Proteins having lysophospholipase and phospholipase activity

Abstract

The present application provides a protein having lysophospholipase and / or phospholipase activity. The protein provided by the present application has a sequence shown in SEQ ID NO: 3, 4, 5, 6 or 19, or has at least 90% homology with the sequence shown in SEQ ID NO: 3, 4, 5, 6 or 19, and the protein is derived from Aspergillus niger. The protein of the present application can not only be used as a phospholipase and / or lysophospholipase, but also can be used in applications requiring both phospholipase and lysophospholipase, for example, can be applied to the preparation of L-alpha-glycerophosphocholine.

Description

Technical Field

[0001] This application relates to the field of phospholipases, and more specifically, to a protein having lysophospholipase and phospholipase activities. Background Technology

[0002] Two lipases, lipase A and lipase B, or lipase 1 and lipase 2, have been reported in Aspergillus niger. Lipase B exhibits unique properties. Zhu Shu-sen cloned and expressed lipase B from Aspergillus niger A733, finding that its optimal temperature is 15℃, its optimal pH is 3.5-4.0, and it cannot tolerate temperatures exceeding 40℃. It can hydrolyze substrates with chain lengths from pNPC4 to pNPC18, with pNPC12 being the optimal substrate. However, lipase B has extremely low specific activity; the specific activity of purified lipase B is only 6.8 U / mg.

[0003] Jiangke Yang et al. cloned and expressed lipase2 from Aspergillus niger CICC 4009. Although this lipase2 is highly homologous to lipaseB cloned by Zhu Shu-sen, differing by only two amino acids, its properties are somewhat different. The optimal substrates are pNPC8 and pNPC10, the optimal pH is less than 6.5, the optimal temperature is 50℃, and it cannot tolerate temperatures above 40℃.

[0004] As stated above, lipase2 or lipase B derived from Aspergillus niger are not very practical. Firstly, their specific enzyme activity is extremely low, and their temperature tolerance is poor. Their optimal substrate is short-chain fatty acid triglycerides. They are inferior to the more widely used lipases TL and RML, which have specific enzyme activities reaching 12000 or 8000 U / mg, respectively. TL can withstand temperatures of 60°C for 20 hours without inactivation, and RML can hydrolyze triglycerides of various long-chain fatty acids.

[0005] To solve the above problems, a new protein sequence is needed that has both lysophospholipase and phospholipase activities. Invention Overview

[0006] In a first aspect, the present invention provides a protein having lysophospholipase and / or phospholipase activity.

[0007] The protein provided by the present invention has the sequence shown in SEQ ID NO: 3, 4, 5, 6 or 19, or has at least 90% homology with the sequence shown in SEQ ID NO: 3, 4, 5, 6 or 19, and the protein is derived from Aspergillus niger.

[0008] In some specific embodiments of the present invention, the protein has at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology with the sequence shown in SEQ ID NO: 3, 4, 5, 6, or 19.

[0009] Secondly, the present invention also provides a polynucleotide sequence.

[0010] The polynucleotide sequences provided by this invention are selected from: (1) polynucleotides encoding polypeptides of the first aspect; (2) polynucleotides complementary to the polynucleotide sequence of (1); and (3) fragments of the polynucleotide of (1) or (2) being 10-40 bases in length. In some specific embodiments of this invention, the sequences of the polynucleotides are as shown in SEQ ID NO: 7, 8, 9, 10 or 20.

[0011] Thirdly, the present invention also provides a polynucleotide construct.

[0012] The polynucleotide construct provided by this invention contains a polynucleotide sequence of the second aspect.

[0013] In some specific embodiments of the present invention, the polynucleotide construct is an expression vector or a cloning vector.

[0014] Fourthly, the present invention also provides a host cell.

[0015] The host cell provided by the present invention: (1) expresses a polypeptide of the first aspect; and / or (2) contains a polynucleotide sequence of the second aspect or a polynucleotide construct of the third aspect.

[0016] In some specific embodiments of the present invention, the host cell is selected from prokaryotic or eukaryotic microorganisms.

[0017] In some specific embodiments of the present invention, the host cell is preferably selected from Aspergillus niger, Pichia pastoris, Escherichia coli, Bacillus, Trichoderma reesei and / or Aspergillus oryzae.

[0018] Fifthly, the present invention also provides a composition comprising the protein of the first aspect.

[0019] In some specific embodiments of the present invention, the composition is an enzyme composition. In some specific embodiments of the present invention, the enzyme composition further includes one or more of phospholipase A1, phospholipase A2, phospholipase B, phospholipase C, amylase, lipase, protease, and cellulase.

[0020] In some specific embodiments of the present invention, the composition is a fermentation expression of a host cell in the fourth aspect, such as fermentation broth, fermentation concentrate, fermentation supernatant, or an enzyme preparation prepared from fermentation broth.

[0021] In a sixth aspect, the present invention also provides a composition comprising the protein of the first aspect and optional excipients.

[0022] In some specific embodiments of the present invention, the auxiliary material is an adsorbent material selected from activated carbon, alumina, diatomaceous earth, porous ceramics, and porous glass.

[0023] In a seventh aspect, the present invention provides a method for preparing the protein of the first aspect, comprising the step of fermenting the host cell of the fourth aspect.

[0024] Eighthly, the present invention also provides the use of the polypeptide of the first aspect, the polynucleotide sequence of the second aspect, the nucleic acid construct of the third aspect, the host cell of the fourth aspect, the composition of the fifth aspect, or the composition of the sixth aspect in vegetable oil degumming, bread dough modification, starch hydrolysis product treatment, lysophospholipase preparation, and / or L-α-glycerophosphocholine. Attached Figure Description

[0025] Figure 1 The specific enzyme activities of AN02-LPL, AN05-LPL, AN08-LPL, and CBS-Lipase B phospholipase A1 were shown.

[0026] Figure 2 The enzyme activity of AN02-LPL, AN05-LPL, AN08-LPL, and CBS-Lipase B lysophospholipase was shown.

[0027] Figure 3 The specific enzyme activities of AN02-LPL, AN05-LPL, AN08-LPL, and CBS-LipaseB lipases were shown.

[0028] Figure 4 The results of the debonding test for AN02-LPL, AN05-LPL, AN08-LPL, and CBS-LipaseB are shown. Detailed description of the invention

[0029] While this application contains numerous details, these should not be construed as limiting the scope of the invention or the claims, but rather as descriptions of features specific to particular embodiments of a particular invention. Certain features described in individual embodiments of this application may also be implemented in combination in a single embodiment. Conversely, various features described in a single embodiment may also be implemented individually or in any suitable sub-combination in multiple embodiments. Furthermore, although features may be described above as functioning in certain combinations and even initially claimed in this way, one or more features from a claimed combination may be removed from the combination in some cases, and the claimed combination may involve sub-combinations or variations thereof.

[0030] Unless otherwise stated, the terms used herein have the same meaning as commonly understood by those skilled in the art, for example, those relating to raw materials and products, operating procedures, process parameters, equipment and tools used, and numerical units.

[0031] In this document, the terms "comprising" and "including" can be open-ended or closed-ended. For example, "comprising" or "including" can mean that it may also include or contain other components, steps, or other elements not listed, or it may only include or contain the listed components, steps, or other elements.

[0032] In this document, the term “about” (e.g., in component content and processing parameters) is interpreted in a meaning that is generally understood by those skilled in the art. Generally, the term “about” can be understood as any value within a range of plus or minus 5% of a given value; for example, about X can represent any value in the range of 95%X to 105%X.

[0033] It should also be understood that the specific numerical values ​​given herein (e.g., in component content, temperature, and processing time) are not only to be understood as individual numerical values, but also as providing endpoints of a range, and can be combined to provide other ranges. For example, when it is disclosed that a treatment can be performed for 30 minutes or 180 minutes, it is also disclosed that a treatment can be performed for 30 minutes to 180 minutes. Furthermore, the specific numerical values ​​given herein can also be understood to be modified by the term "about" in all cases. Therefore, unless otherwise specified, the numerical values ​​described in this application are approximate values ​​that can be changed as required. For example, a processing time of 30 minutes can be understood as a processing time of about 30 minutes, and a processing time of 30 minutes to 180 minutes can be understood as a processing time of about 30 minutes to about 180 minutes or about 30 minutes to 180 minutes.

[0034] In a first aspect, the present invention provides a protein having lysophospholipase and / or phospholipase activity, and thus can be used alone as a phospholipase and / or lysophospholipase, and can also be used in applications that require both phospholipase and lysophospholipase, for example, in the preparation of L-α-glycerophosphocholine.

[0035] The protein provided by the present invention has the sequence shown in SEQ ID NO: 3, 4, 5, 6 or 19, or has at least 90% homology with the sequence shown in SEQ ID NO: 3, 4, 5, 6 or 19, and the protein is derived from Aspergillus niger.

[0036] In some specific embodiments of the present invention, the protein has at least 91%, 92%, 93%, 94%, or 95% homology with the sequence shown in SEQ ID NO: 3, 4, 5, 6, or 19.

[0037] In some specific embodiments of the present invention, the protein has at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology with the sequence shown in SEQ ID NO: 3, 4, 5, 6, or 19.

[0038] In some specific embodiments of the present invention, some proteins have high thermal stability. In these embodiments of the present invention, the proteins used have the sequence shown in SEQ ID NO: 19, or have at least 90% homology with the sequence shown in SEQ ID NO: 19, and the proteins are derived from Aspergillus niger.

[0039] In this invention, the protein may be an "isolated" protein. Hereinafter, "isolated" means a form or substance that does not exist in nature. Non-limiting examples of isolated substances include any substance that is not naturally occurring and any substance removed at least partially from one or more naturally occurring components associated with it in nature, including, but not limited to, any enzyme, variant, nucleic acid, protein, peptide, or cofactor.

[0040] The present invention also includes polypeptides having one or more (typically 1-10, e.g., 1, 2, 3, 4, 5, 6, or 10) amino acid mutations (deletions, insertions, and / or substitutions) based on SEQ ID NO: 3, 4, 5, 6, or 19, while retaining the enzymatic activity of the amino acid sequence shown in SEQ ID NO: 3, 4, 5, 6, or 19. In some embodiments, the amino acid mutation is the addition of one or more (typically up to 20, preferably up to 10, more preferably up to 8) amino acids to the C-terminus and / or N-terminus of SEQ ID NO: 3, 4, 5, 6, or 19.

