A fluorescent compound and preparation method thereof, fluorescent modified nucleotide, and kit

Abstract

The present invention relates to the technical field of organic compound reagents, and in particular to a fluorescent compound and a preparation method thereof, a fluorescently modified nucleotide, and a kit, wherein the fluorescently modified nucleotide can be applied to a nucleic acid sequencing reaction of sequencing by synthesis. 5 The connection structure between the fluorescent compound core structure is a heteroalkyl structure containing an ether bond-(CH 2 ) m ‑O‑(CH 2 ) n ‑COR 5 ‑Connected to the core structure of the fluorescent compound, the modified nucleotide formed by the fluorescent compound as a modified molecule is used as the polymerase affinity in the nucleic acid sequencing reaction process, thereby improving the incorporation efficiency and the sequencing quality.

Description

Technical Field

[0001] The present invention relates to the technical field of organic compound reagents, and in particular to a fluorescent compound and a preparation method thereof, a fluorescently modified nucleotide, and a kit. The fluorescently modified nucleic acid is applied to nucleic acid sequencing. Background Art

[0002] Fluorescent dyes have found widespread use as detection labels in molecular biology, cell biology, and analytical genetics. For example, fluorescent-labeled oligonucleotides are now used in a variety of different assays, including nucleotide sequencing, fluorescence in situ hybridization, nucleotide array-based hybridization assays, fluorescence polarization studies, and nucleic acid amplification assays.

[0003] As an important experimental technique, DNA sequencing has been widely used in biological research. DNA sequencing technology was reported shortly after the discovery of the double helix structure of DNA, but the operation process was complicated at that time and it failed to form a large scale. Then in 1977, Sanger invented the landmark terminal termination sequencing method, and in the same year AM Maxam and W. Gilbert invented the chemical degradation method. The Sanger method has become the mainstream of DNA sequencing so far because it is simple and fast, and has been continuously improved. However, with the development of science, traditional Sanger sequencing can no longer fully meet the needs of research. The genome resequencing of model organisms and the genome sequencing of some non-model organisms require sequencing technologies with lower costs, higher throughput and faster speeds. The second-generation sequencing technology (Next-generation sequencing) came into being. The basic principle of the second-generation sequencing technology is sequencing while synthesizing, using four different dNTPs with different colors of fluorescent labels. When DNA polymerase synthesizes complementary chains, each added dNTP will release different fluorescence. According to the captured fluorescence signal and processed by specific computer software, the sequence information of the DNA to be tested can be obtained.

[0004] However, there are multiple factors that limit the selection of fluorescent markers when using different color fluorescent labeled nucleotides for multiple fluorescence detection. First, because the absorption bands of dyes are usually widely separated, when several fluorescent dyes are used together, it is necessary to select dye compounds that can be properly spectrally resolved and to consider maximizing the distinguishability of the luminescent signals of different fluorescent dyes; second, because many excitation methods use high-power lasers, the dye compounds need to have sufficient photostability to withstand laser excitation during the detection process; in addition, the most important thing is to consider that the fluorescent dye must be compatible with other reagents used, such as buffers, polymerases, ligases, etc., especially the nucleic acids modified with fluorescent dyes need to be recognizable by polymerases. And with the continuous development of sequencing technology, people have found that fluorescent dye molecules with improved fluorescence properties (such as fluorescence intensity, the position of the fluorescence maximum, and the shape of the fluorescence band) can improve the speed and accuracy of nucleic acid sequencing. Because the buffer environment of the sequencing reaction, the temperature environment of the sequencing reaction, and the base structure of the nucleic acid can affect the luminescence properties of the fluorescent compound, such as the fluorescence maximum and fluorescence intensity. As a result, people gradually began to adjust and improve the structure of fluorescent compounds to improve the sequence-specific interaction between fluorescent compounds and nucleobases, thereby improving the luminescence performance of fluorescent compounds during sequencing. At the same time, improving the efficiency of modified nucleic acid incorporation, reducing the error level of sequencing, reducing the use of reagents in nucleic acid sequencing, and reducing the cost of nucleic acid sequencing through the improvement of the structure of fluorescent compounds has become a research hotspot. Summary of the invention

[0005] One of the purposes of the present invention is to provide a fluorescent compound that can be used as a fluorescent modified structure of a modified nucleotide for nucleic acid sequencing, thereby increasing the polymerase affinity of the fluorescent modified nucleic acid, increasing the incorporation efficiency, and improving the sequencing quality.

