 1-5 arginine residues. Suitably, the cationic domain may comprise 1-5 arginine residues. Suitably, the cationic domain may comprise 1-5 histidine residues. Suitably, the cationic domain may comprise a total of 2-5 histidine and 3-5 arginine residues. Suitably, the cationic domain may comprise 3-5 arginine residues. Suitably, the cationic domain may comprise 2-5 histidine residues.

[0087] Suitably, each cationic domain comprises one or more β-alanine residues. Suitably, each cationic domain may comprise a total of 2-5 β-alanine residues, suitably a total of 2 or 3 β-alanine residues.

[0088] Suitably, the cationic domain may comprise one or more hydroxyproline residues or serine residues.

[0089] Suitably, the cationic domain may comprise 1-2 hydroxyproline residues. Suitably, the cationic domain may comprise 1-2 serine residues.

[0090] Suitably, all cationic amino acids in a given cationic domain may be histidine, or, suitably, all cationic amino acids in a given cationic domain may be arginine.

[0091] Suitably, the peptide may comprise at least one cationic histidine-rich domain. Suitably, the peptide may comprise at least one cationic arginine-rich domain.

[0092] Suitably, the peptide may comprise at least one cationic arginine-rich domain and at least one cationic histidine-rich domain.

[0093] In one embodiment, the peptide comprises two arginine-rich cationic domains.

[0094] In one embodiment, the peptide comprises two cationic histidine-rich domains.

[0095] In one embodiment, the peptide comprises two cationic domains rich in arginine and histidine.

[0096] In one embodiment, the peptide comprises an arginine-rich cationic domain and a histidine-rich cationic domain.

[0097] Suitably, each cationic domain comprises no more than 3 consecutive arginine residues, suitably no more than 2 consecutive arginine residues.

[0098] Suitably, each cationic domain does not comprise consecutive histidine residues.

[0099] Suitably, each cationic domain comprises arginine, histidine and / or beta-alanine residues. Suitably, each cationic domain comprises a majority of arginine, histidine and / or beta-alanine residues. Suitably, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100% of the amino acid residues in each cationic domain are arginine, histidine and / or beta-alanine residues. Suitably, each cationic domain consists of arginine, histidine and / or beta-alanine residues.

[0100] In one embodiment, the peptide comprises a first cationic domain comprising arginine and β-alanine residues and a second cationic domain comprising arginine and β-alanine residues.

[0101] In one embodiment, the peptide comprises a first cationic domain comprising arginine and β-alanine residues and a second cationic domain comprising histidine, β-alanine, and optionally arginine residues.

[0102] In one embodiment, the peptide comprises a first cationic domain comprising arginine and β-alanine residues and a second cationic domain comprising histidine and β-alanine residues.

[0103] In one embodiment, the peptide comprises a first cationic domain consisting of arginine and β-alanine residues and a second cationic domain consisting of arginine and β-alanine residues.

[0104] In one embodiment, the peptide comprises a first cationic domain consisting of arginine and β-alanine residues and a second cationic domain consisting of arginine, histidine and β-alanine residues.

[0105] Suitably, the peptide comprises at least two cationic domains, and suitably, these cationic domains form the arms of the peptide. Suitably, the cationic domains are located at the N and C-terminal ends of the peptide. Suitably, the cationic domains can therefore be referred to as cationic arm domains.

[0106] In one embodiment, the peptide comprises two cationic domains, one of which is located at the N-terminus of the peptide and one is located at the C-terminus of the peptide. Suitably, at either end of the peptide. Suitably, no other amino acids or domains are present at the N-terminus and C-terminus of the peptide, except for other groups such as terminal modifications, linkers and / or therapeutic molecules. For the avoidance of doubt, in addition to the "peptide" described and claimed herein, such other groups may also be present. Suitably, each cationic domain thus forms the end of the peptide. Suitably, this does not preclude the presence of other linker groups as described herein.

[0107] Suitably, the peptide may comprise up to 4 cationic domains. Suitably, the peptide comprises two cationic domains.

[0108] In one embodiment, the peptide comprises two cationic domains, both of which are arginine-rich.

[0109] In one embodiment, the peptide comprises a cationic arginine-rich domain.

[0110] In one embodiment, the peptide comprises two cationic domains that are both rich in both arginine and histidine.

[0111] In one embodiment, the peptide comprises an arginine-rich cationic domain and a histidine-rich cationic domain.

[0112] Suitably, the cationic domain comprises an amino acid unit selected from the group consisting of R, H, B, RR, HH, BB, RH, HR, RB, BR, HB, BH, RBR, RBB, BRR, BBR, BRB, RBH, RHB, HRB, BRH, HRR, RRH, HRH, HBB, BBH, RHR, BHB, HBH, or any combination thereof.

[0113] Suitably, the cationic domain may further comprise serine, proline and / or hydroxyproline residues. Suitably, the cationic domain may further comprise an amino acid unit selected from the group consisting of RP, PR, RPR, RRP, PRR, PRP, Hyp; R[Hyp]R, RR[Hyp], [Hyp]RR, [Hyp]R[Hyp], [Hyp][Hyp]R, R[Hyp][Hyp], SB, BS or any combination thereof, or any combination thereof with the amino acid units listed above.

[0114] Suitably, each cationic domain comprises any one of the following sequences: RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRR (SEQ ID NO: 3), RBRRBR (SEQ ID NO: 4), RRBRBR (SEQ ID NO: 5), RBRRB (SEQ ID NO: 6), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8), HBHBR (SEQ ID NO: 9), RBRHBHR (SEQ ID NO: 10), RBRBBHR (SEQ ID NO: 11), RBRRBH (SEQ ID NO: 12), HBRRBR (SEQ ID NO: 13), HBHBH (SEQ ID NO: 14), BHBH (SEQ ID NO: 15), BRBSB (SEQ ID NO: 16), BRB[Hyp]B (SEQ ID NO: 17), R[Hyp]H[Hyp]HB (SEQ ID NO: 18), R[Hyp]RR[Hyp]R (SEQ ID NO: 19), or any combination thereof.

[0115] Suitably, each cationic domain consists of any one of the following sequences: RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRR (SEQ ID NO: 3), RBRRBR (SEQ ID NO: 4), RRBRBR (SEQ ID NO: 5), RBRRB (SEQ ID NO: 6), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8), HBHBR (SEQ ID NO: 9), RBRHBHR (SEQ ID NO: 10), RBRBBHR (SEQ ID NO: 11), RBRRBH (SEQ ID NO: 12), HBRRBR (SEQ ID NO: 13), HBHBH (SEQ ID NO: 14), BHBH (SEQ ID NO: 15), BRBSB (SEQ ID NO: 16), BRB[Hyp]B, R[Hyp]H[Hyp]HB, R[Hyp]RR[Hyp]R (SEQ ID NO: 19), or any combination thereof.

[0116] Suitably, each cationic domain consists of one of the following sequences: RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRRBR (SEQ ID NO: 4), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8), HBHBR (SEQ ID NO: 9).

[0117] Suitably, each cationic domain in the peptide may be the same or different. Suitably, each cationic domain in the peptide is different.

[0118] hydrophobic domain

[0119] The present invention relates to a conjugate comprising a short peptide carrier having a specific structure, wherein there is at least one hydrophobic domain of a certain length.

[0120] Suitably, the peptide comprises at most 3 hydrophobic domains, at most 2 hydrophobic domains.

[0121] Suitably, the peptide comprises a hydrophobic domain.

[0122] As defined above, the peptide comprises two or more hydrophobic domains, each hydrophobic domain having a length of at least 3 amino acid residues.

[0123] Suitably, each hydrophobic domain has a length of 3-6 amino acids. Suitably, each hydrophobic domain has a length of 5 amino acids.

[0124] Suitably, each hydrophobic domain may comprise non-polar, polar and hydrophobic amino acid residues.

[0125] The hydrophobic amino acid residue may be selected from the group consisting of alanine, valine, leucine, isoleucine, phenylalanine, tyrosine, methionine and tryptophan.

[0126] The non-polar amino acid residues may be selected from the group consisting of proline, glycine, cysteine, alanine, valine, leucine, isoleucine, tryptophan, phenylalanine, and methionine.

[0127] The polar amino acid residues may be selected from the group consisting of: serine, asparagine, hydroxyproline, histidine, arginine, threonine, tyrosine, and glutamine.

[0128] Suitably, the hydrophobic domain does not comprise hydrophilic amino acid residues.

[0129] Suitably, each hydrophobic domain comprises a majority of hydrophobic amino acid residues. Suitably, each hydrophobic domain comprises at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, 100% hydrophobic amino acids. Suitably, each hydrophobic domain consists of hydrophobic amino acid residues.

[0130] Suitably, the hydrophobicity of each hydrophobic domain is at least 0.3, at least 0.4, at least 0.5, at least 0.6, at least 0.7, at least 0.8, at least 0.8, at least 1.0, at least 1.1, at least 1.2, at least 1.3.

[0131] Suitably, the hydrophobicity of each hydrophobic domain is at least 0.3, at least 0.35, at least 0.4, at least 0.45.

[0132] Suitably, the hydrophobicity of each hydrophobic domain is at least 1.2, at least 1.25, at least 1.3, at least 1.35.

[0133] Suitably, the hydrophobicity of each hydrophobic domain is from 0.4 to 1.4.

[0134] In one embodiment, the hydrophobicity of each hydrophobic domain is from 0.45 to 0.48.

[0135] In one embodiment, the hydrophobicity of each hydrophobic domain is from 1.27 to 1.39.

[0136] Suitably, hydrophobicity is measured by White and Wimley: WC Wimley and SH White, "Experimentally determined hydrophobicity scale for proteins at membrane interfaces" Nature Struct Biol 3:842 (1996).

[0137] Suitably, each hydrophobic domain comprises at least 3, at least 4 hydrophobic amino acid residues.

[0138] Suitably, each hydrophobic domain comprises phenylalanine, leucine, isoleucine, tyrosine, tryptophan, proline and glutamine residues. Suitably, each hydrophobic domain consists of phenylalanine, leucine, isoleucine, tyrosine, tryptophan, proline and / or glutamine residues.

[0139] In one embodiment, each hydrophobic domain consists of phenylalanine, leucine, isoleucine, tyrosine and / or glutamine residues.

[0140] In one embodiment, each hydrophobic domain consists of tyrosine and / or proline residues.

[0141] Suitably, the peptide comprises a hydrophobic domain. Suitably, the or each hydrophobic domain is located in the center of the peptide. Suitably, the hydrophobic domain may therefore be referred to as a core hydrophobic domain. Suitably, the or each hydrophobic core domain is flanked on either side by arm domains. Suitably, the arm domains may comprise one or more cationic domains and one or more other hydrophobic domains. Suitably, each arm domain comprises a cationic domain.

[0142] In one embodiment, the peptide comprises two arm domains flanking a hydrophobic core domain, wherein each arm domain comprises a cationic domain.

[0143] In one embodiment, the peptide consists of two cationic arm domains flanked by a hydrophobic core domain.

[0144] Suitably, the or each hydrophobic domain comprises one of the following sequences: YQFLI (SEQ ID NO:20), FQILY (SEQ ID NO:21), ILFQY (SEQ ID NO:22), FQIY (SEQ ID NO:23), WWW, WWPWW (SEQ ID NO:24), WPWW (SEQ ID NO:25), WWPW (SEQ ID NO:26) or any combination thereof.

[0145] Suitably, the or each hydrophobic domain consists of one of the following sequences: YQFLI (SEQ ID NO:20), FQILY (SEQ ID NO:21), ILFQY (SEQ ID NO:22), FQIY (SEQ ID NO:23), WWW, WWPWW (SEQ ID NO:24), WPWW (SEQ ID NO:25), WWPW (SEQ ID NO:26) or any combination thereof.

[0146] Suitably, the or each hydrophobic domain consists of one of the following sequences: FQILY (SEQ ID NO: 21), WWW, WWPWW (SEQ ID NO: 24).

[0147] Suitably, the or each hydrophobic domain consists of FQILY (SEQ ID NO: 21):

[0148] Suitably, each hydrophobic domain in the peptide may have the same sequence or a different sequence.

[0149] Peptide carriers

[0150] The present invention relates to conjugates comprising peptide carriers for the delivery of therapeutic nucleic acids formed from trinucleotide repeats in the treatment of medical conditions.

[0151] The sequence of the peptide is a continuous single molecule, and therefore the domains of the peptide are continuous. Suitably, the peptide comprises several domains arranged linearly between the N-terminus and the C-terminus. Suitably, the domains are selected from the cationic domains and hydrophobic domains described above. Suitably, the peptide consists of a cationic domain and a hydrophobic domain, wherein the domains are as defined above.

[0152] Each domain has the consensus sequence characteristics described in the relevant sections above, but the exact sequence of each domain can be varied and modified. Therefore, each domain has a range of possible sequences. The combination of each possible domain sequence produces a range of peptide structures, each of which forms part of the present invention. The characteristics of the peptide structures are described below.

[0153] Suitably, a hydrophobic domain separates any two cationic domains. Suitably, each hydrophobic domain is flanked on either side by a cationic domain.

[0154] Suitably, no cationic domain is adjacent to another cationic domain.

[0155] In one embodiment, the peptide comprises a hydrophobic domain flanked by two cationic domains arranged as follows:

[0156] [Cationic domain]–[Hydrophobic domain]–[Cationic domain]

[0157] Thus, suitably, the hydrophobic domain may be referred to as a core domain and each cationic domain may be referred to as an arm domain. Suitably, the hydrophobic arm domains are flanked on either side by cationic core domains.

[0158] In one embodiment, the peptide consists of two cationic domains and one hydrophobic domain.

[0159] In one embodiment, the peptide consists of a hydrophobic core domain flanked by two cationic arm domains.

[0160] In one embodiment, the peptide consists of a hydrophobic core domain comprising a sequence selected from the group consisting of YQFLI (SEQ ID NO: 20), FQILY (SEQ ID NO: 21), ILFQY (SEQ ID NO: 22), FQIY (SEQ ID NO: 23), WWW, WWPWW (SEQ ID NO: 24), WPWW (SEQ ID No: 25), and WWPW (SEQ ID NO: 26), flanked by two cationic arm domains, each of which comprises a sequence selected from the group consisting of RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRR (SEQ ID NO: 3), RBRRBR (SEQ ID NO: 4), RRBRBR (SEQ ID NO: 5), RBRRB (SEQ ID NO: 6), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8), HBHBR (SEQ ID NO: 9), RBRHBHR (SEQ ID NO: 10), RBRBBHR (SEQ ID NO: 11), RBRRBH (SEQ ID NO: 12). NO:12), HBRRBR (SEQ ID NO:13), HBHBH (SEQ ID NO:14), BHBH (SEQ ID NO:15), BRBSB (SEQ ID NO:16), BRB[Hyp]B (SEQ ID NO:17), R[Hyp]H[Hyp]HB (SEQ ID NO:18) and R[Hyp]RR[Hyp]R (SEQ ID NO:18) NO:19).

[0161] In one embodiment, the peptide consists of a hydrophobic core domain comprising a sequence selected from the group consisting of FQILY (SEQ ID NO: 21), WWW, and WWPWW (SEQ ID NO: 24) flanked by two cationic arm domains comprising a sequence selected from the group consisting of RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRRBR (SEQ ID NO: 4), RBRRB (SEQ ID NO: 6), BRBR (SEQ ID NO: 7), and RBHBH (SEQ ID NO: 8).

[0162] In one embodiment, the peptide consists of a hydrophobic core domain comprising the sequence: FQILY (SEQ ID NO: 21) flanked by two cationic arm domains comprising a sequence selected from the group consisting of: RBRRBRR (SEQ ID NO: 1), RBRBR (SEQ ID NO: 2), RBRRBR (SEQ ID NO: 4), RBRRB (SEQ ID NO: 6), BRBR (SEQ ID NO: 7), RBHBH (SEQ ID NO: 8).