[0041] As is known to those skilled in the art, gene cloning often requires the design of suitable restriction enzyme sites, which inevitably introduces one or more irrelevant residues at the end of the expressed protein, without affecting the activity of the target protein. Similarly, to construct fusion proteins, promote the expression of recombinant proteins, obtain recombinant proteins that are automatically secreted outside host cells, or facilitate the purification of recombinant proteins, it is often necessary to add certain amino acid sequences to the N-terminus, C-terminus, or other suitable regions within the protein of the recombinant protein. These amino acid sequences include, but are not limited to, adaptor peptides, signal peptides, leader peptides, terminal extensions, glutathione S-transferase (GST), maltose E-binding proteins, protein A, tags (such as 6His or Flag), or suitable proteolytic enzyme sites. It should be understood that the presence of these amino acid sequences does not affect the activity of the resulting polypeptide. Therefore, this invention also includes polypeptides having one or more amino acids at the C-terminus and / or N-terminus or suitable regions within the protein of the present invention that facilitate the construction of the polypeptide expression vector, the expression of the polypeptide, and / or purification, and these polypeptides still possess the enzymatic activities described herein.

[0042] In this invention, sequence homology is used to describe the correlation between two amino acid sequences or two nucleotide sequences. Sequence homology can be calculated using methods well-known in the art. For example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, Journal of Molecular Biology, 48:443-453) implemented in the Needle program of the EMBOSS package (EMBOSS: European Molecular Biology Open Software Suite, Rice et al., 2000, Trends in Genetics, 16:276-277) can be used to determine sequence homology between two amino acid sequences, or BLASTP on NCBI can be used to calculate sequence homology between two amino acid sequences.

[0043] Secondly, the present invention also provides a polynucleotide sequence.

[0044] The polynucleotide sequence provided by the present invention is selected from: (1) a polynucleotide encoding a polypeptide of the first aspect; (2) a polynucleotide complementary to the polynucleotide sequence of (1); and (3) a fragment of 10-40 bases in length of the polynucleotide of (1) or (2).

[0045] In some specific embodiments of the present invention, the sequence of the polynucleotide is as shown in SEQ ID NO: 7, 8, 9, 10 or 20.

[0046] In some embodiments of the present invention, those skilled in the art can optimize the codon preference of polynucleotide sequences based on the expression plasmid and / or host used.

[0047] In this invention, the sequence encoding the polypeptide of this invention includes: a coding sequence encoding only the mature polypeptide; a coding sequence of the mature polypeptide and various additional coding sequences; a coding sequence of the mature polypeptide (and optional additional coding sequences) and a non-coding sequence. It should be understood that, due to the inherent properties of eukaryotes, it is also possible to add intron sequences to the polynucleotide sequences of this invention, provided that the enzyme expressed by the eukaryote belongs to the enzyme of the first aspect of this invention.

[0048] Thirdly, the present invention also provides a polynucleotide construct.

[0049] The polynucleotide construct provided by this invention contains a polynucleotide sequence of the second aspect.

[0050] This invention also relates to nucleic acid constructs of isolated polynucleotides of the invention comprising one or more regulatory sequences operably linked to guide the expression of a coding sequence in a suitable host cell under conditions appropriate to the regulatory sequence. The term "operable link" refers to a regulatory sequence located in a suitable position to control and guide the expression of the polynucleotide sequence of interest. The polynucleotide encoding the polypeptide of the invention can be manipulated in various ways to ensure the expression of the polypeptide.

[0051] The regulatory sequence can be a suitable promoter sequence, a nucleotide sequence recognized by a host cell for expressing a polynucleotide encoding the polypeptide of the present invention. The promoter sequence contains a transcriptional regulatory sequence attached to polypeptide expression. The promoter can be any nucleotide sequence exhibiting transcriptional activity in the selected host cell, including mutant, truncated, and heterozygous promoters, and can be obtained from a gene encoding an extracellular or intracellular polypeptide that is homologous or heterologous to that of the host cell.

[0052] Examples of suitable promoters used to guide the nucleic acid constructs of this invention, particularly for transcription in bacterial host cells, are promoter sequences obtained from the bacteriophage T7 promoter, the Escherichia coli lac operon, the Streptomyces coelicolor agarose enzyme gene, the Bacillus subtilis fructan sucrase gene, the Bacillus licheniformis α-amylase gene, the Bacillus amyloliquefaciens α-amylase gene, the Bacillus licheniformis penicillinase gene, and the like.

[0053] Examples of suitable promoters used to guide the positive transcription of the nucleic acid constructs of this invention in filamentous fungal host cells are promoters obtained from the genes of Aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartic protease, Aspergillus niger neutral α-amylase, Aspergillus niger acid-stable α-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Trichoderma reesei cellobiose hydrolase I, Trichoderma reesei cellobiose hydrolase II, Aspergillus oryzae alkaline protease, Aspergillus oryzae triphosphate isomerase, Trichoderma reesei glucan endonuclease, etc., as well as their mutant, truncated, and hybrid promoters.

[0054] In yeast hosts, useful promoters are derived from the genes for *Saccharomyces cerevisiae* enolase (ENO-1), *Saccharomyces cerevisiae* galactokinase (GAL1), *Saccharomyces cerevisiae* alcohol dehydrogenase, glyceraldehyde-3-phosphate dehydrogenase, *Saccharomyces cerevisiae* triose phosphate isomerase, *Saccharomyces cerevisiae* 3-phosphate glycerate kinase, and *Pichia pastoris* alcohol oxidase. Other useful promoters for yeast host cells are described by Romanos et al., 1992, Yeast8:423-488.

[0055] The regulatory sequence can also be a suitable transcription terminator sequence, a sequence recognized by the host cell to terminate transcription. The terminator sequence is operatively linked to the 3′ end of the nucleotide sequence encoding the polypeptide. Any terminator that is functional in a selected host cell can be used in this invention.

[0056] The preferred terminator for the bacterial host can be a terminator derived from T7 phage.

[0057] Preferred terminators for filamentous fungal host cells were obtained from the genes of Aspergillus oryzae TAKA amylase, Aspergillus niger glucosylase, Aspergillus nidulans anthranilate synthase, and Aspergillus niger α-glucosidase.

[0058] Preferred terminators for yeast host cells were obtained from genes such as Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C, Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase, and Pichia pastoris alcohol oxidase.

[0059] The regulatory sequence can also be a suitable leader sequence, or the untranslated region of an mRNA important for translation in the host cell. The sign-in sequence is operatively linked to the 5' end of the nucleotide sequence encoding the polypeptide. Any terminator that is functional in a selected host cell can be used in this invention.

[0060] The regulatory sequence can also be an amino acid sequence that encodes an amino acid terminus of a polypeptide and directs the encoded polypeptide into a signal peptide coding region in the cellular secretion pathway. The 5′ end of the nucleotide sequence may inherently contain a signal peptide coding region naturally linked to a translation reading frame containing a segment encoding the secreted polypeptide. Alternatively, the 5′ end of the coding sequence may contain a signal peptide coding region exogenous to that coding region. When the coding sequence does not naturally contain a signal peptide coding region, an exogenous signal peptide coding region may be required. Alternatively, an exogenous signal peptide coding region may simply replace the native signal peptide coding region to enhance polypeptide secretion. However, any signal peptide coding region that directs the expressed polypeptide into the secretion pathway of a selected host cell, i.e., secretion into the culture medium, can be used in this invention.

[0061] In some embodiments, the nucleic acid construct of the present invention is an expression frame. The term "expression frame" refers to the complete elements required to express a gene, including the promoter, gene coding sequence, and PolyA tailing signal sequence.

[0062] In some specific embodiments of the present invention, the polynucleotide construct is an expression vector or a cloning vector.

[0063] Expression vectors can be any vector (such as plasmids or viruses) that can be readily subjected to recombinant DNA methods and result in the expression of nucleotide sequences of interest. Cloning vectors typically multiply rapidly in host cells after being introduced into them.

[0064] The choice of vector generally depends on the compatibility between the vector and the host cell in which it is introduced. The vector can be a linear or closed circular plasmid.

[0065] The vector can be a self-replicating vector, that is, a vector that exists as an extrachromosomal entity and whose replication does not depend on chromosome replication, such as a plasmid, extrachromosomal element, mini-chromosome, or artificial chromosome. The vector can contain any means necessary to ensure self-replication. Alternatively, the vector can be a vector that, when introduced into a host cell, integrates into the genome and replicates along with the chromosome into which it has already been integrated. Furthermore, a single vector or plasmid, or two or more vectors or plasmids, or transposons, containing the total DNA to be introduced into the host cell's genome, can be used.

[0066] The vector of the present invention preferably contains one or more selectable markers that allow for easy selection of cells for transformation, transfection, transduction, etc. The selectable markers are genes whose products provide resistance to antibiotics or viruses, resistance to heavy metals, prototrophic to auxotrophic traits, etc.

[0067] The vector of the present invention preferably includes elements that allow the vector to integrate into the host cell genome or to replicate autonomously in the cell independently of the genome.

[0068] One or more copies of the polynucleotide of the present invention can be inserted into a host cell to increase the yield of the gene product. The increase in polynucleotide copy number can be achieved by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selector gene and the polynucleotide. Cells containing an amplified selector gene and thereby containing additional copies of the polynucleotide can be screened by culturing the cells in the presence of a suitable selector.

[0069] The vector of the present invention preferably contains a synthetically produced sequence containing multiple restriction endonuclease recognition sites, which can provide multiple insertion sites or insertion schemes for exogenous DNA.

[0070] Fourthly, the present invention also provides a host cell.

[0071] The host cell provided by the present invention: (1) expresses a polypeptide of the first aspect; and / or (2) contains a polynucleotide sequence of the second aspect or a polynucleotide construct of the third aspect.

[0072] In some specific embodiments of the present invention, the host cell is selected from prokaryotic or eukaryotic microorganisms.

[0073] The host cell can be a single-celled microorganism or a non-single-celled microorganism. Single-celled microorganisms include Gram-positive bacteria, including but not limited to Bacillus cells such as *Bacillus alkalophilus*, *Bacillus amyloliquefaciens*, *Bacillus brevis*, *Bacillus megaterium*, *Bacillus subtilis*, *Bacillus licheniformis*, *Bacillus coagulans*, *Bacillus stearothermophilus*, and *Bacillus thuringiensis*; or Streptomyces cells, such as *Streptomyces purpureus*; or Gram-negative bacteria such as *Escherichia coli* and *Pseudomonas* spp. In a preferred aspect, the bacterial host is *Bacillus subtilis*, *Escherichia coli*, *Bacillus licheniformis*, *Bacillus stearothermophilus*, or *Escherichia coli* cells.

[0074] The host cell can also be a eukaryotic organism, such as a mammalian, insect, plant, yeast, or fungal cell. In a preferred aspect, the host cell is a eukaryotic cell, such as the term "eukaryotic" as used herein, which includes Ascomycota, Basidiomycota, Chytridiomycota, Zygomycota, and Oomycota, etc.

[0075] In a more preferred aspect, the host cell is a cell of the Ascomycota phylum such as Saccharomyces, Pichia, Yarrowia, Candida, and Komagataella.

[0076] In some specific embodiments of the present invention, the host cell is selected from Aspergillus niger, Pichia pastoris, Escherichia coli, Bacillus, Trichoderma reesei and / or Aspergillus oryzae.

