SNP Molecular Marker Closely Linked to Eggplant Fruit Color and Its Application

By QTL localization of the anthocyanin regulatory gene of eggplant fruit and screening out closely linked SNP molecular markers, the problem of long color breeding cycle of eggplant fruit in the prior art is solved, early identification and screening of eggplant fruit color is achieved, and breeding efficiency is improved.

CN114703312BActive Publication Date: 2025-06-10SOUTH SUBTROPICAL CROP RES INST CHINA ACAD OF TROPICAL AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202210139090.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-02-15
Publication Date
2025-06-10
Estimated Expiration
2042-02-15

AI Technical Summary

Technical Problem

The prior art is difficult to effectively shorten the breeding cycle of eggplant fruit color, and traditional methods need to wait until the eggplant blooms and bears fruit before the fruit color can be determined, resulting in low breeding efficiency.

Method used

By performing QTL localization of the anthocyanin regulatory gene in eggplant fruit, SNP molecular markers closely linked to the anthocyanin regulatory gene in the fruit, including the 95538422 and 98266374 SNP sites on chromosome 10, these markers can be used to predict the color of eggplant fruit.

Benefits of technology

Early identification and screening of eggplant fruit color has been achieved, shortening the time of traditional gene location, reducing the breeding workload, and improving breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114703312B_ABST
    Figure CN114703312B_ABST
Patent Text Reader

Abstract

The present invention discloses SNP molecular markers closely linked to eggplant fruit color and their applications, belonging to the technical field of molecular genetic breeding. The key points of the technical solution are as follows: The SNP molecular markers include SNP molecular marker I and SNP molecular marker II; SNP molecular marker I contains the nucleotide sequence shown in SEQ ID NO.1, and the 51st base from the 5' end of the nucleotide sequence shown in SEQ ID NO.1 is SNP locus I; SNP molecular marker II contains the nucleotide sequence shown in SEQ ID NO.2, and the 51st base from the 5' end of the nucleotide sequence shown in SEQ ID NO.2 is SNP locus II; SNP locus I and SNP locus II are located at the 95,538,422nd base and the 98,266,374th base of chromosome 10 of eggplant respectively, the 95,538,422nd base is C or T; the 98,266,374th base is C or T; SEQ ID NO.1 is TACATCAGTGCATAGTTTCATTTGAGTTGATATTTCGTATACAGTGTTTC[C / T]TGCCTTATATATTCAATACATTATCTCGTACTGATGTCCCTTACGGGGGA; SEQ ID NO.2 is GATTATAATATGAGAAATCGAACATTCATTAATAATAATAAATAAAAGTT[C / T]AAATAATCAACTGATTAAACTATTAAGAAAGTTGATTTAGCCTATTACAA. The present invention is mainly used for reducing the breeding workload and improving the breeding efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular genetic breeding, and particularly relates to SNP molecular markers closely linked to eggplant fruit color and their applications. Background Art

[0002] Eggplant (Solanum melongena L.) is an important vegetable of the Solanaceae family, with important economic value and health care value. China is the largest eggplant producer in the world, and the annual eggplant output accounts for about 60% of the world's total output. Eggplant fruit color is an important commercial trait of eggplant, with rich variations, and there are obvious differences in the demand for eggplant fruits in different regions of China due to different consumption habits. Common purple eggplants are mainly determined by anthocyanins in the pericarp, and the depth of their color is closely related to the content of anthocyanins.

[0003] With the mature development of high-throughput sequencing technology, especially the development of a large number of SNP (single nucleotide polymorphism) markers and the application of high-density genetic maps to carry out gene mapping of plant traits have become one of the hotspots for exploring plant genes. By using high-throughput sequencing technology to develop a large number of SNP markers and developing molecular markers linked to traits for the initial screening of varieties to achieve the purpose of molecular-assisted breeding, the breeding cycle can be greatly shortened and the breeding efficiency can be improved.

