A method for knocking out large DNA fragments in Halomonas using a dual-sgRNA binding RecET system

By using the double sgRNA-bound RecET system in Saltmonas, the problem of difficulty in knocking out large DNA fragments in the prior art is solved, and knocking out large DNA fragments from 10kb to 50kb is achieved, improving the efficiency of genomic operation and the application prospects of tools.

CN114717233BActive Publication Date: 2025-06-20INST OF MICROBIOLOGY CHINESE ACAD OF SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202110011391.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-01-06
Publication Date
2025-06-20
Estimated Expiration
2041-01-06

AI Technical Summary

Technical Problem

The prior art is difficult to efficiently knock out large DNA fragments, especially DNA fragments with a length of more than 3 kb in salmonas.

Method used

Using the method of combining double sgRNA with RecET system, knocking out large DNA fragments is achieved by introducing recombinant vectors with specific characteristics into Saltmonas. The system includes dual sgRNAs that can transcribe and target large fragments of DNA, upstream and downstream homologous arms, Cas9, RecE and RecT proteins.

Benefits of technology

It has achieved efficient knockdown of large DNA fragments of 10kb to 50kb in salmonas, improving the tool effectiveness of genome streamlining and synthetic biology transformation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0002885300160000051
    Figure BDA0002885300160000051
  • Figure HDA0002885300170000011
    Figure HDA0002885300170000011
  • Figure HDA0002885300170000012
    Figure HDA0002885300170000012
Patent Text Reader

Abstract

The present invention discloses a method for knocking out large DNA fragments in Halomonas using a dual-sgRNA binding RecET system. In the method for knocking out large DNA fragments in Halomonas disclosed by the present invention, the size of the knocked-out large DNA fragment is greater than or equal to 10 kb, and the method comprises: introducing a recombinant vector having the following features 1)-4) into the starting Halomonas to achieve the knockout of the large DNA fragment; 1) capable of transcribing sgRNA1 and sgRNA2, where sgRNA1 and sgRNA2 respectively target both ends of the knocked-out large DNA fragment; 2) containing an upstream homologous arm and a downstream homologous arm of the knocked-out large DNA fragment in the starting Halomonas; 3) capable of expressing Cas9; 4) capable of expressing RecE protein and RecT protein. The present invention solves the problem that large DNA fragment knockout cannot be experimentally carried out in Halomonas at present, and has broad application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a method for knocking out large DNA fragments of Halomonas in the field of biotechnology by using a dual-sgRNA binding RecET system. Background Art

[0002] Halomonas bluephagenesis TD1.0 has the natural ability to adapt to two extreme conditions of "salt" and "alkali", and can achieve sterile-free open continuous fermentation. It has been used as a low-cost industrial fermentation strain for the synthesis of various biological products. As an important industrial production platform strain, it is necessary to perform efficient gene editing on it, such as the deletion of large DNA fragments. With the rapid development of the new generation of gene editing technology CRISPR / Cas9, the type II-A CRISPR-Cas system from Streptococcus pyogenes has been widely applied in prokaryotes and eukaryotes. The effector complex that realizes the interference process of this system is composed of crRNA, tracrRNA and the Cas9 protein with a multifunctional domain. In current practical applications, crRNA has been fused with tracrRNA into one strand, which is called sgRNA, and contains 20 base sequences that can base-pair with the target DNA and an RNA secondary structure that can bind to Cas9. The Cas9 protein contains an HNH domain and a RuvC domain, both of which have nuclease activity, and respectively cleave the target strand complementary to crRNA and the non-target strand replaced by crRNA in the target DNA.

[0003] Previous studies have utilized the CRISPR-Cas9 system of Streptococcus pyogenes to initially establish a gene editing tool in Halomonas spp. This tool consists of a two-plasmid system: a Cas9 expression vector and an sgRNA expression vector (Qin, Q., Ling, C., Zhao, Y., Yang, T., Yin, J., & Guo, Y., et al. (2018). Crispr / cas9 editing genome of extremophile halomonas spp. Metabolic Engineering, S1096717618300053.) (see also Chinese patent application "A vector combination for rapid gene editing in Halomonas spp. and its application", application number 201711445256.3). The test results of this method show that as the length of the DNA fragment increases, the knockout success rate significantly decreases. The maximum knockout achievable is approximately 3 kb DNA fragment, and the knockout success rate is only 25%. This method cannot achieve large DNA fragment deletion in this bacterium. And in this study, the λ-Red recombination system was also tested for its ability to improve the efficiency of CRISPR-Cas9 gene editing in Halomonas spp. The results showed that the expression of the λ-Red recombination system was toxic to the cells, severely inhibiting the growth of the bacteria, and the knockout success rate was 0. There is an urgent need to explore a method that can knockout large DNA fragments. Summary of the Invention

[0004] The technical problem to be solved by the present invention is how to effectively knockout large DNA fragments of Halomonas spp.

[0005] To solve the above technical problem, the present invention first provides a method for knocking out large DNA fragments of Halomonas spp. (denoted as Method 1), where the large DNA fragment is greater than or equal to 10 kb. The Method 1 includes: introducing a recombinant vector with the following 1)-4) characteristics into the starting Halomonas spp. to achieve the knockout of the large DNA fragment;

[0006] 1) capable of transcribing sgRNA1 and sgRNA2, where sgRNA1 and sgRNA2 respectively target both ends of the large DNA fragment;

[0007] 2) containing the upstream homologous arm and downstream homologous arm of the large DNA fragment in the starting Halomonas spp.;

[0008] 3) capable of expressing Cas9;

[0009] 4) capable of expressing RecE protein and RecT protein.

[0010] In the above method 1, the lengths of the upstream homologous arm and the downstream homologous arm can both be greater than or equal to 1000 bp. The lengths of the upstream homologous arm and the downstream homologous arm can both be 1000 bp.

[0011] In the above method 1, the recombinant vector can be two, one, three or four recombinant vectors.

[0012] In the above method 1, the recombinant vectors can be two recombinant vectors named recombinant vector 1 and recombinant vector 2 respectively. Recombinant vector 1 has the following characteristics 1) and 2):

[0013] 1) It can transcribe sgRNA1 and sgRNA2, and sgRNA1 and sgRNA2 target both ends of the large DNA fragment respectively;

[0014] 2) It contains the upstream homologous arm and the downstream homologous arm of the large DNA fragment in Halomonas ventosae;

[0015] Recombinant vector 2 has the following characteristics 3) and 4):

[0016] 3) It can express Cas9;

[0017] 4) It can express RecE protein and RecT protein.

[0018] In the above method 1, recombinant vector 1 is a recombinant vector obtained by inserting the DNA fragment shown at positions 21 - 320 of sequence 1 in the sequence listing, the upstream homologous arm, and the downstream homologous arm into the starting vector (denoted as starting vector 1);

[0019] Recombinant vector 2 is a recombinant vector obtained by inserting the expression cassettes of RecE protein and RecT protein into another starting vector (denoted as starting vector 2) that can express Cas9.

[0020] Among them, positions 21 - 55 and 171 - 205 of sequence 1 are both promoter sequences; positions 56 - 136 and 206 - 286 are the DNA sequences for transcribing sgRNA1 and sgRNA2 respectively; positions 137 - 161 and 287 - 311 are both terminator sequences. The target sequences of sgRNA1 and sgRNA2 are positions 56 - 75 and 206 - 225 of sequence 1 respectively.

[0021] In one embodiment of the present invention, the starting vector 1 is pgVector. The recombinant vector 1 is obtained by replacing the small DNA fragment between AGCCGTCGTGACTGGGAAAA and TACCGAGCTCGAATTCGCGC in the starting vector 1 with the DNA fragment shown at positions 21 - 320 of Sequence 1 in the Sequence Listing, the upstream homologous arm, and the downstream homologous arm.

[0022] In one embodiment of the present invention, the starting vector 2 is the pSC101 - bad - ETgA - tet plasmid.

[0023] The amino acid sequence of the RecE protein is Sequence 3 in the Sequence Listing, and the amino acid sequence of the RecT protein is Sequence 4 in the Sequence Listing.

[0024] The expression cassette contains the RecE gene shown at positions 341 - 2941 of Sequence 2 and the RecT gene shown at positions 2934 - 3743 of Sequence 2. Positions 22 - 306 of Sequence 2 are the araBAD promoter sequence, positions 341 - 2941 are the RecE gene sequence, positions 2934 - 3743 are the RecT gene sequence. The RecE gene sequence encodes the RecE protein shown in Sequence 3, and the RecT gene sequence encodes the RecT protein shown in Sequence 4.