[0163] In any such embodiment, additional groups may be present, such as linkers, terminus modifications, and / or therapeutic molecules.

[0164] Suitably, the peptide is N-terminally modified.

[0165] Suitably, the peptide is N-acetylated, N-methylated, N-trifluoroacetylated, N-trifluoromethylsulfonylated or N-methylsulfonylated. Suitably, the peptide is N-acetylated.

[0166] Optionally, the N-terminus of the peptide may be unmodified.

[0167] In one embodiment, the peptide is N-acetylated.

[0168] Suitably, the peptide comprises a C-terminal modification selected from the group consisting of carboxyl-, thioacid-, aminooxy-, hydrazine-, thioester-, azide, strained alkyne, strained olefin, aldehyde-, thiol or haloacetyl.

[0169] Advantageously, C-terminal or N-terminal modifications can provide a means for linking the peptide to a therapeutic molecule.

[0170] Thus, a C-terminal or N-terminal modification may comprise a linker, and vice versa. Suitably, a C-terminal or N-terminal modification may consist of a linker, and vice versa. Suitable linkers are described elsewhere herein.

[0171] Suitably, the peptide comprises a C-terminal carboxyl group.

[0172] Suitably, the C-terminal carboxyl group is provided by a glycine, β-alanine, glutamic acid or γ-aminobutyric acid residue.

[0173] In one embodiment, the C-terminal carboxyl group is provided by a β-alanine residue.

[0174] Suitably, the C-terminal residue is a linker. Suitably, the C-terminal β-alanine residue is a linker.

[0175] Suitably, therefore, each cationic domain may further comprise an N- or C-terminal modification. Suitably, the cationic domain comprises a C-terminal modification at the C-terminus. Suitably, the cationic domain comprises an N-terminal modification at the N-terminus. Suitably, the cationic domain comprises a linker group at the C-terminus, suitably, the cationic domain comprises a C-terminal β-alanine at the C-terminus. Suitably, the cationic domain is N-acetylated at the N-terminus.

[0176] The peptides of the present invention are defined as having a total length of 40 amino acid residues or less. Thus, the peptides can be considered as oligopeptides.

[0177] Suitably, the total length of the peptide is 3-30 amino acid residues, suitably 5-25 amino acid residues, 10-25 amino acid residues, 13-23 amino acid residues, 15-20 amino acid residues.

[0178] Suitably, the total length of the peptide is at least 12, at least 13, at least 14, at least 15, at least 16, at least 17 amino acid residues.

[0179] Suitably, the peptide is capable of penetrating cells. Suitably, the peptide may be regarded as a cell penetrating peptide.

[0180] Suitably, the peptide is used to attach to a therapeutic molecule. Suitably, the peptide is used to transport the therapeutic molecule into a target cell. Suitably, the peptide is used to deliver the therapeutic molecule into a target cell. Thus, the peptide is considered a peptide vector.

[0181] Suitably, the peptide vector is capable of penetrating into cells and tissues, suitably into the nucleus of a cell, and suitably into muscle tissue.

[0182] Suitably, the peptide vector may be selected from any one of the following sequences:

[0183]

[0184]

[0185]

[0186] Suitably, the peptide may be selected from any of the following additional sequences:

[0187]

[0188]

[0189] Suitably, the peptide consists of one of the following sequences:

[0190]

[0191] In one embodiment, the peptide consists of the following sequence: RBRRBRFQILYBRBR (SEQ ID NO: 35).

[0192] In one embodiment, the peptide consists of the following sequence: RBRRBRRFQILYRBHBH (SEQ ID NO: 37).

[0193] In one embodiment, the peptide consists of the following sequence: RBRRBRFQILYRBHBH (SEQ ID NO: 44).

[0194] therapeutic molecules

[0195] The peptide vector is covalently linked to a therapeutic molecule to provide a conjugate of the invention, wherein the therapeutic molecule is a nucleic acid comprising multiple trinucleotide repeats.

[0196] Suitably, the nucleic acid may be selected from: antisense oligonucleotides (eg PNA, PMO), mRNA, gRNA (eg when using CRISPR / Cas9 technology), short interfering RNA, microRNA and antagomiRNA.

[0197] Suitably, the nucleic acid is an antisense oligonucleotide.

[0198] Suitably, the antisense oligonucleotide is a phosphorodiamidate morpholino oligonucleotide (PMO).

[0199] Alternatively, the antisense oligonucleotide may be a modified PMO or any other charge-neutral antisense oligonucleotide, such as peptide nucleic acid (PNA), chemically modified PNA such as γ-PNA (Bahal, Nat. Comm. 2016), oligonucleotide phosphoramidates (in which the non-bridging oxygen of the phosphate group is replaced by an amine or alkylamine) such as those described in WO2016028187A1, or any other partially or fully charge-neutralized oligonucleotide.

[0200] Suitably, the nucleic acid consists of a plurality of trinucleotide repeats.

[0201] Suitably, the nucleic acid comprises any trinucleotide repeat. Suitably, the nucleic acid comprises a trinucleotide repeat selected from the group consisting of GTC, CAG, GCC, GGC, CTT and CCG repeats. Suitably, the nucleic acid consists of a trinucleotide repeat selected from the group consisting of GTC, CAG, GCC, GGC, CTT and CCG repeats.

[0202] Suitably, the nucleic acid comprises CAG repeats. Suitably, the nucleic acid consists of CAG repeats.

[0203] In one embodiment, the nucleic acid is an antisense oligonucleotide comprising CAG repeats. In one embodiment, the nucleic acid is an antisense oligonucleotide consisting of CAG repeats.

[0204] Suitably, the nucleic acid comprises or consists of a plurality of trinucleotide repeats. Suitably, the nucleic acid comprises or consists of at least 2 trinucleotide repeats. Suitably, the nucleic acid comprises or consists of 5-50 trinucleotide repeats. Suitably, the nucleic acid comprises or consists of 5-40 trinucleotide repeats. Suitably, the nucleic acid comprises or consists of 5-30 trinucleotide repeats. Suitably, the nucleic acid comprises or consists of 5-20 trinucleotide repeats. Suitably, the nucleic acid comprises or consists of 5-10 trinucleotide repeats. Suitably, the nucleic acid comprises or consists of 7 trinucleotide repeats.

[0205] In one embodiment, the nucleic acid is an antisense oligonucleotide comprising 7 CAG repeats. In one embodiment, the nucleic acid is an antisense oligonucleotide consisting of 7 CAG repeats. Suitably, in such an embodiment, the nucleic acid is an antisense oligonucleotide consisting of [CAG]7.

[0206] Suitably, the nucleic acid is complementary to a microsatellite region, suitably, complementary to a repeat expansion, suitably, complementary to a trinucleotide repeat expansion.

[0207] Suitably, the nucleic acid targets and binds to a microsatellite region. Suitably, the microsatellite region comprises a repeat expansion, suitably they comprise a trinucleotide repeat expansion.

[0208] In some embodiments, the repeat expansion can include higher repeat expansions, such as four, five, six, seven, eight, nine, or ten repeat expansions, each repeat of which comprises four, five, six, seven, eight, nine, or ten nucleotides, respectively.

[0209] Thus, in some embodiments, the therapeutic molecule is a nucleic acid comprising a plurality of tetra-, penta-, hexa-, hepta-, octa-, nona-, or deca-nucleotide repeats. Thus, in some embodiments, the therapeutic molecule is a nucleic acid consisting of a plurality of tetra-, penta-, hexa-, hepta-, octa-, nona-, or deca-nucleotide repeats.

[0210] Any statements herein regarding nucleic acids comprising trinucleotide repeats apply equally to nucleic acids comprising higher nucleotide repeats.

[0211] Suitably, the nucleic acid binds to a complementary microsatellite region, suitably, binds to a complementary repeat expansion region, suitably, binds to a complementary trinucleotide repeat expansion region.

[0212] Suitably, the microsatellite region is present in DNA or RNA. Suitably, the microsatellite region is present in RNA.

[0213] Suitably, the microsatellite region may be present in a coding or non-coding sequence. Suitably, the microsatellite region is present in a non-coding sequence, such as a 3' or 5' UTR. Suitably, the microsatellite region is present in a 3' UTR.

[0214] Suitably, the nucleic acid may be formed from trinucleotide repeats combined with complementary trinucleotide repeat expansions.

[0215] Suitably, the nucleic acid may be formed from trinucleotide repeats combined with complementary trinucleotide repeat expansions in RNA.

[0216] Suitably, the nucleic acid may be formed from trinucleotide repeats combined with complementary trinucleotide repeat expansions in non-coding sequences of RNA.

[0217] Suitably, the nucleic acid may be formed from trinucleotide repeats bound to complementary trinucleotide repeat expansions in the untranslated region of the RNA.

[0218] In one embodiment, the nucleic acid may be formed from a trinucleotide repeat that is combined with a complementary trinucleotide repeat expansion in the 3'UTR of an RNA.

[0219] Optionally, lysine residues can be added to one or both ends of the nucleic acid (eg, PMO or PNA) prior to attachment to the peptide vector to improve water solubility.

[0220] trinucleotide repeat disorders

[0221] The conjugates of the present invention are for use as medicaments, preferably for preventing or treating trinucleotide repeat disorders.

[0222] Suitably, a trinucleotide repeat disorder is a genetic disease caused by a trinucleotide repeat expansion (which may also be referred to as a triplet repeat expansion).

[0223] Suitably, the trinucleotide repeat expansion is present in a gene. Suitably, the trinucleotide repeat expansion is present in a gene selected from the group consisting of: ATN1, HTT, AR, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, TBP, FMR1, AFF2, FXN, DMPK, SCA8, JPH3 and PPP2R2B.

[0224] Suitably, the trinucleotide repeat expansion is present in the AR, SCA8 or DMPK gene.

[0225] In one embodiment, the trinucleotide repeat expansion is in the DMPK gene.

[0226] Suitably, the trinucleotide repeat expansion consists of repeats selected from the group consisting of: CAG, CTG, CGG, CCG, GAA, TTC and GGC.

[0227] Suitably, the trinucleotide repeat expansion consists of CAG or CTG repeats.

[0228] In one embodiment, the trinucleotide repeat expansion consists of CTG repeats.

[0229] Typically, a trinucleotide repeat disorder is caused by the presence of a specific trinucleotide repeat expansion found in a specific gene. Typically, the number of trinucleotide repeats present in a gene is higher than the number of trinucleotide repeats present in the same gene in a normal, healthy subject.

[0230] Suitably, the trinucleotide repeat expansion is a CAG repeat in a gene selected from the group consisting of: ATN1, HTT, AR, ATXN1, ATXN, ATXN3, CACNA1A, ATXN7, JPH3 and TBP.

[0231] Suitably, trinucleotide repeat disorders caused by CAG repeats are referred to as "polyglutamine diseases". Thus, suitably, the trinucleotide repeat disorder may be a polyglutamine disorder. Suitably, the polyglutamine disorder may be selected from: DRPLA (dentatorubral pallidum-Lewy body atrophy), HD (Huntington's disease), HDL2 (Huntington's disease-like syndrome 2), SBMA (spinal bulbar muscular atrophy), SCA1 (spinocerebellar ataxia type 1), SCA2 (spinocerebellar ataxia type 2), SCA3 (spinocerebellar ataxia type 3 or Machado-Jospeh disease), SCA6 (spinocerebellar ataxia type 6), SCA7 (spinocerebellar ataxia type 7) and SCA17 (spinocerebellar ataxia type 17).

[0232] Suitably, the trinucleotide repeat expansion is a CGG repeat in a gene selected from: FMR1.

[0233] Suitably, the trinucleotide repeat expansion is a CCG repeat in a gene selected from: AFF2.

[0234] Suitably, the trinucleotide repeat expansion is a GAA repeat in a gene selected from FXN.

[0235] Suitably, the trinucleotide repeat expansion is a CTG repeat in a gene selected from DMPK and ATXN8.

[0236] Suitably, the trinucleotide repeat expansion is a GTC repeat in a gene selected from JPH3.

[0237] Suitably, trinucleotide repeat disorders caused by trinucleotide repeats other than CAG repeats are referred to as "non-polyglutamine diseases". Thus, suitably, the trinucleotide repeat disorder may be a non-polyglutamine disorder. Suitably, the non-polyglutamine disorder may be selected from: HDL2 (Huntington's disease-like syndrome 2), FRAXA (Fragile X syndrome), FXTAS (Fragile X-associated tremor / ataxia syndrome), FRAXE (Fragile XE mental retardation), FRDA (Friedrich's ataxia), DM1 (myotonic dystrophy type 1), SCA8 (spinocerebellar ataxia type 8) and SCA12 (spinocerebellar ataxia type 12).

[0238] Suitably, the trinucleotide repeat disorder is due to an increase in the number of trinucleotide repeats compared to a healthy subject. Suitably, the number of trinucleotide repeats in a gene is increased compared to the same gene in a healthy subject. Suitably, the number of trinucleotide repeats in a trinucleotide repeat expansion is increased compared to the number of trinucleotide repeats in a normal healthy subject.

[0239] Suitably, the number of repeats in the trinucleotide repeat expansion is at least 1.5 times the number of repeats in a normal, healthy subject. Suitably, the number of repeats in the trinucleotide repeat expansion is at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45 or 50 times the number of repeats in a normal, healthy subject.

[0240] Suitably, the trinucleotide repeat disorder is caused by a trinucleotide repeat expansion in which the number of repeats is increased by at least 1.5 times compared to the number of repeats in a normal healthy subject.

[0241] Suitably, the trinucleotide repeat disorder is caused by a trinucleotide repeat expansion in which the number of repeats is increased by at least 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 35-fold, 40-fold, 45-fold or 50-fold compared to the number of repeats in a normal healthy subject.

[0242] Suitably, the number of repeats in the trinucleotide repeat expansion is 1.5 to 15 times the number of repeats in a normal healthy subject.

[0243] Suitably, the trinucleotide repeat disorder is caused by a trinucleotide repeat expansion in which the number of repeats is 1.5 to 15 times the number of repeats present in a normal healthy subject.

[0244] Suitably, the number of repeats in the trinucleotide expansion is greater than 50, greater than 75, greater than 100, greater than 125, greater than 150, greater than 175, greater than 200, greater than 225, greater than 250.

[0245] Suitably, the trinucleotide repeat disorder is caused by a trinucleotide repeat expansion comprising greater than 50, greater than 75, greater than 100, greater than 125, greater than 150, greater than 175, greater than 200, greater than 225, greater than 250 repeats.

[0246] Suitably, the number of repeats in the trinucleotide expansion is greater than 50.

[0247] Suitably, the trinucleotide repeat disorder is caused by a trinucleotide repeat expansion comprising greater than 50 repeats.

[0248] Suitably, the number of repeats in the trinucleotide expansion is between 50 and 250.

[0249] Suitably, the trinucleotide repeat disorder is caused by a trinucleotide repeat expansion comprising 50 to 250 repeats.

[0250] Suitably, the trinucleotide repeat disorder is a non-polyglutamine disorder.

[0251] Suitably, the trinucleotide repeat disorder is DM1 or SCA8.

[0252] In one embodiment, the trinucleotide disorder is DM1.

[0253] In one embodiment, when the trinucleotide repeat disorder is DM1, the number of repeats in the trinucleotide expansion is greater than 50. In one embodiment, when the trinucleotide repeat disorder is DM1, the number of CTG repeats in the trinucleotide expansion is greater than 50. In one embodiment, when the trinucleotide repeat disorder is DM1, the number of CTG repeats in the trinucleotide expansion of the DMPK gene is greater than 50.