[0004] At present, breeding for eggplant fruit color traits using traditional breeding methods is time-consuming and laborious. Generally, it is necessary to wait until the eggplant blossoms and bears fruit to know the fruit color of commercial eggplants, with a relatively long breeding cycle and a large amount of work required during this period. Moreover, for mapping the anthocyanin regulatory genes in eggplant pericarp, screening closely linked molecular markers, developing molecular markers closely linked to the anthocyanin regulatory genes in eggplant fruits, and establishing an early auxiliary selection technology system are of great significance for the genetic improvement of eggplant color breeding, but the existing technology has not effectively achieved this.

[0005] To solve the above problems, SNP molecular markers closely linked to eggplant fruit color and their applications are provided on the basis of the existing technology. Summary of the Invention

[0006] The object of the present invention is to provide SNP molecular markers closely linked to eggplant fruit color and their applications. The present invention conducts QTL mapping on the anthocyanin regulatory genes in eggplant fruits and screens molecular marker loci closely linked to the fruit anthocyanin regulatory genes, which are the SNP loci of 95538422 and 98266374 on chromosome 10, and the physical distance between the two markers is 2.61 M. Through the two molecular markers, the eggplant fruit color can be predicted, providing molecular-assisted selection technology support for the early identification and screening of eggplant fruit color breeding, while greatly shortening the traditional gene mapping time, reducing the breeding workload, and improving the breeding efficiency.

[0007] The above technical object of the present invention is achieved by the following technical solutions:

[0008] SNP molecular markers closely linked to the color of eggplant fruits, the SNP molecular markers including SNP molecular marker I and SNP molecular marker II; the SNP molecular marker I contains the nucleotide sequence shown in SEQ ID NO.1, and the 51st base from the 5' end of the nucleotide sequence shown in SEQ ID NO.1 is SNP locus I; the SNP molecular marker II contains the nucleotide sequence shown in SEQ ID NO.2, and the 51st base from the 5' end of the nucleotide sequence shown in SEQ ID NO.2 is SNP locus II;

[0009] The SNP locus I and SNP locus II are located at the 95538422nd base and the 98266374th base of chromosome 10 of eggplant respectively, the 95538422nd base is C or T; the 98266374th base is C or T;

[0010] The SEQ ID NO.1 is TACATCAGTGCATAGTTTCATTTGAGTTGATATTTCGTATACAGTGTTTC[C / T]TGCCTTATATATTCAATACATTATCTCGTACTGATGTCCCTTACGGGGGA;

[0011] The SEQ ID NO.2 is GATTATAATATGAGAAATCGAACATTCATTAATAATAATAAATAAAAGTT[C / T]AAATAATCAACTGATTAAACTATTAAGAAAGTTGATTTAGCCTATTACAA.

[0012] The present invention also provides a detection method for SNP molecular markers closely linked to the color of eggplant fruits, and the specific steps are as follows:

[0013] S1. Extract the nucleotide sequence of the SNP molecular marker;

[0014] S2. Convert the SNP molecular marker in the nucleotide sequence of step S1 into a KASP marker through primer design software;

[0015] S3. Perform SNP genotyping detection based on KASP on the overall nucleotide sequence obtained by conversion in step S2 through a genotyping detection platform.

[0016] Furthermore, the reaction system where KASP is located contains a KASP primer mixture, a KASP master mixture, and a DNA template; the KASP primer mixture includes a forward primer F-1, a forward primer F-2, and a reverse primer; the KASP master mixture includes an oligonucleotide sequence labeled with FAM at the tail of the forward primer F-1, an oligonucleotide sequence labeled with HEX at the tail of the forward primer F-2, a FAM dye, a HEX dye, and a quencher; the DNA template is eggplant genomic DNA.

[0017] Furthermore, the nucleotide sequence of the KASP marker primer for detecting the SNP molecular marker Ⅰ is: the forward primer F-1 is GAAGGTGACCAAGTTCATGCTTTTTTAGTGCATCCCAAAAAGAATGTC; the forward primer F-2 is GAAGGTCGGAGTCAACGGATTTGAGTTGATATTTCGTATACAGTGTTTCT; the reverse primer R is ACATCAGTACGAGATAATGTATTGAATATATAAG.