[0077] Fifthly, the present invention also provides a composition comprising the protein of the first aspect.

[0078] In some specific embodiments of the present invention, the composition is an enzyme composition. In some specific embodiments of the present invention, the enzyme composition further includes one or more of phospholipase A1, phospholipase A2, phospholipase B, phospholipase C, amylase, lipase, protease, and cellulase.

[0079] In some specific embodiments of the present invention, the composition is a fermentation expression of a host cell in the fourth aspect, such as fermentation broth, fermentation concentrate, fermentation supernatant, or an enzyme preparation prepared from fermentation broth.

[0080] In a sixth aspect, the present invention also provides a composition comprising the protein of the first aspect and optional excipients.

[0081] In some specific embodiments of the present invention, the auxiliary material is an adsorbent material selected from activated carbon, alumina, diatomaceous earth, porous ceramics, and porous glass.

[0082] In a seventh aspect, the present invention provides a method for preparing the protein of the first aspect, comprising the step of fermenting the host cell of the fourth aspect.

[0083] Eighthly, the present invention also provides the use of the polypeptide of the first aspect, the polynucleotide sequence of the second aspect, the nucleic acid construct of the third aspect, the host cell of the fourth aspect, the composition of the fifth aspect, or the composition of the sixth aspect in vegetable oil degumming, bread dough modification, starch hydrolysis product treatment, lysophospholipase preparation, and / or L-α-glycerophosphocholine.

[0084] This invention relates to a phospholipase that can be used to reduce the phospholipid content of edible oils. This method can be used to purify any edible oil containing phospholipids, such as vegetable oils (e.g., soybean oil, rapeseed oil, sunflower seed oil). Typically, at the start of phospholipase treatment, the oil contains 50-1000 ppm of phosphorus in the form of phospholipids; treatment can reduce the phosphorus level to below 5-10 ppm. Phospholipase treatment is carried out by dispersing an aqueous solution of phospholipase, preferably in the form of droplets with an average diameter of less than 10 μm. Preferably, the water content is 0.5-5% of the oil weight. An emulsifier may be added. Mechanical agitation can be used to maintain emulsification. Phospholipase treatment can be carried out in a pH range of about 3.5 to 5 to maximize enzyme performance, or a pH range of about 1.5 to 3 (e.g., 2-3) can be used to inhibit the alkaline hydrolysis (saponification) of triglycerides. The pH value can be adjusted by adding citric acid, citrate buffer, or hydrochloric acid. The suitable temperature is typically 30-70°C (especially 30-45°C, e.g., 35-40°C), and the reaction time is typically 1-12 hours (e.g., 2-6 hours). A suitable enzyme dosage is typically 0.1-10 mg / L (e.g., 0.5-5 mg / L). Phospholipase treatment can be performed in batches (e.g., in a stirred vessel) or continuously (e.g., in a series of stirred reaction vessels). Following phospholipase treatment is the separation of the aqueous and oil phases. This separation can be accomplished using conventional methods (e.g., centrifugation). The aqueous phase contains phospholipase, and these enzymes can be reused to improve the economics of the process. This treatment can be performed using various methods known in the art.

[0085] Baked goods are made from raw dough, which is typically composed of the basic ingredients flour, water, and optionally salt. Depending on the baked goods, other optional ingredients include sugar, flavorings, and so on. For fermented products, bread yeast is primarily used after a chemical fermentation system (such as a combination of acid (acid-producing compounds) and bicarbonate). Efforts are constantly being made to develop methods that enhance the properties of raw dough and the final properties of baked goods. Raw dough properties that need improvement include processability, gas retention, and so on. Properties of baked goods that can be improved include: bread volume, crust crispness, crust texture and softness, taste and aroma, and shelf life. Currently available processing aids can be divided into two groups: chemical additives and enzymes.

[0086] Chemical additives that improve properties include oxidizing agents (such as ascorbic acid, bromate, and azocarbonates), reducing agents (such as L-cysteine ​​and glutathione), emulsifiers as dough conditioners (such as mono / diglycerides of diacetyl tartrate (DATEM), sodium stearoyl lactylate (SSL), or calcium stearoyl lactylate (CSL)), or emulsifiers as bread filling softeners (such as glyceryl monostearate (GMS), etc.), and fatty materials (such as triglycerides (fat) or lecithin and others).

[0087] The current trend is towards using enzymes instead of chemical additives. The latter are considered more natural compounds and therefore more readily accepted by consumers. Suitable enzymes can be selected from amylases, arabinoxylans, and other hemicellulose-degrading enzymes, cellulases, oxidases, lipases, and proteases.

[0088] The present invention also relates to a method for preparing raw dough or baked products, the method comprising incorporating an effective amount of the phospholipase of the present invention into the raw dough, the phospholipase improving one or more properties of the raw dough or baked products derived therefrom, relative to raw dough or baked products without added peptides.

[0089] The phospholipase of this invention can be used to degumme aqueous sugar solutions or slurries to improve their filterability, especially starch hydrolysates, particularly wheat starch hydrolysates that are difficult to filter and produce turbid filtrates. This treatment can be carried out using methods well known in the art.

[0090] The phospholipase of this invention can be used in any application requiring the hydrolysis of phospholipids or the acquisition of their specific cleavage products. For example, the phospholipase of this invention can produce lysophospholipids, diacylglycerols, choline- or ethanolamine phosphate, lysophosphatidylcholine, lysophosphatidylethanolamine, and various phosphatidic acids. The phospholipase of this invention is preferably used at its optimal activity pH. Example

[0091] The present application is further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the application. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions or as recommended by the manufacturer. Percentages are by weight unless otherwise stated. Unless otherwise defined, all technical terms or scientific terms used herein have the same meaning as are familiar to those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein may be applied to this application. The preferred embodiments and materials described herein are for illustrative purposes only.

[0092] In the embodiments of this application, the following are used

[0093] Aspergillus niger strains GIM 3.24(AN02), GIM 3.150(AN03), GIM 3.488(AN04), GIM 3.452(AN07), and GIM 3.564(AN05) were purchased from the Guangdong Provincial Microbial Culture Collection Center.

[0094] CICC40273(AN08) was purchased from the China Industrial Microbial Culture Collection Center.

[0095] Aspergillus niger AS3.795 strain was purchased from the Institute of Microbiology, Chinese Academy of Sciences.

[0096] The pAOP-Eno vector was constructed by the inventors using the method described in *Molecular Cloning: A Laboratory Manual* (3rd edition, New York: Cold Spring Harbor Laboratory Press, 1989). The specific process is as follows:

[0097] The RML gene (SEQ ID NO:23, containing the Aspergillus oryzae α-amylase signal peptide (NCBI sequence number: XM_001821384.2, 1-63bp sequence)) obtained from the whole genome synthesis of Sangon Biotech (Shanghai) Co., Ltd. was inserted into the expression frame containing the Aspergillus oryzae enolase promoter (NCBI sequence number: D63941.1, 215-734bp; containing 12 copies of enhancer sequence (SEQ ID NO:24)) and the Aspergillus niger saccharidase terminator (NCBI sequence number: AF214480.1, including the terminator sequence portion) using SphI and HindIII restriction sites. The entire expression frame was then inserted into the multiple cloning site of the cloning vector pSP72 using BglII and XhoI. Finally, the Aspergillus oryzae-derived PyrG expression gene (NCBI sequence number: AB017705.1) was inserted into the vector using the XhoI restriction site, thus constructing the vector pAOP-Eno.

[0098] The mini beadbeater was purchased from Biospec in the USA.

[0099] DNA Polymerase was purchased from Takara, catalog number: R010A;

[0100] Mighty TA-cloning Reagent Set for The reagent kit was purchased from Takara, catalog number: 6019;

[0101] In this invention, the following are used:

[0102] The formula for Aspergillus niger fermentation medium is as follows:

[0103] 2% glucose, 10% maltose, 7% sodium citrate, 1.5% ammonium sulfate, 4% tryptic soy broth, 0.1% sodium dihydrogen phosphate, 0.1% magnesium sulfate, 0.07% Tween 80, and trace elements (KI 0.83g / L, H3BO3 6.2g / L, MnSO4·4H2O 22.3g / L, ZnSO4·7H2O 8.6g / L, Na2MoO4·2H2O 0.25g / L, CuSO4·5H2O 0.025g / L, CoCl2·6H2O 0.025g / L added at a ratio of 1 / 1000; FeSO4·7H2O 2.78g / L, Na2·EDTA 3.73g / L added at a ratio of 1 / 100).

[0104] The lysis buffer formulation is: 100mM Tris-HCl pH 8.0; 50mM Na·EDTA; 1% SDS.

[0105] BMMY-Soybean Lecithin Medium:

[0106] Component A, BMMY solid medium: 1% yeast extract, 2% peptone, 100mM citrate-sodium citrate buffer, pH 6.6, 1.34% YNB, 4 x 10⁻⁵% biotin (added before pouring), 2% methanol (added before pouring), 2% agar dissolved in 250ml deionized water.

[0107] Component B, 250 ml soybean lecithin substrate solution: Prepare 4% soybean lecithin, emulsify at 8000 rpm for 3 min using a high-speed homogenizer, pause for 1 min, and then emulsify for another 3 min to prepare the substrate solution.

[0108] After sterilization, mix components A and B, add 10 ml of methanol, and pour into a plate.

[0109] The glass beads were purchased from Biospec in the United States.

[0110] Example 1: Cloning of the lipase B gene in Aspergillus niger

[0111] Aspergillus niger strains GIM 3.24 (AN02), GIM 3.150 (AN03), GIM 3.452 (AN07), GIM 3.488 (AN04), GIM 3.564 (AN05), and CICC40273 (AN08) were cultured in Aspergillus niger fermentation medium at 30°C for 24 hours. The fermentation culture was then centrifuged at 4000 rpm for 5 min, and the bacterial cells were collected. Resuspend in 700 μL lysis buffer, transfer to cryovial, add 300 μL glass beads, vibrate on a mini beadbeater for 40 s, centrifuge at 12000 rpm for 10 min, take 600 μL of supernatant and add 275 μL 7M ammonium acetate, incubate at 65°C for 10 min, then on ice for 5 min, add an equal volume of phenol, chloroform, and isoamyl alcohol (volume ratio: phenol:chloroform:isoamyl alcohol = 24:25:1), vortex thoroughly, centrifuge at 12000 rpm for 5 min, take the supernatant and add an equal volume of chloroform, vortex thoroughly, centrifuge at 12000 rpm for 5 min, take the supernatant and add 2 volumes of anhydrous ethanol, incubate at -80°C for 20 min, centrifuge at 12000 rpm for 10 min to obtain white DNA precipitate, wash twice with 70% ethanol, after the ethanol has completely evaporated, add sterile water to dissolve the DNA, obtaining GIM 3.24 (AN02), GIM 3.150 (AN03), and GIM 3.452(AN07), GIM 3.488(AN04), GIM 3.564(AN05), CICC40273(AN08) genomes.