[0254] In one embodiment, when the trinucleotide repeat disorder is SCA8, the number of repeats in the trinucleotide expansion is 110 to 250. In one embodiment, when the trinucleotide repeat disorder is SCA8, the number of CTG repeats in the trinucleotide expansion is 110 to 250. In one embodiment, when the trinucleotide repeat disorder is SCA8, the number of CTG repeats in the trinucleotide expansion of the ATXN8 gene is 110 to 250.

[0255] In some embodiments, the conjugates of the invention are for use as a medicament, preferably for preventing or treating a nucleotide repeat disorder.

[0256] Suitably, a nucleotide repeat disorder is a genetic disease caused by a nucleotide repeat expansion (which may also be referred to as a repeat expansion or microsatellite repeat expansion).

[0257] Suitably, the nucleotide repeat disorder may be caused by a repeat expansion of four, five, six, seven, eight, nine or ten nucleotides.

[0258] Suitably, the nucleotide repeat expansion may be a higher repeat expansion as discussed above, such as a tetra-, penta-, hexa-, hepta-, octa-, nona-, or deca-nucleotide repeat expansion.

[0259] Thus, suitably, the conjugates of the invention are for use as a medicament, preferably for the prevention or treatment of a tetra-, penta-, hexa-, hepta-, octa-, nona-, or decanucleotide repeat disorder.

[0260] Suitably, the nucleotide repeat expansion is a tetranucleotide repeat, suitably, the tetranucleotide repeat is a CCTG repeat.

[0261] Thus, suitably, the conjugates of the invention are for use as a medicament, preferably for use in the prevention or treatment of DM2 (myotonic dystrophy type 2).

[0262] Suitably, the nucleotide repeat expansion is a pentanucleotide repeat, suitably, the pentanucleotide repeat is an ATTCT repeat.

[0263] Thus, suitably, the conjugates of the invention are for use as a medicament, preferably for the prevention or treatment of SCA10 (Spinocerebellar Ataxia Type 10).

[0264] Thus, suitably, the conjugates of the present invention are for use as a medicament, preferably for the prevention or treatment of SCA31 (Spinocerebellar Ataxia Type 31).

[0265] Suitably, the nucleotide repeat expansion is a hexanucleotide repeat, suitably, the hexanucleotide repeat is a GGCCTG repeat or a GGGGCC repeat.

[0266] Thus, suitably, the conjugates of the present invention are for use as a medicament, preferably for the prevention or treatment of SCA36 (Spinocerebellar Ataxia Type 36).

[0267] Thus, suitably, the conjugates of the present invention are for use as a medicament, preferably for the prevention or treatment of C9ORF72-ALS (amyotrophic lateral sclerosis).

[0268] Any statement herein relating to the treatment of a trinucleotide repeat disorder applies equally to the treatment of higher nucleotide repeat disorders, such as a tetra-, penta-, hexa-, hepta-, octa-, nona- or decanucleotide repeat disorder.

[0269] Covalent attachment

[0270] The peptide vector present in the conjugates of the present invention is covalently linked to the therapeutic molecule.

[0271] Suitably, the peptide vector is covalently linked to the therapeutic molecule at the C-terminus or N-terminus. Suitably, the peptide vector is covalently linked to the therapeutic molecule at the C-terminus.

[0272] Suitably, if desired, the peptide vector is covalently linked to the therapeutic molecule via a linker. The linker can act as a spacer to separate the peptide sequence from the therapeutic molecule.

[0273] The linker may be selected from any suitable sequence.

[0274] Suitably, the linker is present between the peptide and the therapeutic molecule. Suitably, the linker is a spacer group between the peptide and the therapeutic molecule. Thus, the linker may comprise an artificial amino acid.

[0275] In one embodiment, the conjugate comprises a peptide vector covalently linked to a therapeutic molecule via a linker.

[0276] In one embodiment, the conjugate comprises the structure:

[0277] [Peptide]–[Linker]-[Therapeutic Molecule]

[0278] In one embodiment, the conjugate consists of the structure:

[0279] [Peptide]–[Linker]-[Therapeutic Molecule]

[0280] Suitably, any of the peptides listed herein may be used in a conjugate according to the invention. In one embodiment, the conjugate comprises a peptide carrier selected from one of the following sequences: RBRRBRFQILYBRBR (SEQ ID NO: 35), RBRRBRRFQILYRBHBH (SEQ ID NO: 37) and RBRRBRFQILYRBHBH (SEQ ID NO: 44).

[0281] Suitably, in any case, the peptide vector may further comprise an N-terminal modification as described above.

[0282] Suitable linkers include, for example, a C-terminal cysteine ​​residue, which can form a disulfide, thioether, or thiol-maleimide linkage; a C-terminal aldehyde to form an oxime to undergo a click reaction with a basic amino acid on a peptide or a carboxylic acid moiety on a peptide to form a morpholino linkage, which is covalently attached to an amino group to form a carboxamide linkage.

[0283] Suitably, the linker is 1-5 amino acids in length. Suitably, the linker may comprise any linker known in the art.

[0284] Suitably, the linker is selected from any one of the following sequences: G, BC, XC, C, GGC, BBC, BXC, XBC, X, XX, B, BB, BX, XB, succinic acid, GABA and E. Suitably, wherein X is 6-aminohexanoic acid.

[0285] Suitably, the linker may be a polymer, such as PEG.

[0286] Suitably, the linker is selected from the group consisting of: beta-alanine (B), succinate (Succ), GABA (Ab) and glutamate (E).

[0287] In one embodiment, the linker is β-alanine (B).

[0288] In one embodiment, the peptide vector is conjugated to the therapeutic molecule via a carboxamide bond.

[0289] The linker of the conjugate may form part of the therapeutic molecule to which the peptide is attached. Alternatively, the therapeutic molecule may be attached directly to the C-terminus or N-terminus of the peptide vector. Suitably, in such embodiments, no linker is required.

[0290] Alternatively, the peptide vector can be chemically conjugated to the therapeutic molecule. Chemical linkage can be through, for example, a disulfide, an alkenyl, an alkynyl, an aryl, an ether, a thioether, a triazole, an amide, a carboxamide, urea, thiourea, a semicarbazide, a carbohydrazide, a hydrazine, an oxime, a phosphate ester, a phosphoramidate, a phosphorothioate, a boranophosphate, a phosphorimidate, or a thiol-maleimide linkage.

[0291] Optionally, a cysteine ​​can be added to the N-terminus of the therapeutic molecule to allow disulfide bond formation with the peptide vector, or the N-terminus can be bromoacetylated to allow thioether conjugation to the peptide vector.

[0292] In one embodiment, the conjugate comprises a peptide vector selected from one of the following sequences: RBRRBRFQILYBRBR (SEQ ID NO: 35), RBRRBRRFQILYRBHBH (SEQ ID NO: 37) and RBRRBRFQILYRBHBH (SEQ ID NO: 44), which is covalently linked to an antisense oligonucleotide comprising CAG repeats via a linker, wherein the linker is selected from: β-alanine (B), GABA (Ab) and glutamic acid (E).

[0293] In one embodiment, the conjugate comprises a peptide vector selected from one of the following sequences: RBRRBRFQILYBRBR (SEQ ID NO: 35), RBRRBRRFQILYRBHBH (SEQ ID NO: 37) and RBRRBRFQILYRBHBH (SEQ ID NO: 44), which is covalently linked to an antisense oligonucleotide consisting of CAG repeats via a linker, wherein the linker is selected from: β-alanine (B), GABA (Ab) and glutamic acid (E).

[0294] In one embodiment, the conjugate comprises a peptide vector selected from one of the following sequences: RBRRBRFQILYBRBR (SEQ ID NO: 35), RBRRBRRFQILYRBHBH (SEQ ID NO: 37) and RBRRBRFQILYRBHBH (SEQ ID NO: 44), which is covalently linked to an antisense oligonucleotide consisting of seven CAG repeats via a linker, wherein the linker is selected from: β-alanine (B), GABA (Ab) and glutamic acid (E).

[0295] In one embodiment, the conjugate comprises the peptide vector RBRRBRFQILYBRBR (SEQ ID NO: 35) covalently linked via β-alanine (B) to an antisense oligonucleotide consisting of seven CAG repeats. (DPEP1.9)

[0296] In one embodiment, the conjugate comprises the peptide carrier RBRRBRFQILYBRBR (SEQ ID NO: 35) covalently linked via glutamic acid (E) to an antisense oligonucleotide consisting of seven CAG repeats (DPEP1.9b). In one embodiment, this conjugate increases penetration into diaphragmatic muscle tissue. Suitably, increasing penetration into the diaphragm can be used to treat muscle disorders affecting the respiratory system, such as myotonic dystrophy.

[0297] In one embodiment, the conjugate comprises the peptide carrier RBRRBRRFQILYRBHBH (SEQ ID NO: 37) covalently linked via β-alanine (B) to an antisense oligonucleotide consisting of seven CAG repeats (DPEP3.1). In one embodiment, this conjugate increases penetration into muscle tissue. Suitably, increasing penetration into muscle can be used to treat muscle disorders.

[0298] In one embodiment, the conjugate comprises the peptide carrier RBRRBRRFQILYRBHBH (SEQ ID NO: 37) covalently linked via glutamic acid (E) to an antisense oligonucleotide consisting of seven CAG repeats (DPEP3.1b). In one embodiment, this conjugate increases penetration into muscle tissue. Suitably, increasing penetration into muscle can be used to treat muscle disorders.

[0299] In one embodiment, the conjugate comprises the peptide vector RBRRBRRFQILYRBHBH (SEQ ID NO: 37) covalently linked via GABA(Ab) to an antisense oligonucleotide consisting of seven CAG repeats. (DPEP3.1a)

[0300] In one embodiment, the conjugate comprises the peptide carrier RBRRBRFQILYRBHBH (SEQ ID NO: 44) covalently linked via β-alanine (B) to an antisense oligonucleotide consisting of seven CAG repeats (DPEP3.8). In one embodiment, this conjugate increases penetration into muscle tissue. Suitably, increasing penetration into muscle can be used to treat muscle disorders.

[0301] In one embodiment, the conjugate comprises the peptide carrier RBRRBRFQILYRBHBH (SEQ ID NO: 44) covalently linked via glutamic acid (E) to an antisense oligonucleotide consisting of seven CAG repeats. (DPEP.3.8b) In one embodiment, this conjugate increases penetration into diaphragmatic tissue. Suitably, increasing penetration into the diaphragm can be used to treat muscle disorders affecting the respiratory system, such as myotonic dystrophy.

[0302] Any of the above conjugates may be acetylated at the N-terminus.

[0303] Pharmaceutical compositions and administration

[0304] The conjugates of the present invention can be formulated into pharmaceutical compositions as described above.

[0305] According to the sixth aspect of the present invention, the pharmaceutical composition comprises the conjugate of the present invention.

[0306] Suitably, the pharmaceutical composition may further comprise one or more pharmaceutically acceptable components, such as one or more diluents, adjuvants or carriers.

[0307] Suitable pharmaceutically acceptable diluents, adjuvants and carriers are well known in the art.

[0308] As used herein, the phrase "pharmaceutically acceptable" refers to those ligands, materials, formulations and / or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problems or complications, commensurate with a reasonable benefit / risk ratio.

[0309] As used herein, the phrase "pharmaceutically acceptable carrier" refers to a pharmaceutically acceptable material, formulation, or vehicle, such as a liquid or solid filler, diluent, excipient, solvent, or encapsulating material, that is involved in carrying or transporting the conjugate from one organ or part of the body to another organ or part of the body. Each peptide must be "acceptable" in the sense of being compatible with the other components of the composition (e.g., peptide and therapeutic molecule) and not deleterious to the individual.

[0310] Lyophilized compositions that can be reconstituted and administered are also within the scope of the compositions of the present invention.

[0311] Pharmaceutically acceptable carriers can be, for example, excipients, vehicles, diluents, and combinations thereof. For example, when the compositions are administered orally, they can be formulated into tablets, capsules, granules, powders, or syrups; or when used for parenteral administration, they can be formulated into injections, drip preparations, or suppositories. These compositions can be prepared by conventional methods, and if desired, the active compound (i.e., the conjugate) can be mixed with any conventional additives, such as excipients, binders, disintegrants, lubricants, flavoring agents, solubilizers, suspending agents, emulsifiers, coating agents, or combinations thereof.

[0312] It is understood that the pharmaceutical compositions of the present disclosure may further include other known therapeutic agents, drugs, modifications of the compounds into prodrugs, etc., for medical use to alleviate, regulate, prevent and treat the diseases, disorders and conditions described herein.

[0313] Suitably, the pharmaceutical composition is for use as a medicament. Suitably, it is for use as a medicament in the same manner as the conjugates described herein. All features described herein in relation to medical treatments using the conjugates apply to the pharmaceutical composition.

[0314] Thus, in another aspect of the present invention, there is provided a pharmaceutical composition according to the sixth aspect for use as a medicament. In another aspect, there is provided a method of preventing or treating a disease condition in a subject, comprising administering to the subject an effective amount of the pharmaceutical composition according to the sixth aspect.

[0315] Suitably, wherein the pharmaceutical composition is for use in preventing or treating a trinucleotide disorder, and suitably, wherein the method of prevention or treatment is for a trinucleotide disorder in a subject.

[0316] Prevention or treatment

[0317] The conjugate of the present invention can be used as a drug for preventing or treating a disease, preferably a trinucleotide repeat disorder.

[0318] The medicament may be in the form of a pharmaceutical composition as defined above.

[0319] Also provided is a method of preventing or treating a subject in need of treatment for a disease condition, the method comprising the step of administering to the subject a therapeutically effective amount of the conjugate.

[0320] Suitably, the conjugate is for use in preventing or treating a trinucleotide repeat disorder.

[0321] Details of suitable genes comprising trinucleotide repeat expansions and the trinucleotide repeat disorders resulting therefrom are detailed above.

[0322] Alternatively, the conjugates may be used to prevent or treat other nucleotide repeat disorders. Suitable details of such higher repeat expansions and the nucleotide repeat disorders resulting therefrom are detailed above.

[0323] The specific mechanism by which a nucleic acid formed by trinucleotide repeats acts to treat a trinucleotide repeat disorder will vary depending on the trinucleotide repeat disorder in question. Suitably, the nucleic acid binds to a trinucleotide repeat expansion in a gene or transcript. Suitably, the nucleic acid reduces the level of a transcript comprising a trinucleotide repeat expansion. Suitably, the nucleic acid prevents the pathological effects of the trinucleotide repeat expansion, thereby preventing the trinucleotide repeat disorder. The same applies to other nucleotide repeat disorders.

[0324] Thus, suitably, the conjugate improves the physiological condition of the subject.

[0325] For example, the therapeutic nucleic acid of the conjugate may be operable to correct a splicing defect caused by a trinucleotide repeat disorder. Suitably, the therapeutic nucleic acid of the conjugate may be operable to normalize splicing in a subject suffering from a trinucleotide repeat disorder.

[0326] Suitably, the therapeutic nucleic acid of the conjugate is operable to bind to the transcript of the DMPK gene. Suitably, the therapeutic nucleic acid of the conjugate is operable to bind to the repeat expansion present in the DMPK gene transcript. Suitably, the therapeutic nucleic acid of the conjugate is operable to bind to the CUG repeat expansion present in the DMPK gene transcript.

[0327] Thus, suitably, the conjugate reduces the level of DMPK transcripts. Thus, suitably, the conjugate reduces the level of DMPK transcripts with repeat expansions. Thus, suitably, the conjugate reduces the level of DMPK transcripts with CUG repeat expansions.