[0018] Furthermore, the nucleotide sequence of the KASP marker primer for detecting the SNP molecular marker Ⅱ is: the forward primer F-1 is GAAGGTGACCAAGTTCATGCTTCGAACATTCATTAATAATAATAAATAAAAGTTC; the forward primer F-2 is GAAGGTCGGAGTCAACGGATTAAATCGAACATTCATTAATAATAATAAATAAAAGTTT; the reverse primer R is GCTAAATCAACTTTCTTAATAGTTTAATCAGTTGAT.

[0019] The present invention also provides the application of the SNP molecular marker closely linked to the eggplant fruit color, and applies the SNP molecular marker to the early identification and screening of the eggplant fruit color trait.

[0020] Furthermore, apply the SNP molecular marker to the assisted breeding for selecting eggplants with high anthocyanin content.

[0021] Furthermore, apply the molecular probe or primer of the SNP molecular marker to the preparation of a kit for detecting anthocyanin content.

[0022] The present invention also provides a method for eggplant assisted breeding, which detects the type of the SNP molecular marker and determines the high or low anthocyanin content of the eggplant variety according to the SNP genotyping.

[0023] Through the above technical solution, an SNP molecular marker closely linked to the eggplant fruit anthocyanin regulation gene is located on chromosome 10 of eggplant. The SNP molecular marker I contains the nucleotide sequence shown in SEQ ID NO.1. The 51st base from the 5' end of the nucleotide sequence shown in SEQ ID NO.1 is the SNP locus, and its base is C / T. When the base at this SNP locus I in the allele is C, the eggplant fruit color is purplish red and the anthocyanin content is high. When the base at this SNP locus I in the allele is T, the eggplant fruit color is white and the anthocyanin content is low.

[0024] The SNP molecular marker II contains the nucleotide sequence shown in SEQ ID NO.2. The 51st base from the 5' end of the nucleotide sequence shown in SEQ ID NO.2 is the SNP locus II, and its base is C / T. When the base at this SNP locus in the allele is C, the eggplant fruit color is purplish red and the anthocyanin content is low. When the base at this SNP locus II in the allele is T, the eggplant fruit color is white.

[0025] In summary, the present invention has the following beneficial effects: The present invention conducts QTL mapping on the eggplant fruit anthocyanin regulation gene and screens molecular marker loci closely linked to the fruit anthocyanin regulation gene, which are SNP loci 95538422 and 98266374 on chromosome 10. The physical distance between the two markers is 2.61 M. The fruit color of eggplant can be predicted through the two molecular markers, providing molecular assisted selection technical support for the early identification and screening of eggplant fruit color breeding. At the same time, it greatly shortens the traditional gene mapping time, reduces the breeding workload, and improves the breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 It is a graph of the mutant (L6-5), wild-type fruit phenotype (A) and anthocyanin content (B) in the embodiment of the present invention;

[0027] Figure 2 It is a photo of the fruit color of the F1 generation in the embodiment of the present invention being consistent with that of the wild type;

[0028] Figure 3 It is the fruit color segregation of the F2 generation hybrid population in the embodiment of the present invention;

[0029] Figure 4 It is the preliminary mapping result graph of the eggplant anthocyanin gene in the embodiment of the present invention;

[0030] Figure 5 It is the genotyping result of the SNP molecular marker I in the embodiment of the present invention;

[0031] Figure 6 It is the genotyping result of the SNP molecular marker II in the embodiment of the present invention;

[0032] Figure 7 Schematic diagram of the localization interval of the anthocyanin regulatory gene in the embodiment of the present invention. Detailed implementation manners

[0033] The present invention will be further described in detail below in conjunction with the accompanying drawings and embodiments:

[0034] In the following embodiments of the present invention, the methods and devices used are conventional methods and devices unless otherwise specified; the equipment and reagents used are all conventional equipment and reagents purchased from reagent companies.