[0025] In the above Method 1, the large DNA fragment can be greater than or equal to 10 kb and less than or equal to 50 kb. Further, the large DNA fragment can be greater than or equal to 10 kb and less than or equal to 40 kb. Still further, the large DNA fragment can be greater than or equal to 10 kb and less than or equal to 30 kb. Even further, the large DNA fragment can be greater than or equal to 10 kb and less than or equal to 20 kb.

[0026] In the above Method 1, the starting Halomonas can be Halomonas bluephagenesis TD1.0.

[0027] The present invention also provides a method for knocking out a large DNA fragment in Halomonas (denoted as Method 2), the large DNA fragment is greater than or equal to 10 kb, and Method 2 includes: introducing a recombinant vector with the following characteristics 1) - 3) into the starting Halomonas to achieve the knockout of the large DNA fragment;

[0028] 1) It can transcribe sgRNA1 and sgRNA2, and sgRNA1 and sgRNA2 respectively target both ends of the large DNA fragment;

[0029] 2) It contains the upstream homologous arm and the downstream homologous arm of the large DNA fragment in the starting Halomonas;

[0030] 3) It can express Cas9.

[0031] In the above method 2, the recombinant vector may be the above-mentioned recombinant vector 1 and plasmid pQ08.

[0032] The recombinant vector in the above method 1 or the above method 2 also belongs to the protection scope of the present invention.

[0033] The present invention also provides a Halomonas DNA large fragment knockout system, which contains two sgRNAs or the transcriptional DNA fragments of these two sgRNAs that respectively target both ends of the DNA large fragment to be knocked out, Cas9 protein or its coding gene, and RecE protein and RecT protein or the coding genes of these two proteins.

[0034] The application of the recombinant vector in the above method 1 or the above method 2 in knocking out the Halomonas DNA large fragment;

[0035] Or, the application of the recombinant vector in the above method 1 or the above method 2 in preparing a product for knocking out the Halomonas DNA large fragment;

[0036] Or, the application of the system in knocking out the Halomonas DNA large fragment;

[0037] Or, the application of the system in preparing a product for knocking out the Halomonas DNA large fragment also belongs to the protection scope of the present invention.

[0038] The method for knocking out large fragment DNA in Halomonas by using the dual-sgRNA combined with RecET recombination system provided by the present invention can achieve efficient deletion of large fragment DNA in Halomonas. The present invention improves the genetic operation tool for large fragment DNA in Halomonas, provides an effective tool for genome streamlining and synthetic biology transformation of Halomonas, and further promotes the R & D process of Halomonas as a platform strain. The present invention solves the problem that large fragment DNA knockout cannot be effectively achieved in Halomonas at present and has a wide application prospect. Brief Description of the Drawings

[0039] Figure 1 Construction of plasmid p2gPSn carrying DNA of transcriptional dual-sgRNA and homologous arms.

[0040] Figure 2 Construction of plasmid pQ08-recET carrying RecET and Cas9.

[0041] Figure 3 DNA large fragment gene editing diagram of the present invention.

[0042] Figure 4 Design for knockout of flagellar gene fragments with different lengths of 20 kb - 50 kb.

[0043] Figure 5 It is the detection result of the 20 kb knockout PCR product. A is the PCR product of VF and 20kVR; B is the PCR product of VF and WTVR.

[0044] Figure 6 It is the detection result of the 30 kb knockout PCR product. A is the PCR product of VF and 30kVR; B is the PCR product of VF and WTVR.

[0045] Figure 7 It is the detection result of the 40 kb knockout PCR product. A is the PCR product of VF and 40kVR; B is the PCR product of VF and WTVR.

[0046] Figure 8 It is the detection result of the 50 kb knockout PCR product. A is the PCR product of VF and 50kVR; B is the PCR product of VF and WTVR.

[0047] Figure 9 It is the detection result of the 50 kb knockout PCR product when using pQ08-recET. The upper figure is the PCR product of VF and 50kVR; the lower figure is the PCR product of VF and WTVR. Detailed implementation manners

[0048] The present invention will be further described in detail below in conjunction with the detailed implementation manners. The provided embodiments are only for clarifying the present invention, rather than limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0049] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product specifications. The materials, reagents, instruments, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified. In the following embodiments, for the quantitative tests, three repeated experiments are set, and the results are averaged. In the following embodiments, unless otherwise specified, the first position of each nucleotide sequence in the sequence listing is the 5′-terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3′-terminal nucleotide of the corresponding DNA / RNA.

[0050] Halomonas bluephagenesis TD1.0 in the following examples (Qin, Q., Ling, C., Zhao, Y., Yang, T., Yin, J., & Guo, Y., et al. (2018). Crispr / cas9 editing genome of extremophile halomonas spp. Metabolic Engineering, 47(2018) 219–229, S1096717618300053.) can be obtained by the public from the applicant. This biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0051] Plasmids pQ08 and pSEVA241 in the following examples are described in the literature (Qin, Q., Ling, C., Zhao, Y., Yang, T., Yin, J., & Guo, Y., et al. (2018). Crispr / cas9 editing genome of extremophile halomonas spp. Metabolic Engineering, 47(2018) 219–229, S1096717618300053.). The public can obtain both of them from the applicant. These two plasmids are only used for repeating the relevant experiments of the present invention and cannot be used for other purposes. Among them, plasmid pQ08 carries the coding gene of Cas9, can express Cas9, and carries a chloramphenicol resistance gene (for Escherichia coli and Halomonas). The sequence of pSEVA241 is Sequence 9 in the Sequence Listing.

[0052] The pSC101-BAD-ETgA-tet plasmid in the following examples (Wang H, Li Z, Jia R, et al. RecET direct cloning and Redαβ recombineering of biosynthetic gene clusters, large operons or single genes for heterologous expression. [J]. Nature Protocols, 2016, 11(7): 1175-1190.) can be obtained by the public from the applicant. This biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0053] Escherichia coli E.coli S17-1 in the following examples (Qin, Q., Ling, C., Zhao, Y., Yang, T., Yin, J., & Guo, Y., et al. (2018). Crispr / cas9 editing genome of extremophile halomonas spp. Metabolic Engineering, Crispr / cas9 editing genome of extremophile halomonas S1096717618300053.), the public can obtain this biological material from the applicant. This biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0054] LB medium: 5 g / L yeast extract, 10 g / L tryptone, 10 g / L NaCl. Adjust the pH value to 7.0 - 7.2 and sterilize by high-pressure steam.

[0055] 60LB medium: 5 g / L yeast extract, 10 g / L tryptone, 60 g / L NaCl. Adjust the pH value to 7.0 - 7.2 and sterilize by high-pressure steam.

[0056] 20LB medium: 5 g / L yeast extract, 10 g / L tryptone, 20 g / L NaCl. Adjust the pH value to 7.0 - 7.2 and sterilize by high-pressure steam.

[0057] Example 1. Construction of plasmid carrying DNA of transcription dual sgRNA and homologous arms

[0058] The plasmid (named p2gPSn) carrying DNA of transcription dual sgRNA and homologous arms provided in this example is obtained by ligating four parts: DNA of two sgRNAs for transcribing the target fragment to be knocked out (this DNA fragment is denoted as 2gRNA, and the two transcribed sgRNAs are denoted as sgRNA1 and sgRNA2), upstream homologous arm H1, downstream homologous arm H2, and the plasmid backbone of pgVector, as Figure 1 shown.

[0059] The sequence of 2gRNA is sequence 1 in the sequence listing. The 21st - 55th and 171st - 205th positions of sequence 1 are promoter sequences; the 56th - 136th and 206th - 286th positions are respectively the DNA sequences of two sgRNAs for transcribing the target fragment to be knocked out, and the target sequences of these two sgRNAs are the 56th - 75th and 206th - 225th positions of sequence 1; the 137th - 161st and 287th - 311th positions are terminator sequences. N represents A, T, C or G.

[0060] The upstream homologous arm H1 is obtained by performing PCR amplification using the primer pair consisting of H1F and H1R with the genomic DNA of the strain with the gene to be knocked out as the template; the downstream homologous arm H2 is obtained by performing PCR amplification using the primer pair consisting of H2F and H2R with the genomic DNA of the strain with the gene to be knocked out as the template. The length of the upstream homologous arm H1 is 1000 bp, and the length of the downstream homologous arm H2 is 1000 bp.