[0328] Thus, suitably, the conjugate reduces the number of nuclear foci. Suitably, the conjugate prevents nuclear foci from interacting with the cell's splicing machinery. Suitably, the conjugate prevents nuclear foci from interacting with MBNL1. Suitably, the conjugate prevents nuclear foci from sequestering MBNL1.

[0329] Suitably, these effects are used to prevent or treat DM1.

[0330] Suitably, the conjugate reduces myotonia in a subject with DM1 by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%, 100% compared to a healthy subject. Suitably, the conjugate reduces myotonia in a subject with DM1 by at least 50%. Suitably, the conjugate reduces myotonia in a subject with DM1 by 50-100%.

[0331] Suitably, the conjugate reduces nuclear foci in myoblasts of a subject with DM1 by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 80%, 90%. Suitably, the conjugate reduces nuclear foci in myoblasts of a subject with DM1 by at least 50%. Suitably, the conjugate reduces nuclear foci in myoblasts of a subject with DM1 by 50-90%.

[0332] Suitably, the conjugate corrects cardiac conduction in a subject with DM1 by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%. Suitably, the conjugate improves cardiac conduction in a subject with DM1 by at least 10%. Suitably, the conjugate improves cardiac conduction in a subject with DM1 by 10%-50%.

[0333] Suitably, the conjugate improves motor function in a subject with DM1 by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%. Suitably, the conjugate improves motor function in a subject with DM1 by at least 10%. Suitably, the conjugate improves motor function in a subject with DM1 by 10%-50%.

[0334] Suitably, the conjugate improves muscle strength in a subject with DM1 by 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% relative to body weight. Suitably, the conjugate improves muscle strength in a subject with DM1 by at least 10% relative to body weight. Suitably, the conjugate improves muscle strength in a subject with DM1 by 10%-50% relative to body weight.

[0335] Suitably, the subject to be treated may be any animal or human. Suitably, the subject may be a non-human mammal. Suitably, the subject may be male or female.

[0336] Suitably, the subject to be treated may be of any age. Suitably, the subject to be treated is aged 0-40 years, suitably 0-30 years, suitably 0-25 years, suitably 0-20 years.

[0337] Suitably, the conjugate is for systemic administration to a subject, for example, by the intramedullary, intrathecal, intraventricular, intravitreal, enteral, parenteral, intravenous, intraarterial, intramuscular, intratumoral, subcutaneous oral or nasal routes.

[0338] In one embodiment, the conjugate is for intravenous administration to a subject.

[0339] In one embodiment, the conjugate is for intravenous administration to a subject by injection.

[0340] Suitably, the conjugate is administered to a subject in a "therapeutically effective amount," by which is meant an amount sufficient to show benefit to the individual. The actual amount administered, as well as the rate and time course of administration, will depend on the nature and severity of the disease being treated. Dosage decisions are the responsibility of general practitioners and other physicians. Examples of such techniques and protocols can be found in Remington's Pharmaceutical Sciences, 20th Edition, 2000, pub. Lippincott, Williams & Wilkins.

[0341] Exemplary dosages can be between 0.01 mg / kg and 50 mg / kg, between 0.05 mg / kg and 40 mg / kg, between 0.1 mg / kg and 30 mg / kg, between 0.5 mg / kg and 18 mg / kg, between 1 mg / kg and 16 mg / kg, between 2 mg / kg and 15 mg / kg, between 5 mg / kg and 10 mg / kg, between 10 mg / kg and 20 mg / kg, between 12 mg / kg and 18 mg / kg, between 13 mg / kg and 17 mg / kg.

[0342] Advantageously, the dosage of the conjugate of the invention is an order or magnitude lower than the dosage required to be effective by administering the therapeutic nucleic acid alone.

[0343] Suitably, following administration of the conjugate of the invention, one or more markers of toxicity are significantly reduced compared to conjugates using currently available peptide vectors.

[0344] A suitable marker of toxicity may be a marker of nephrotoxicity.

[0345] Appropriate toxicity markers include serum KIM-1, NGAL, BUN, creatinine, alkaline phosphatase, alanine aminotransferase, and aspartate aminotransferase levels.

[0346] Suitable other markers of toxicity include urine sodium, potassium, chloride, urea, creatinine, calcium, phosphorus, glucose, uric acid, magnesium, and protein levels.

[0347] Suitably, the level of at least one of KIM-1, NGAL and BUN is suitably reduced following administration of the conjugate of the invention when compared to conjugates using currently available peptide vectors.

[0348] Suitably, the levels of each of KIM-1, NGAL and BUN are suitably reduced following administration of the conjugate of the invention when compared to conjugates using currently available peptide vectors.

[0349] Suitably, the level of the or each marker is significantly reduced when compared to conjugates using currently available peptide vectors.

[0350] Suitably, the level of the or each marker is reduced by at most 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% following administration of the conjugate of the invention when compared to conjugates using currently available peptide vectors.

[0351] Advantageously, the conjugates exhibit significantly reduced toxicity compared to existing peptides and conjugates. In particular, KIM-1 and NGAL-1, markers of toxicity, are significantly reduced by up to 120-fold compared to conjugates using currently available peptide vectors.

[0352] Suitably, the conjugate has negligible long-term toxicity. Suitably, the conjugate has no long-term toxic effects.

[0353] Suitably, the conjugate has no significant effect on gene expression in the subject other than the intended effect on the target trinucleotide repeat expansion. Suitably, the conjugate has no negative effect on gene expression in the subject.

[0354] Suitably, following administration of the conjugates of the invention, cell viability is significantly improved compared to conjugates using currently available peptide vectors.

[0355] Suitably, following administration of the conjugate of the invention, myoblast and hepatocyte viability is significantly improved compared to conjugates using currently available peptide vectors. Suitably, following administration of the conjugate of the invention, myoblast and hepatocyte viability is increased by up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% compared to conjugates using currently available peptide vectors.

[0356] Suitably, following administration of the conjugates of the invention, cell survival is significantly improved compared to conjugates using currently available peptide vectors.

[0357] Suitably, recovery time following administration of the conjugate of the invention is reduced by up to 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50% compared to conjugates using currently available peptide vectors.

[0358] Suitably, after administration of the conjugate of the invention, the recovery time is less than 60 minutes, less than 50 minutes, less than 40 minutes, less than 30 minutes, less than 20 minutes, less than 10 minutes or less than 5 minutes. Suitably, after administration of the conjugate of the invention, there is no recovery time.

[0359] Nucleic acids and hosts

[0360] The peptide vectors of the present invention can be prepared by any standard protein synthesis method (eg, chemical synthesis, semi-chemical synthesis) or by using an expression system.

[0361] Therefore, the present invention also relates to nucleotide sequences comprising or consisting of DNA encoding the conjugate, expression systems (e.g., vectors comprising the sequence and sequences required for expression and control of expression), and host cells and host organisms transformed by the expression system.

[0362] Therefore, there is also provided a nucleic acid encoding a conjugate according to the invention.

[0363] Suitably, the nucleic acid may be provided in isolated or purified form.

[0364] Also provided are expression vectors comprising a nucleic acid encoding a conjugate according to the invention.

[0365] Suitably, the vector is a plasmid.

[0366] Suitably, the vector comprises a regulatory sequence (e.g. a promoter) operably linked to a nucleic acid encoding a conjugate according to the invention. Suitably, the expression vector is capable of expressing the conjugate when transfected into a suitable cell (e.g. a mammalian, bacterial or fungal cell).

[0367] Also provided are host cells comprising the expression vectors of the invention.

[0368] The expression vector can be selected based on the host cell into which the nucleic acid of the present invention can be inserted. Such transformation of the host cell involves conventional techniques, such as those taught in Sambrook et al. [Sambrook, J., Russell, D. (2001) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY, USA]. The selection of an appropriate vector is within the ability of those skilled in the art. Suitable vectors include plasmids, bacteriophages, cosmids, and viruses.

[0369] The resulting conjugate can be isolated and purified from the host cells by any suitable method, such as precipitation or chromatography, such as affinity chromatography.

[0370] Appropriate vectors, hosts and recombinant techniques are well known in the art.