[0035] Example: SNP molecular marker tightly linked to eggplant fruit color , Its positioning and application steps are as follows:

[0036] I. Construction of EMS mutants and genetic analysis

[0037] 1. Test plant materials

[0038] The inbred line of purple eggplant was mutagenized with EMS to obtain a stable white eggplant mutant. The pericarp of this mutant is white and the total anthocyanin content is significantly reduced, as Figure 1 shown. The mutant was self-crossed for several generations to obtain a homozygous inbred line. After backcrossing the white eggplant mutant with the wild-type purple eggplant, the F1 generation was produced, as Figure 2 shown. The phenotype is normal, all are purple eggplants, showing recessive inheritance. Figure 1 Photos of wild-type (WT), mutant eggplant (L6-5) and F1 generation eggplant. The F1 generation eggplant was self-crossed to obtain the F2 generation eggplant. The F2 generation segregation population was constructed using the F2 generation seeds. The fruit color of the F2 generation eggplant was observed, the fruit color percentage of the F2 generation eggplant was counted, the genetic law was analyzed, and the white eggplant trait was positioned. The fruit of the wild-type WT is purple-red with a high anthocyanin content; the fruit color of the EMS mutant (L6-5) is white with a low anthocyanin content.

[0039] 2. Genetic law analysis of fruit color in the F2 generation

[0040] As Figure 3 shown, the total number of plants in the F2 generation segregation population constructed in this method is 346. The field trait statistics results show that there are 85 plants with white eggplant fruit color and 261 plants with purple-red eggplant fruit color. Chi-square test shows that X2 for white and purple-red fruit colors is 0.035 < X20.05.1 = 3.84, which conforms to the segregation ratio of 3:1. However, since the depth of purple-red in eggplants is not consistent, it is speculated that the eggplant fruit color trait may be controlled by polygenic recessive inheritance.

[0041] II. Preliminary localization of anthocyanin regulatory genes

[0042] 1. Sample collection

[0043] Using the constructed F2 fruit color segregation population, 30 leaves of purple-red eggplants were selected to construct the pooled DNA sample W-pool, and 30 white eggplants were selected to construct the pooled DNA sample M-pool. At the same time, young leaves of the wild type (WT) and the white eggplant mutant (L6-5) were collected for bulked segregant analysis (BSA).

[0044] 2. Bulked segregant analysis (BSA)

[0045] In the early stage of this study, Guangzhou Genedenovo Biotechnology Co., Ltd. was commissioned to perform genome resequencing on the pooled DNA samples W-pool, M-pool, WT, and L6-5. The sequencing process was as follows: First, genomic DNA was extracted from plant materials. After the genomic DNA was randomly fragmented into short DNA fragments by enzymes, blunt-end repair was performed. Then, dA tails were ligated to both ends of the DNA fragments, and sequencing adapters were ligated. The DNA fragments with adapters were purified by AMPure XP magnetic beads, and fragments in the range of 300-400 bp were selected for PCR amplification. The constructed libraries were purified and library-checked, and then sequenced on the Hiseq X10 PE150 platform.

[0046] 3. Sequencing data analysis

[0047] (1) Quality control of resequencing data

[0048] The wild type of purple-red eggplant (WT), the white eggplant mutant (L6-5), 30 F2 purple-red eggplants were collected to construct the wild-type phenotype pooled DNA sample (W-pool) and 30 white eggplants to construct the mutant phenotype pooled DNA sample (M-pool). Through high-throughput sequencing (Illumina HiSeq2500 sequencing platform), a total of 120.65 Gbp of raw paired-end sequences (Clean Data) were obtained for the four samples. After filtering, 119.83 Gbp (HQ Clean Data) were obtained, and Q30 reached over 91.31%. The average alignment rate of the samples to the reference genome was 96.87%, the average coverage depth was 30X, and the genome coverage was 98.53% (at least one base coverage). The version of the eggplant reference genome was Eggplant_V3, the genome size was 1.08 Gb, the sequencing depth was 30X. After filtering, WT, L6-5, W-pool, and M-pool obtained 28.29, 30.63, 31.42, and 28.88 Gb respectively, and the GC% was 37.92%, 37.26%, 38.28%, and 37.27% respectively. The specific SNP variations were detected, and non-synonymous mutations of SNPs occurred between the samples and the reference genome. The genes with DNA-level variations were annotated in databases such as KEGG, GO, COG, NR, and SwissProt.