[0061] Using pSEVA241 as the template, perform PCR amplification using the primer pair consisting of pgVector F and pgVector R. Digest the obtained PCR product with DpnI for 2 h to remove the template plasmid to obtain the pgVector plasmid backbone, which contains a resistance gene.

[0062] One end sequence of the obtained PCR product 1 is the same as that of the PS1 upstream homologous arm, the PS1 upstream homologous arm is the same as the PS1 downstream homologous arm, the PS1 downstream homologous arm is the same as the pgVector plasmid backbone, and the pgVector plasmid backbone is the same as PCR product 1.

[0063] Synthesize the 2gRNA shown in Sequence 1 of the sequence listing (this DNA fragment can also be obtained by first synthesizing the 2gRNA and then performing PCR amplification using it as the template with sgRNA F and sgRNA R). Recombine the 2gRNA, the upstream homologous arm H1, the downstream homologous arm H2, and the pgVector plasmid backbone through the Gibson Assembly Cloning Kit. Transform the obtained product into Escherichia coli JM109, and pick monoclonal colonies to extract plasmids for sequencing verification. The recombinant plasmid with the correct sequence obtained is p2gPSn, as Figure 1 shown.

[0064] The sequences of each primer are shown in Table 1.

[0065] Table 1. Primers for constructing the knockout vector and the synthesized sgRNA sequence

[0066]

[0067] The sequences with the same markers in Table 1 are reverse complementary or the same. N represents A, T, C, or G. The fragments represented by N in H1F and H1R are used to specifically recognize the upstream homologous arm, and the fragments represented by N in H2F and H2R are used to specifically recognize the downstream homologous arm.

[0068] Example 2. Construction of the pQ08-recET plasmid carrying RecET and Cas9

[0069] In this example, the pQ08-recET plasmid carrying RecET and Cas9 is constructed based on pQ08. The steps are as follows:

[0070] Digest pQ08 with the restriction endonuclease XmaI to obtain a linearized vector fragment. Using the pSC101-BAD-ETgA-tet plasmid as a template, perform PCR amplification with the primer pair F and R to obtain a PCR product (its sequence is sequence 2 in the sequence listing). The obtained PCR product contains the RecET gene and the upstream araBAD promoter. Recombine the above-mentioned linearized vector fragment and the PCR product through the Gibson Assembly Cloning Kit. The correctly sequenced recombinant plasmid is the pQ08-recET plasmid. As Figure 2 shown, this plasmid contains a chloramphenicol resistance gene (for Escherichia coli and Halomonas).

[0071] The primer sequences used are as follows: 5'-3'

[0072] F: 5'-acagtaatacaaggggtgttcaagaaaccaattgtccatat-3';

[0073] R: 5'-aggtcgactctagaggatccccggttattcctctgaattatcga-3'.

[0074] In sequence 2, positions 22-306 are the araBAD promoter sequence, positions 341-2941 are the RecE gene sequence, positions 2934-3743 are the RecT gene sequence. The RecE gene encodes the RecE protein shown in sequence 3 (its sequence is sequence 3), and the RecT gene encodes the RecT protein shown in sequence 4 (its sequence is sequence 4).

[0075] Example 3: Knockout test of 10-50 kb flagellar gene DNA large fragment in Halomonas

[0076] In this example, the p2gPSn and pQ08 plasmids obtained in Example 1 were used to knockout different lengths of flagellar gene DNA large fragments of Halomonas bluephagenesis TD1.0, as Figure 3 shown. The lengths of the knockout DNA large fragments are 20 kb, 30 kb, 40 kb, and 50 kb respectively, which are denoted as 20 kb fragment, 30 kb fragment, 40 kb fragment, and 50 kb fragment respectively. The knockout design of each fragment is as Figure 4 shown. The upstream homologous arms used are all H1, and the downstream homologous arms are 20kH2, 30kH2, 40kH2, and 50kH2 respectively. The involved fragments are included in fragment 1, and the sequence of fragment 1 is positions 305096-253077 of Genbank ID GL949758.1 (update date: March 13, 2015).

[0077] In Genbank ID GL949758.1 (update date: March 13, 2015), H1 is shown at positions 306095 - 305096; the 20kb fragment to be knocked out is shown at positions 305095 - 284367, and 20kH2 is shown at positions 284368 - 283369; the 30kb fragment to be knocked out is shown at positions 305095 - 274216, and 30kH2 is shown at positions 274217 - 273218; the 40kb fragment to be knocked out is shown at positions 305095 - 263758, and 40kH2 is shown at positions 263759 - 262760; the 50kb fragment to be knocked out is shown at positions 305095 - 254075, and 50kH2 is shown at positions 254076 - 253077.

[0078] 1. Conjugative transformation

[0079] Use E.coli S17 - 1 as the donor strain for conjugative transformation. The process is as follows:

[0080] Introduce the plasmid to be transformed into E.coli S17 - 1 to obtain E.coli S17 - 1 carrying the plasmid to be transformed.

[0081] Overnight culture and activate the target Halomonas and E.coli S17 - 1 carrying the plasmid to be transformed in LB60 and LB media supplemented with the corresponding antibiotics. Then centrifuge at 6000rpm for 2 minutes to collect the cells, resuspend each in 50μl of the corresponding medium, mix the resuspended cell suspensions of the target Halomonas and E.coli S17 - 1 carrying the plasmid to be transformed, and place a drop of the mixed cell suspension on the LB20 solid medium. After culturing upright at 37°C in an incubator for 12 hours, scrape the bacterial lawn and resuspend it in 100μl of LB60 medium containing the corresponding antibiotic, and spread it on the LB60 plate with the corresponding resistance. Culture at 37°C in an incubator for 24 - 48h to obtain the Halomonas carrying the transformed plasmid.

[0082] 2. Knockout of the 20kb fragment

[0083] Synthesize 2gRNA targeting the 20kb fragment to be knocked out for transcription, denoted as 20 - 2gRNA. Its sequence is sequence 5 in the sequence listing. The 56 - 136th and 206 - 286th positions of sequence 5 transcribe two sgRNA sequences respectively.

[0084] Using the genomic DNA of Halomonas bluephagenesis TD1.0 as a template, PCR amplification was performed with the primer pair consisting of H1F and H1R to obtain a PCR product containing the upstream homologous arm H1; using the genomic DNA of Halomonas bluephagenesis TD1.0 as a template, PCR amplification was performed with the primer pair consisting of 20-H2F and 20-H2R to obtain a PCR product containing the downstream homologous arm 20kH2. The primer sequences used are as follows:

[0085] H1F: ACTGCATGTGCAGCTAATGCcacgttgtttgcctcatcgt;

[0086] H1R:

[0087] 20-H2F:

[0088] 20-H2R: TTTTCCCAGTCACGACGGCT cccaggaagcgttggtcgac.

[0089] The 20-2gRNA, the PCR product containing the upstream homologous arm H1, the PCR product containing the downstream homologous arm 20kH2, and the pgVector plasmid backbone of Example 1 were recombined by the Gibson Assembly Cloning Kit. The resulting product was transformed into Escherichia coli JM109, and monoclonal colonies were picked to extract plasmids for sequencing verification. The correctly sequenced recombinant plasmid is the knockout plasmid p2gPS20, which contains a kanamycin resistance gene (for Escherichia coli) and a spectinomycin resistance gene (for Halomonas).

[0090] The knockout plasmid p2gPS20 was introduced into Escherichia coli E.coli S17-1, and the resulting recombinant bacterium was designated as E.coli S17-1 / p2gPS20.

[0091] Using pQ08 as the plasmid to be transformed and Halomonas bluephagenesis TD1.0 as the target Halomonas, pQ08 was introduced into Halomonas bluephagenesis TD1.0 according to the method of step 1 to obtain the recombinant bacterium Halomonas TD1.0 / pQ08.