[0006] A second object of the present invention is to provide a method for preparing a fluorescent compound.

[0007] The third object of the present invention is to provide fluorescent modified nucleotides modified by connecting to the fluorescent compounds of the present invention, which are applied to the sequencing-by-synthesis system to improve the incorporation efficiency of the modified nucleic acid and improve the sequencing quality.

[0008] At the same time, the present invention also provides a kit, comprising the fluorescent modified nucleotides provided by the present invention, which is applied to nucleic acid sequencing.

[0009] In order to achieve the above object, the technical solution adopted by the present invention is as follows:

[0010] A fluorescent compound is formed by a compound having a chemical structural formula shown in formula (I):

[0011] (I);

[0012] Wherein P is an integer of 1 to 5; m and n are integers of 1 to 3;

[0013] R1 and R2 are each independently an alkyl group or a substituted alkyl group;

[0014] R3 and R4 are each independently H, halogen, SO3 - , sulfonamide, or another ring fused to an adjacent carbon atom;

[0015] At least one of R1, R2, R3, and R4 has a sulfonic acid group;

[0016] R5 is OR6 or NR6R7, wherein R6 and R7 are independently H, alkyl or substituted alkyl, aryl or substituted aryl.

[0017] It should be explained that the compound formed by the chemical structure general formula shown in formula (I) means that the structure of the fluorescent compound can be the chemical structure shown in formula (I), it can also be the racemic body of the chemical structure shown in formula (I), or it can be other resonance structures of the chemical structure shown in formula (I).

[0018] The fluorescent compound of the present invention is used as a marker with fluorescence as a detection signal, and is usually attached to a reagent that reacts during the detection process, such as a protein reagent, a nucleic acid reagent, etc., by covalent bonding, surface conjugation or other forms; the present invention specifically illustrates the use of the fluorescent compound of the present invention as a fluorescent modification group of a nucleotide. Specifically, the fluorescent compound of the present invention is attached to a nucleotide via a linker to form a modified nucleotide, so that the modified nucleotide has a unique fluorescent property, and the presence of the modified nucleotide is determined by detecting the fluorescent signal, and even the type of the modified nucleotide is determined. The fluorescent compound of the present invention is usually attached to a nucleotide via -COR5- as a linker to form a modified nucleotide. The present invention creatively improves the connection structure between -COR5- and the core structure of the fluorescent compound, and adopts a heteroalkyl structure -(CH2) containing an ether bond. m -O-(CH2) n - as a connecting structure to connect the linker -COR5- to the core structure of the fluorescent compound, thereby improving the incorporation efficiency of the modified nucleotide formed by the fluorescent compound as a modified molecule during the nucleic acid sequencing reaction and improving the sequencing quality.

[0019] In a most preferred embodiment of the present invention, in the structure of the fluorescent compound, m is 3, n is 1; R3 is H, R4 is sulfonamide; R1 is -(CH2)4 SO3 -, R2 is methyl; P is 2 or 4; it should be understood that, without affecting the fluorescent properties of the fluorescent compound claimed in the present invention and other properties of the modified nucleotide formed as a modified molecule, the substituents at different positions of the core structure of the fluorescent compound of the present invention may also be other structural substituents, m and n are integers of 1 to 3; P is an integer of 1 to 5.

[0020] The preparation method of the fluorescent compound is prepared using compounds represented by formula (i), formula (ii) and formula (iii) as raw materials:

[0021] (i) (ii) (iii);

[0022] Wherein R1 and R2 are each independently an alkyl group or a substituted alkyl group; R3 and R4 are each independently H, halogen, SO3 - , sulfonamide or another ring fused to an adjacent carbon atom; at least one of R1, R2, R3, and R4 has a sulfonic acid group; and t is an integer from 1 to 5.

[0023] The fluorescent compound is attached to the nucleotide via the linker R5 to form a fluorescent modified nucleotide, usually at the C5 position of the pyrimidine base of the nucleotide or the C7 position of the 7-deazapurine base. In order to cooperate with the nucleic acid sequencing process of sequencing by synthesis, a blocking group is covalently attached to the 3'OH position of the ribose or deoxyribose of the fluorescent modified nucleic acid. In one embodiment of the present invention, the blocking group is preferably methyl azide.