[0112] Primers LPL-1 / LPL-2 were designed based on the lipase B gene sequence of Aspergillus niger CBS513.88 in NCBI, and the sequences are as follows:

[0113] LPL-1: 5'-atgtttctccgcagggaatt-3' (SEQ ID NO: 1);

[0114] LPL-2: 5'-ctacgagcattcactaatgt-3' (SEQ ID NO: 2).

[0115] Using LPL-1 / LPL-2 as primer pairs, utilizing DNA Polymerase cloned LPL DNA from Aspergillus niger strains GIM 3.24(AN02), GIM 3.150(AN03), GIM 3.452(AN07), GIM 3.488(AN04), GIM 3.564(AN05), and CICC40273(AN08) using Mighty TA-cloning Reagent Set for After TA cloning using the kit, DH5α E. coli was transformed and sent to Sangon Biotech Co., Ltd. for DNA sequencing. The LPL DNA sequences of GIM 3.24(AN02), GIM 3.150(AN03), GIM 3.452(AN07), GIM 3.488(AN04), GIM 3.564(AN05), and CICC40273(AN08) were finally obtained. The results showed that the LPL sequences of GIM 3.24(AN02), GIM 3.150(AN03), and GIM 3.452(AN07) were completely identical, as shown in SEQ ID NO:3; the LPL sequence of GIM 3.564(AN05) was shown in SEQ ID NO:4; and the LPL sequence of CICC40273(AN08) was shown in SEQ ID NO:5. The LPL DNA sequence of GIM 3.488(AN04) is identical to the lipase B DNA sequence of CBS513.88, as shown in SEQ ID NO:6.

[0116] Based on the intron sequences of the lipase B DNA sequence of CBS513.88, the intron sequences of GIM 3.24 (AN02), GIM3.150 (AN03), GIM 3.452 (AN07), GIM3.564 (AN05), and CICC40273 (AN08) were identified. After removal, the translated amino acid sequences are as follows:

[0117] The sequences of GIM 3.24(AN02)LPL, GIM 3.150(AN03)LPL, and GIM 3.452(AN07)LPL are shown in SEQ ID NO:7; the sequence of GIM 3.564(AN05)LPL is shown in SEQ ID NO:8; the sequence of CICC40273(AN08)LPL is shown in SEQ ID NO:9; and the amino acid sequence of lipase B of GIM 3.488(AN04)LPL, i.e., CBS513.88, is shown in SEQ ID NO:10.

[0118] Example 2: Phospholipase A1 activity of AN02-LPL, AN05-LPL, AN08-LPL and CBS-lipase B

[0119] Design and synthesize primers LPL-11C, LPL-12C, and LPL-2C:

[0120] LPL-11C:

[0121] CCCAAGCTTTTTCCAACTCAATTTACCTCTATCCACACTTCTCTCCTTCCTCAATCCTCTATATACACAACTGGGGATCCTCACCATG ATGGTCGCGTGGTGGTCT (SEQ ID NO:11);

[0122] LPL-12C:

[0123] ATGATGGTCGCGTGGTGGTCT CTATTTCTGTACGGCCTTCAGGTCGCGGCACCTGCTTTGGCTGCTCCCGCACCTGCTCCGAT (SEQ ID NO: 12);

[0124] LPL-2C:ACATgcatgcctaGGAGCACTCGGAG (SEQ ID NO: 13).

[0125] Using the genomes of AN02, AN04, AN05, and AN08 as templates, PCR was first performed using LPL-12C and LPL-2C as primer pairs. Then, using these PCR products as templates, PCR was performed using LPL-11C and LPL-2C to obtain the DNA sequences of AN02-LPL, AN04LPL (i.e., CBS-lipase B), AN05-LPL, and AN08-LPL (with a TPI 5'-UTR (SEQ ID NO:14) sequence added to the 5' end of each gene sequence) and the Amylase signal peptide (SEQ ID NO:15) sequence. The PCR products were digested with HindIII and SphI, and ligated into the pAOP-Eno vector through the HindIII and SphI restriction sites. The correctly sequenced clones were transformed into Aspergillus niger strain AS3.795, and the resulting strains were named AN02L, AN04L, AN05-L, and AN08-L, respectively.

[0126] The conversion method is as follows:

[0127] Spores of *Aspergillus niger* cultured on PDA solid medium (purchased from BD, catalog number BD 213400) were eluted with spore washing solution. The eluted spores were vortexed for 1 min and then filtered through a miRCLOTH filter to prepare a homogeneous spore suspension. 1 × 10⁶ spores were then inoculated. 7Spore suspension was added to fermentation medium (2% glucose, 6% maltose, 7% sodium citrate, 1.5% ammonium sulfate, 4% Tryptic soy broth, 0.1% sodium dihydrogen phosphate, 0.1% magnesium sulfate, 0.07% Tween 80, trace elements (KI 0.83 g / L, H3BO3 6.2 g / L, MnSO4·4H2O 22.3 g / L, ZnSO4·7H2O 8.6 g / L, Na2MoO4·2H2O 0.25 g / L, CuSO4·5H2O 0.025 g / L, CoCl2·6H2O 0.025 g / L added at a ratio of 1 / 1000; FeSO4·7H2O 2.78 g / L, Na2·EDTA) Add 3.73 g / L at a 1 / 100 ratio to the solution and incubate at 28℃ and 200 rpm for 42-48 h. Collect the mycelia by filtration with a sterile Mircloth (purchased from Milliproe). Then, irrigate the collected mycelia with a sterile osmotic stabilizer (0.6 mol / L). Wash three times with MgSO4 and press dry; transfer the mycelium to a 100mL Erlenmeyer flask, and suspend each 0.8g mycelium weight in 10mL of enzymatic hydrolysis solution (1% cellulase (purchased from Sigma, catalog number C1184-25KU), 1% lysozyme (purchased from Sigma, catalog number L1412-25G), 0.1% snailase (purchased from Sangon Biotech, catalog number A600870-0005)) and disperse; incubate at 30℃, 60rpm for 60-90min (observe every 10min after 30min); filter the enzyme-hydrolyzed mycelium through Mircloth filter, and then rinse with 0.6mol / L... Wash with MgSO4 and collect the filtrate; centrifuge at 1000g for 10 min at 4℃, discard the supernatant; resuspend the protoplast precipitate in 5 mL of pre-cooled 1.0 mol / L sorbitol solution, centrifuge at 800g for 10 min at 4℃, discard the supernatant; resuspend the protoplast in 1 mL of pre-cooled 1.0 mol / L sorbitol solution and keep on ice. Centrifuge the protoplasts and adjust the solution to 1×10⁻⁶ with pre-cooled STC (1.0 M Sorbitol, 50 mM CaCl₂, 50 mM Tris-HCl, pH = 7.5). 7DNA / mL; Add 5 μg DNA and 50 μL PTC (40% PEG4000, 50 mM CaCl2, 50 mM Tris-HCl, pH=7.5) solution to 200 μL protoplast suspension, gently pat to mix, and incubate on ice for 30 min; add 0.2 mL PTC solution, mix well, then add 0.8 mL PTC solution, mix well, and incubate at room temperature for 30 min; add the above mixture to 5 mL regeneration medium (0.2% KH2PO4, 0.1% KCl, 0.05% MgSO4·7H2O, 0.005% FeSO4·7H2O, 1 M sucrose, 10 mM acetamide, 20 mM cesium chloride, 0.6% agar), mix well; spread on regeneration medium (same composition as above, 1.5% agar), and incubate at 28℃ for at least 3 days.

[0128] Positive clones grown on the regeneration medium were spread onto 3% PDA solid medium (purchased from BD, catalog number BD 213400) and incubated at 28°C for about 3 days, resulting in the formation of a large number of spores. The eluted spores were vortexed for 1 min and then filtered through a mircloth to prepare a homogeneous spore suspension. 1×10⁷ spore suspensions were inoculated into fermentation medium (2% glucose, 10% maltose, 7% sodium citrate, 1.5% ammonium sulfate, 4% Tryptic soy broth, 0.1% sodium dihydrogen phosphate, 0.1% magnesium sulfate, 0.07% Tween 80, trace elements) and incubated at 28°C and 200 rpm for 8 days, followed by enzyme activity assay.

[0129] The enzyme activity assay method is as follows:

[0130] 9ml substrate: 5ml 1% soybean lecithin, 1ml 20% Triton X-100, 2.5ml 0.1M citrate-sodium citrate buffer.

[0131] Mix 10 μL of diluted enzyme solution with 90 μL of substrate and react at 50°C for 10 min, then inactivate at 95°C for 5 min. Centrifuge at 7000 rpm for 5 min. Take 1 μL of the supernatant and add 80 μL of reagent A from the NEFA kit. React at 37°C for 10 min, then add 160 μL of reagent B and react for 10 min. Measure the absorbance at 550 nm.

[0132] The phospholipase A1 specific activity of AN02-LPL, AN05-LPL, AN08-LPL, and CBS-Lipase B is as follows: Figure 1 As shown.

[0133] Figure 1The results showed that the specific enzyme activities of phospholipase A1 in AN02-LPL, AN05-LPL, AN08-LPL, and CBS-LipaseB were 20311 U / mg, 19677 U / mg, 17765 U / mg, and 19135 U / mg, respectively.

[0134] The DNA sequences identified were: AN02-LPL DNA sequence SEQ ID NO:7, AN05-LPL DNA sequence SEQ ID NO:8, AN08-LPL DNA sequence SEQ ID NO:9, CBS-Lipase B DNA sequence SEQ ID NO:10; AN02-LPL amino acid sequence SEQ ID NO:3, AN05-LPL amino acid sequence SEQ ID NO:4, AN08-LPL amino acid sequence SEQ ID NO:5, and CBS-Lipase B amino acid sequence SEQ ID NO:6.

[0135] Example 3: Lysophospholipase activity of AN02-LPL, AN05-LPL, AN08-LPL and CBS-lipase B

[0136] Similarly, shake-flask fermentation broths of AN02-LPL, AN04LPL (i.e., CBS-lipase B), AN05-LPL, and AN08-LPL were used, and lysophospholipase activity was determined using 1-palmitoylglycerol phosphocholine (lysophospholipid) as a substrate. The enzyme activity assay method is as follows:

[0137] 9ml substrate: 5ml 1% lysophospholipid, 1ml 20% Triton X-100, 2.5ml 0.1M citrate-sodium citrate buffer.

[0138] Mix 10 μL of diluted enzyme solution with 90 μL of substrate and react at 50°C for 10 min, then inactivate at 95°C for 5 min. Centrifuge at 7000 rpm for 5 min. Take 1 μL of the supernatant and add 80 μL of reagent A from the NEFA kit. React at 37°C for 10 min, then add 160 μL of reagent B and react for 10 min. Measure the absorbance at 550 nm.