[0092] The recombinant strains Halomonas TD1.0 / pQ08 and E. coli S17-1 / p2gPS20 were respectively cultured overnight for activation in LB60 and LB media supplemented with the corresponding antibiotics. Then, they were centrifuged at 6000 rpm for 2 minutes to collect the bacterial cells, and each was resuspended in 50 μl of the corresponding medium. The resuspended bacterial cell suspensions of Halomonas TD1.0 / pQ08 and E. coli S17-1 / p2gPS20 were mixed evenly, and a drop of the mixed bacterial suspension was placed on the LB20 solid medium. After culturing upright at 37°C in an incubator for 12 hours, the bacterial lawn was scraped and spread on an LB60 plate containing chloramphenicol and spectinomycin, and then cultured at 37°C in the incubator for 24 - 48 h for transformation screening. The grown monoclonal colonies were identified by PCR amplification using primers. The primer pair VF and 20kVR was used to verify the presence of the knockout. If the knockout was successful, a band of approximately 2400 bp could be amplified by VF and 20kVR. The primer pair VF and WTVR was used to verify the presence of the wild-type band. If the knockout failed, a band of approximately 1700 bp could be amplified by VF and WTVR. The sequences of each primer are as follows:

[0093] VF: ccttcacgaatagcttcgcg;

[0094] WTVR: ctcattgcggaactagcaat;

[0095] 20kVR: gggcgagattctcaacctga.

[0096] The homozygosity rate (i.e., the knockout success rate) and the mutation rate were calculated. Homozygosity rate = number of homozygous monoclonal colonies / total number of monoclonal colonies × 100%, and mutation rate = (number of homozygous monoclonal colonies + number of heterozygous monoclonal colonies) / total number of monoclonal colonies × 100%. A homozygous monoclonal colony refers to a clone in which a band of approximately 2400 bp can be amplified by VF and 20kVR and a band of approximately 1700 bp cannot be amplified by VF and 20kVR. A heterozygous monoclonal colony refers to a clone in which a band of approximately 2400 bp can be amplified by VF and 20kVR and a band of approximately 1700 bp can be amplified by VF and 20kVR. The total number of monoclonal colonies refers to the total number of identified clones.

[0097] The electrophoresis results of the PCR products of 32 randomly selected monoclonal colonies are as Figure 5As shown, Halomonas bluephagenesis TD1.0 was used as the wild-type control. Among the randomly selected 32 monoclonal colonies, numbers 2, 4, 5, 6, 7, 8, 10, 11, 15, 18, 21, 22, 23, 24, 25, 28, 29, 30, 31, and 32 were successfully knocked out and were homozygous monoclonal colonies. Numbers 1, 3, 12, 13, 14, 17, 19, 20, 26, and 27 were heterozygous monoclonal colonies. Numbers 9 and 16 did not have the target fragment knocked out. The homozygosity rate was 62.5%, and the mutation rate was 93.75%. After sequencing verification, all the obtained homozygous monoclonal colonies successfully achieved the knockout of the 20 kb target fragment and did not contain the 20 kb fragment between its upstream and downstream homologous arms.

[0098] 3. Knockout of the 30 kb fragment

[0099] Synthesize the 2 gRNA targeting the 30 kb fragment to be knocked out for transcription, denoted as 30-2gRNA. Its sequence is sequence 6 in the sequence listing. The 56-136th and 206-286th positions of sequence 6 transcribe two sgRNAs respectively.

[0100] Using the genomic DNA of Halomonas bluephagenesis TD1.0 as a template, perform PCR amplification with the primer pair composed of 30-H2F and 30-H2R to obtain a PCR product containing the downstream homologous arm 30kH2. The primer sequences used are as follows:

[0101] 30-H2F:

[0102] 30-H2R: TTTTCCCAGTCACGACGGCT cggctagctggggagcataa.

[0103] Recombine 30-2gRNA, the above-obtained PCR product containing the upstream homologous arm H1, the PCR product containing the downstream homologous arm 30kH2, and the pgVector plasmid backbone of Example 1 through the Gibson Assembly Cloning Kit. Transform the obtained product into Escherichia coli JM109, and pick monoclonal colonies to extract plasmid for sequencing verification. The correctly sequenced recombinant plasmid is the knockout plasmid p2gPS30, which contains a kanamycin resistance gene (for Escherichia coli) and a spectinomycin resistance gene (for Halomonas).

[0104] Introduce the knockout plasmid p2gPS30 into Escherichia coli E.coli S17-1, and denote the obtained recombinant bacterium as E.coli S17-1 / p2gPS30.

[0105] The recombinant bacteria Halomonas TD1.0 / pQ08 and E. coli S17-1 / p2gPS30 were respectively cultured overnight for activation in LB60 and LB media supplemented with the corresponding antibiotics. Then, they were centrifuged at 6000 rpm for 2 minutes to collect the bacterial cells, and each was resuspended in 50 μl of the corresponding medium. The resuspended bacterial solutions of the recombinant bacteria Halomonas TD1.0 / pQ08 and E. coli S17-1 / p2gPS30 were mixed evenly, and the mixed bacterial solution was dropped onto the LB20 solid medium. After culturing upright at 37°C in an incubator for 12 hours, the bacterial lawn was scraped and spread on an LB60 plate containing chloramphenicol and spectinomycin, and cultured at 37°C in an incubator for 24 - 48 h for transformation screening. The grown monoclonal colonies were identified by PCR amplification using primers. The primer pairs VF and 30kVR were used to verify the presence of the knockout. If the knockout was successful, a band of approximately 2400 bp could be amplified by VF and 30kVR. VF and WTVR were used to verify the presence of the wild-type band. If the knockout failed, a band of approximately 1700 bp could be amplified by the primer pair VF and WTVR. The primers of VF and WTVR were the same as in step 2, and the primer sequence of 30kVR: 30kVR: aagtcggcaagggcaatctt.

[0106] The homozygosity rate (i.e., the knockout success rate) and the mutation rate were statistically analyzed. The electrophoresis results of the PCR products of 32 randomly selected monoclonal colonies are as Figure 6 shown. Halomonas bluephagenesis TD1.0 was used as the wild-type control. Among the 32 randomly selected monoclonal colonies, numbers 2, 6, 9, 11, 15, 17, 18, and 25 were successfully knocked out and were homozygous monoclonal colonies, numbers 22 and 27 were heterozygous monoclonal colonies, and the remaining did not have the knockout of the target fragment. The homozygosity rate was 25%, and the mutation rate was 31.25%. After sequencing verification, all the obtained homozygous monoclonal colonies successfully achieved the knockout of the target 30 kb fragment and did not contain the 30 kb fragment between its upstream and downstream homologous arms.

[0107] 4. Knockout of the 40 kb fragment

[0108] Synthesize the 2gRNA targeting the 40 kb fragment to be knocked out for transcription, denoted as 40 - 2gRNA. Its sequence is sequence 7 in the sequence listing. The 56 - 136th and 206 - 286th positions of sequence 7 respectively transcribe the target sequences of two sgRNAs.

[0109] Using the genomic DNA of Halomonas bluephagenesis TD1.0 as a template, PCR amplification was carried out using the primer pair composed of 40 - H2F and 40 - H2R to obtain a PCR product containing the downstream homologous arm 40kH2. The primer sequences used are as follows:

[0110] 40-H2F:

[0111] 40-H2R: TTTTCCCAGTCACGACGGCT atcggcattttgtttcaccg。

[0112] Recombine 40-2gRNA, the PCR product containing the upstream homologous arm H1 obtained above, the PCR product containing the downstream homologous arm 40kH2, and the pgVector plasmid backbone of Example 1 through the Gibson Assembly Cloning Kit. Transform the obtained product into Escherichia coli JM109, pick monoclonal colonies and extract plasmids for sequencing verification. The recombinant plasmid with the correct sequence obtained is the knockout plasmid p2gPS40, which contains a kanamycin resistance gene (for Escherichia coli) and a spectinomycin resistance gene (for Halomonas).

[0113] Introduce the knockout plasmid p2gPS40 into Escherichia coli E.coli S17-1, and the obtained recombinant bacterium is designated as E.coli S17-1 / p2gPS40.

[0114] Overnight culture and activate the above-mentioned recombinant bacteria Halomonas TD1.0 / pQ08 and E.coli S17-1 / p2gPS40 in LB60 and LB media supplemented with the corresponding antibiotics respectively. Then centrifuge at 6000 rpm for 2 minutes to collect the bacterial cells, resuspend each with 50 μl of the corresponding medium, mix the resuspended bacterial solutions of the recombinant bacteria Halomonas TD1.0 / pQ08 and E.coli S17-1 / p2gPS40, and take the mixed bacterial solution and drop it on the LB20 solid medium. After culturing upright in a constant temperature incubator at 37 °C for 12 hours, scrape the bacterial lawn and spread it on an LB60 plate containing chloramphenicol and spectinomycin, and culture in a constant temperature incubator at 37 °C for 24 - 48 h for transformation screening. Identify the grown monoclonal colonies by PCR amplification using primers. The primer pair VF and 40kVR are used to verify the presence of knockout. If the knockout is successful, a band of about 2400 bp can be amplified by VF and 40kVR. VF and WTVR are used to verify the presence of the wild-type band. If the knockout fails, a band of about 1700 bp can be amplified by the primer pair VF and WTVR. The primers of VF and WTVR are the same as in Step 2. The primer sequence of 40kVR: 40kVR: taccgaggcattgagtgcca.