[0024] The present invention also provides a kit for nucleotide sequencing, comprising four nucleotide reagents, one of which is the fluorescent modified nucleotide, and the other three nucleotide reagents are labeled and modified with different fluorescent compounds, each fluorescent compound has a different maximum absorbance and each fluorescent compound is distinguishable from each other;

[0025] In another embodiment of the present invention, a kit for nucleotide sequencing is provided, comprising four nucleotide reagents, wherein the first nucleotide uses the above fluorescent compound as a fluorescent modification group, the second nucleotide uses the above fluorescent compound with a structure different from that of the first nucleotide as a fluorescent modification group, the third nucleotide is modified with a fluorescent modification group different from that of the first nucleotide and the second nucleotide, and the fourth nucleotide does not carry a fluorescent modification group;

[0026] As further preferred, another embodiment of the present invention provides a kit for nucleotide sequencing, comprising four nucleotide reagents, wherein the first nucleotide uses the above-mentioned fluorescent compound as a fluorescent modification group, the second nucleotide uses the above-mentioned fluorescent compound with a different structure from the first nucleotide as a fluorescent modification group, the third nucleotide uses a mixture of the first nucleotide fluorescent modification group and the second nucleotide silver light modification group as a fluorescent modification group, and the fourth nucleotide does not have a fluorescent modification group. The sequencing instrument may include two lasers operating at different wavelengths to achieve recognition of the four modified nucleotides.

[0027] The fluorescent compounds, modified nucleotides and kits can be used for expression analysis, hybridization analysis, cell assay or protein assay, etc. in addition to nucleotide sequencing. The fluorescent compounds can be attached to the substrate part in combination with specific application scenarios. The substrate part can be any molecule or substance that needs to be fluorescently labeled and modified, such as nucleotides, polynucleotides, carbohydrates, ligands, particles, solid surfaces, organic or inorganic polymers, chromosomes, cell nuclei, living cells and combinations or collections thereof; the fluorescent compounds can be attached to the corresponding substrate part in combination with actual application scenarios through various methods such as hydrophobic attraction, ionic attraction and covalent attachment. Preferably, -COR5 is converted into an amide or ester structure and covalently attached to the substrate part through a linker. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 is a comparative diagram of the stability of fluorescence performance of different modified nucleotides in Experimental Example 1;

[0029] Figure 2 This is a comparative diagram of the fluorescence performance stability of different modified nucleotides in Experimental Example 2. DETAILED DESCRIPTION

[0030] definition:

[0031] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0032] The term "alkyl" refers to a C1-C20 hydrocarbon and may include a C3-C10 non-aromatic carbocyclic ring. The alkyl group may contain one or more unsaturated groups, such as alkenyl and alkynyl.

[0033] The term "halogen" refers to fluorine, chlorine, bromine, or iodine, and generally involves the substitution of an H atom in the core structure.

[0034] The term "substituted alkyl" refers to the above alkyl, alkenyl or alkynyl, optionally substituted by halogen, cyano, SO3 -In some embodiments, the present invention further replaces with SR, OR, NR, R, oxo, CONR, R, COOH and COOR. R, R and R can be selected from H, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, aryl and substituted aryl independently of one another. Wherein substituted alkyl, substituted alkenyl and substituted alkynyl can be randomly interrupted by being selected from O, NR, S, SO and analog at least one heteroatom or group. Substituted alkyl also includes other aryl or substituted aryl moiety.

[0035] Detailed description of the technical solution of the present invention:

[0036] Below, in conjunction with specific embodiments, the present invention is further described, but the embodiments do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art. Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0037] The present invention provides a fluorescent compound having a chemical structural formula shown in formula (I), or a mesomorph or resonance structure of the compound having the chemical structural formula shown in formula (I):

[0038] (I);

[0039] Wherein P is an integer of 1 to 5; m and n are integers of 1 to 3;

[0040] R1 and R2 are each independently an alkyl group or a substituted alkyl group;

[0041] R3 and R4 are each independently H, halogen, SO3 - , sulfonamide, or another ring fused to an adjacent carbon atom;

[0042] At least one of R1, R2, R3, and R4 has a sulfonic acid group;

[0043] R5 is OR6 or NR6R7, wherein R6 and R7 are independently H, alkyl or substituted alkyl, aryl or substituted aryl.

[0044] Preferably, one embodiment of the present invention provides a fluorescent compound having a chemical structure shown in formula (II), or a mesomorph or resonance structure of the chemical structure shown in formula (II):

[0045] (II);

[0046] Wherein P is an integer of 1 to 5; m and n are integers of 1 to 3;

[0047] R3 and R4 are each independently H, halogen, SO3 - , sulfonamide, or another ring fused to an adjacent carbon atom;

[0048] R5 is OR6 or NR6R7, wherein R6 and R7 are independently H, alkyl or substituted alkyl, aryl or substituted aryl.