[0139] The lysophospholipase specific activity of AN02-LPL, AN05-LPL, AN08-LPL, and CBS-Lipase B is as follows: Figure 2 As shown.

[0140] Figure 2 The results showed that the specific enzyme activities of AN02-LPL, AN05-LPL, AN08-LPL, and CBS-LipaseB were 22547 U / mg, 22134 U / mg, 21413 U / mg, and 22263 U / mg, respectively.

[0141] Example 4: Lipase activities of AN02-LPL, AN05-LPL, AN08-LPL and CBS-Lipase B

[0142] Similarly, shake-flask fermentation broths of AN02-LPL, AN05-LPL, and AN08-LPL were used, and lipase activity was determined using olive oil as a substrate. The lipase activity was determined by acid-base titration as follows:

[0143] Measure 150 ml of 4% PVA solution, add 50 ml of olive oil, emulsify using a high-speed homogenizer at 8000 rpm for 3 min, pause for 1 min, and then emulsify for another 3 min to prepare the substrate solution (this solution must be prepared fresh for use).

[0144] Enzyme activity definition and calculation formula

[0145] One unit of lipase activity is defined as the amount of enzyme that catalyzes the release of 1 μmol of fatty acid from a substrate per minute.

[0146] Enzyme activity calculation formula:

[0147]

[0148] In the formula: V: Volume of NaOH solution consumed by the titrating sample (ml)

[0149] V0: Volume of NaOH solution (ml) consumed in the titration of the blank sample.

[0150] t: Reaction time (min)

[0151] n: Enzyme solution volume (ml)

[0152] M: Concentration of the NaOH solution used in the titration (mmol / L)

[0153] The lipase specificity of AN02-LPL, AN05-LPL, AN08-LPL, and CBS-Lipase B is as follows: Figure 3 As shown.

[0154] according to Figure 3 As a result, the lipase specificity of AN02-LPL, AN05-LPL, AN08-LPL, and CBS-LipaseB was extremely low.

[0155] according to Figure 1-3The results showed that, compared to the specific activities of lysophospholipase and phospholipase A1, the specific activities of AN02-LPL, AN05-LPL, AN08-LPL, and CBS-Lipase B were 200 times less. Therefore, AN02-LPL, AN05-LPL, AN08-LPL, and CBS-Lipase B are clearly not practical as lipases.

[0156] Example 5: Debonding test of AN02-LPL, AN05-LPL and AN08-LPL

[0157] Take 60g of crude oil and shake well. Stir and heat the crude oil until the temperature stabilizes at 55℃. Add 50% CA·H2O 500ppm and shear at 20000rpm for 1.5min. Stir and react at 55℃ for 1h. Mix AN02-LPL, AN05-LPL, AN08-LPL, CBS-LipaseB with water and add the mixture. Shear at 200000rpm for 1.5min. Start timing when the temperature rises to 55℃ and react for 4h. After the reaction is completed, raise the temperature to 85℃ to inactivate the enzyme and maintain it for at least >8min. Centrifuge to obtain degummed oil and take a sample to the analysis and testing center for phosphorus content testing.

[0158] Amounts of each component added:

[0159] 60g crude oil; 1.8ml 3% H2O; 0.3ml 50ppm 1% AN02-LPL, AN05-LPL, AN08-LPL, or CBS-Lipase B; 0.03ml 500ppm 50% CA·H2O; 0.3ml 5% CA·H2O; 1.2ml H2O

[0160] The debonding test results for AN02-LPL, AN05-LPL, AN08-LPL, and CBS-LipaseB are as follows: Figure 4 As shown. According to Figure 4 As a result, AN02-LPL, AN05-LPL, AN08-LPL, and CBS-LipaseB can all reduce the phosphorus content of crude oil to below 10 ppm, achieving enzymatic degumming and meeting the standards for further physical refining.

[0161] Example 5: Expression and random mutation of AN02-LPL in Pichia pastoris

[0162] The mature peptide of AN02-LPL, as shown in SEQ ID NO:16, was selected and its gene sequence was synthesized by Sangon Biotech Co., Ltd. (optimized by Sangon Biotech Co., Ltd. based on Pichia pastoris codon preference). The sequence was cloned into the pET-pAOm-7-9PLC (Shanghai Sangon Biotech) vector to obtain the pic-AN02 plasmid. After linearization with BglII, 500 ng of the linearized DNA was used to transform the vector into competent cells of Pichia pastoris strain GS115 (purchased from Invitrogen) using electroporation. The transformants were inoculated onto MGYS plates (1.34% yeast nitrogen base (YNB) containing ammonium sulfate but no amino acids, 1% glycerol, 1M sorbitol, 4×10⁻⁶). -5 Pichia pastoris transformants of pic-AN02 were cultured on 2% D-biotin (2% agar) at 30°C for 3 days. Single colonies from the plates were picked and transferred to BMM-soybean lecithin selection plates. Clones with large white precipitate circles were selected and named pic-AN02-LPL.

[0163] Using pic-AN02-LPL as a template, error-prone PCR was performed on PLPL-1 / PLPL-2 using TaKaRa Taq enzyme and primers (with an additional 0.3 mM MnCl2 added during PCR) to obtain a set of mutant amplicon fragments of approximately 1000 bp. The obtained fragments were cloned into the pic-AN02 plasmid via Sac-II and EcoRI restriction sites, and the resulting vector was transformed into *E. coli* DH5α strain. The PLPL-1 / PLPL-2 sequences are shown below:

[0164] PLPL-1:TCCCCGCGGCGAAACGATGAGATTTCCTTC (SEQ ID NO:17),

[0165] PLPL-2: CCGGAATTCTTAAGAACACTCAGAAATG (SEQ ID NO: 18).

[0166] The plate containing the pic-AN02 mutant was washed with 2 ml of sterile water, plasmid was extracted, linearized with SalI, and a fragment of approximately 8.5 kb was recovered. 500 ng of the vector was transformed into competent Pichia pastoris GS115 cells using electroporation. The transformants were inoculated onto BMM-soybean lecithin selection plates and cultured at 30°C for 3 days to obtain the pic-AN02-LPL Pichia pastoris mutant library.

[0167] Forty-six mutant clones exhibiting white precipitate rings on BMM-soybean lecithin selection medium plates, along with two wild-type clones of pic-AN02-LPL, were transferred to two 24-well deep-plates. Each deep-plate contained 2 ml of BMGY medium. After 24 h of incubation, centrifugation was performed to remove the liquid medium, and 2 ml of BMMY medium was added for induction culture. After 72 h of induction culture, the fermentation supernatant was collected by centrifugation. The supernatant was diluted 10-fold with 0.1 M pH 4.0 citrate buffer and incubated at 60°C for 30 min; then diluted 20-fold (total dilution 200-fold), and 4 μL was taken for enzyme activity assay. Samples taken at 4°C were directly diluted 200-fold and 4 μL was used as a control for enzyme activity assay, recorded as 100%. The residual enzyme activity after heat treatment was calculated. The assay method is as follows:

[0168] 9.6ml substrate: 5ml 1% lysophospholipid, 1ml 20% Triton X-100, 2.5ml 0.1M citrate-sodium citrate buffer, add water to 9.6ml.

[0169] Add 4 μL of diluted enzyme solution and 96 μL of substrate, react at 50°C for 10 min, inactivate at 95°C for 5 min, centrifuge at 7000 rpm for 5 min, take 4 μL of supernatant, add 80 μL of reagent A from the NEFA kit, react at 37°C for 10 min, add 160 μL of reagent B, react for 10 min. Measure the absorbance at 550 nm.

[0170] The residual enzyme activity results of 48 samples after heat treatment are shown in Table 1. Among them, 6C and 6D are wild-type pic-AN02-LPL, and their average residual enzyme activity is 27.6%. The residual enzyme activity of mutant 1C is 66.3%, which is 2.4 times that of wild type, an increase of 140%.

[0171] Table 1

[0172] 1 2 3 4 5 6 36.6％ 31.3％ 27.8％ 17.5％ 34.9％ 30.0％ A 35.4％ 31.1％ 30.1％ 17.7％ 2.9％ 22.6％ B 66.3％ 28.0％ 30.2％ 14.3％ 17.1％ 26.8％ C 30.1％ 30.6％ 33.9％ 29.4％ 22.7％ 28.4％ D 9.9％ 23.9％ 8.5％ 18.4％ 2.4％ 8.2％ E 12.3％ 0.0％ 26.5％ 27.1％ 26.0％ 36.5％ F 6.4％ 7.3％ 37.2％ 21.3％ 33.3％ 38.0％ G 9.1％ 0.0％ 41.4％ 11.9％ 28.1％ 39.5％ H

[0173] Strain strain 1C was inoculated into 3 ml of YPD liquid medium and incubated overnight at 30°C. Genomic DNA was then extracted. Using the genomic DNA of strain pic-AN0m1 as a template, [the following was performed / conducted / etc.]. DNA polymerase and primer pair AOX-5 / 3'-AOX1 (where AOX-5: GACTGGTTCCAATTGACAACG (SEQ ID NO: 21), 3'-AOX1: GCAAATGGCATTCTGACATCC (SEQ ID NO: 22)) were used for PCR amplification to obtain the DNA sequence of the AN02 mutant in strain pic-AN02m1. The obtained sequence was sent to Shanghai Sangon Biotech Co., Ltd., and AOX-5 / 3'-AOX1 was sequenced using primer pair AOX-5. The amino acid sequencing results of the AN02 mutant of strain 1C are shown in SEQ ID NO: 19, with the mutation site being T255I, and its nucleotide sequence is shown in SEQ ID NO: 20.

[0174] The sequence in this invention possesses both phospholipase and lysophospholipase activities, and has wide applications in industry.

[0175] As a phospholipase, it can first be used in the degumming process of vegetable oils. During enzymatic degumming, phospholipids in vegetable oils (such as soybean oil, rapeseed oil, flaxseed oil, sunflower oil, etc.) are converted into lysophospholipids, which are more easily absorbed into the aqueous phase, and thus removed. Furthermore, the sequence of this invention exhibits good phospholipase activity at pH 4.0, allowing for pH adjustment without the addition of alkali during enzymatic degumming, thus reducing soap formation. Another industrial application of phospholipase is in baking, where it can improve the properties of dough and bread, such as dough viscosity and extensibility, and bread structure and color. It can also be used as a phospholipase for lysophospholipids with specific emulsifying properties.

[0176] Lysophospholipases can improve the filterability of hydrolyzed wheat starch syrups. Lysophospholipids have emulsifying properties, which typically make the filtration of hydrolyzed starch syrups difficult, especially those derived from wheat. Lysophospholipases break down lysophospholipids to form free fatty acids and water-soluble glycerophosphates. Removal of lysophospholipids improves the filterability and clarity of hydrolyzed starch syrups. Lysophospholipases can also increase the filtration rate of corn starch syrups.