[0371] In this specification, the term "operably linked" may include situations in which a selected nucleotide sequence and a regulatory nucleotide sequence are covalently linked in such a manner that expression of the nucleotide coding sequence is under the control of the regulatory sequence, such that the regulatory sequence is able to affect the transcription of the nucleotide coding sequence that forms part or all of the selected nucleotide sequence. The resulting transcript can then be translated into the desired conjugate, where appropriate. SEQUENCE LISTING <110> Oxford University Technology Innovation Co., Ltd. <120> Conjugates and uses thereof <130> P266149GB <160> 121 <170> PatentIn version 3.5 <210> 1 <211> 7 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <400> 1 Arg Xaa Arg Arg Xaa Arg Arg 1 5 <210> 2 <211> 5 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (4)..(4) <223> X is bAla <400> 2 Arg Xaa Arg Xaa Arg 1 5 <210> 3 <211> 4 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <400> 3 Arg Xaa Arg Arg 1 <210> 4 <211> 6 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <400> 4 Arg Xaa Arg Arg Xaa Arg 1 5 <210> 5 <211> 6 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (3)..(3) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <400> 5 Arg Arg Xaa Arg Xaa Arg 1 5 <210> 6 <211> 5 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <400> 6 Arg Xaa Arg Arg Xaa 1 5 <210> 7 <211> 4 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (1)..(1) <223> X is bAla <220> <221> MOD_RES <222> (3)..(3) <223> X is bAla <400> 7 Xaa Arg Xaa Arg 1 <210> 8 <211> 5 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (4)..(4) <223> X is bAla <400> 8 Arg Xaa His Xaa His 1 5 <210> 9 <211> 5 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (4)..(4) <223> X is bAla <400> 9 His Xaa His Xaa Arg 1 5 <210> 10 <211> 7 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <400> 10 Arg Xaa Arg His Xaa His Arg 1 5 <210> 11 <211> 7 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (4)..(5) <223> X is bAla <400> 11 Arg Xaa Arg Xaa Xaa His Arg 1 5 <210> 12 <211> 6 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <400> 12 Arg Xaa Arg Arg Xaa His 1 5 <210> 13 <211> 6 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <400> 13 His Xaa Arg Arg Xaa Arg 1 5 <210> 14 <211> 5 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (4)..(4) <223> X is bAla <400> 14 His Xaa His Xaa His 1 5 <210> 15 <211> 4 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (1)..(1) <223> X is bAla <220> <221> MOD_RES <222> (3)..(3) <223> X is bAla <400> 15 Xaa His Xaa His 1 <210> 16 <211> 5 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (1)..(1) <223> X is bAla <220> <221> MOD_RES <222> (3)..(3) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <400> 16 Xaa Arg Xaa Ser Xaa 1 5 <210> 17 <211> 5 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (1)..(1) <223> X is bAla <220> <221> MOD_RES <222> (3)..(3) <223> X is bAla <220> <221> MOD_RES <222> (4)..(4) <223> X is hydroxyproline <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <400> 17 Xaa Arg Xaa Xaa Xaa 1 5 <210> 18 <211> 6 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is hydroxyproline <220> <221> MOD_RES <222> (4)..(4) <223> X is hydroxyproline <220> <221> MOD_RES <222> (6) <223> X is bAla <400> 18 Arg Xaa His Xaa His Xaa 1 5 <210> 19 <211> 6 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is hydroxyproline <220> <221> MOD_RES <222> (5)..(5) <223> X is hydroxyproline <400> 19 Arg Xaa Arg Arg Xaa Arg 1 5 <210> 20 <211> 5 <212> PRT <213> Artificial sequence <220> <223> peptides <400> 20 Tyr Gln Phe Leu Ile 1 5 <210> twenty one <211> 5 <212> PRT <213> Artificial sequence <220> <223> peptides <400> twenty one Phe Gln Ile Leu Tyr 1 5 <210> twenty two <211> 5 <212> PRT <213> Artificial sequence <220> <223> peptides <400> twenty two Ile Leu Phe Gln Tyr 1 5 <210> twenty three <211> 4 <212> PRT <213> Artificial sequence <220> <223> peptides <400> twenty three Phe Gln Ile Tyr 1 <210> twenty four <211> 5 <212> PRT <213> Artificial sequence <220> <223> peptides <400> twenty four Trp Trp Pro Trp Trp 1 5 <210> 25 <211> 4 <212> PRT <213> Artificial sequence <220> <223> peptides <400> 25 Trp Pro Trp Trp 1 <210> 26 <211> 4 <212> PRT <213> Artificial sequence <220> <223> peptides <400> 26 Trp Trp Pro Trp 1 <210> 27 <211> 17 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <220> <221> MOD_RES <222> (16)..(16) <223> X is bAla <400> 27 Arg Xaa Arg Arg Xaa Arg Arg Phe Gln Ile Leu Tyr Arg Xaa Arg Xaa 1 5 10 15 Arg <210> 28 <211> 16 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <400> 28 Arg Xaa Arg Arg Xaa Arg Arg Phe Gln Ile Leu Tyr Arg Xaa Arg Arg 1 5 10 15 <210> 29 <211> 17 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <220> <221> MOD_RES <222> (16) <223> X is bAla <400> 29 Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Arg Arg Xaa Arg Xaa 1 5 10 15 Arg <210> 30 <211> 17 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (4)..(4) <223> X is bAla <220> <221> MOD_RES <222> (12)..(12) <223> X is bAla <220> <221> MOD_RES <222> (15)..(15) <223> X is bAla <400> 30 Arg Xaa Arg Xaa Arg Phe Gln Ile Leu Tyr Arg Xaa Arg Arg Xaa Arg 1 5 10 15 Arg <210> 31 <211> 17 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <220> <221> MOD_RES <222> (16) <223> X is bAla <400> 31 Arg Xaa Arg Arg Xaa Arg Arg Tyr Gln Phe Leu Ile Arg Xaa Arg Xaa 1 5 10 15 Arg <210> 32 <211> 17 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <220> <221> MOD_RES <222> (16) <223> X is bAla <400> 32 Arg Xaa Arg Arg Xaa Arg Arg Ile Leu Phe Gln Tyr Arg Xaa Arg Xaa 1 5 10 15 Arg <210> 33 <211> 16 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (13) <223> X is bAla <220> <221> MOD_RES <222> (15)..(15) <223> X is bAla <400> 33 Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Arg Xaa Arg Xaa Arg 1 5 10 15 <210> 34 <211> 16 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (12)..(12) <223> X is bAla <220> <221> MOD_RES <222> (15)..(15) <223> X is bAla <400> 34 Arg Xaa Arg Arg Xaa Phe Gln Ile Leu Tyr Arg Xaa Arg Arg Xaa Arg 1 5 10 15 <210> 35 <211> 15 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (12)..(12) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <400> 35 Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Xaa Arg Xaa Arg 1 5 10 15 <210> 36 <211> 15 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (12)..(12) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <400> 36 Arg Xaa Arg Arg Xaa Phe Gln Ile Leu Tyr Arg Xaa Arg Xaa Arg 1 5 10 15 <210> 37 <211> 17 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <220> <221> MOD_RES <222> (16) <223> X is bAla <400> 37 Arg Xaa Arg Arg Xaa Arg Arg Phe Gln Ile Leu Tyr Arg Xaa His Xaa 1 5 10 15 His <210> 38 <211> 17 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <220> <221> MOD_RES <222> (16)..(16) <223> X is bAla <400> 38 Arg Xaa Arg Arg Xaa Arg Arg Phe Gln Ile Leu Tyr His Xaa His Xaa 1 5 10 15 Arg <210> 39 <211> 17 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <220> <221> MOD_RES <222> (16)..(16) <223> X is bAla <400> 39 Arg Xaa Arg Arg Xaa Arg Arg Phe Gln Ile Leu Tyr His Xaa Arg Xaa 1 5 10 15 His <210> 40 <211> 17 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <220> <221> MOD_RES <222> (16)..(16) <223> X is bAla <400> 40 Arg Xaa Arg Arg Xaa Arg Arg Tyr Gln Phe Leu Ile Arg Xaa His Xaa 1 5 10 15 His <210> 41 <211> 17 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <220> <221> MOD_RES <222> (16) <223> X is bAla <400> 41 Arg Xaa Arg Arg Xaa Arg Arg Ile Leu Phe Gln Tyr Arg Xaa His Xaa 1 5 10 15 His <210> 42 <211> 17 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <220> <221> MOD_RES <222> (16)..(16) <223> X is bAla <400> 42 Arg Xaa Arg His Xaa His Arg Phe Gln Ile Leu Tyr Arg Xaa Arg Xaa 1 5 10 15 Arg <210> 43 <211> 17 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (4)..(4) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <220> <221> MOD_RES <222> (16)..(16) <223> X is bAla <400> 43 Arg Xaa Arg Xaa Xaa His Arg Phe Gln Ile Leu Tyr Arg Xaa His Xaa 1 5 10 15 His <210> 44 <211> 16 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (13) <223> X is bAla <220> <221> MOD_RES <222> (15)..(15) <223> X is bAla <400> 44 Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Arg Xaa His Xaa His 1 5 10 15 <210> 45 <211> 16 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (13)..(13) <223> X is bAla <220> <221> MOD_RES <222> (15)..(15) <223> X is bAla <400> 45 Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr His Xaa His Xaa His 1 5 10 15 <210> 46 <211> 16 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (13)..(13) <223> X is bAla <220> <221> MOD_RES <222> (15)..(15) <223> X is bAla <400> 46 Arg Xaa Arg Arg Xaa His Phe Gln Ile Leu Tyr Arg Xaa His Xaa His 1 5 10 15 <210> 47 <211> 16 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (13)..(13) <223> X is bAla <220> <221> MOD_RES <222> (15)..(15) <223> X is bAla <400> 47 His Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Arg Xaa His Xaa His 1 5 10 15 <210> 48 <211> 15 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (12)..(12) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <400> 48 Arg Xaa Arg Arg Xaa Phe Gln Ile Leu Tyr Arg Xaa His Xaa His 1 5 10 15 <210> 49 <211> 15 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (12)..(12) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <400> 49 Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Xaa His Xaa His 1 5 10 15 <210> 50 <211> 16 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (13) <223> X is bAla <220> <221> MOD_RES <222> (15)..(15) <223> X is bAla <400> 50 Arg Xaa Arg Arg Xaa Arg Tyr Gln Phe Leu Ile His Xaa His Xaa His 1 5 10 15 <210> 51 <211> 16 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (13)..(13) <223> X is bAla <220> <221> MOD_RES <222> (15)..(15) <223> X is bAla <400> 51 Arg Xaa Arg Arg Xaa Arg Ile Leu Phe Gln Tyr His Xaa His Xaa His 1 5 10 15 <210> 52 <211> 17 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <220> <221> MOD_RES <222> (16) <223> X is bAla <400> 52 Arg Xaa Arg Arg Xaa Arg Arg Phe Gln Ile Leu Tyr His Xaa His Xaa 1 5 10 15 His <210> 53 <211> 15 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (12)..(12) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <400> 53 Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Xaa Arg Xaa Ser 1 5 10 15 <210> 54 <211> 15 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (12)..(12) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <220> <221> MOD_RES <222> (15)..(15) <223> x Hydroxyproline <400> 54 Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Xaa Arg Xaa Xaa 1 5 10 15 <210> 55 <211> 15 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (12)..(12) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is hydroxyproline <400> 55 Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Xaa Arg Xaa Arg 1 5 10 15 <210> 56 <211> 16 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (3)..(3) <223> X is bAla <220> <221> MOD_RES <222> (6) <223> X is bAla <220> <221> MOD_RES <222> (13) <223> X is bAla <220> <221> MOD_RES <222> (15)..(15) <223> X is bAla <400> 56 Arg Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Xaa Arg Xaa Arg 1 5 10 15 <210> 57 <211> 15 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (1)..(1) <223> X is bAla <220> <221> MOD_RES <222> (4)..(4) <223> X is bAla <220> <221> MOD_RES <222> (12)..(12) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <400> 57 Xaa Arg Arg Xaa Arg Arg Phe Gln Ile Leu Tyr Xaa Arg Xaa Arg 1 5 10 15 <210> 58 <211> 13 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (10)..(10) <223> X is bAla <220> <221> MOD_RES <222> (12)..(12) <223> X is bAla <400> 58 Arg Xaa Arg Arg Xaa Arg Trp Trp Trp Xaa Arg Xaa Arg 1 5 10 <210> 59 <211> 15 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (12)..(12) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <400> 59 Arg Xaa Arg Arg Xaa Arg Trp Trp Pro Trp Trp Xaa Arg Xaa Arg 1 5 10 15 <210> 60 <211> 14 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (11)..(11) <223> X is bAla <220> <221> MOD_RES <222> (13)..(13) <223> X is bAla <400> 60 Arg Xaa Arg Arg Xaa Arg Trp Pro Trp Trp Xaa Arg Xaa Arg 1 5 10 <210> 61 <211> 14 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (11)..(11) <223> X is bAla <220> <221> MOD_RES <222> (13)..(13) <223> X is bAla <400> 61 Arg Xaa Arg Arg Xaa Arg Trp Trp Pro Trp Xaa Arg Xaa Arg 1 5 10 <210> 62 <211> 15 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (12)..(12) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <400> 62 Arg Xaa Arg Arg Xaa Arg Arg Trp Trp Trp Arg Xaa Arg Xaa Arg 1 5 10 15 <210> 63 <211> 17 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <220> <221> MOD_RES <222> (16) <223> X is bAla <400> 63 Arg Xaa Arg Arg Xaa Arg Arg Trp Trp Pro Trp Trp Arg Xaa Arg Xaa 1 5 10 15 Arg <210> 64 <211> 16 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (13)..(13) <223> X is bAla <220> <221> MOD_RES <222> (15)..(15) <223> X is bAla <400> 64 Arg Xaa Arg Arg Xaa Arg Arg Trp Pro Trp Trp Arg Xaa Arg Xaa Arg 1 5 10 15 <210> 65 <211> 16 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (13)..(13) <223> X is bAla <220> <221> MOD_RES <222> (15)..(15) <223> X is bAla <400> 65 Arg Xaa Arg Arg Xaa Arg Arg Trp Trp Pro Trp Arg Xaa Arg Xaa Arg 1 5 10 15 <210> 66 <211> 16 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (13)..(13) <223> X is bAla <220> <221> MOD_RES <222> (15)..(15) <223> X is bAla <400> 66 Arg Xaa Arg Arg Xaa Arg Arg Phe Gln Ile Leu Tyr Xaa Arg Xaa Arg 1 5 10 15 <210> 67 <211> 15 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <400> 67 Arg Xaa Arg Arg Xaa Arg Arg Phe Gln Ile Leu Tyr Arg Xaa Arg 1 5 10 15 <210> 68 <211> 16 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (1)..(1) <223> X is bAla <220> <221> MOD_RES <222> (3)..(3) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (12)..(12) <223> X is bAla <220> <221> MOD_RES <222> (15)..(15) <223> X is bAla <400> 68 Xaa Arg Xaa Arg Xaa Trp Trp Pro Trp Trp Arg Xaa Arg Arg Xaa Arg 1 5 10 15 <210> 69 <211> 16 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (13)..(13) <223> X is bAla <220> <221> MOD_RES <222> (15)..(15) <223> X is bAla <400> 69 Arg Xaa Arg Arg Xaa Arg Arg Phe Gln Ile Leu Tyr Xaa His Xaa His 1 5 10 15 <210> 70 <211> 16 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (13) <223> X is bAla <220> <221> MOD_RES <222> (15)..(15) <223> X is bAla <400> 70 Arg Xaa Arg Arg Xaa Arg Arg Phe Gln Ile Tyr Arg Xaa His Xaa His 1 5 10 15 <210> 71 <211> 15 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (12)..(12) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <400> 71 Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Xaa Arg Xaa His 1 5 10 15 <210> 72 <211> 16 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (13)..(13) <223> X is hydroxyproline <220> <221> MOD_RES <222> (15)..(15) <223> X is hydroxyproline <400> 72 Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Arg Xaa His Xaa His 1 5 10 15 <210> 73 <211> 16 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is hydroxyproline <220> <221> MOD_RES <222> (5)..(5) <223> X is hydroxyproline <220> <221> MOD_RES <222> (13) <223> X is bAla <220> <221> MOD_RES <222> (15)..(15) <223> X is bAla <400> 73 Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Arg Xaa His Xaa His 1 5 10 15 <210> 74 <211> 16 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is hydroxyproline <220> <221> MOD_RES <222> (5)..(5) <223> X is hydroxyproline <220> <221> MOD_RES <222> (13) <223> X is hydroxyproline <220> <221> MOD_RES <222> (15)..(15) <223> X is hydroxyproline <400> 74 Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Arg Xaa His Xaa His 1 5 10 15 <210> 75 <211> 14 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (11)..(11) <223> X is bAla <220> <221> MOD_RES <222> (13) <223> X is bAla <400> 75 Arg Xaa Arg Arg Xaa Arg Trp Trp Trp Arg Xaa His Xaa His 1 5 10 <210> 76 <211> 14 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (11)..(11) <223> X is bAla <220> <221> MOD_RES <222> (13) <223> X is bAla <400> 76 Arg Xaa Arg Arg Xaa Arg Trp Trp Pro Arg Xaa His Xaa His 1 5 10 <210> 77 <211> 14 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (11)..(11) <223> X is bAla <220> <221> MOD_RES <222> (13) <223> X is bAla <400> 77 Arg Xaa Arg Arg Xaa Arg Pro Trp Trp Arg Xaa His Xaa His 1 5 10 <210> 78 <211> 16 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (13) <223> X is bAla <220> <221> MOD_RES <222> (15)..(15) <223> X is bAla <400> 78 Arg Xaa Arg Arg Xaa Arg Trp Trp Pro Trp Trp Arg Xaa His Xaa His 1 5 10 15 <210> 79 <211> 15 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (12)..(12) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <400> 79 Arg Xaa Arg Arg Xaa Arg Trp Trp Pro Trp Arg Xaa His Xaa His 1 5 10 15 <210> 80 <211> 15 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (12)..(12) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <400> 80 Arg Xaa Arg Arg Xaa Arg Trp Pro Trp Trp Arg Xaa His Xaa His 1 5 10 15 <210> 81 <211> 15 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (12)..(12) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <400> 81 Arg Xaa Arg Arg Xaa Arg Arg Trp Trp Trp Arg Xaa His Xaa His 1 5 10 15 <210> 82 <211> 17 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <220> <221> MOD_RES <222> (16) <223> X is bAla <400> 82 Arg Xaa Arg Arg Xaa Arg Arg Trp Trp Pro Trp Trp Arg Xaa His Xaa 1 5 10 15 His <210> 83 <211> 16 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (13)..(13) <223> X is bAla <220> <221> MOD_RES <222> (15)..(15) <223> X is bAla <400> 83 Arg Xaa Arg Arg Xaa Arg Arg Trp Pro Trp Trp Arg Xaa His Xaa His 1 5 10 15 <210> 84 <211> 16 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (13) <223> X is bAla <220> <221> MOD_RES <222> (15)..(15) <223> X is bAla <400> 84 Arg Xaa Arg Arg Xaa Arg Arg Trp Trp Pro Trp Arg Xaa His Xaa His 1 5 10 15 <210> 85 <211> 17 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (3)..(3) <223> X is bAla <220> <221> MOD_RES <222> (6) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <220> <221> MOD_RES <222> (16)..(16) <223> X is bAla <400> 85 Arg Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Arg Xaa His Xaa 1 5 10 15 His <210> 86 <211> 16 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (1)..(1) <223> X is bAla <220> <221> MOD_RES <222> (4)..(4) <223> X is bAla <220> <221> MOD_RES <222> (13) <223> X is bAla <220> <221> MOD_RES <222> (15)..(15) <223> X is bAla <400> 86 Xaa Arg Arg Xaa Arg Arg Phe Gln Ile Leu Tyr Arg Xaa His Xaa His 1 5 10 15 <210> 87 <211> 16 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (3)..(3) <223> X is bAla <220> <221> MOD_RES <222> (6) <223> X is bAla <220> <221> MOD_RES <222> (13)..(13) <223> X is bAla <220> <221> MOD_RES <222> (15)..(15) <223> X is bAla <400> 87 Arg Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Xaa His Xaa His 1 5 10 15 <210> 88 <211> 15 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (1)..(1) <223> X is bAla <220> <221> MOD_RES <222> (4)..(4) <223> X is bAla <220> <221> MOD_RES <222> (12)..(12) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <400> 88 Xaa Arg Arg Xaa Arg Arg Phe Gln Ile Leu Tyr Xaa His Xaa His 1 5 10 15 <210> 89 <211> 17 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MOD_RES <222> (2)..(2) <223> X is bAla <220> <221> MOD_RES <222> (5)..(5) <223> X is bAla <220> <221> MOD_RES <222> (14)..(14) <223> X is bAla <220> <221> MOD_RES <222> (16) <223> X is bAla <400> 89 Arg Xaa Arg Arg Xaa His Arg Phe Gln Ile Leu Tyr Arg Xaa His Xaa 1 5 10 15 His <210> 90 <211> 15 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MISC_FEATURE <222> (2)..(2) <223> X is bAla <220> <221> MISC_FEATURE <222> (5)..(5) <223> X is bAla <220> <221> MISC_FEATURE <222> (12)..(12) <223> X is hydroxyproline <220> <221> MISC_FEATURE <222> (14)..(14) <223> X is hydroxyproline <400> 90 Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Xaa Arg Xaa Arg 1 5 10 15 <210> 91 <211> 15 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MISC_FEATURE <222> (2)..(2) <223> X is hydroxyproline <220> <221> MISC_FEATURE <222> (5)..(5) <223> X is hydroxyproline <220> <221> MISC_FEATURE <222> (12)..(12) <223> X is bAla <220> <221> MISC_FEATURE <222> (14)..(14) <223> X is bAla <400> 91 Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Xaa Arg Xaa Arg 1 5 10 15 <210> 92 <211> 15 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MISC_FEATURE <222> (2)..(2) <223> X is hydroxyproline <220> <221> MISC_FEATURE <222> (5)..(5) <223> X is hydroxyproline <220> <221> MISC_FEATURE <222> (12)..(12) <223> X is hydroxyproline <220> <221> MISC_FEATURE <222> (14)..(14) <223> X is hydroxyproline <400> 92 Arg Xaa Arg Arg Xaa Arg Phe Gln Ile Leu Tyr Xaa Arg Xaa Arg 1 5 10 15 <210> 93 <211> 13 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MISC_FEATURE <222> (2)..(2) <223> X is bAla <220> <221> MISC_FEATURE <222> (5)..(5) <223> X is bAla <220> <221> MISC_FEATURE <222> (10)..(10) <223> X is bAla <220> <221> MISC_FEATURE <222> (12)..(12) <223> X is bAla <400> 93 Arg Xaa Arg Arg Xaa Arg Trp Trp Trp Xaa Arg Xaa Arg 1 5 10 <210> 94 <211> 15 <212> PRT <213> Artificial sequence <220> <223> peptides <220> <221> MISC_FEATURE <222> (2)..(2) <223> X is bAla <220> <221> MISC_FEATURE <222> (5)..(5) <223> X is bAla <220> <221> MISC_FEATURE <222> (12)..(12) <223> X is bAla <220> <221> MISC_FEATURE <222> (14)..(14) <223> X is bAla <400> 94 Arg Xaa Arg Arg Xaa Arg Trp Trp Pro Trp Trp Xaa Arg Xaa Arg 1 5 10 15 <210> 95 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> 21-mer PMO antisense sequence <400> 95 cagcagcagc agcagcagca g 21 <210> 96 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Phosphorothioate probes <220> <221> misc_feature <222> (1)..(1) <223> Labeled with digoxigenin <220> <221> misc_feature <222> (21)..(21) <223> Labeling with biotin <400> 96 ctgctgctgc tgctgctgct g 21 <210> 97 <211> 11 <212> PRT <213> Artificial sequence <220> <223> D-PEP 5.70 <220> <221> MISC_FEATURE <222> (2)..(2) <223> X is bAla <220> <221> MISC_FEATURE <222> (4)..(4) <223> X is bAla <220> <221> MISC_FEATURE <222> (6) <223> Glycosylated serine residues <220> <221> MISC_FEATURE <222> (8) <223> X is bAla <220> <221> MISC_FEATURE <222> (10)..(10) <223> X is bAla <400> 97 Arg Xaa Arg Xaa Arg Ser Arg Xaa Arg Xaa Arg 1 5 10 <210> 98 <211> twenty one <212> PRT <213> Artificial sequence <220> <223> Pip6a <220> <221> MISC_FEATURE <222> (2)..(2) <223> X is aminocaproic acid <220> <221> MISC_FEATURE <222> (5)..(5) <223> X is bAla <220> <221> MISC_FEATURE <222> (8) <223> X is aminocaproic acid <220> <221> MISC_FEATURE <222> (16) <223> X is aminocaproic acid <220> <221> MISC_FEATURE <222> (18) <223> X is bAla <220> <221> MISC_FEATURE <222> (20)..(20) <223> X is aminocaproic acid <400> 98 Arg Xaa Arg Arg Xaa Arg Arg Xaa Arg Tyr Gln Phe Leu Ile Arg Xaa 1 5 10 15 Arg Xaa Arg Xaa Arg 20 <210> 99 <211> 17 <212> PRT <213> Artificial sequence <220> <223> Pip9b2 <220> <221> MISC_FEATURE <222> (2)..(2) <223> X is aminocaproic acid <220> <221> MISC_FEATURE <222> (5)..(5) <223> X is bAla <220> <221> MISC_FEATURE <222> (14)..(14) <223> X is bAla <220> <221> MISC_FEATURE <222> (16)..(16) <223> X is aminocaproic acid <400> 99 Arg Xaa Arg Arg Xaa Arg Arg Phe Gln Ile Leu Tyr Arg Xaa Arg Xaa 1 5 10 15 Arg <210> 100 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Primer Mbnl1.F <400> 100 gctgcccaat accaggtcaa c 21 <210> 101 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Primer Mbnl1.R <400> 101 tggtgggaga aatgctgtat gc 22 <210> 102 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Primer Clcn1.F <400> 102 ttcacatcgc cagcatctgt gc 22 <210> 103 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primer Clcn1.R <400> 103 cacggaacac aaaggcactg aatgt 25 <210> 104 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Primer Serca.F <400> 104 gctcatggtc ctcaagatct cac 23 <210> 105 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primer Serca.R <400> 105 gggtcagtgc ctcagctttg 20 <210> 106 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Primer Ldb3.F <400> 106 ggaagatgag gctgatgagt gg 22 <210> 107 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Primer Ldb3.R <400> 107 tgctgacagt ggtagtgctc tttc 24 <210> 108 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Primer BIN.F <400> 108 agaacctcaa tgatgtgctg g 21 <210> 109 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Primer BIN.R <400> 109 tcgtgttgac tctgatctcg g 21 <210> 110 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primer DMD.F <400> 110 ttagaggagg tgatggagca 20 <210> 111 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primer DMD.R <400> 111 gatactaagg actccatcgc 20 <210> 112 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primer INSR.F <400> 112 ccaaagacag actctcagat 20 <210> 113 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primer INSR.R <400> 113 aacatcgcca agggacctgc 20 <210> 114 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Primer LDB3.F <400> 114 gcaagaccct gatgaagaag ctc 23 <210> 115 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Primer LDB3.R <400> 115 gacagaaggc cggatgctg 19 <210> 116 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primer SERCA.F <400> 116 atcttcaagc tccgggccct 20 <210> 117 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primer SERCA.R <400> 117 cagctctgcc tgaagatgtg 20 <210> 118 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Primer SOS1.F <400> 118 cagtaccaca gatgtttgca gtg 23 <210> 119 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Primer SOS1.R <400> 119 tctggtcgtc ttcgtggagg aa 22 <210> 120 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Primer TNNT2.F <400> 120 atagaagagg tggtggaaga gtac 24 <210> 121 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Primer TNNT2.R <400> 121 gtctcagcct ctgcttcagc atcc 24 BRIEF DESCRIPTION OF THE DRAWINGS