[0115] Statistical analysis of the homozygosity rate (i.e., the knockout success rate) and the mutation rate. The electrophoresis results of the PCR products of 32 randomly selected monoclonal colonies are as Figure 7As shown, Halomonas bluephagenesis TD1.0 was used as the wild-type control. Among the randomly selected 32 monoclonal colonies, numbers 3, 5, 6, 12, 15, 22, 29, and 31 were successfully knocked out and were homozygous monoclonal colonies, number 21 was a heterozygous monoclonal colony, and the others did not have the target fragment knocked out. The homozygosity rate was 25%, and the mutation rate was 28.125%. Sequencing verification showed that all the obtained homozygous monoclonal colonies had successfully achieved the knockout of the 40 kb target fragment, and did not contain the 40 kb fragment between its upstream and downstream homologous arms.

[0116] Knockout of the 50 kb fragment

[0117] Synthesize 2gRNA targeting the 50 kb fragment to be knocked out for transcription, denoted as 50-2gRNA. Its sequence is sequence 8 in the sequence listing. The 56-136th and 206-286th positions of sequence 8 transcribe two sgRNAs respectively.

[0118] Using the genomic DNA of Halomonas bluephagenesis TD1.0 as a template, PCR amplification was performed with the primer pair composed of 50-H2F and 50-H2R to obtain a PCR product containing the downstream homologous arm 50kH2. The primer sequences used are as follows:

[0119] 50-H2F:

[0120] 50-H2R: TTTTCCCAGTCACGACGGCT atatcatcacgtacataggt.

[0121] Recombine 50-2gRNA, the above-obtained PCR product containing the upstream homologous arm H1, the PCR product containing the downstream homologous arm 50kH2, and the pgVector plasmid backbone of Example 1 through the Gibson assembly cloning kit. Transform the obtained product into Escherichia coli JM109, and pick monoclonal colonies to extract plasmid for sequencing verification. The recombinant plasmid with the correct sequence obtained is the knockout plasmid p2gPS50. This plasmid contains a kanamycin resistance gene (for Escherichia coli) and a spectinomycin resistance gene (for Halomonas).

[0122] Introduce the knockout plasmid p2gPS50 into Escherichia coli E.coli S17-1, and the obtained recombinant bacterium is denoted as E.coli S17-1 / p2gPS50.

[0123] The recombinant bacteria Halomonas TD1.0 / pQ08 and E. coli S17-1 / p2gPS50 mentioned above were respectively cultured overnight for activation in LB60 and LB media supplemented with the corresponding antibiotics. Then, they were centrifuged at 6000 rpm for 2 minutes to collect the bacterial cells, and each was resuspended in 50 μl of the corresponding medium. The resuspended bacterial solutions of the recombinant bacteria Halomonas TD1.0 / pQ08 and E. coli S17-1 / p2gPS50 were mixed evenly, and the mixed bacterial solution was taken and dropped onto the LB20 solid medium. After culturing upright at 37°C in an incubator for 12 hours, the bacterial lawn was scraped and spread on the LB60 plate containing chloramphenicol and spectinomycin, and then cultured at 37°C in an incubator for 24 - 48 h for transformation screening. The grown monoclonal colonies were identified by PCR amplification using primers. The primer pairs VF and 50kVR were used to verify the presence of the knockout. If the knockout was successful, a band of approximately 2400 bp could be amplified by VF and 50kVR. VF and WTVR were used to verify the presence of the wild-type band. If the knockout failed, a band of approximately 1700 bp could be amplified by the primer pair VF and WTVR. The primers of VF and WTVR were the same as in step 2, and the primer sequence of 50kVR was: 50kVR: cgtaggtagccatcgtacga.

[0124] The homozygosity rate (i.e., the knockout success rate) and the mutation rate were statistically analyzed. The electrophoresis results of the PCR products of 32 randomly selected monoclonal colonies were as Figure 8 shown. Halomonas bluephagenesis TD1.0 was used as the wild-type control. Among the 32 randomly selected monoclonal colonies, numbers 2, 7, 9, and 22 were successfully knocked out and were homozygous monoclonal colonies, number 22 was a heterozygous monoclonal colony, and the others did not have the knockout of the target fragment. The homozygosity rate was 12.5%, and the mutation rate was 15.6%. After sequencing verification, all the obtained homozygous monoclonal colonies successfully achieved the knockout of the target 50 kb fragment and did not contain the 50 kb fragment between its upstream and downstream homologous arms.

[0125] 6. Knocking out a 50-kb DNA large fragment in Halomonas by the double sgRNA-binding RecET recombination system

[0126] The knockout plasmid p2gPS50 in step 5 and pQ08-recET obtained in Example 2 were used to knock out the 50-kb fragment of Halomonas bluephagenesis TD1.0 respectively. The specific steps are as follows:

[0127] The knockout plasmid p2gPS50 was introduced into Escherichia coli S17-1, and the resulting recombinant bacterium was designated as E. coli S17-1 / p2gPS50. Using pQ08-recET obtained in Example 2 as the plasmid to be transformed and Halomonas bluephagenesis TD1.0 as the target Halomonas, pQ08-recET was introduced into Halomonas bluephagenesis TD1.0 according to the method of Step 1 to obtain the recombinant bacterium Halomonas TD1.0 / pQ08-recET.

[0128] The obtained recombinant bacteria Halomonas TD1.0 / pQ08-recET and E. coli S17-1 / p2gPS50 were cultured overnight for activation in LB60 and LB media supplemented with the corresponding antibiotics. Then, they were centrifuged at 6000 rpm for 2 minutes to collect the bacterial cells, and each was resuspended in 50 μl of the corresponding medium. The resuspended bacterial solutions of the recombinant bacteria Halomonas TD1.0 / pQ08 and E. coli S17-1 / p2gPS50 were mixed evenly, and a drop of the mixed bacterial solution was placed on the LB20 solid medium. After culturing upright at 37°C in an incubator for 12 hours, the bacterial lawn was scraped and spread on an LB60 plate containing chloramphenicol and spectinomycin, and then cultured at 37°C in an incubator for 24 - 48 h for transformation screening. The grown monoclonal colonies were identified by PCR amplification using primers, and the identification method was the same as in Step 5.

[0129] The homozygosity rate (i.e., the knockout success rate) and the mutation rate were statistically analyzed. The electrophoresis results of the PCR products of 16 randomly selected monoclonal colonies are shown as Figure 9 follows. Using Halomonas bluephagenesis TD1.0 as the wild-type control. Among the 16 randomly selected monoclonal colonies, Nos. 1, 3, 7, and 11 were successfully knocked out and were homozygous monoclonal colonies, Nos. 2, 4, 5, 6, 9, and 12 were heterozygous monoclonal colonies, and the remaining ones did not have the knockout of the target fragment. The homozygosity rate was 25%, and the mutation rate was 62.5%. After sequencing verification, all the obtained homozygous monoclonal colonies successfully achieved the knockout of the target 50-kb fragment and did not contain the 50-kb fragment between its upstream and downstream homologous arms.

[0130] This method can achieve the knockout of 20 - 50 kb large fragment DNA in Halomonas. However, with the extension of the fragment, the knockout efficiency decreases. The present invention further successfully improved the knockout rate of larger fragments (such as 50 kb) by adding the RecET recombination system to the system.