[0049] Table 1 Statistics of sample sequencing data

[0050]

[0051] (2) SNP Detection

[0052] SNP (Single Nucleotide Polymorphism) refers to the variation of a single nucleotide on the genome. By counting the read support numbers of SNPs detected in a sample and the cumulative distribution of the distances between adjacent SNPs, the credibility of sample SNPs can be ensured. The variations of SNP types are divided into two categories: transition and transversion. The mutation between the same type of bases is called transition, such as the variation between purines or between pyrimidines. The mutation between different types of bases is called transversion, such as the variation between purine and pyrimidine. Usually, transition is more likely to occur than transversion, so the ratio of transition / transversion (Ti / Tv) is generally greater than 1.

[0053] The two parents and two mixed pools sequenced in this study are 2.57, 2.58, 2.61, and 2.62 respectively, as shown in Table 2. For diploid or polyploid species, if a certain SNP locus on homologous chromosomes is the same type of base, then this SNP locus is called a homozygous SNP locus (Homozygosity); if the SNP locus on homologous chromosomes contains different types of bases, then this SNP locus is called a heterozygous SNP locus (Heterozygosity). The more homozygous SNPs there are, the greater the difference between the sample and the reference genome. The more heterozygous SNPs there are, the higher the heterozygosity of the sample.

[0054] By comparing with the reference genome, WT and L6-5 have 815,002 SNPs and 1,173,163 SNPs respectively, among which there are 586,944 SNPs and 845,815 SNPs, 228,058 SNPs and 327,348 SNPs of the transition and transversion types respectively; 1,545,825 SNPs and 1,765,226 SNPs are detected in the two parents W-pool and M-pool respectively, among which there are 985,143 SNPs and 984,489 SNPs, 377,408 SNPs and 376,477 SNPs of the transition and transversion types respectively.

[0055] The homozygous sites of the two parental samples have 561,147 SNPs and 900,796 SNPs respectively, and the heterozygous sites have 253,855 SNPs and 272,367 SNPs respectively. The heterozygous SNP sites account for approximately 31.15% and 23.22% of the total SNP sites. The homozygous sites of the two pooled samples have 381,057 SNPs and 380,588 SNPs respectively, and the heterozygous sites have 981,494 SNPs and 980,378 SNPs respectively. The heterozygous SNP sites account for approximately 72.03% and 72.04% of the total SNP sites, indicating that the difference between the F2 population and the reference genome is small, while the difference between the two parents and the reference genome is large.

[0056] Table 2 SNP statistics of four samples

[0057]

[0058]

[0059] (3) SNP annotation

[0060] The position of the variant site on the reference genome and the gene position information on the reference genome are obtained to get the region where the variant site occurs in the genome and the impact of the variant. A synonymous mutation means that after the base is replaced, a new codon is generated, but due to the degeneracy of the genetic codons of organisms, the old and new codons are still synonymous codons, and the types of encoded amino acids remain unchanged. If the type of encoded amino acid changes, it is a non-synonymous mutation.

[0061] As can be seen from Table 3 and Table 4, a total of 1,188,355 SNPs were detected in the intergenic regions in M-pool, 24,374 SNPs in the exon regions, and 68,364 SNPs in the intron regions within genes, including 15,109 non-synonymous mutations and 8,784 synonymous mutations. A total of 1,187,770 SNPs were detected in the intergenic regions in W-pool, 68,245 SNPs in the intron regions within genes, and 24,333 SNPs in the exon regions, including 15,164 non-synonymous mutations and 8,793 synonymous mutations.