[0049] As further preferred, another embodiment of the present invention provides a fluorescent compound having a chemical structural formula shown in formula (III), or a mesomorph or resonance structure of the chemical structural formula shown in formula (III):

[0050] (III)

[0051] Wherein P is an integer of 1 to 5; m and n are integers of 1 to 3;

[0052] R5 is OR6 or NR6R7, wherein R6 and R7 are independently H, alkyl or substituted alkyl, aryl or substituted aryl.

[0053] In the structure of the fluorescent compound, COR5 as part of the linking group is used to attach the fluorescent compound to a detection reagent or a detection carrier that needs to generate a fluorescent signal in the detection reaction, such as a protein, a magnetic particle, a nucleic acid, etc., to achieve fluorescent labeling of the detection reagent and the detection carrier. Preferably, the fluorescent compound is used as a modified structure of a nucleotide to form a modified nucleotide that participates in a nucleotide sequencing reaction as a reaction reagent, and COR5 is used as part of the linking group to connect the fluorescent compound to the corresponding position of the nucleotide; the present invention creatively improves the connection structure between -COR5- and the core structure of the fluorescent compound, using a heteroalkyl structure -(CH2) containing an ether bond. m -O-(CH2) n - As a connecting structure, the linker -COR5- is connected to the core structure of the fluorescent compound, thereby improving the incorporation efficiency of the modified nucleotide formed by the fluorescent compound as a modified molecule during the nucleic acid sequencing reaction, thereby improving the sequencing quality. The following will be combined with the analysis of the fluorescent compound with a specific structure and the modified nucleotide formed as an example to characterize and verify the above beneficial effects:

[0054] Example 1

[0055] This embodiment provides a fluorescent compound, the general chemical structure of which is shown in formula (IV):

[0056] (IV)

[0057] Example 2

[0058] This embodiment provides a fluorescent compound, the general chemical structure of which is shown in Formula (V):

[0059] (V)

[0060] Example 3

[0061] This embodiment provides a fluorescent compound, the general chemical structure of which is shown in formula (VI):

[0062] (VI)

[0063] Example 4

[0064] This embodiment provides a fluorescent compound, the general chemical structure of which is shown in Formula (VII):

[0065] (VII)

[0066] Example 5

[0067] This embodiment provides a fluorescent compound, whose general chemical structure is shown in Formula (VIII):

[0068] (VIII)

[0069] Example 6

[0070] This embodiment provides a fluorescent compound, whose general chemical structure is shown in Formula (IV-1):

[0071] (IV-1)

[0072] Example 7

[0073] This embodiment provides a fluorescent compound, whose general chemical structure is shown in Formula (V-1):

[0074] (V-1)

[0075] Example 8

[0076] This embodiment provides a fluorescent compound, whose general chemical structure is shown in Formula (VI-1):

[0077] (VI-1)

[0078] Example 9

[0079] This embodiment provides a fluorescent compound, whose general chemical structure is shown in Formula (VII-1):

[0080] (VII-1)

[0081] Example 10

[0082] This embodiment provides a fluorescent compound, whose general chemical structure is shown in Formula (VIII-1):

[0083] (VIII-1)

[0084] When the fluorescent compounds in the above-mentioned embodiments 1 to 10 are used as modifying molecules to perform fluorescent modification on nucleotides, an intermediate linker structure is usually required to attach the fluorescent compound to the corresponding position of the nucleotide. It is usually necessary to first react the COOH structure of the fluorescent compound in embodiments 1 to 10 with the compound forming the linker structure to form a -COOR6 structure or a -CONR6R7 structure, and attach the fluorescent compound to the nucleotide through the R6 or R6R7 structure to form a fluorescent modified nucleic acid. The OR6 and NR6R7 structures are equivalent to the Linker structure in the structure of the fluorescent modified nucleic acid compound. The Linker structures known to those skilled in the art can be applied to the present application. For example, R6 and R7 can be selected from alkyl or substituted alkyl, aryl or substituted aryl, and the Linker structure usually includes a chemically cleavable or physically / biologically cleavable structure. The following embodiments of the present invention select a specific Linker structure to illustrate the fluorescent modified nucleotides of the present invention.