[0131] The present invention has been described in detail above. For those skilled in the art, without departing from the spirit and scope of the present invention and without the need for unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any modifications, uses, or improvements to the present invention, including those that depart from the scope disclosed in this application but are made using conventional techniques known in the art. The application of some basic features can be made within the scope of the following appended claims. Sequence Listing <110> Institute of Microbiology, Chinese Academy of Sciences <120> Method for knocking out large DNA fragments of Halomonas using a dual sgRNA-binding RecET system <160> 9 <170> PatentIn version 3.5 <210> 1 <211> 340 <212> DNA <213> Artificial sequence <220> <221> misc_feature <222> (56)..(75) <223> n is a, c, g, or t <220> <221> misc_feature <222> (206)..(225) <223> n is a, c, g, or t <400> 1 gcgcgaattc gagctcggta ttgacagcta gctcagtcct aggtataata ctagtnnnnn 60 nnnnnnnnnn nnnnngtttt agagctagaa atagcaagtt aaaataaggc tagtccgtta 120 tcaacttgaa aaagtggcac cgagtcggtg ctttttttga acccgggatg ttgacagcta 180 gctcagtcct aggtataata ctagtnnnnn nnnnnnnnnn nnnnngtttt agagctagaa 240 atagcaagtt aaaataaggc tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg 300 ctttttttga acccgggatg actgcatgtg cagctaatgc 340 <210> 2 <211> 3767 <212> DNA <213> Artificial sequence <400> 2 acagtaatac aaggggtgtt caagaaacca attgtccata ttgcatcaga cattgccgtc 60 actgcgtctt ttactggctc ttctcgctaa ccaaaccggt aaccccgctt attaaaagca 120 ttctgtaaca aagcgggacc aaagccatga caaaaacgcg taacaaaagt gtctataatc 180 acggcagaaa agtccacatt gattatttgc acggcgtcac actttgctat gccatagcat 240 ttttatccat aagattagcg gatcctacct gacgcttttt atcgcaactc tctactgttt 300 ctccataccc gtttttttgg gctagcagga ggaattcact atgagcacaa aaccactctt 360 cctgttacgg aaagcgaaaa aatcatccgg tgaacctgac gtcgtcctgt gggcaagcaa 420 cgattttgaa tcgacctgtg ccactctgga ctacctgatc gttaagtcag gtaaaaaact 480 gagcagctat tttaaagctg ttgccacgaa ttttcctgtc gttaatgacc tgcccgctga 540 aggtgagatc gattttacct ggagtgaacg ctatcaactc agcaaagact ccatgacatg 600 ggaactaaaa ccgggagcag caccagacaa cgctcactat caaggcaata ccaacgtcaa 660 cggcgaagac atgactgaga ttgaggagaa tatgctactc ccaatttctg gccaggaact 720 gcccattcgt tggcttgctc aacacggcag cgaaaaaccg gtaacgcacg tttcacgcga 780 cggactccag gcattacaca ttgctcgggc tgaagaacta ccggctgtta ctgccctggc 840 tgtttcccac aaaaccagcc tgctcgaccc gctggaaatt cgcgaactcc acaaactggt 900 tcgtgacact gacaaagttt tccctaatcc tggtaattca aacctgggac tgataactgc 960 ttttttcgaa gcatacctga acgctgacta caccgatcga ggactgctga caaaagagtg 1020 gatgaagggt aatcgtgttt cacacatcac tcgcacggct tccggtgcta atgctggcgg 1080 cggaaacctc accgatcgcg gcgaaggttt cgtacacgat ctgacgtcac tggcgcgcga 1140 cgtagccact ggcgtactgg cccgttcaat ggatctggac atctataacc ttcatccggc 1200 acacgctaaa cgcattgagg aaattatcgc tgaaaataaa ccgccctttt ctgttttccg 1260 cgacaaattc atcaccatgc ctggcgggct ggattattcc cgcgccatcg tggttgcgtc 1320 cgtaaaagaa gcaccaattg ggatcgaggt catccccgcg cacgtcactg aatatctgaa 1380 caaagtactg actgaaaccg atcatgccaa ccctgatccg gaaatcgtgg atattgcctg 1440 cggtcgctcc tctgccccga tgccgcagcg agtaacagaa gaaggaaaac aggatgatga 1500 agaaaaaccg caaccatctg gaacaacggc agttgaacag ggagaggctg aaacaatgga 1560 accggacgca actgaacatc atcaggacac gcagccgctg gatgctcagt cacaggtaaa 1620 ttctgttgat gcgaaatatc aggaactgcg ggcagaactc catgaagccc ggaaaaacat 1680 tccatcaaaa aatcctgtcg atgacgataa attgcttgct gcatcacgtg gtgaatttgt 1740 tgacggaatt agcgacccga acgatccgaa atgggtaaag gggatccaga ctcgcgattg 1800 tgtgtaccag aaccagccag aaacggaaaa aaccagccca gatatgaatc aacctgagcc 1860 agtagtgcaa caggaaccgg aaatagcctg caatgcctgc ggccagactg gcggggataa 1920 ctgccctgac tgtggtgcgg tgatgggcga cgcaacatac caggaaacat tcgatgaaga 1980 gagtcaggtt gaagctaagg aaaatgatcc ggaggaaatg gaaggcgctg aacatccgca 2040 caatgagaat gctggcagcg atccgcatcg cgattgcagt gatgaaactg gcgaagtcgc 2100 agatcccgta atcgtagaag acatagagcc aggtatttat tacggaattt cgaatgagaa 2160 ttaccacgcg ggtcccggta tcagtaagtc tcagctcgat gacattgctg atactccggc 2220 actatatttg tggcgtaaaa atgcccccgt ggacaccaca aagacaaaaa cgctcgattt 2280 aggaactgct ttccactgcc gggtacttga accggaagaa ttcagtaacc gctttatcgt 2340 agcacctgaa tttaaccgcc gtacaaacgc cggaaaagaa gaagagaaag cgtttctgat 2400 ggaatgcgca agcacaggaa aaacggttat cactgcggaa gaaggccgga aaattgaact 2460 catgtatcaa agcgttatgg ctttgccgct ggggcaatgg cttgttgaaa gcgccggaca 2520 cgctgaatca tcaatttact gggaagatcc tgaaacagga attttgtgtc ggtgccgtcc 2580 ggacaaaatt atccctgaat ttcactggat catggacgtg aaaactacgg cggatattca 2640 acgattcaaa accgcttatt acgactaccg ctatcacgtt caggatgcat tctacagtga 2700 cggttatgaa gcacagtttg gagtgcagcc aactttcgtt tttctggttg ccagcacaac 2760 tattgaatgc ggacgttatc cggttgaaat tttcatgatg ggcgaagaag caaaactggc 2820 aggtcaacag gaatatcacc gcaatctgcg aaccctgtct gactgcctga ataccgatga 2880 atggccagct attaagacat tatcactgcc ccgctgggct aaggaatatg caaatgacta 2940 agcaaccacc aatcgcaaaa gccgatctgc aaaaaactca gggaaaccgt gcaccagcag 3000 cagttaaaaa tagcgacgtg attagtttta ttaaccagcc atcaatgaaa gagcaactgg 3060 cagcagctct tccacgccat atgacggctg aacgtatgat ccgtatcgcc accacagaaa 3120 ttcgtaaagt tccggcgtta ggaaactgtg acactatgag ttttgtcagt gcgatcgtac 3180 agtgttcaca gctcggactt gagccaggta gcgccctcgg tcatgcatat ttactgcctt 3240 ttggtaataa aaacgaaaag agcggtaaaa agaacgttca gctaatcatt ggctatcgcg 3300 gcatgattga tctggctcgc cgttctggtc aaatcgccag cctgtcagcc cgtgttgtcc 3360 gtgaaggtga cgagtttagc ttcgaatttg gccttgatga aaagttaata caccgcccgg 3420 gagaaaacga agatgccccg gttacccacg