[0062] Table 3 Statistical information on SNP genomic positions

[0063]

[0064] Table 4 SNP coding information

[0065]

[0066]

[0067] 4. Use the Euclidean Distance (ED) algorithm to associate and initially locate gene differential intervals

[0068] Using the Euclidean Distance (ED) algorithm is a method that utilizes sequencing data to find significantly different markers among the bulk pools and thereby evaluate the regions associated with traits. Calculate the association value using the ED method, take the square of the ED as the association value, and fit the ED values, as Figure 3 shown. Screen the significant intervals and candidate genes within the intervals obtained according to the 99% quantile. The association region containing the gene is between 86000001 and 99540000 on chromosome 10, with a region size of 12.91 Mb and 609 candidate genes.

[0069] Figure 4 This is the distribution map of ED values on the chromosome. The abscissa is the chromosome name, the scatter points represent the ED values of each SNP locus, line Ⅰ is the fitted ED value, line Ⅱ represents the 0.95 significance association threshold, and line Ⅲ represents the 0.99 significance association threshold.

[0070] III. Fine mapping of anthocyanin regulatory genes

[0071] The KASP-PCR reaction is carried out on an ABIQ6plus fluorescence quantitative PCR instrument, using a 384-well PCR plate, and the reaction system is 6 μL: among which 1 μL of DNA (60 ng·μL -1 ), 3 μL of KASP Master mix (2×), 0.45 μL of primer mixture (obtained by mixing F_FAM, F_HEX, and R with a volume ratio of 1:1:1 at a concentration of 10 μmoL -1 ), and ddH 2 O is added up to 6 μL.

[0072] Reaction procedure: The first stage is denaturation at 94 °C for 15 min; the second stage is denaturation at 94 °C for 20 s and annealing at 61 °C for 60 s, for a total of 10 cycles (starting from the second cycle, each cycle decreases by 0.6 °C); the third stage is denaturation at 94 °C for 20 s and annealing at 55 °C for 60 s, for a total of 26 cycles; the fourth stage is cooling and maintaining at 37 °C for 1 min.

[0073] Primer sequence: The primer sequence of SNP molecular marker Ⅰ for genotyping is:

[0074] Forward primer F-1: 5’-GAAGGTGACCAAGTTCATGCTAGTTGATATTTCGTATACAGTGTTTCC-3’; Forward primer F-2: 5’-GAAGGTCGGAGTCAACGGATTTGAGTTGATATTTCGTATACAGTGTTTCT-3’; Reverse primer R: ACATCAGTACGAGATAATGTATTGAATATATAAG-3’.

[0075] The primer sequences for the SNP molecular marker Ⅱ used for genotyping are as follows:

[0076] Forward primer F-1: 5’-AAGGTGACCAAGTTCATGCTTCGAACATTCATTAATAATAATAAATAAAAGTTC-3’; Forward primer F-2: 5’-GAAGGTCGGAGTCAACGGATTAAATCGAACATTCATTAATAATAATAAATAAAAGTTT-3’; Reverse primer R: 5’-GCTAAATCAACTTTCTTAATAGTTTAATCAGTTGAT-3’.

[0077] Using the KASP genotyping technology, gene mapping was performed on the F2 segregating population. As Figure 7 shown, it was mapped between two SNP markers, SNP molecular marker Ⅰ and SNP molecular marker Ⅱ. Among them, SNP molecular marker Ⅰ is located at 95538422 of SMEL3Ch10, and SNP molecular marker Ⅱ is located at 98266374 of SMEL3Ch10. The interval ranges from 91.11 to 93.71 Mb, with a distance of 2.6 Mb. The nucleotide sequence of SNP molecular marker Ⅰ is TACATCAGTGCATAGTTTCATTTGAGTTGATATTTCGTATACAGTGTTTC[C / T]TGCCTTATATATTCAATACATTATCTCGTACTGATGTCCCTTACGGGGGA, where the change of C→T marked by [] (i.e., the SNP site base at the 50th base from the 5’ end is C or T).

[0078] The nucleotide sequence of SNP molecular marker Ⅱ is GATTATAATATGAGAAATCGAACATTCATTAATAATAATAAATAAAAGTT[C / T]AAATAATCAACTGATTAAACTATTAAGAAAGTTGATTTAGCCTATTACAA, where the change of C→T marked by [] (i.e., the SNP site base at the 50th base from the 5’ end is C or T).