[0177] Because it possesses both phospholipase and lysophospholipase activities, it can be used in the preparation of L-α-glycerophosphocholine. Under the catalysis of phospholipase activity, when the substrate is lecithin, the products are L-β-lysophosphatidylcholine and fatty acids. Under certain reaction systems and catalytic conditions, the acyl group at the sn-2 position of L-β-lysophosphatidylcholine will transfer to the sn-1 position, and then be hydrolyzed by the enzyme to generate L-α-glycerophosphocholine and fatty acids. L-α-glycerophosphocholine has wide applications in the pharmaceutical and health product fields.

[0178] Finally, it should be understood that while specific embodiments are described in various aspects of this specification, it will be readily apparent to those skilled in the art that these disclosed embodiments are merely illustrative of the principles of the subject matter disclosed herein. Therefore, it should be understood that, unless expressly stated otherwise, the disclosed subject matter is not limited to the specific combinations, methods, and / or formulations described herein. Furthermore, those skilled in the art will recognize that certain changes, modifications, substitutions, alterations, additions, reductions, and sub-combinations can be made in accordance with the teachings herein without departing from the spirit of this specification. Therefore, the appended claims are intended to be construed as including all such changes, modifications, substitutions, alterations, additions, reductions, and sub-combinations within their true spirit and scope. sequence list <110> Wilmar (Shanghai) Biotechnology R&D Center Co., Ltd. <120> Proteins with lysophospholipase and phospholipase activity <130> 123 <160> twenty four <170> SIPOSequenceListing 1.0 <210> 1 <211> 20 <212> DNA <213> Artificial sequence() <400> 1 atgtttctcc gcagggaatt 20 <210> 2 <211> 20 <212> DNA <213> Artificial sequence() <400> 2 ctacgagcat tcactaatgt 20 <210> 3 <211> 1072 <212> DNA <213> Aspergillus niger () <400> 3 atgtttctcc gcagggaatt tggggctgtt gcagccctat ctgtgctggc ccatgctgct 60 cccgcacctg ctccgatgca gcgtagaggt aagacacact taccaatttg cagaacaccc 120 gctaacctac tcagacatct cctctaccgt cttggacaat atcgacctct tcgcccaata 180 cagtgcagca gcttactgct cctcgaacat cgagtccacc ggcacgactc tgacctgcga 240 cgtaggcaat tgccctctcg tcgaggcagc cggtgccacg accatcgatg agtttgacga 300 gtaagccaat ccaaccccaa catcttcccc cacttggcat ccagctcaca cccccatagc 360 accagcagct acggcgaccc gactgggttc atcgccgttg acccaacgaa cgagttaatt 420 gttctgtctt tccggggtag ttccgacctc tcgaactgga ttgccgacct agacttcggc 480 ctcacctccg taagcagcat ctgtgatggc tgtgagatgc acaagggctt ctacgaggcc 540 tgggaagtca tcgcggacac catcactagc aaggtggagg ctgctgtctc cagctatccg 600 gactacaccc tcgtgttcac tggacacagc tacggcgctg cattggcggc tgtcgcggcc 660 accgtgctcc gcaacgccgg atacactctt gacctggtaa gttcctactc ttttatcctt 720 gtaacgttcc cccatcattc ggatggtcta ctaacacaat caacagtaca acttcggcca 780 gccccgtatt ggcaacctcg ccttagccga ctatatcacc ggccaaaata tgggcagcaa 840 ctaccgcgtc acgcacaccg atgacatcgt gcctaagctg cctccggagc tgctgggcta 900 ccaccacttc agcccggagt actggatcac cagcggtaat gatgtgacgg tgactacgtc 960 ggacgtgacc gaggtcgtgg gggtggattc gacggctggg aatgacggca cgctgcttga 1020 cagtacgact gcccatcggt ggtacacgat ctacattagt gaatgctcgt ag 1072 <210> 4 <211> 1072 <212> DNA <213> Aspergillus niger() <400> 4 ]atgtttctcc gcagggaatt tggggctgtt gcagccctat ctgtgctggc ccatgctgct 60 cccgcacctg ctccgatgca gcgtagaggt aagacacact tacccatttg cagaacaccc 120 gctaacatac tcagacatct cctctaccgt cttggacaat atcgacctct tcgcccaata 180 cagtgcagca gcttactgct cctccaacat cgagtccacc ggcacgactc tgacctgcga 240 cgtaggcaat tgccctctcg tcgaggcagc cggtgccacg accatcgatg agtttgacga 300 gtaagccaat ccaaccccaa cgtctcctcc cacttggcat ccagctcaca cccccatagc 360 agcagcagct acggcgaccc gacggggttc atcgccgttg acccgacgaa cgagttgatc 420 gttctgtctt tccggggtag ttccgacctc tcgaactgga ttgccgacct agacttcggc 480 ctcacctccg taagcagcat ctgtgatggc tgtgagatgc acaagggctt ctatgaggcc 540 tgggaagtca ttgccgacac catcacatcc aaggtggagg ccgctgtctc cagctatccg 600 gactacaccc tcgtgttcac cggacacagc tacggcgctg cattggcggc tgtcgcggcc 660 accgtgctcc gcaacgccgg atacactctt gacctggtag gcccctaccc ttgtattttt 720 gctatgttcc tccatcattt ggatggtcta ctaacacaat cgacagtaca acttcggcca 780 gccccgtatc ggcaacctcg ccttagccga ctacatcacc gaccaaaaca tgggcagcaa 840 ctaccgcgtc acgcacaccg acgacatcgt gcctaagctg cctccggagc tgctgggcta 900 ccaccacttc agtccggagt actggatcac cagcggtaat gatgtgacgg tgactacgtc 960 ggacgtgacc gaggttgtgg gggtggattc gacggatggg aatgacggca cgctgcttga 1020 cagtacgact gcccatcggt ggtacacgat ctacattagt gaatgctcgt ag 1072 <210> 5 <211> 1072 <212> DNA <213> Aspergillus niger() <400> 5 atgtttctcc gcagggaatt tggggctgtt gcagccctat ctgtgctggc ccatgctgct 60 cccgcacctg ctccgatgca gcgtagaggt aagacacact tacccatttg cagaacaccc 120 gctaacatac tcagacatct cctctaccgt cttggacaat atcgacctct tcgcccaata 180 cagtgcagca gcttactgct cctccaacat tgagtccacc ggcacgactc tgacctgcga 240 cgtaggcaat tgccccctcg tcgaggcagc cggtgccacg accatcgatg agtttgacga 300 gtaagccaat ccaaccccaa cgtctcctcc cacttggcat ccagctcaca cccccatagc 360 agcagcagct acggcgatcc gacggggttc atcgccgttg acccgacgaa cgagttaatc 420 gttctgtctt tccggggcag ttccgacctc tcgaactgga ttgccgacct agacttcggc 480 ctcacctccg taagcagcat ctgtgatggc tgtgagatgc acaagggctt ctacgaggcc 540 tgggaagtca ttgccgacac tatcacatcc aaggtggagg ccgccgtctc cagctatccg 600 gactacaccc tcgtgttcac cggacacagc tacggtgctg cattggcggc tgtcgcggcc 660 accgtgctcc gcaacgccgg atacactctt gacctggtag gcccctaccc ttgtattctt 720 gttatgttct tccatccttc ggatagtcta ctaacacaat cgacagtaca acttcggcca 780 gccccgtatc ggcaaccttg ctttagccga ctacatcacc gaccaaaaca tgggcggcaa 840 ctaccgtgtc acacacaccg atgacatcgt gcctaagctg cctccggagc tgctgggcta 900 ccaccacttc agtccggagt actggatcac cagcggtaat gatgtgacgg tgactacgtc 960 ggacgtgacc gaggttgtgg gggtggattc gacggatggg aatgacggca cgctgcttga 1020 cagtacgact gcccatcggt ggtacacgat ctacattagt gaatgctcgt ag 1072 <210> 6 <211> 1072 <212> DNA <213> Aspergillus niger() <400> 6 atgtttctcc gcagggaatt tggggctgtt gcagccctat ctgtgctggc ccatgctgct 60 cccgcacctg ctccgatgca gcgtagaggt aagacacact tacccatttg cagaaattcc 120 gctaatatac tcagacatct cctctaccgt cttggacaat atcgacctct tcgcccaata 180 cagtgcagca gcttactgct cctccaacat cgagtccacc ggcacgactc tgacctgcga 240 cgtaggcaat tgccctctcg tcgaggcagc cggtgccacg accatcgatg agtttgacga 300 gtaagccaat ccaaccccaa cgtctcctcc cacttggcat ccagctcaca cccccatagc 360 agcagcagct acggcgaccc gacggggttc atcgccgttg acccgacgaa cgagttaatc 420 gttctgtctt tccggggcag ttccgacctc tcgaactgga ttgccgacct agacttcggc 480 ctcacatccg taagcagcat ctgtgatggc tgtgagatgc acaagggctt ctacgaggcc 540 tgggaagtca ttgccgacac catcacatcc aaggtggagg ccgccgtctc cagctatccg 600 gactacaccc tcgtgttcac cggacacagc tacggcgctg cattggcggc tgtcgcggcc 660 accgtgctcc gcaacgccgg atacactctt gacctggtaa gttcctactc ttttatcctt 720 gtaatgttcc tccgtcattc ggatagtcta ctaaatcaat cgacagtaca acttcggcca 780 gccccgtatt ggcaacctcg ccttagccga ctacatcacc gaccaaaaca tgggcagcaa 840 ctaccgcgtc acgcacaccg atgacatcgt gcctaagctg cctccggagc tgctgggcta 900 ccaccacttc agtccggagt actggatcac cagcggcaat gatgtgacgg tgacaacgtc 960 ggacgtcacc gaggtcgtgg gggtggattc gacggctggg aatgacggca cgctgcttga 1020 cagtacgact gcccatcggt ggtacacgat ctacattagt gaatgctcgt ag 1072 <210> 7 <211> 298 <212> PRT <213> Aspergillus niger() <400> 7 Met Phe Leu Arg Arg Glu Phe Gly Ala Val Ala Ala Leu Ser Val Leu 1 5 10 15 Ala His Ala Ala Pro Ala Pro Ala Pro Met Gln Arg Arg Asp Ile Ser 20 25 30 Ser Thr Val Leu Asp Asn Ile Asp Leu Phe Ala Gln Tyr Ser Ala Ala 35 40 45 Ala Tyr Cys Ser Ser Asn Ile Glu Ser Thr Gly Thr Thr Leu Thr Cys 50 55 60 Asp Val Gly Asn Cys Pro Leu Val Glu Ala Ala Gly Ala Thr Thr Ile 65 70 75 80 Asp Glu Phe Asp Asp Thr Ser Ser Tyr Gly Asp Pro Thr Gly Phe Ile 85 90 95 Ala Val Asp Pro Thr Asn Glu Leu Ile Val Leu Ser Phe Arg Gly Ser 100 105 110 Ser Asp Leu Ser Asn Trp Ile Ala Asp Leu Asp Phe Gly Leu Thr Ser 115 120 125 Val Ser Ser Ile Cys Asp Gly Cys Glu Met His Lys Gly Phe Tyr Glu 130 135 140 Ala Trp Glu Val Ile Ala Asp Thr Ile Thr Ser Lys Val Glu Ala Ala 145 150 155 160 Val Ser Ser Tyr Pro Asp Tyr Thr Leu Val Phe Thr Gly His Ser Tyr 165 170 175 Gly Ala Ala Leu Ala Ala Val Ala Ala Thr Val Leu Arg Asn Ala Gly 180 185 190 Tyr Thr Leu Asp Leu Tyr Asn Phe Gly Gln Pro Arg Ile Gly Asn Leu 195 200 205 Ala Leu Ala Asp Tyr Ile Thr Gly Gln Asn Met Gly Ser Asn Tyr Arg 210 215 220 Val Thr His Thr Asp Asp Ile Val Pro Lys Leu Pro Pro Glu Leu Leu 225 230 235 240 Gly Tyr His His Phe Ser Pro Glu Tyr Trp Ile Thr Ser Gly Asn Asp 245 250 255 Val Thr Val Thr Thr Ser Asp Val Thr Glu Val Val Gly Val Asp Ser 260 265 270 Thr Ala Gly Asn Asp Gly Thr Leu Leu Asp Ser Thr Thr Ala His Arg 275 280 285 Trp Tyr Thr Ile Tyr Ile Ser Glu Cys Ser 290 295 <210> 8 <211> 298 <212> PRT <213> Aspergillus niger() <400> 8 Met Phe Leu Arg Arg Glu Phe Gly Ala Val Ala Ala Leu Ser Val Leu 1 5 10 15 Ala His Ala Ala Pro Ala Pro Ala Pro Met Gln Arg Arg Asp Ile Ser 20 25 30 Ser Thr Val Leu Asp Asn Ile Asp Leu Phe Ala Gln Tyr Ser Ala Ala 35 40 45 Ala Tyr Cys Ser Ser Asn Ile Glu Ser Thr Gly Thr Thr Leu Thr Cys 50 55 60 Asp Val Gly Asn Cys Pro Leu Val Glu Ala Ala Gly Ala Thr Thr Ile 65 70 75 80 Asp Glu Phe Asp Asp Ser Ser Ser Tyr Gly Asp Pro Thr Gly Phe Ile 85 90 95 Ala Val Asp Pro Thr Asn Glu Leu Ile Val Leu Ser Phe Arg Gly Ser 100 105 110 Ser Asp Leu Ser Asn Trp Ile Ala Asp Leu Asp Phe Gly Leu Thr Ser 115 120 125 Val Ser Ser Ile Cys Asp Gly Cys Glu Met His Lys Gly Phe Tyr Glu 130 135 140 Ala Trp Glu Val Ile Ala Asp Thr Ile Thr Ser Lys Val Glu Ala Ala 145 150 155 160 Val Ser Ser Tyr Pro Asp Tyr Thr Leu Val Phe Thr Gly His Ser Tyr 165 170 175 Gly Ala Ala Leu Ala Ala Val Ala Ala Thr Val Leu Arg Asn Ala Gly 180 185 190 Tyr Thr Leu Asp Leu Tyr Asn Phe Gly Gln Pro Arg Ile Gly Asn Leu 195 200 205 Ala Leu Ala Asp Tyr Ile Thr Asp Gln Asn Met Gly Ser Asn Tyr Arg 210 215 220 Val Thr His Thr Asp