[0085] Embodiment 11

[0086] This embodiment provides a fluorescent modified nucleotide, the general chemical structure of which is shown in formula (IX):

[0087] (IX)

[0088] Example 12

[0089] This embodiment provides a fluorescent modified nucleotide, the general chemical structure of which is shown in formula (X):

[0090] (Ⅹ)

[0091] In the above embodiment, the fluorescent compounds of formula (IX) and formula (X) are attached to the C7 position of adenine nucleotide through a specific linker structure to form a fluorescent modified nucleotide, which can still respond to the enzymatic Watson-Crick base pairing reaction. It should be understood that other fluorescent compounds provided in other embodiments of the present invention can also be attached to adenine nucleotides through a linker structure to form new fluorescent modified nucleotides. It should also be understood that the fluorescent compounds provided in the embodiments of the present invention can also be attached to other types of nucleotides through a linker structure to form fluorescent modified nucleotides. For pyrimidine nucleotides, the attachment position is the C5 position of the pyrimidine base, and the formed fluorescent modified nucleotides can also respond to the enzymatic Watson-Crick base pairing reaction.

[0092] In addition, it should be explained that the above embodiments illustrate the linker structure between the fluorescent compound and the nucleotide. In order to prevent the fluorescent compound molecules from affecting the recognition ability of the DNA polymerase to the nucleotide, the linker structure is usually extended and improved, such as adding a spacer unit. It should be understood that linkers of other structures known to those skilled in the art are also applicable to the modified nucleic acid of the present invention, as long as the formed fluorescent modified nucleic acid can respond normally to the enzymatic Watson-Crick base pairing reaction.

[0093] In addition, in the currently commonly used high-throughput sequencing-by-synthesis method, different nucleotide triphosphates (A, T, C and G) are modified with unique and mutually distinguishable fluorescent molecules. In the sequencing reaction, a modified nucleotide reagent is added, and the type of the incorporated nucleotide is determined by detecting the signal of the unique fluorescent molecule incorporated into the sequencing template polynucleotide chain, thereby achieving sequencing of the polynucleotide chain; the modified nucleotide usually needs to have a 3'-OH blocking group, and the blocking group includes a cleavable or cut removable structure to control the continuation of the polymerization extension reaction. After completing a fluorescent signal detection, the 3'-blocking group and fluorescent molecule of the incorporated modified nucleotide are removed by the same or different chemical or enzymatic or physical methods to expose the extendable new chain for the next step of incorporation of the modified nucleotide, thereby achieving continuous sequencing of the nucleotide chain. Therefore, the fluorescent modified nucleic acid provided in the embodiment of the present invention can be used as a nucleotide reagent in a kit for sequencing by synthesis, and when the fluorescent modified nucleic acid of the present invention is used as a nucleotide reagent for nucleotide sequencing reaction, a blocking group is covalently attached to the 3'OH position of the ribose or deoxyribose of the fluorescent modified nucleic acid, and the blocking group is usually chemically cleavable or physically / biologically cleavable, such as methyl azide. At the same time, the above-mentioned kit for nucleotide sequencing also includes three other nucleotide reagents in addition to the fluorescent modified nucleic acid provided in the embodiment of the present invention, and the other three nucleotide reagents may be fluorescently labeled or not fluorescently labeled. Preferably, the other three nucleotide reagents have different fluorescent modifications, and each fluorescent compound has a different maximum absorbance and each fluorescent compound is distinguishable from each other.

[0094] As further preferred, the kit of the present invention comprises four fluorescently labeled nucleotides, wherein the first nucleotide is labeled with the fluorescent compound of the present invention, the second nucleotide is labeled with a compound having a spectral emission color different from that of the fluorescent compound of the present invention, the third nucleotide is labeled with a mixture of fluorescent modification groups of the first and second nucleotides, and the fourth oligonucleotide is not connected to a fluorescent marker. Specifically, the first nucleotide, the second nucleotide, the third nucleotide and the fourth nucleotide form "red", "green", "red / green" and "dark" light signals, respectively.

[0095] Example 13

[0096] This embodiment provides a method for preparing the fluorescent modified nucleic acid shown in Example 12, using the compounds shown in formula (i-1), formula (ii-1), and formula (iii-1) as raw materials:

[0097] (i-1), (ii-1), (ⅲ-1),

[0098] (iv) (v)

[0099] The specific steps are as follows:

[0100] 1) Synthesis of fluorescent compounds:

[0101] ① Take bromopropanol and add it to an organic solvent, add ethyl bromoacetate, slowly add NaH under low temperature, react at low temperature for a certain period of time, then heat it to room temperature and continue to stir the reaction. After the reaction is complete by TLC (PE / EA system), adjust the pH of the reaction system, extract the organic phase, and separate it with a drying and concentrating column to obtain the intermediate product 1; the reaction equation is shown in the following formula (1):