[0079] The nucleotide sequences of the KASP marker primers for detecting SNP molecular marker Ⅰ are as follows:

[0080] The forward primer F-1 is GAAGGTGACCAAGTTCATGCTTTTTTAGTGCATCCCAAAAAGAATGTC; the forward primer F-2 is GAAGGTCGGAGTCAACGGATTTGAGTTGATATTTCGTATACAGTGTTTCT; the reverse primer R is ACATCAGTACGAGATAATGTATTGAATATATAAG.

[0081] The nucleotide sequences of the KASP marker primers for detecting SNP molecular marker Ⅱ are as follows:

[0082] The forward primer F-1 is GAAGGTGACCAAGTTCATGCTTCGAACATTCATTAATAATAATAAATAAAAGTTC; the forward primer F-2 is GAAGGTCGGAGTCAACGGATTAAATCGAACATTCATTAATAATAATAAATAAAAGTTT; the reverse primer R is GCTAAATCAACTTTCTTAATAGTTTAATCAGTTGAT.

[0083] SNP molecular marker Ⅰ contains the nucleotide sequence shown in SEQ ID NO.1. The 51st base from the 5' end of the nucleotide sequence shown in SEQ ID NO.1 is the SNP site, and its base is C / T. When the base at this SNP site Ⅰ in the allele is C, the color of the eggplant fruit is purplish red and the anthocyanin content is high. When the base at this SNP site Ⅰ in the allele is T, the color of the eggplant fruit is white and the anthocyanin content is low.

[0084] Figure 5 This is the genotyping result of SNP molecular marker Ⅰ. A represents the homozygous phenotype with the purple wild type WT, C represents the homozygous phenotype with the white mutant L6-5, and B represents the heterozygous phenotype.

[0085] SNP molecular marker Ⅱ contains the nucleotide sequence shown in SEQ ID NO.2. The 51st base from the 5' end of the nucleotide sequence shown in SEQ ID NO.2 is the SNP site, and its base is C / T. When the base at this SNP site Ⅱ in the allele is C, the color of the eggplant fruit is purplish red and the anthocyanin content is low. When the base at this SNP site Ⅱ in the allele is T, the color of the eggplant fruit is white.

[0086] Figure 6It is the genotyping result of SNP molecular marker II. A' represents the homozygous phenotype of the purple wild type WT in the F2 population, C' represents the homozygous phenotype of the white mutant L6-5 in the F2 population, and B' represents the heterozygous phenotype in the F2 population.

[0087] This specific embodiment is only an explanation of the present invention and is not a limitation thereof. After reading this specification, those skilled in the art can make modifications to this embodiment that do not contribute creatively, but as long as they are within the scope of the claims of the present invention, they are protected by the patent law. Sequence Listing <110> South Subtropical Crops Research Institute, Chinese Academy of Tropical Agricultural Sciences <120> SNP Molecular Marker Closely Linked to Eggplant Fruit Color and Its Application <160> 8 <170> SIPOSequenceListing 1.0 <210> 1 <211> 101 <212> DNA <213> Eggplant (Solanum melongena L.) <400> 1 <210> 2 <211> 101 <212> DNA <213> Eggplant (Solanum melongena L.) <400> 2 <210> 3 <211> 48 <212> DNA <213> Eggplant (Solanum melongena L.) <400> 3 <210> 4 <211> 50 <212> DNA <213> Eggplant (Solanum melongena L.) <400> 4 <210> 5 <211> 34 <212> DNA <213> Eggplant (Solanum melongena L.) <400> 5 <210> 6 <211> 55 <212> DNA <213> Eggplant (Solanum melongena L.) <400> 6 <210> 7 <211> 58 <212> DNA <213> Eggplant (Solanum melongena L.) <400> 7 <210> 8 <211> 36 <212> DNA <213> Eggplant (Solanum melongena L.) <400> 8