Asp Ile Val Pro Lys Leu Pro Pro Glu Leu Leu 225 230 235 240 Gly Tyr His His Phe Ser Pro Glu Tyr Trp Ile Thr Ser Gly Asn Asp 245 250 255 Val Thr Val Thr Thr Ser Asp Val Thr Glu Val Val Gly Val Asp Ser 260 265 270 Thr Asp Gly Asn Asp Gly Thr Leu Leu Asp Ser Thr Thr Ala His Arg 275 280 285 Trp Tyr Thr Ile Tyr Ile Ser Glu Cys Ser 290 295 <210> 9 <211> 298 <212> PRT <213> Aspergillus niger() <400> 9 Met Phe Leu Arg Arg Glu Phe Gly Ala Val Ala Ala Leu Ser Val Leu 1 5 10 15 Ala His Ala Ala Pro Ala Pro Ala Pro Met Gln Arg Arg Asp Ile Ser 20 25 30 Ser Thr Val Leu Asp Asn Ile Asp Leu Phe Ala Gln Tyr Ser Ala Ala 35 40 45 Ala Tyr Cys Ser Ser Asn Ile Glu Ser Thr Gly Thr Thr Leu Thr Cys 50 55 60 Asp Val Gly Asn Cys Pro Leu Val Glu Ala Ala Gly Ala Thr Thr Ile 65 70 75 80 Asp Glu Phe Asp Asp Ser Ser Ser Tyr Gly Asp Pro Thr Gly Phe Ile 85 90 95 Ala Val Asp Pro Thr Asn Glu Leu Ile Val Leu Ser Phe Arg Gly Ser 100 105 110 Ser Asp Leu Ser Asn Trp Ile Ala Asp Leu Asp Phe Gly Leu Thr Ser 115 120 125 Val Ser Ser Ile Cys Asp Gly Cys Glu Met His Lys Gly Phe Tyr Glu 130 135 140 Ala Trp Glu Val Ile Ala Asp Thr Ile Thr Ser Lys Val Glu Ala Ala 145 150 155 160 Val Ser Ser Tyr Pro Asp Tyr Thr Leu Val Phe Thr Gly His Ser Tyr 165 170 175 Gly Ala Ala Leu Ala Ala Val Ala Ala Thr Val Leu Arg Asn Ala Gly 180 185 190 Tyr Thr Leu Asp Leu Tyr Asn Phe Gly Gln Pro Arg Ile Gly Asn Leu 195 200 205 Ala Leu Ala Asp Tyr Ile Thr Asp Gln Asn Met Gly Gly Asn Tyr Arg 210 215 220 Val Thr His Thr Asp Asp Ile Val Pro Lys Leu Pro Pro Glu Leu Leu 225 230 235 240 Gly Tyr His His Phe Ser Pro Glu Tyr Trp Ile Thr Ser Gly Asn Asp 245 250 255 Val Thr Val Thr Thr Ser Asp Val Thr Glu Val Val Gly Val Asp Ser 260 265 270 Thr Asp Gly Asn Asp Gly Thr Leu Leu Asp Ser Thr Thr Ala His Arg 275 280 285 Trp Tyr Thr Ile Tyr Ile Ser Glu Cys Ser 290 295 <210> 10 <211> 298 <212> PRT <213> Aspergillus niger() <400> 10 Met Phe Leu Arg Arg Glu Phe Gly Ala Val Ala Ala Leu Ser Val Leu 1 5 10 15 Ala His Ala Ala Pro Ala Pro Ala Pro Met Gln Arg Arg Asp Ile Ser 20 25 30 Ser Thr Val Leu Asp Asn Ile Asp Leu Phe Ala Gln Tyr Ser Ala Ala 35 40 45 Ala Tyr Cys Ser Ser Asn Ile Glu Ser Thr Gly Thr Thr Leu Thr Cys 50 55 60 Asp Val Gly Asn Cys Pro Leu Val Glu Ala Ala Gly Ala Thr Thr Ile 65 70 75 80 Asp Glu Phe Asp Asp Ser Ser Ser Tyr Gly Asp Pro Thr Gly Phe Ile 85 90 95 Ala Val Asp Pro Thr Asn Glu Leu Ile Val Leu Ser Phe Arg Gly Ser 100 105 110 Ser Asp Leu Ser Asn Trp Ile Ala Asp Leu Asp Phe Gly Leu Thr Ser 115 120 125 Val Ser Ser Ile Cys Asp Gly Cys Glu Met His Lys Gly Phe Tyr Glu 130 135 140 Ala Trp Glu Val Ile Ala Asp Thr Ile Thr Ser Lys Val Glu Ala Ala 145 150 155 160 Val Ser Ser Tyr Pro Asp Tyr Thr Leu Val Phe Thr Gly His Ser Tyr 165 170 175 Gly Ala Ala Leu Ala Ala Val Ala Ala Thr Val Leu Arg Asn Ala Gly 180 185 190 Tyr Thr Leu Asp Leu Tyr Asn Phe Gly Gln Pro Arg Ile Gly Asn Leu 195 200 205 Ala Leu Ala Asp Tyr Ile Thr Asp Gln Asn Met Gly Ser Asn Tyr Arg 210 215 220 Val Thr His Thr Asp Asp Ile Val Pro Lys Leu Pro Pro Glu Leu Leu 225 230 235 240 Gly Tyr His His Phe Ser Pro Glu Tyr Trp Ile Thr Ser Gly Asn Asp 245 250 255 Val Thr Val Thr Thr Ser Asp Val Thr Glu Val Val Gly Val Asp Ser 260 265 270 Thr Ala Gly Asn Asp Gly Thr Leu Leu Asp Ser Thr Thr Ala His Arg 275 280 285 Trp Tyr Thr Ile Tyr Ile Ser Glu Cys Ser 290 295 <210> 11 <211> 108 <212> DNA <213> Artificial sequence () <400> 11 cccaagcttt ttccaactca atttacctct atccacactt ctcttccttc ctcaatcctc 60 tatatacaca actggggatc cttcaccatg atggtcgcgt ggtggtct 108 <210> 12 <211> 83 <212> DNA <213> Artificial sequence () <400> 12 atgatggtcg cgtggtggtc tctatttctg tacggccttc aggtcgcggc acctgctttg 60 gctgctcccg cacctgctcc gat 83 <210> 13 <211> 26 <212> DNA <213> Artificial sequence () <400> 13 acatgcatgc ctaggagcac tcggag 26 <210> 14 <211> 78 <212> DNA <213> Artificial sequence () <400> 14 tttccaactc aatttacctc tatccacact tctcttcctt cctcaatcct ctatatacac 60 aactggggat ccttcacc 78 <210> 15 <211> 63 <212> DNA <213> Artificial Sequence() <400> 15 atgatggtcg cgtggtggtc tctatttctg tacggccttc aggtcgcggc acctgctttg 60 gct 63 <210> 16 <211> 269 <212> PRT <213> Aspergillus niger() <400> 16 [[ID=!20]]Asp Ile Ser Ser Thr Val Leu Asp Asn Ile Asp Leu Phe Ala Gln Tyr 1 5 10 15 Ser Ala Ala Ala Tyr Cys Ser Ser Asn Ile Glu Ser Thr Gly Thr Thr 20 25 30 Leu Thr Cys Asp Val Gly Asn Cys Pro Leu Val Glu Ala Ala Gly Ala 35 40 45 Thr Thr Ile Asp Glu Phe Asp Asp Thr Ser Ser Tyr Gly Asp Pro Thr 50 55 60 Gly Phe Ile Ala Val Asp Pro Thr Asn Glu Leu Ile Val Leu Ser Phe 65 70 75 80 Arg Gly Ser Ser Asp Leu Ser Asn Trp Ile Ala Asp Leu Asp Phe Gly 85 90 95 Leu Thr Ser Val Ser Ser Ile Cys Asp Gly Cys Glu Met His Lys Gly 100 105 110 Note: There seems to be a formatting issue with the original text where line breaks are a bit irregular. I've tried to maintain the overall structure as closely as possible during translation. Also, the "!" in the translation of ID=20 is just to mark the original text for reference in case there's a mistake in the translation. In a proper translation, it should be removed.Phe Tyr Glu Ala Trp Glu Val Ile Ala Asp Thr Ile Thr Ser Lys Val 115 120 125 Glu Ala Ala Val Ser Ser Tyr Pro Asp Tyr Thr Leu Val Phe Thr Gly 130 135 140 His Ser Tyr Gly Ala Ala Leu Ala Ala Val Ala Ala Thr Val Leu Arg 145 150 155 160 Asn Ala Gly Tyr Thr Leu Asp Leu Tyr Asn Phe Gly Gln Pro Arg Ile 165 170 175 Gly Asn Leu Ala Leu Ala Asp Tyr Ile Thr Gly Gln Asn Met Gly Ser 180 185 190 Asn Tyr Arg Val Thr His Thr Asp Asp Ile Val Pro Lys Leu Pro Pro 195 200 205 Glu Leu Leu Gly Tyr His His Phe Ser Pro Glu Tyr Trp Ile Thr Ser 210 215 220 Gly Asn Asp Val Thr Val Thr Thr Ser Asp Val Thr Glu Val Val Gly 225 230 235 240 Val Asp Ser Thr Ala Gly Asn Asp Gly Thr Leu Leu Asp Ser Thr Thr 245 250 255 Ala His Arg Trp Tyr Thr Ile Tyr Ile Ser Glu Cys Ser 260 265 <210> 17 <211> 30 <212> DNA <213> Artificial sequence () <400> 17 tccccgcggc gaaacgatga gatttccttc 30 <210> 18 <211> 28 <212> DNA <213> Artificial sequence () <400> 18 ccggaattct taagaacact cagaaatg 28 <210> 19 <211> 269 <212> PRT <213> Aspergillus niger () <400> 19 Asp Ile Ser Ser Thr Val Leu Asp Asn Ile Asp Leu Phe Ala Gln Tyr 1 5 10 15 Ser Ala Ala Ala Tyr Cys Ser Ser Asn Ile Glu Ser Thr Gly Thr Thr 20 25 30 Leu Thr Cys Asp Val Gly Asn Cys Pro Leu Val Glu Ala Ala Gly Ala 35 40 45 Thr Thr Ile Asp Glu Phe Asp Asp Thr Ser Ser Tyr Gly Asp Pro Thr 50 55 60 Gly Phe Ile Ala Val Asp Pro Thr Asn Glu Leu Ile Val Leu Ser Phe 65 70 75 80 Arg Gly Ser Ser Asp Leu Ser Asn Trp Ile Ala Asp Leu Asp Phe Gly 85 90 95 Leu Thr Ser Val Ser Ser Ile Cys Asp Gly Cys Glu Met His Lys Gly 100 105 110 Phe Tyr Glu Ala Trp Glu Val Ile Ala Asp Thr Ile Thr Ser Lys Val 115 120 125 Glu Ala Ala Val Ser Ser Tyr Pro Asp Tyr Thr Leu Val Phe Thr Gly 130 135 140 His Ser Tyr Gly Ala Ala Leu Ala Ala Val Ala Ala Thr Val Leu Arg 145 150 155 160 Asn Ala Gly Tyr Thr Leu Asp Leu Tyr Asn Phe Gly Gln Pro Arg Ile 165 170 175 Gly Asn Leu Ala Leu Ala Asp Tyr Ile Thr Gly Gln Asn Met Gly Ser 180 185 190 Asn Tyr Arg Val Thr His Thr Asp Asp Ile Val Pro Lys Leu Pro Pro 195 200 205 Glu Leu Leu Gly Tyr His His Phe Ser Pro Glu Tyr Trp Ile Thr Ser 210 215 220 Gly Asn Asp Val Thr Val Thr Thr Ser Asp Val Thr Glu Val Val Gly 225 230 235 240 Val Asp Ser Thr Ala Gly Asn Asp Gly Thr Leu Leu Asp Ser Ile Thr 245 250 255 Ala His Arg Trp Tyr Thr Ile Tyr Ile Ser Glu Cys Ser 260 265 <210> 20 <211> 810 <212> DNA <213> Aspergillus niger() <400> 20 gatatttctt ctaccgtttt ggataacatt gatttgttcg ctcaatactc cgctgctgct 60 tactgttctt ctaacattga gtctactggt accactttga cttgtgacgt tggtaactgt 120 ccattggttg aggctgctgg tgctaccact attgatgagt tcgatgatac ttcctcttac 180 ggtgatccta ctggtttcat tgctgttgac cctactaacg agttgattgt tttgtctttt 240 agaggttctt ctgacttgtc taactggatt gctgatttgg atttcggttt gacttctgtt 300 tcttctattt gtgacggttg tgaaatgcac aagggtttct atgaagcctg ggaagttatt 360 gctgatacta ttacttctaa ggttgaagct gctgtttctt cttacccaga ttacactttg 420 gttttcaccg gtcactctta cggtgctgcc ttggctgctg ttgctgctac tgttttgaga 480 aacgctggtt acactttgga tttgtacaac tttggtcaac caagaattgg taacttggct 540 ttggctgact acattactgg tcaaaacatg ggttctaact acagagttac tcacactgat 600 gatattgttc ctaagttgcc accagagttg ttgggttacc accacttctc cccagagtac 660 tggattactt ctggtaacga tgttactgtt accacttctg atgttactga ggttgttggt 720 gttgattcca ccgctggtaa cgatggtact ttgttggact ctattactgc tcacagatgg 780 tacaccattt acatttctga gtgttcttaa 810 <210> 21 <211> 21 <212> DNA <213> Artificial sequence () <400> 21 gactggttcc aattgacaac g 21 <210> 22 <211> 21 <212> DNA <213> Artificial sequence () <400> 22 gcaaatggca ttctgacatc c 21 <210> 23 <211> 1020 <212> DNA <213> Artificial sequence () <400> 23 gtgccaatca agagacaatc aaacagcacg gtggatagtc tgccacccct catcccctct 60 cgaacctcgg caccttcatc atcaccaagc acaaccgacc ctgaagctcc agccatgagt 120 cgcaatggac cgctgccctc ggatgtagag actaaatatg gcatggcttt gaatgctact 180 tcctatccgg attctgtggt ccaagcaatg agcattgatg gtggtatccg cgctgcgacc 240 tcgcaagaaa tcaatgaatt gacttattac actacactat ctgccaactc gtactgccgc 300 actgtcattc ctggagctac ctgggactgt atccactgtg atgcaacgga ggatctcaag 360 attatcaaga cttggagcac gctcatctat gatacaaatg caatggttgc acgtggtgac 420 agcgaaaaaa ctatctatat cgttttccga ggttcgagct ctatccgcaa ctggattgct 480 gatctcacct ttgtgccagt ttcatatcct ccggtcagtg gtacaaaagt acacaaggga 540 ttcctggaca gttacggggga agttcaaaac gagcttgttg ctactgttct tgatcaattc 600 aagcaatatc caagctacaa ggttgctgtt acaggtcact cactcggtgg tgctactgcg 660 ttgctttgcg ccctgggtct ctatcaacga gaaggac tctcatccag caacttgttc 720 ctttacactc aaggtcaacc acgggtaggc gaccctgcct ttgccaacta cgttgttagc 780 accggcattc cttacaggcg cacggtcaat gaacgagata tcgttcctca tcttccacct 840 gctgcttttg gttttctcca cgctggcgag gagtattgga ttactgacaa tagcccagag 900 actgttcagg tctgcacaag cgatctggaa acctctgatt gctctaacag cattgttccc 960 ttcacaagtg ttcttgacca tctctcgtac tttggtatca acacaggcct ctgtacttaa 1020 <210> 24 <211> 43 <212> DNA <213> Artificial Sequence () <400> 24 gtcgtgtcgg gcatttatcg ggggatggac caatcagcgt agg 43