[0102] (1)

[0103] ② Take 4-hydrazinobenzenesulfonamide hydrochloride and add it to an organic solvent, add 3-methyl-2-butanone, and continue the reaction at elevated temperature. After TLC detection shows that the reaction is complete, cool to room temperature, add an extractant, filter, and drain to obtain the intermediate product 2. The reaction equation is shown in formula (2):

[0104] (2)

[0105] ③ Take the intermediate product 2 and add it to a single-mouth bottle, add an organic solvent and the intermediate product 1, heat to react, and detect the reaction completion by TLC. Cool down to room temperature, add an extractant and filter to obtain the intermediate product 3; the reaction equation is shown in formula (3):

[0106] (3)

[0107] ④ Take the intermediate product 3 and dissolve it in an organic solvent, add sodium hydroxide, heat to react, and detect the completion of the reaction by TLC. Concentrate and remove the organic solvent to obtain the raw material represented by formula (I-1); the reaction equation is shown in formula (4):

[0108] (4)

[0109] ⑤ Take ethyl 2-methylacetoacetate, add an organic solvent, add a catalyst at low temperature, warm to room temperature, add butane sultone, heat to reflux for reaction, spin dry the solvent, add water to dissolve, adjust the pH, filter, spin dry the solution to obtain an oily substance as intermediate product 4; take intermediate product 4, add an organic solvent to dissolve, dropwise add an aqueous potassium hydroxide solution, heat to reflux, spin dry the solvent, add water to dissolve, adjust the pH, spin dry, and perform multi-stage extraction to obtain an oily substance as intermediate product 5; take intermediate product 5, add an organic solvent and diphenylhydrazine hydrochloride, heat to react completely, spin dry, add ethyl acetate to wash, pour out the organic phase, spin dry to obtain an oily substance as the raw material shown in formula (ii-1); the entire reaction equation is shown in formula (5):

[0110] (5)

[0111] ⑥ Take the raw material represented by formula (ⅰ-1), dissolve it in an organic solvent, add N,N-diphenylpropionamidine, heat to react, after TLC detection, the reaction is complete, concentrate to remove the organic solvent, redissolve the residue, add the raw material represented by formula (ⅱ-2), heat to react, after TLC detection, the reaction is complete, concentrate to remove the solvent, and separate the compound represented by formula (Ⅳ-1) by mixing with a sample column; the entire reaction equation is as shown in formula (6) to obtain the fluorescent compound:

[0112] (6)

[0113] 2) Fluorescent compound connecting Linker structure: The fluorescent compound represented by formula (IV-1) is dissolved in DMF, DIEA and TSTU are added, and the reaction is stirred at room temperature. The organic solution of the compound represented by formula (IV) is added, and the reaction is stirred at room temperature. TLC detection is performed. When the reaction is complete, the solvent is concentrated to remove the solvent, and the intermediate product 6 is separated by mixing with a sample column. The reaction equation is shown in formula (7):

[0114] (7)

[0115] 3) Preparation of fluorescent modified nucleic acid: Dissolve the intermediate product 6 in DMF, add DIEA and TSTU, stir at room temperature for 5 min, add the organic solution of the compound represented by formula (V), stir at room temperature for 2 h, detect the reaction completion by HPLC, add 0.1 M TEAB, stir at room temperature for 30 min, concentrate to remove the solvent, separate and purify to obtain formula.

[0116] Weigh 35 mg of the intermediate product prepared in step 2), add 2 mL of DMF to dissolve, add 100 μL of DIEA, stir for 10 min, add 4 mg of TSTU, and monitor the reaction of the raw materials for 10 min. Weigh 15 mg of the compound (v) synthesized in advance, dissolve it in 300 μL of 0.1 M TEAB solution, add it to the reaction, and react for 20 min. Separate and purify to obtain the fluorescent modified nucleotide (X); the reaction equation is shown in formula (8):

[0117] (8)

[0118] It should be noted that the fluorescent modified nucleic acid using the fluorescent compounds shown in Examples 1 to 10 as the modified molecule can be synthesized according to the same method principle as Example 13, and it is only necessary to replace the corresponding raw materials according to the compound structure of the final product.