Claims

1. SNP molecular markers closely linked to eggplant fruit color, which are characterized in that: The SNP molecular markers include SNP molecular marker I and SNP molecular marker II; the SNP molecular marker I contains the nucleotide sequence shown in SEQ ID NO.1, and the 51st base from the 5' end of the nucleotide sequence shown in SEQ ID NO.1 is SNP site I; the SNP molecular marker II contains the nucleotide sequence shown in SEQ ID NO.2, and the 51st base from the 5' end of the nucleotide sequence shown in SEQ ID NO.2 is SNP site II; The SNP site I and SNP site II are located at the 95,538,422nd base and the 98,266,374th base of chromosome 10 of eggplant respectively, the 95,538,422nd base is C or T; the 98,266,374th base is C or T; The SEQ ID NO.1 is TACATCAGTGCATAGTTTCATTTGAGTTGATATTTCG TATACAGTGTTTC[C / T]TGCCTTATATATTCAATACATTATCTCGTACTGATGTCCCT TACGGGGGA; The SEQ ID NO.2 is GATTATAATATGAGAAATCGAACATTCATTAATAATA ATAAATAAAAGTT[C / T]AAATAATCAACTGATTAAACTATTAAGAAAGTTGATTTAGC CTATTACAA.

2. The detection method of the SNP molecular markers closely linked to eggplant fruit color according to claim 1, which is characterized in that The specific steps are as follows: S1. Extract the nucleotide sequence of the SNP molecular marker; S2. Convert the SNP molecular marker in the nucleotide sequence of step S1 into a KASP marker through primer design software; S3. Perform KASP-based SNP genotyping detection on the overall nucleotide sequence obtained by conversion in step S2 through a genotyping detection platform.

3. The detection method of the SNP molecular markers closely linked to eggplant fruit color according to claim 2, which is characterized in that: The reaction system where KASP is located contains a KASP primer mixture, a KASP master mixture and a DNA template; the KASP primer mixture includes a forward primer F-1, a forward primer F-2 and a reverse primer; the KASP master mixture includes an oligonucleotide sequence with a FAM label at the tail of the forward primer F-1, an oligonucleotide sequence with a HEX label at the tail of the forward primer F-2, a FAM dye, a HEX dye and a quencher; the DNA template is eggplant genomic DNA.

4. The detection method of the SNP molecular markers closely linked to eggplant fruit color according to claim 2, which is characterized in that The nucleotide sequence of the KASP marker primer for detecting SNP molecular marker I is: The forward primer F-1 is GAAGGTGACCAAGTTCATGCTTTTTTAGTGCATCCCAAAAA GAATGTC; the forward primer F-2 is GAAGGTCGGAGTCAACGGATTTGAGTTGATATTTC GTATACAGTGTTTCT; the reverse primer R is ACATCAGTACGAGATAATGTATTGAATATA TAAG.

5. The detection method of the SNP molecular marker closely linked to the eggplant fruit color according to claim 3, characterized in that, the nucleotide sequence of the KASP marker primer for detecting the SNP molecular marker II is: The forward primer F-1 is GAAGGTGACCAAGTTCATGCTTCGAACATTCATTAATAATA ATAAATAAAAGTTC; the forward primer F-2 is GAAGGTCGGAGTCAACGGATTAAATCGAA CATTCATTAATAATAATAAATAAAAGTTT; the reverse primer R is GCTAAATCAACTTTCT TAATAGTTTAATCAGTTGAT.

6. The application of the SNP molecular marker closely linked to the eggplant fruit color according to claim 1, characterized in that: The SNP molecular marker is applied to the early identification and screening of the eggplant fruit color trait, and the color traits are white and purplish red.

7. The application of the SNP molecular marker closely linked to the eggplant fruit color according to claim 1, characterized in that: The SNP molecular marker is applied to the assistant breeding for selecting eggplants with high anthocyanin content.

8. The application of the SNP molecular marker closely linked to the eggplant fruit color according to claim 1, characterized in that: The molecular probe or primer of the SNP molecular marker is applied to the preparation of a kit for detecting eggplants with high anthocyanin content.