[0372] The invention will now be described with reference to the following drawings and examples, in which:

[0373] Figure 1 Figure 3 shows a reduction in the number of pathogenic nuclear foci and redistribution of MBNL in DM1 patient myoblasts with 2600 CTG repeats. Results show that different doses of DPEP1 / 3-[CAG]7PMO conjugate do not reduce cell viability of myoblasts or hepatocytes 48 hours after transfection (shown at 10 uM).

[0374] Figure 2A , B, C, D and E and Figure 3A , B, C, and D show that different DPEP1 / 3-[CAG]7PMO conjugates corrected the splicing defect of Mbnl-dependent transcripts in DM1 patient myoblasts derived from a DM1 patient with 2600 repeats in the DMPK gene at various concentrations, compared to conjugates formed using existing peptide vectors Pip6a and Pip9b2.

[0375] Figure 4Systemic delivery of different DPEP1 / 3-[CAG]7 PMO conjugates at 30 mg / kg (intravenous, tail vein) corrected splicing defects of Mbnl-dependent transcripts in the gastrocnemius and quadriceps femoris muscles of HSA-LR mice. RT-PCR analysis of splicing of clcn1 exon 7a, serca exon 22, and mbnl1 exon 5 (the most widely used DM1 biomarkers) showed that splicing normalized to wild-type levels for the DPEP1 and 3-based conjugates. Data from six HSA-LR mice per peptide-PMO were analyzed by ANOVA with Tukey's post hoc test compared to untreated HSA-LR mice. Data are mean ± SEM (*p < 0.05, **p < 0.01, ***p < 0.001, ns not significant).

[0376] Figure 5 The figure shows the percentage of myoblast cell viability 48 hours after transfection of DM1 patient myoblasts, which have 2600 CTG repeats, with various doses of different DPEP1 / 3-[CAG]7PMO conjugates. Compared to conjugates formed with existing peptide vectors Pip6a and Pip9b2, the DPEP1 / 3-[CAG]7PMO conjugate concentration can be increased several-fold from therapeutic levels without causing cell death in myoblasts.

[0377] Figure 6 The figure shows the percentage of hepatocyte cell viability 48 hours after transfection of DM1 patient myoblasts with 2600 CTG repeats with different DPEP1 / 3-[CAG]7 conjugates and comparative conjugates. Compared to conjugates formed with existing peptide vectors Pip6a and Pip9b2, the concentration of DPEP1 / 3-[CAG]7 PMO conjugates can be increased several-fold from therapeutic levels without causing cell death in hepatocytes.

[0378] Figure 7 and Figure 9 Shown are electromyographic myotonia measurements of the gastrocnemius muscle of HSA-LR mice 2 weeks after a single dose of different DPEP1 / 3-[CAG]7PMO conjugates (30 mg / kg, n=6, intravenous injection, tail vein). The data were analyzed by ANOVA and Tukey post hoc test and compared with untreated HAS-LR mice and the comparison conjugate with DPEP5.7. Data are mean ± SEM (*p<0.05, **p<0.01, ***p<0.001, ns not significant). Figure 10 shows detailed data for individual tests.

[0379] Figure 8Shown are the changes in HSA-LR mice 2 weeks after a single dose of different DPEP1 / 3-[CAG]7PMO conjugates (30 mg / kg, n=6, i.v., tail vein). Figure 8 The corresponding myotonia grade measurements of the data in 10. Data were analyzed by unpaired Student's t-test and compared with untreated HSA-LR mice and the comparative conjugate with DPEP5.7. Data are mean ± SEM.

[0380] Figure 10A A, B, and C show ALP, ALT, and AST levels assessed in serum from C57BL6 female mice (8-10 weeks old, n=5 per group) that were injected intravenously (tail vein) with different DPEP1 / 3-[CAG]7PMO conjugates. Serum was collected 7 days after injection, compared to saline. ALP, ALT, and AST levels were similar to saline control injections, compared to the fold increases induced by the existing Pip series peptide vectors.

[0381] Figure 11 A shows KIM-1 levels assessed in urine and serum on days 2 and 7 after injection of various DPEP1 / 3-[CAG]7PMO conjugates into C57BL6 female mice. This was measured by ELISA (R&D cat#MKM100) using samples diluted to fit within the standard curve. Values ​​were normalized to urine creatinine levels (Harwell) to calculate urine protein concentration. Compared to the fold increase induced by existing Pip series peptide vectors, KIM-1 levels were similar to saline control injections.

[0382] Figure 11 B and C show BUN and creatinine levels assessed in serum of C57BL6 female mice (Harwell) on day 7 after injection of different DPEP1 / 3-[CAG]7PMO conjugates compared to saline injection. BUN and creatinine levels were similar to saline control injections, compared to the fold increase induced by the existing Pip series peptide vectors.

[0383] Figure 12 and 13 Shown are KIM-1 / creatinine ratios assessed in urine on days 2, 7, and 14 after administration of DPEP3.8-[CAG]7PMO conjugates by injection to C57BL6 female mice at 30 mg / kg or 6 doses of 5 mg / kg, compared to saline injections. Creatinine and KIM-1 levels were similar to saline control injections, compared to the fold increases induced by existing Pip series peptide vectors.

[0384] Figure 14AA, B, C, and D show the levels of urinary sodium, potassium, chloride, urea, creatinine, calcium, phosphorus, glucose, uric acid, magnesium, and protein in urine after administration of different DPEP1 / 3-[CAG]7PMO conjugates at 5, 7.5, and 30 mg / kg by injection to C57BL6 female mice (8-12 weeks old, n=5 per group) compared to saline injection. Error bars represent SEM.

[0385] Figure 15 The body weight of HSA-LR mice after treatment with DPEP3.8-[CAG]7PMO conjugate is shown. Compared with 5 HSA-LR mice injected with saline, 5 HSA-LR mice injected with a single dose of 30 mg / kg did not show any significant decrease in long-term body weight.

[0386] Figure 16 Shown is a biodistribution delivery analysis of different DPEP1 / 3-[CAG]7PMO conjugates measured by ELISA two weeks after administration of 30 mg / kg conjugate or 3x200 mg / kg bare PMO in HSA-LR mice (intravenous injection). Evaluation of the biodistribution of DPEP1.9 and DPEP3.8 conjugates revealed optimal delivery to severely affected tissues in DM1. PMO was detected by a custom ELISA assay using probes labeled with digoxigenin and biotin. After two weeks of treatment, the concentration of PMO in muscle tissue was still >1 nM, while the pM detected after bare PMO injection was lower (although the molar concentration difference between bare PMO and DPEP-PMO conjugate treatment was >20-fold) (n=4). Data are expressed as mean + / - SEM. Statistics: One-way ANOVA with Tukey's post hoc test.

[0387] Figure 17 Shown are the pharmacokinetic properties of various DPEP1 / 3-[CAG]7PMO conjugates measured in serum following a single 5 mg / kg dose. A custom ELISA was used to quantify serum concentrations, which reached 500-800 nM 5 minutes after intravenous injection at 5 mg / kg, decreasing to 100 nM after 1 hour and 10 nM after 3 hours. Concentrations were approximately 1 nM 6 hours after treatment, indicating that most of the compound had been cleared or delivered to the tissue of interest.

[0388] Figure 18AA, B, C, and D show in more detail that systemic delivery of different DPEP1 / 3-[CAG]7PMO conjugates corrected splicing defects of Mbnl-dependent transcripts in the gastrocnemius muscle of HSA-LR mice. RT-PCR analysis of splicing of Clcn1 exon 7a, Serca exon 22, Mbnl1 exon 5, and Ldb3 exon 11 showed that splicing was normalized to wild-type levels using 30 and 40 mg / kg of DPEP1.9- and DPEP3.8-based conjugates. Splicing correction persisted for at least 3 months after treatment and was also significant after a single low dose (5 and 7.5 mg / kg) (boxes indicate data distribution into quartiles, mean values ​​are highlighted, error bars indicate variability outside the upper and lower quartiles, n=5 per group).

[0389] Figure 19 A, B and C show that after a single dose of 30 or 40 mg / kg of a conjugate based on DPEP1.9 and DPEP3.8, the myotonia grade of HSA-LR mice was corrected to wild-type levels (from 4 to 0). This correction lasted for at least 3 months after treatment (A). When the dose was distributed over four injections (4×7.5 mg / kg), myotonia was reduced to 50% (B), while reducing the dose to 4×5 mg / kg reduced myotonia by 20-25% (C) two weeks after the last injection (error bars represent SEM); (n=6, intravenous injection, tail vein).

[0390] Figure 20 Toxicology screening of serum and urine 2 days and 1 week after intravenous administration of different DPEP1 / 3-[CAG]7PMO conjugates in HSA-LR mice (8-12 weeks old, n=5 per group) shows no significant changes at doses that normalize the phenotype of HSA-LR mice. KIM1 levels were significantly altered only after treatment with 30 mg / kg or 40 mg / kg of DPEP1.9, DPEP3.8, DPEP3.1, and DPEP3.1b, and only 2 days after treatment, compared to saline-treated HSA-LR mice. Error bars represent SEM.

[0391] Figure 21The DM1 phenotype (myotonia) was corrected in HSA-LR mice within a few weeks after the first injection of various administration schedules, including: four doses of 5 mg / kg of DPEP3.8-[CAG]7PMO conjugate, four doses of 7.5 mg / kg of DPEP3.8-[CAG]7PMO conjugate, a single 7.5 mg / kg dose of DPEP3.8-[CAG]7PMO conjugate, a single 30 mg / kg dose of DPEP3.8-[CAG]7PMO conjugate, or a single 40 mg / kg dose of DPEP3.8-[CAG]7PMO conjugate. Treatment with low doses of DPEP3.8-[CAG]7PMO conjugate (5-7.5 mg / kg) was not associated with any toxicity and reduced myotonia.

[0392] Figure 22 The DM1 phenotype (myotonia) was corrected in HSA-LR mice several weeks after the first injection of various administration schedules, including: four doses of 5 mg / kg of DPEP1.9-[CAG]7PMO conjugate, four doses of 7.5 mg / kg of DPEP1.9-[CAG]7PMO conjugate, a single dose of 7.5 mg / kg of DPEP1.9-[CAG]7PMO conjugate, or a single dose of 40 mg / kg of DPEP1.9-[CAG]7PMO conjugate. Treatment with low doses of DPEP1.9-[CAG]7PMO conjugate (5-7.5 mg / kg) that were not associated with any toxicity reduced myotonia.