[0119] Comparative Example 1

[0120] This comparative example provides a fluorescent modified nucleotide, the general chemical structure of which is shown in the following formula (IX-1):

[0121] (Ⅸ-1)

[0122] Comparative Example 2

[0123] This comparative example provides a fluorescent modified nucleotide, the general chemical structure of which is shown in the following formula (X-1):

[0124] (Ⅹ-1)

[0125] Comparative Example 3

[0126] This comparative example provides a fluorescent modified nucleotide, the general chemical structure of which is shown in the following formula (IX-2):

[0127] (Ⅸ-2)

[0128] Comparative Example 4

[0129] This comparative example provides a fluorescent modified nucleotide, the general chemical structure of which is shown in the following formula (X-2):

[0130] (Ⅹ-2)

[0131] Comparative Example 5

[0132] This comparative example provides a fluorescent modified nucleotide, the general chemical structure of which is shown in the following formula (IX-3):

[0133] (Ⅸ-3)

[0134] Comparative Example 6

[0135] This comparative example provides a fluorescent modified nucleotide, the general chemical structure of which is shown in the following formula (IX-4):

[0136] (Ⅸ-4)

[0137] Comparative Example 7

[0138] This comparative example provides a fluorescent modified nucleotide, the general chemical structure of which is shown in the following formula (X-3):

[0139] (Ⅹ-3)

[0140] Comparative Example 8

[0141] This comparative example provides a fluorescent modified nucleotide, whose chemical structure is shown in formula (X-4):

[0142] (Ⅹ-4)

[0143] Test Example 1

[0144] The fluorescent modified nucleotides provided in Example 11, Comparative Example 1, Comparative Example 3, Comparative Example 5 and Comparative Example 6 were respectively prepared into solutions of the same concentration (0.5 μmol / L), and the attenuation ratio of the fluorescence intensity of the different modified nucleotide solutions as the temperature increased was detected using a fluorescence spectrophotometer (20°C, 40°C, 60°C). The results are as follows: Figure 1 As shown:

[0145] The structural differences between different fluorescent modified nucleotides are mainly reflected in the connection structure between COOH and the core structure of the fluorescent compound. The main difference is whether it contains an ether bond. Figure 1 The results shown show that the connection structure between COOH and the core structure of the fluorescent compound contains an ether bond or an alkyl straight chain structure. When the core structure of the fluorescent compound remains unchanged, the temperature stability of the fluorescence properties of the fluorescent modified nucleotide does not change significantly.

[0146] Test Example 2

[0147] The fluorescent modified nucleotides provided in Example 12, Comparative Example 2, Comparative Example 4, Comparative Example 7 and Comparative Example 8 were respectively prepared into solutions of the same concentration (0.5 μmol / L), and the attenuation ratio of the fluorescence intensity of the different modified nucleotide solutions as the temperature increased was detected using a fluorescence spectrophotometer (20°C, 40°C, 60°C). The results are as follows: Figure 2 As shown:

[0148] The structural differences between different fluorescent modified nucleotides are mainly reflected in the connection structure between COOH and the core structure of the fluorescent compound. The main difference is whether it contains an ether bond. Figure 2 The results shown show that the connection structure between COOH and the core structure of the fluorescent compound contains an ether bond or an alkyl straight chain structure. When the core structure of the fluorescent compound remains unchanged, the temperature stability of the fluorescence properties of the fluorescent modified nucleotide does not change significantly.

[0149] Test Example 3

[0150] Detection of polymerase affinity Kd values ​​of different fluorescent modified nucleotides:

[0151] Detection method: 50uL reaction system, Therminator™ III DNA Polymerase 1uL, 1*Thermopol Reaction Buffer, 10uM ONA26, 0.1uM, 0.2uM, 0.4uM0.8uM, 1.6uM, 5uM, 10uM nucleotide A concentrations to be tested, react at 65℃ for 10min, terminate with 25mM EDTA and dilute, then use Aglient DNA1000 kit to analyze the incorporation rate and calculate Kd according to the Michaelis-Menten equation; ONA26 is a hairpin structure nucleic acid substrate, and its sequence is GACT GCGCCGCGCCATCATGACAGCTAG TT CTAGCTGTCATGATGGCGCGGCGC, The underlined parts are complementary and paired, and annealed to form a hairpin structure. The results are shown in Tables 1-2 below:

[0152] Table 1

[0153] Embodiment 11 Comparative Example 1 Comparative Example 3 Comparative Example 5 Comparative Example 6 KdμM 0.54 2.51 1.9 0.75 2.0

[0154] Table 2

[0155] Example 12 Comparative Example 2 Comparative Example 4 Comparative Example 7 Comparative Example 8 KdμM 0.55 2.82 2.11 0.82 2.1