tctatgctgt cgcaagactg aaagacggag 3480 gtactcagtt tgaagttatg acgcgcaaac agattgagct ggtgcgcagc ctgagtaaag 3540 ctggtaataa cgggccgtgg gtaactcact gggaagaaat ggcaaagaaa acggctattc 3600 gtcgcctgtt caaatatttg cccgtatcaa ttgagatcca gcgtgcagta tcaatggatg 3660 aaaaggaacc actgacaatc gatcctgcag attcctctgt attaaccggg gaatacagtg 3720 taatcgataa ttcagaggaa taaccgggga tcctctagag tcgacct 3767 <210> 3 <211> 866 <212> PRT <213> Artificial sequence <400> 3 Met Ser Thr Lys Pro Leu Phe Leu Leu Arg Lys Ala Lys Lys Ser Ser 1 5 10 15 Gly Glu Pro Asp Val Val Leu Trp Ala Ser Asn Asp Phe Glu Ser Thr 20 25 30 Cys Ala Thr Leu Asp Tyr Leu Ile Val Lys Ser Gly Lys Lys Leu Ser 35 40 45 Ser Tyr Phe Lys Ala Val Ala Thr Asn Phe Pro Val Val Asn Asp Leu 50 55 60 Pro Ala Glu Gly Glu Ile Asp Phe Thr Trp Ser Glu Arg Tyr Gln Leu 65 70 75 80 Ser Lys Asp Ser Met Thr Trp Glu Leu Lys Pro Gly Ala Ala Pro Asp 85 90 95 Asn Ala His Tyr Gln Gly Asn Thr Asn Val Asn Gly Glu Asp Met Thr 100 105 110 Glu Ile Glu Glu Asn Met Leu Leu Pro Ile Ser Gly Gln Glu Leu Pro 115 120 125 Ile Arg Trp Leu Ala Gln His Gly Ser Glu Lys Pro Val Thr His Val 130 135 140 Ser Arg Asp Gly Leu Gln Ala Leu His Ile Ala Arg Ala Glu Glu Leu 145 150 155 160 Pro Ala Val Thr Ala Leu Ala Val Ser His Lys Thr Ser Leu Leu Asp 165 170 175 Pro Leu Glu Ile Arg Glu Leu His Lys Leu Val Arg Asp Thr Asp Lys 180 185 190 Val Phe Pro Asn Pro Gly Asn Ser Asn Leu Gly Leu Ile Thr Ala Phe 195 200 205 Phe Glu Ala Tyr Leu Asn Ala Asp Tyr Thr Asp Arg Gly Leu Leu Thr 210 215 220 Lys Glu Trp Met Lys Gly Asn Arg Val Ser His Ile Thr Arg Thr Ala 225 230 235 240 Ser Gly Ala Asn Ala Gly Gly Gly Asn Leu Thr Asp Arg Gly Glu Gly 245 250 255 Phe Val His Asp Leu Thr Ser Leu Ala Arg Asp Val Ala Thr Gly Val 260 265 270 Leu Ala Arg Ser Met Asp Leu Asp Ile Tyr Asn Leu His Pro Ala His 275 280 285 Ala Lys Arg Ile Glu Glu Ile Ile Ala Glu Asn Lys Pro Pro Phe Ser 290 295 300 Val Phe Arg Asp Lys Phe Ile Thr Met Pro Gly Gly Leu Asp Tyr Ser 305 310 315 320 Arg Ala Ile Val Val Ala Ser Val Lys Glu Ala Pro Ile Gly Ile Glu 325 330 335 Val Ile Pro Ala His Val Thr Glu Tyr Leu Asn Lys Val Leu Thr Glu 340 345 350 Thr Asp His Ala Asn Pro Asp Pro Glu Ile Val Asp Ile Ala Cys Gly 355 360 365 Arg Ser Ser Ala Pro Met Pro Gln Arg Val Thr Glu Glu Gly Lys Gln 370 375 380 Asp Asp Glu Glu Lys Pro Gln Pro Ser Gly Thr Thr Ala Val Glu Gln 385 390 395 400 Gly Glu Ala Glu Thr Met Glu Pro Asp Ala Thr Glu His His Gln Asp 405 410 415 Thr Gln Pro Leu Asp Ala Gln Ser Gln Val Asn Ser Val Asp Ala Lys 420 425 430 Tyr Gln Glu Leu Arg Ala Glu Leu His Glu Ala Arg Lys Asn Ile Pro 435 440 445 Ser Lys Asn Pro Val Asp Asp Asp Lys Leu Leu Ala Ala Ser Arg Gly 450 455 460 Glu Phe Val Asp Gly Ile Ser Asp Pro Asn Asp Pro Lys Trp Val Lys 465 470 475 480 Gly Ile Gln Thr Arg Asp Cys Val Tyr Gln Asn Gln Pro Glu Thr Glu 485 490 495 Lys Thr Ser Pro Asp Met Asn Gln Pro Glu Pro Val Val Gln Gln Glu 500 505 510 Pro Glu Ile Ala Cys Asn Ala Cys Gly Gln Thr Gly Gly Asp Asn Cys 515 520 525 Pro Asp Cys Gly Ala Val Met Gly Asp Ala Thr Tyr Gln Glu Thr Phe 530 535 540 Asp Glu Glu Ser Gln Val Glu Ala Lys Glu Asn Asp Pro Glu Glu Met 545 550 555 560 Glu Gly Ala Glu His Pro His Asn Glu Asn Ala Gly Ser Asp Pro His 565 570 575 Arg Asp Cys Ser Asp Glu Thr Gly Glu Val Ala Asp Pro Val Ile Val 580 585 590 Glu Asp Ile Glu Pro Gly Ile Tyr Tyr Gly Ile Ser Asn Glu Asn Tyr 595 600 605 His Ala Gly Pro Gly Ile Ser Lys Ser Gln Leu Asp Asp Ile Ala Asp 610 615 620 Thr Pro Ala Leu Tyr Leu Trp Arg Lys Asn Ala Pro Val Asp Thr Thr 625 630 635 640 Lys Thr Lys Thr Leu Asp Leu Gly Thr Ala Phe His Cys Arg Val Leu 645 650 655 Glu Pro Glu Glu Phe Ser Asn Arg Phe Ile Val Ala Pro Glu Phe Asn 660 665 670 Arg Arg Thr Asn Ala Gly Lys Glu Glu Glu Lys Ala Phe Leu Met Glu 675 680 685 Cys Ala Ser Thr Gly Lys Thr Val Ile Thr Ala Glu Glu Gly Arg Lys 690 695 700 Ile Glu Leu Met Tyr Gln Ser Val Met Ala Leu Pro Leu Gly Gln Trp 705 710 715 720 Leu Val Glu Ser Ala Gly His Ala Glu Ser Ser Ile Tyr Trp Glu Asp 725 730 735 Pro Glu Thr Gly Ile Leu Cys Arg Cys Arg Pro Asp Lys Ile Ile Pro 740 745 750 Glu Phe His Trp Ile Met Asp Val Lys Thr Thr Ala Asp Ile Gln Arg 755 760 765 Phe Lys Thr Ala Tyr Tyr Asp Tyr Arg Tyr His Val Gln Asp Ala Phe 770 775 780 Tyr Ser Asp Gly Tyr Glu Ala Gln Phe Gly Val Gln Pro Thr Phe Val 785 790 795 800 Phe Leu Val Ala Ser Thr Thr Ile Glu Cys Gly Arg Tyr Pro Val Glu 805 810 815 Ile Phe Met Met Gly Glu Glu Ala Lys Leu Ala Gly Gln Gln Glu Tyr 820 825 830 His Arg Asn Leu Arg Thr Leu Ser Asp Cys Leu Asn Thr Asp Glu Trp 835 840 845 Pro Ala Ile Lys Thr Leu Ser Leu Pro Arg Trp Ala Lys Glu Tyr Ala 850 855 860 Asn Asp 865 <210> 4 <211> 269 <212> PRT <213> Artificial sequence <400> 4 Met Thr Lys Gln Pro Pro Ile Ala Lys Ala Asp Leu Gln Lys Thr Gln 1 5 10 15 Gly Asn Arg Ala Pro Ala Ala Val Lys Asn Ser Asp Val Ile Ser Phe 20 25 30 Ile Asn Gln Pro Ser Met Lys Glu Gln Leu Ala Ala Ala Leu Pro Arg 35 40 45 His Met Thr Ala Glu Arg Met Ile Arg Ile Ala Thr Thr Glu Ile Arg 50 55 60 Lys Val Pro Ala Leu Gly Asn Cys Asp Thr Met Ser Phe Val Ser Ala 65 70 75 80 Ile Val Gln Cys Ser Gln Leu Gly Leu Glu Pro Gly Ser Ala Leu Gly 85 90 95 His Ala Tyr Leu Leu Pro Phe Gly Asn Lys Asn Glu Lys Ser Gly Lys 100 105 110 Lys Asn Val Gln Leu Ile Ile Gly Tyr Arg Gly Met Ile Asp Leu Ala 115 120 125 Arg Arg Ser Gly Gln Ile Ala Ser Leu Ser Ala Arg Val Val Arg Glu 130 135 140 Gly Asp Glu Phe Ser Phe Glu Phe Gly Leu Asp Glu Lys Leu Ile His 145 150 155 160 Arg Pro Gly Glu Asn Glu Asp Ala Pro Val Thr His Val Tyr Ala Val 165 170 175 Ala Arg Leu Lys Asp Gly Gly Thr Gln