[0393] Figure 23 The figure shows the concentrations of PMO (pM) in various tissues 2 weeks after intravenous administration of the following substances to HSA-LR mice: naked PMO (3 doses of 200 mg / kg), 30 mg / kg of DPEP3.8-[CAG]7PMO conjugate, 30 mg / kg of DPEP3.8b-[CAG]7PMO conjugate, 7.5 mg / kg of DPEP3.8-[CAG]7PMO conjugate, and 40 mg / kg of DPEP3.8-[CAG]7PMO conjugate. Both peptides (DPEP3.8 and DPEP3.8b) were able to successfully deliver PMO to muscle, reaching concentrations of >6 nM in skeletal muscle.

[0394] Figure 24Shown are the concentrations of PMO (pM) in various tissues after two weeks of IV administration of the following to HSA-LR mice: bare PMO (3 doses of 200 mg / kg), 30 mg / kg of DPEP1.9-[CAG]7PMO conjugate, 30 mg / kg of DPEP1.9b-[CAG]7PMO conjugate, 7.5 mg / kg of DPEP1.9-[CAG]7PMO conjugate, and 40 mg / kg of DPEP1.9-[CAG]7PMO conjugate. Both peptides (DPEP1.9 and DPEP1.9b) were able to successfully deliver PMO to muscle. DPEP1.9b-[CAG]7PMO reached the diaphragm particularly well (>15 nM after a single intravenous injection of 30 mg / kg for two weeks).

[0395] Figure 25 Shown are the concentrations of PMO (pM) in various tissues 2 weeks after intravenous administration of the following substances to HSA-LR mice: naked PMO (3 doses of 200 mg / kg), 30 mg / kg of DPEP3.1-[CAG]7PMO conjugate, 30 mg / kg of DPEP3.1a-[CAG]7PMO conjugate, and 30 mg / kg of DPEP3.1b-[CAG]7PMO conjugate. The three peptides (DPEP3.1, DPEP3.1a, and DPEP3.1b) are able to deliver PMO to skeletal and cardiac muscle (>1 nM).

[0396] Figure 26 、 27 Figures 28 and 29 show a toxicology screen of KIM-1 relative to creatinine levels measured in urine at different times following systemic intravenous administration of different doses of various peptide-[CAG]7PMO conjugates of the present invention in HSA-LR mice compared to saline injection, compared to injection of naked [CAG]7PMO, and compared to injection of Pip peptide-[CAG]7PMO conjugates. The DPEP peptide-[CAG]7PMO conjugates of the present invention maintained low toxicity even at higher doses compared to the Pip6a-[CAG]7PMO conjugate. DPEP conjugates did not affect toxicity biomarkers using a dose regimen that reversed the DM1 phenotype to healthy levels.

[0397] Throughout the description and claims of this specification, the words "comprise" and "include" and their variations mean "including but not limited to", and they are not intended to (and do not) exclude other parts, additives, components, integers or steps. Throughout the description and claims of this specification, the singular includes the plural, unless the context requires otherwise. In particular, where the indefinite article is used, the invention should be understood to encompass both the plural and the singular, unless the context requires otherwise.

[0398] Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith. All features disclosed in this specification (including any accompanying claims, abstract and drawings) and / or all steps of any method or process so disclosed may be combined in any combination, except where at least some of the features and / or steps are mutually exclusive combinations.

[0399] The invention is not limited to the details of any foregoing embodiments. The invention extends to any novel one or any novel combination of the features disclosed in this specification (including any accompanying claims, abstract and drawings), or to any novel one or any novel combination of the steps of any method or process so disclosed. The reader's attention is drawn to all papers and documents filed concurrently with or before this specification in connection with this application, which are open to public inspection with this specification, and the contents of all such papers and documents are incorporated herein by reference.

[0400] Example

[0401] 1. Materials and Methods

[0402] Synthesis and Preparation of P-PMO

[0403] 9-Fluorenylmethoxycarbonyl (Fmoc)-protected L-amino acids, benzotriazol-1-yl-oxy-tripyrrolidinophosphine (PyBOP), 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate (HBTU), and Fmoc-β-Ala-OH were pre-packed on Wang resin (0.19 or 0.46 mmol g -1) was obtained from Merck (Hohenbrunn, Germany). 1-Hydroxy-7-azabenzotriazole (HOAt) was obtained from Sigma-Aldrich. HPLC-grade acetonitrile, methanol, and synthetic-grade N-methyl-2-pyrrolidone (NMP) were purchased from Fisher Scientific (Loughborough, UK). Peptide synthesis-grade N,N-dimethylformamide (DMF) and diethyl ether were obtained from VWR (Leicestershire, UK). Piperidine and trifluoroacetic acid (TFA) were obtained from Alfa Aesar (Heysham, UK). PMO was purchased from Gene Tools Inc. (Philomath, USA). Unless otherwise stated, all other reagents were obtained from Sigma-Aldrich (St. Louis, MO, USA). MALDI-TOF mass spectrometry analyses were performed using a Voyager DE ProBioSpectrometry workstation. 10 mg mL in 50% acetonitrile in water was added. -1 Stock solutions of α-cyano-4-hydroxycinnamic acid or sinapinic acid were used as matrices. Error bars are ±0.1%.

[0404] Synthesis of P-PMO peptides for screening

[0405] a) Preparation of peptide variant library

[0406] Peptides were prepared on a 10 μmol scale using Wang resin (0.19 or 0.46 mmol g-1, Merck Millipore) preloaded with Fmoc-β-Ala-OH by applying standard Fmoc chemistry and following the manufacturer's recommendations, using an Intavis parallel peptide synthesizer or using CEM Liberty Blue TMPeptides were prepared on a 100 μmol scale using a peptide synthesizer (Buckingham, UK). In the case of synthesis using an Intavis parallel peptide synthesizer, a double coupling step was used with a PyBOP / NMM coupling mixture, followed by acetic anhydride capping after each step. For synthesis using a CEM Liberty Blue peptide synthesizer, single standard coupling was used for all amino acids, with the exception of arginine, which was performed by double coupling. The couplings were performed at 75°C for 5 minutes at 60 watts of microwave power, with the exception of arginine residues, each of which was coupled twice. Each deprotection reaction was performed twice at 75°C for 30 seconds, then at 35 watts of microwave power for 3 minutes. Once the synthesis was complete, the resin was washed with DMF (3 x 50 mL), and the N-terminus of the solid-phase bound peptide was acetylated with acetic anhydride at room temperature in the presence of DIPEA. After N-terminal acetylation, the peptide resin was washed with DMF (3 x 20 mL) and DCM (3 x 20 mL). The peptide was separated from the solid support by treatment with a separation mixture consisting of trifluoroacetic acid (TFA): H2O: triisopropylsilane (TIPS) (95%: 2.5%: 2.5%: 3-10 mL) at room temperature for 3 hours. After peptide release, excess TFA was removed by purging with nitrogen. The crude peptide was precipitated by adding cold ether (15-40 mL, depending on the scale of synthesis) and centrifuged at 3200 rpm for 5 minutes. The crude peptide precipitate was washed three times with cold ether (3 × 15 mL) and purified by RP-HPLC using a Varian 940-LC HPLC system equipped with a 445-LC amplification module and a 440-LC fraction collector. The peptide was purified by semi-preparative HPLC on a RP-C18 column (10 x 250 mm, Phenomenex Jupiter) using a linear gradient of CH3CN in 0.1% TFA / H2O at a flow rate of 15 mL min -1 Detection was performed at 220 nm and 260 nm. Fractions containing the desired peptide were pooled and lyophilized to afford the peptide as a white solid (yield see Table 1).

[0407]

[0408]

[0409] Table 1: Synthetic peptides tested in the examples with N-terminal acetylation (Ac), N-terminal succinate linker (Succ), C-terminal β-alanine linker (B), γ-aminobutyric acid linker (Ab), and glutamic acid linker (E). S* is a glucosylated serine residue. Conjugates formed with DPEP5.7, Pip6a, and Pip9b2 are comparable.

[0410] b) Synthetic peptide-PMO conjugate library

[0411] The 21-mer PMO antisense sequence for triplet repeats, CAGCAGCAGCAGCAGCAGCAG (SEQ ID NO. 95), also known as [CAG]7, was used. The PMO sequence targeting the CUG / CTG expanded repeats (5′-CAGCAGCAGCAGCAGCAGCAG-3′ (SEQ ID NO: 95)) was purchased from Gene Tools LLC. This is the [CAG]7 PMO mentioned elsewhere herein. The peptide was conjugated to the 3′ end of the PMO via its C-terminal carboxyl group. This was achieved using 2.5 and 2 equivalents of PyBOP and HOAt, respectively, in NMP in the presence of 2.5 equivalents of DIPEA and a 2.5-fold excess of peptide using PMO dissolved in DMSO. Typically, to a solution of peptide (2500 nmol) dissolved in N-methylpyrrolidone (NMP, 80 μL), PyBOP (19.2 μL of a 0.3 M solution in NMP), HOAt (16.7 μL of a 0.3 M solution in NMP), DIPEA (1.0 mL), and PMO (180 μL of a 10 mM solution in DMSO) were added. The mixture was incubated at 40°C for 2.5 hours and quenched with 0.1% TFA in H₂O (300 μL). The solution was purified by ion exchange chromatography using a modified Gilson HPLC system. The PMO-peptide conjugate was purified on an ion exchange column (Resource S 4 mL, GE Healthcare) using a linear gradient of sodium phosphate buffer (25 mM, pH 7.0) containing 20% ​​CH₃CN. The conjugate was eluted from the column using sodium chloride solution (1 M) at a flow rate of 4 mL min⁻¹ or 6 mL min⁻¹. The fractions containing the desired compound were immediately combined and desalted. The peptide-PMO conjugate was filtered through an ultra-15 3K centrifugal filter unit to remove excess salts. The conjugate was lyophilized and analyzed by MALDI-TOF. Before use, the conjugate was dissolved in sterile water and filtered through a 0.22 μm cellulose acetate membrane. The peptide-PMO concentration was determined by the molar absorbance of the conjugate at 265 nm in 0.1 N HCl solution. (See Table 2 for yields.)

[0412] peptides Yield D-Pep 1.1 36％ D-Pep 1.7 41％ D-pep 1.8 38％ D-Pep 1.9 40％ D-Pep 1.9b 34％ D-Pep 1.9W3 43％ D-Pep 1.9W4P 23％ D-Pep 3.1 31％ D-Pep 3.1a 17％ D-Pep 3.1b 25％ D-Pep 3.1d 37％ D-Pep 3.8 36％ D-Pep 3.8b 35％ D-Pep 5.70 31％

[0413] Table 2. Yields of P-PMO conjugates used for cell culture assays and in vivo experiments (yields are based on the dry weight of lyophilized purified P-PMO. The purity of P-PMO was greater than 95% as determined by normal phase HPLC at 220 nm and 260 nm.

[0414] Animal model and ASO injection. Experiments were performed at the University of Oxford or the “Centre d'études fonctionnelles” (Sorbonne University School of Medicine), respectively, according to UK and French law (ethics committee permission #1760-2015091512001083v6). Intravenous injections of HSA-LR or C57BL / 6 mice were performed by single or multiple administrations via the tail vein. Peptide-PMO-CAG7 at doses of 5, 7.5, 12.5, 30 or 40 mg / kg and PMO at 12.5 or 200 mg / kg were diluted in 0.9% saline and administered in a volume of 5-6 μL / g body weight. Multiple injections were performed at intervals of 2 weeks. Myotonia was assessed and tissues were harvested 2 weeks after the last injection. For long-term experiments, tissues were collected 3 months after injection. For toxicological measurements, tissues were harvested after 1 week. Urine was tested by ELISA (R&D cat#MKM100), where samples were diluted to fit the standard curve. Values ​​were normalized to urine creatinine levels (Harwell) to calculate urine protein concentration

[0415] In situ myotonia / muscle relaxation measurement. The isometric contraction properties of the gastrocnemius muscle were studied in situ. Mice were anesthetized with ketamine / xylan solution (80 mg / kg and 15 mg / kg, respectively). The knees and feet were fixed with clamps and needles. The distal tendon of the gastrocnemius muscle was connected to the lever arm of the servo motor system (305B, dual-mode lever). Data were recorded and analyzed using a PowerLab system (4SP, ADInstruments) and software (Figure 4, ADInstruments). The sciatic nerve (proximal crush) was stimulated using a bipolar silver electrode using an ultra-large (10-V) square wave pulse with a duration of 0.1 ms. The absolute maximum isometric tetanic force (P0) was measured during isometric contraction in response to electrical stimulation (frequency of 25 to 150 Hz, stimulation sequence of 500 milliseconds). Myotonia was measured as the delay in muscle relaxation after measuring P0.

[0416] Cell culture and peptide-PMO treatment. Immortalized myoblasts from healthy individuals or DM1 patients with 2600 CTG repeats were cultured in a growth medium consisting of an M199:DMEM mixture (1:4 ratio, Life technologies), supplemented with 20% FBS (Life technologies), 50 μg / ml gentamicin (Life Technologies), 25 μg / ml fetuin, 0.5 ng / ml bFGF, 5 ng / ml EGF, and 0.2 μg / ml dexamethasone (Sigma-Aldrich). For myoblasts, myogenic differentiation was induced by switching the confluent cell culture to a DMEM culture medium supplemented with 5 μg / ml insulin (Sigma-Aldrich). For treatment, WT or DM1 cells were differentiated for 4 days. The culture medium was then replaced with fresh differentiation medium containing peptide-PMO conjugates at a concentration of 1, 2, 5, 10, 20, or 40 μM. Cells were harvested 48 hours after treatment for analysis. Cell viability was quantified using a fluorescence-based assay (Promega) 2 days after transfection of peptide-PMO at a concentration of 40 uM in human hepatocytes or at 1, 2, 5, 10, 20, or 40 μM in myoblasts.

[0417] RNA isolation, RT-PCR and qPCR analysis. For mouse tissue: Before RNA extraction, muscle was disrupted in TriReagent (Sigma-Aldrich) using the Fastprep system and Lysing Matrix D tubes (MP biomedicals). For human cells: Before RNA extraction, cells were lysed at 55°C in Proteinase K buffer (500mM NaCl, 10mM Tris-HCl, pH 7.2, 1.5mM MgCl2, 10mM EDTA, 2% SDS and 0.5mg / ml Proteinase K) for 45 minutes. Total RNA was isolated using TriReagent according to the manufacturer's protocol. One microgram of RNA was reverse transcribed using the M-MLV first-strand synthesis system (Life Technologies) according to the manufacturer's instructions, for a total of 20 μL. Subsequently, one microliter of cDNA preparation was used for semi-quantitative PCR analysis according to a standard protocol (ReddyMix, ThermoScientific). Primers are shown in Table 3 below:

[0418] Table 3

[0419]

[0420]

[0421] PCR amplification was performed for 25–35 cycles within the linear amplification range for each gene. PCR products were separated on 1.5–2% agarose gels, stained with ethidium bromide, and quantified using ImageJ software. The ratio of exon inclusion was quantified as the percentage of inclusion relative to the total intensity of the isoform signal. To quantify mRNA expression, real-time PCR was performed according to the manufacturer's instructions. PCR cycles consisted of a 15-minute denaturation step followed by 50 cycles of denaturation at 94°C for 15 seconds, annealing at 58°C for 20 seconds, and extension at 72°C for 20 seconds.

[0422] Fluorescence in situ hybridization / immunofluorescence. Fluorescence in situ hybridization (FISH) experiments were performed as described previously using a Cy3-labeled 2'OMe(CAG)7 probe (Eurogentec). For combined FISH-immunofluorescence experiments, immunofluorescence staining was performed after the last wash of FISH using a rabbit polyclonal anti-MBNL1 antibody, followed by a secondary Alexa Fluor 488-conjugated goat anti-rabbit (1:500, Life Technologies) antibody.