[0156] From the results shown in Tables 1 and 2 above, it can be seen that compared with the nucleotide A modified with the fluorescent modifying group in which COOH is connected to the core structure of the fluorescent compound through a straight-chain alkyl structure, the COOH of the present invention is connected to the core structure of the fluorescent compound through a heteroalkyl chain -(CH2) containing an ether bond. m -O-(CH2) n -(m, n=1~3) Nucleotide A modified with a fluorescent modification group connected to the core structure of the fluorescent compound has a higher polymerase affinity, improves the incorporation efficiency of the modified nucleotide, reduces the amount of modified nucleotide used, and reduces the reagent cost.

[0157] Test Example 4

[0158] By replacing the modified nucleotide A in the commercially available high-throughput sequencing kit (where A is labeled with a mixture of at least two different fluorescent compounds), human templates were sequenced, and the quality data of sequencing using modified nucleotide A with different structures were statistically analyzed. The specific experimental design and grouping are as follows:

[0159] The first group: modified nucleotide A includes comparative example 1+comparative example 2; the second group: modified nucleotide A includes comparative example 1+example 12; the third group: modified nucleotide A includes example 11+comparative example 2; the fourth group: modified nucleotide A includes example 11+example 12; the fifth group: modified nucleotide A includes comparative example 1+comparative example 4; the sixth group: modified nucleotide A includes comparative example 3+comparative example 2; the seventh group: modified nucleotide A includes comparative example 5+comparative example 7; the eighth group: modified nucleotide A includes comparative example 6+comparative example 8. The statistical results of the various data of the sequencing process are shown in Table 3 below:

[0160] Table 3

[0161] Group Sequencing cycle number <![CDATA[Density(k / mm 2 )]]> Cluster PF (%) Phas / prephas %>=Q30(100cycles) Error rate (%) Group 1 100 256 62 0.333 / 0.566 56.1 3.55 Group 2 100 256 74.1 0.265 / 0.805 72 2.12 Group 3 100 256 79.4 0.247 / 0.712 76.6 1.98 Group 4 100 256 90.4 0.159 / 0.120 84.1 0.75 Group 5 100 256 65 0.301 / 0.915 60.1 2.98 Group 6 100 256 63 0.324 / 0.923 58.4 3.12 Group 7 100 256 75.5 0.274 / 0.785 74.3 2.05 Group 8 100 256 72.3 0.287 / 0.901 65.7 2.43

[0162] From the statistical results in Table 3 above, it can be seen that compared with the fluorescent modification group of COOH connected to the core structure of the fluorescent compound through a straight-chain alkyl structure, the COOH of the present invention is connected to the core structure of the fluorescent compound through a heteroalkyl chain -(CH2) containing an ether bond. m -O-(CH2) n - (m, n = 1~3) The fluorescent modification group connected to the core structure of the fluorescent compound can improve the sequencing quality and the accuracy of the sequencing results when it is used as a fluorescent labeling structure of the nucleotide to form a modified nucleotide reagent.

[0163] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A fluorescent compound, characterized in that: It is formed by a compound of the general chemical structure shown in formula (I): （Ⅰ）； Where P is 1 or 2; m=2 or 3, n=1; R1 is -(CH2)4SO3 - ; R2 is methyl; R3 is H, and R4 is sulfonamide; R5 is OR6, wherein R6 is H or alkyl; wherein the alkyl is C1-C20 hydrocarbon.

2. The fluorescent compound according to claim 1, characterized in that R5 is OH.

3. A fluorescent modified nucleotide, characterized in that: A nucleotide using the fluorescent compound as described in any one of claims 1 to 2 as a modified group.

4. The fluorescent modified nucleotide according to claim 3, characterized in that The fluorescent compound is attached to the nucleotide via the linker R5 to form the fluorescent modified nucleotide.

5. The fluorescent modified nucleotide according to claim 4, characterized in that The linker is attached to the C5 position of a pyrimidine base of a nucleotide or the C7 position of a 7-deazapurine base.

6. The fluorescent modified nucleotide according to any one of claims 3 to 5, characterized in that A blocking group is covalently attached to the 3'OH position of the ribose or deoxyribose of the fluorescent modified nucleotide.

7. The fluorescent modified nucleotide according to claim 6, characterized in that The blocking group is methyl azide.

8. A kit, characterized in that: Comprising the fluorescent modified nucleotide according to any one of claims 3 to 7.

Images