Claims

1. A protein possessing lysophospholipase and / or phospholipase activity, characterized in that, The protein sequence is shown in SEQ ID NO:

19.

2. A polynucleotide, characterized in that, The polynucleotide is selected from: (1) a polynucleotide encoding the protein of claim 1; and (2) a polynucleotide whose sequence is complementary to that of (1).

3. The polynucleotide as described in claim 2, characterized in that... The sequence of the polynucleotide is shown in SEQ ID NO:

20.

4. A polynucleotide construct, characterized in that, The polynucleotide construct contains the polynucleotide as described in claim 2 or 3.

5. The polynucleotide construct as described in claim 4, wherein it is an expression vector or a cloning vector.

6. A host cell, characterized in that, The host cell: (1) expresses the protein of claim 1; or (2) contains the polynucleotide of claim 2 or 3 or the polynucleotide construct of claim 4 or 5.

7. The host cell as described in claim 6, wherein the host cell is selected from prokaryotic or eukaryotic microorganisms.

8. The host cell as described in claim 7, wherein the host cell is selected from Aspergillus niger, Pichia pastoris, Escherichia coli, Bacillus, Trichoderma reesei, or Aspergillus oryzae.

9. A composition comprising the protein of claim 1.

10. The composition of claim 9, wherein it is an enzyme composition.

11. The composition according to claim 10, characterized in that, The enzyme composition further includes phospholipase A1, phospholipase A2, phospholipase B, phospholipase C, amylase, lipase, protease and / or cellulase.

12. The composition according to any one of claims 9-11, characterized in that, The composition is a fermentation expression of the host cell as described in any one of claims 6-8.

13. The composition according to claim 12, characterized in that, The fermentation expression product is fermentation broth, fermentation concentrate, or fermentation supernatant.

14. A composition, characterized in that, The composition contains the protein of claim 1 and optional excipients.

15. The composition according to claim 14, characterized in that, The auxiliary material is an adsorbent material selected from activated carbon, alumina, diatomaceous earth, porous ceramics, and porous glass.

16. A method for preparing the protein of claim 1, comprising the step of fermenting the host cell of any one of claims 6-8.

17. The use of the protein of claim 1, the polynucleotide of claim 2 or 3, the polynucleotide construct of claim 4 or 5, the host cell of any one of claims 6-8, or the composition of any one of claims 9-15 in vegetable oil degumming, bread dough modification, starch hydrolysis product treatment, lysophospholipase preparation, and / or L-α-glycerophosphocholine preparation.

Images