[0423] ELISA-based measurement of oligonucleotide concentrations in tissues. A custom hybridization-based ELISA was developed to determine the concentration of PMO oligonucleotides using a phosphorothioate probe with a phosphorothioate bond (sequence (5'->3')[DIG]C*T*G*C*T*G*C*TGCTGCT*G*C*T*G*C*T*G[BIO](SEQ ID NO:96)) dual-labeled with digoxigenin and biotin. The assay had a linear detection range of 5–250 pM (R2>0.99) in mouse serum and tissue lysates. The probe was used to detect peptide-PMO or naked PMO concentrations in eight different tissues (brain, kidney, liver, lung, heart, diaphragm, gastrocnemius, and quadriceps femoris) from treated HSA-LR mice.

[0424] 2. Results

[0425] In this work, we used a cell-penetrating arginine-rich peptide with a specific structure and showed that this peptide conjugated to [CAG]7 morpholinophosphodiamidate oligomer (PMO) significantly enhanced ASO delivery into striated muscle of DM1 model HSA-LR mice after systemic administration compared to unconjugated PMO and other peptide carrier conjugate strategies. Thus, low-dose treatment with the conjugate formed by peptide-[CAG]7PMO targeting pathological amplification claimed herein was sufficient to reverse splicing defects and myotonia in DM1 mice (HSA-LR) and normalize the overall disease transcriptome. In addition, treated DM1 patient-derived muscle cells (myoblasts) showed that the peptide-[CAG]7PMO conjugate claimed herein specifically targeted mutant CUGexp-DMPK transcripts, thereby eliminating the deleterious sequestration of MBNL1 splicing factors by nuclear RNA foci and the resulting loss of MBNL1 function, which caused splicing defects and muscle dysfunction. Our results demonstrate that the peptide-[CAG]7PMO conjugates as claimed herein induce efficient and durable correction of DM1-associated phenotypes at the molecular and functional levels and strongly support the use of these peptide conjugates for systemic corrective therapy of DM1.

[0426] We have generated data on conjugates containing peptide carriers that do not contain artificial amino acids (e.g., X residues) that have a wider therapeutic window and a safer toxicology profile than previous cell-penetrating peptides and therefore constitute more promising candidates for testing in DM1 patients. When conjugated to the CAG7 repeat antisense oligonucleotide PMO, these new generation so-called "DPEP1 and DPEP3" peptides showed promising results in vitro in reducing the number of pathogenic aggregation sites ( Figure 1) and corrected splicing defects (Figures 2, 3, 4, and 19). None of the concentrations tested resulted in a decrease in cell viability in human hepatocytes (1-40 μM), in contrast to similar comparative conjugates formed with known "Pip" carrier peptides; Pip6a-PMO and Pip9b2-PMO induced significant cell death (>50%) at 40 μM ( Figure 7 Many of the concentrations tested did not result in reduced cell viability in human myoblasts and performed better than similar comparative conjugates formed from the known "Pip" carrier peptides Pip6a-PMO and Pip9b2-PMO, which induced cell death at lower doses ( Figure 5 and 6 ).

[0427] We then tested whether these new peptides could also effectively correct myotonia and splicing changes in HSA-LR mice. To this end, we tested the main peptide carriers of the DPEP 1 and 3 series, DPEP1.9 and DPEP3.8, and compared them with the existing peptide carrier DPEP5.70. We were able to show that after two weeks of treatment with 30 mg / kg of the conjugate formed by DPEP3.8 and DPEP1.9, the splicing defects ( Figure 4 ) and myotonia ( Figure 8 、 9 and 10) were corrected to wild-type levels.

[0428] The biodistribution of naked PMO and the biodistribution of the conjugate formed with carrier peptides DPEP1.9 and DPEP3.8 were assessed by ELISA to quantify the delivery of peptide-[CAG]7 PMO conjugates. Detecting PMO in tissues severely affected in DM1 (e.g., heart and brain) is important for drug delivery development. A single intravenous injection of 30 mg / kg of peptide-[CAG]7 PMO conjugate or 3 injections of 200 mg / kg of naked PMO were administered to HAS-LR mice (a total of 600 mg / kg). PMO detection in gastrocnemius, quadriceps femoris, diaphragm, heart, and brain was analyzed 2 weeks after administration. Unconjugated naked [CAG]7 PMO had low to undetectable levels in all tissues tested, whereas [CAG]7 PMO conjugated to peptide carriers DPEP1.9 and DPEP3.8 was still detected at higher levels (>20 times molar concentration) despite being injected at lower doses. Typically, peptide-[CAG]7 PMO conjugates were detected at 1 nM to 4 nM in quadriceps, gastrocnemius, and diaphragm muscles and at 1 nM in heart 2 weeks after injection at 30 mg / kg ( Figure 17 ).

[0429] Table 4

[0430]

[0431] We also studied the pharmacokinetic properties of the peptide-[CAG]7 PMO conjugates of the present invention, measured in serum after administration of a low dose of the peptide-[CAG]7 PMO conjugate (5 mg / kg). We quantified serum concentrations, which reached 500-800 nM 5 minutes after intravenous injection, falling to 100 nM after 1 hour and 10 nM after 3 hours. Six hours after treatment, concentrations were approximately 1 nM, indicating that most of the compound had been cleared or delivered to the tissue of interest (Figure 18).

[0432] Preliminary toxicological evaluation of conjugates of DPEP3.8 and DPEP1.9 carrier peptides in wild-type mice showed that ALP, ALT, AST, KIM-1, creatinine, BUN, and NGAL levels were similar to those of saline control injections, in contrast to the fold increases typically seen with currently available peptide carriers from the Pip series. With these preliminary data, we demonstrate that conjugates of DPEP peptides with [CAG]7 PMO are as active in vivo as Pip6a and have a wider therapeutic window ( Figure 11 、 12 and 21).

[0433] In addition, the body weight of 5 HSA-LR mice injected with a single dose of 30 mg / kg of the conjugate formed by DPEP3.8-[CAG]7 did not show any significant trend compared with 5 HSA-LR mice injected with saline ( Figure 16 ).

[0434] Furthermore, the recovery time of HSA-LR mice after injection of DPEP-based [CAG]7 PMO conjugates was shorter than that after injection of conjugates formed from existing peptide vectors such as Pip6a (Table 5).

[0435] Table 5

[0436]

[0437] Evaluating the efficacy of the conjugates of the present invention in more detail, we also found that splicing defects and myotonia were corrected to wild-type levels (100% and 100% respectively) at least 3 months after administration of the DPEP peptide-[CAG]7PMO conjugate. Figure 19 and 20 We also measured a 50% reduction in mis-splicing and myotonia following administration of a 7.5 mg / kg dose.

[0438] It is noteworthy that conjugates formed with existing peptide vectors (such as Pip6a-[CAG]7 PMO) could not be tested at >20 mg / kg without causing high mortality in mice, in contrast to the present conjugates, where concentrations could be increased more than 5-fold without causing any mortality. Furthermore, in toxicity screening, we detected changes in Kim1 levels compared to saline levels only at doses exceeding 30 mg / kg 2 days after treatment ( Figure 21 ).

[0439] Efficacy and toxicology data demonstrate that the claimed conjugates formed with the DPEP1 and DPEP3 series of carrier peptides are particularly effective in blocking sequestration of MBNL1 by expanded CTG repeats in individuals affected by DM1, while inducing low toxicity. These conjugates are able to fully correct the DM1 phenotype at the molecular level by normalizing splicing and at the muscle level by correcting myotonia to wild-type levels. These new conjugates also have a wider therapeutic window than existing peptide carrier conjugates, making them closer to clinical implementation.

[0440] In summary, we show strong evidence supporting that (1) peptide-[CAG]7 PMO blocks the pathological interaction of MBNL1 with nuclear mutant CUGexp-RNA and rescues downstream effects on RNA splicing; (2) the peptide-conjugated antisense oligonucleotide approach allows for therapeutic delivery to inaccessible tissues such as the heart in the diaphragm; and (3) the potent effect of [CAG]7 PMO directly targeting the disease mutation, combined with the ability of peptide vector technology to deliver highly effective therapy in vivo, together strongly reverse the DM1 phenotype in skeletal muscle DM1 mice (HSA-LR) to wild-type levels, even months after cessation of treatment. These evidences strongly suggest that peptide-[CAG]7 conjugates may have a strong disease-modifying effect in DM1.

[0441] Indeed, our experiments show that the effects we observed in HSA-LR mice not only prevented the progression of DM1 pathology but actually led to a reversal of the disease phenotype. Amplified CUG transcripts were already expressed in pups, and HSA-LR mice developed overt myotonia at 1 month of age. The animals we used to generate the results supporting this application were treated at least 2 months of age and even up to 7 months of age, well beyond the time point when the molecular and functional phenotypes of DM1 develop.

[0442] 3. Conclusion

[0443] *Conjugates containing the DPEP carrier peptide and [CAG]7 PMO (10 μM) were able to reduce the number of nuclear foci by >50% in DM1 patient myoblasts and controls (at doses that did not reduce cell viability). In contrast to comparative conjugates formed with other carrier peptides that induced significant cell death (>50%) at concentrations of 20 μM or higher, none of the concentrations tested resulted in a reduction in cell viability (1-40 μM).

[0444] *Conjugates containing the DPEP carrier peptide and [CAG]7 PMO exhibited positive pharmacokinetics, and biodistribution assessments revealed optimal delivery to tissues severely affected in DM1.

[0445] *Conjugates containing the DPEP carrier peptide and [CAG]7 PMO induced 50%-90% splicing correction in Clcn1 exon 7a, Serca exon 22, Mbnl1 exon 5, and Ldb3 exon 11 in HSA-LR mice at doses (30 mg / kg, intravenous injection) that were less toxic than comparable conjugates formed with other carrier peptides at 12.5 mg / kg. RT-PCR analysis also showed that conjugates containing DPEP1.9 and DPEP3.8 normalized splicing to wild-type levels using 30 and 40 mg / kg of conjugates. Splicing correction persisted for at least 3 months after treatment and was also significant after a single low dose (5 and 7.5 mg / kg).

[0446] * Based on qualitative observations of myotonia and electromyographic myotonia measurements, conjugates containing the DPEP carrier peptide and [CAG]7 PMO reduced myotonia to wild-type levels after a single injection at 40 mg / kg or 30 mg / kg (IV). Moderate correction of myotonia also occurred after four injections of conjugates containing DPEP3.8 or DPEP1.9 at 7.5 mg / kg.

[0447] *Conjugates containing the DPEP carrier peptide and [CAG]7 PMO induced shorter duration of lethargy (>1 hour) in wild-type mice at 30 mg / kg (intravenous) compared to single injections of 12.5 mg / kg of comparable conjugates formed with other carrier peptides. Urine biochemistry tests of renal function and blood analysis showed no changes in wild-type mice compared to saline, with slight changes in Kim1 levels in HSA-LR and urine protein after =>30 mg / kg.

Claims

1. A conjugate comprising: a peptide carrier covalently linked to a therapeutic molecule; wherein the peptide vector consists of one of the following sequences: RBRRBRFQILYBRBR (SEQ ID NO: 35), RBRRBRRFQILYRBHBH (SEQ ID NO: 37) and RBRRBRFQILYRBHBH (SEQ ID NO: 44); and wherein the therapeutic molecule is a nucleic acid, wherein the nucleic acid is a plurality of trinucleotide repeats, wherein the repeated trinucleotide sequence is CAG, and the nucleic acid comprises 5-20 of the trinucleotide repeats; The peptide carrier is acetylated at its N-terminus and covalently linked to the therapeutic molecule at its C-terminus via a linker selected from β-alanine, glutamic acid and GABA.

2. The conjugate of claim 1, wherein the nucleic acid comprises 5-10 trinucleotide repeats.

3. The conjugate of claim 2, wherein the nucleic acid comprises 7 trinucleotide repeats.

4. The conjugate of claim 1, wherein the peptide carrier is: RBRRBRFQILYBRBR (SEQ ID NO: 35), acetylated at its N-terminus and covalently linked to the therapeutic molecule at its C-terminus via a β-alanine linker, and wherein: the nucleic acid is a phosphorodiamidate morpholino oligomer (PMO), the 3' end of the PMO is linked to the C-terminus of the peptide via the linker, and the trinucleotide repeat sequence is [CAG] 7 .

5. The conjugate of claim 1, wherein the peptide carrier is: RBRRBRFQILYBRBR (SEQ ID NO: 35), acetylated at its N-terminus and covalently linked to the therapeutic molecule at its C-terminus via a glutamic acid linker, and wherein: the nucleic acid is a phosphorodiamidate morpholino oligomer (PMO), the 3' end of the PMO is linked to the C-terminus of the peptide via the linker, and the trinucleotide repeat sequence is [CAG] 7 .

6. The conjugate of claim 1, wherein the peptide carrier is: RBRRBRFQILYRBHBH (SEQ ID NO: 44), acetylated at its N-terminus and covalently linked to the therapeutic molecule at its C-terminus via a β-alanine linker, and wherein: the nucleic acid is a phosphodiamidate morpholino oligomer (PMO), the 3' end of the PMO is linked to the C-terminus of the peptide via the linker, and the trinucleotide repeat sequence is [CAG] 7 .

7. The conjugate of claim 1, wherein the peptide carrier is: RBRRBRFQILYRBHBH (SEQ ID NO: 44), acetylated at its N-terminus and covalently linked to the therapeutic molecule at its C-terminus via a glutamic acid linker, and wherein: the nucleic acid is a phosphodiamidate morpholino oligomer (PMO), the 3' end of the PMO is linked to the C-terminus of the peptide via the linker, and the trinucleotide repeat sequence is [CAG] 7 .

8. A conjugate comprising: (a) a cell penetrating peptide vector RBRRBRFQILYBRBR (SEQ ID NO: 35), which is covalently linked to an antisense oligonucleotide consisting of seven CAG repeats via a β-alanine linker; (b) a cell penetrating peptide vector RBRRBRFQILYBRBR (SEQ ID NO: 35), which is covalently linked to an antisense oligonucleotide consisting of seven CAG repeats via a glutamic acid linker; (c) a cell penetrating peptide vector RBRRBRRFQILYRBHBH (SEQ ID NO: 37), which is covalently linked to an antisense oligonucleotide consisting of seven CAG repeats via a β-alanine linker; (d) a cell penetrating peptide vector RBRRBRRFQILYRBHBH (SEQ ID NO: 37), which is covalently linked to an antisense oligonucleotide consisting of seven CAG repeats via a glutamic acid linker; (e) a cell penetrating peptide vector RBRRBRRFQILYRBHBH (SEQ ID NO: 37), which is covalently linked to an antisense oligonucleotide consisting of seven CAG repeats via a GABA linker; (f) a cell penetrating peptide vector RBRRBRFQILYRBHBH (SEQ ID NO: 44) covalently linked to an antisense oligonucleotide consisting of seven CAG repeats via a β-alanine linker; or (g) a cell penetrating peptide vector RBRRBRFQILYRBHBH (SEQ ID NO: 44), which is covalently linked to an antisense oligonucleotide consisting of seven CAG repeats via a glutamic acid linker; Optionally, the cell penetrating peptide of the conjugate is acetylated at the N-terminus.

9. The conjugate according to claim 8, wherein the cell penetrating peptide carrier of the conjugate is acetylated at its N-terminus, the oligonucleotide of the conjugate is a phosphorodiamidate morpholino oligomer (PMO), and the 3' end of the PMO is connected to the C-terminus of the peptide carrier of the conjugate through a linker.

10. Use of the conjugate according to any one of claims 1 to 9 in the preparation of a medicament for preventing or treating a trinucleotide repeat disorder, wherein the trinucleotide repeat disorder is DM1 (myotonic dystrophy type 1).

Images