Phe Glu Val Met Thr Arg Lys 180 185 190 Gln Ile Glu Leu Val Arg Ser Leu Ser Lys Ala Gly Asn Asn Gly Pro 195 200 205 Trp Val Thr His Trp Glu Glu Met Ala Lys Lys Thr Ala Ile Arg Arg 210 215 220 Leu Phe Lys Tyr Leu Pro Val Ser Ile Glu Ile Gln Arg Ala Val Ser 225 230 235 240 Met Asp Glu Lys Glu Pro Leu Thr Ile Asp Pro Ala Asp Ser Ser Val 245 250 255 Leu Thr Gly Glu Tyr Ser Val Ile Asp Asn Ser Glu Glu 260 265 <210> 5 <211> 340 <212> DNA <213> Artificial sequence <400> 5 gcgcgaattc gagctcggta ttgacagcta gctcagtcct aggtataata ctagtccaag 60 cgcgtcacga cgtgtgtttt agagctagaa atagcaagtt aaaataaggc tagtccgtta 120 tcaacttgaa aaagtggcac cgagtcggtg ctttttttga acccgggatg ttgacagcta 180 gctcagtcct aggtataata ctagtgacta acgcgctgcg ttgttgtttt agagctagaa 240 atagcaagtt aaaataaggc tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg 300 ctttttttga acccgggatg actgcatgtg cagctaatgc 340 <210> 6 <211> 340 <212> DNA <213> Artificial sequence <400> 6 gcgcgaattc gagctcggta ttgacagcta gctcagtcct aggtataata ctagtccaag 60 cgcgtcacga cgtgtgtttt agagctagaa atagcaagtt aaaataaggc tagtccgtta 120 tcaacttgaa aaagtggcac cgagtcggtg ctttttttga acccgggatg ttgacagcta 180 gctcagtcct aggtataata ctagtccagc ccatgattat gtttggtttt agagctagaa 240 atagcaagtt aaaataaggc tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg 300 ctttttttga acccgggatg actgcatgtg cagctaatgc 340 <210> 7 <211> 340 <212> DNA <213> Artificial sequence <400> 7 gcgcgaattc gagctcggta ttgacagcta gctcagtcct aggtataata ctagtccaag 60 cgcgtcacga cgtgtgtttt agagctagaa atagcaagtt aaaataaggc tagtccgtta 120 tcaacttgaa aaagtggcac cgagtcggtg ctttttttga acccgggatg ttgacagcta 180 gctcagtcct aggtataata ctagtgtgtg gtgttcggta tgccagtttt agagctagaa 240 atagcaagtt aaaataaggc tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg 300 ctttttttga acccgggatg actgcatgtg cagctaatgc 340 <210> 8 <211> 340 <212> DNA <213> Artificial sequence <400> 8 gcgcgaattc gagctcggta ttgacagcta gctcagtcct aggtataata ctagtccaag 60 cgcgtcacga cgtgtgtttt agagctagaa atagcaagtt aaaataaggc tagtccgtta 120 tcaacttgaa aaagtggcac cgagtcggtg ctttttttga acccgggatg ttgacagcta 180 gctcagtcct aggtataata ctagtttagc cggtaagcag gtgaagtttt agagctagaa 240 atagcaagtt aaaataaggc tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg 300 ctttttttga acccgggatg actgcatgtg cagctaatgc 340 <210> 9 <211> 5143 <212> DNA <213> Artificial sequence <400> 9 gtctagggcg gcggtctagg gcggcggatt tgtcctactc aggagagcgt tcaccgacaa 60 acaacagata aaacgaaagg cccagtcttt cgactgagcc tttcgtttta tttgatgcct 120 ttaattaaag cggataacaa tttcacacag gaggccgcct aggccgcggc cgcgcgaatt 180 cgagctcggt acccggggat cctctagagt cgacctgcag gcatgcaagc ttgcggccgc 240 agccgtcgtg actgggaaaa ccctggcgac tagtcttgga ctcctgttga tagatccagt 300 aatgacctca gaactccatc tggatttgtt cagaacgctc ggttgccgcc gggcgttttt 360 tattggtgag aatccagcca gacgttgtgt ctcaaaatct ctgatgttac attgcacaag 420 ataaaaatat atcatcatga acaataaaac tgtctgctta cataaacagt aatacaaggg 480 gtgttatgag ccatattcaa cgggaaacgt cttgctcgag gccgcgatta aattccaaca 540 tggatgctga tttatatggg tataaatggg ctcgcgataa tgtcgggcaa tcaggtgcga 600 caatctatcg attgtatggg aagcccgatg cgccagagtt gtttctgaaa catggcaaag 660 gtagcgttgc caatgatgtt acagatgaga tggtcagact aaactggctg acggaattta 720 tgcctcttcc gaccatcaag cattttatcc gtactcctga tgatgcatgg ttactcacca 780 ctgcgatccc cgggaaaaca gcattccagg tattagaaga atatcctgat tcaggtgaaa 840 atattgttga tgcgctggca gtgttcctgc gccggttgca ttcgattcct gtttgtaatt 900 gtccttttaa cagcgatcgc gtatttcgtc tcgctcaggc gcaatcacga atgaataacg 960 gtttggttga tgcgagtgat tttgatgacg agcgtaatgg ctggcctgtt gaacaagtct 1020 ggaaagaaat gcataagctt ttgccattct caccggattc agtcgtcact catggtgatt 1080 tctcacttga taaccttatt tttgacgagg ggaaattaat aggttgtatt gatgttggac 1140 gagtcggaat cgcagaccga taccaggatc ttgccatcct atggaactgc ctcggtgagt 1200 tttctccttc attacagaaa cggctttttc aaaaatatgg tattgataat cctgatatga 1260 ataaattgca gtttcatttg atgctcgatg agtttttcta atcagaattg gttaattggt 1320 tgtaacactg gcagagcatt acgctgactt gacgggacgg cggctttgtt gaataaatcg 1380 aacttttgct gagttgaagg atcagatcac gcatcttccc gacaacgcag accgttccgt 1440 ggcaaagcaa aagttcaaaa tcaccaactg gtccacctac aacaaagctc tcatcaaccg 1500 tggctccctc actttctggc tggatgatgg ggcgattcag gcctggtatg agtcagcaac 1560 accttcttca cgaggcagac ctcagcgcta ttctgacctt gccatcacga ctgtgctggt 1620 cattaaacgc gtattcaggc tgaccctgcg cgctgcgcag ggctttattg attccatttt 1680 tacactgatg aatgttccgt tgcgctgccc ggattacagc cggatcctct agagtcgacc 1740 tgcaggcatg ctgatcggca cgtaagaggt tccaactttc accataatga aataagatca 1800 ctaccgggcg tattttttga gttatcgaga ttttcaggag ctaaggaagc taaaatgcgc 1860 tcacgcaact ggtccagaac cttgaccgaa cgcagcggtg gtaacggcgc agtggcggtt 1920 ttcatggctt gttatgactg tttttttggg gtacagtcta tgcctcgggc atccaagcag 1980 caagcgcgtt acgccgtggg tcgatgtttg atgttatgga gcagcaacga tgttacgcag 2040 cagggcagtc gccctaaaac aaagttaaac atcatgaggg aagcggtgat cgccgaagta 2100 tcgactcaac tatcagaggt agttggcgtc atcgagcgcc atctcgaacc gacgttgctg 2160 gccgtacatt tgtacggctc cgcagtggat ggcggcctga agccacacag tgatattgat 2220 ttgctggtta cggtgaccgt aaggcttgat gaaacaacgc ggcgagcttt gatcaacgac 2280 cttttggaaa cttcggcttc ccctggagag agcgagattc tccgcgctgt agaagtcacc 2340 attgttgtgc acgacgacat cattccgtgg cgttatccag ctaagcgcga actgcaattt 2400 ggagaatggc agcgcaatga cattcttgca ggtatcttcg agccagccac gatcgacatt 2460 gatctggcta tcttgctgac aaaagcaaga gaacatagcg ttgccttggt aggtccagcg 2520 gcggaggaac tctttgatcc ggttcctgaa caggatctat ttgaggcgct aaatgaaacc 2580 ttaacgctat ggaactcgcc gcccgactgg gctggcgatg agcgaaatgt agtgcttacg 2640 ttgtcccgca tttggtacag cgcagtaacc ggcaaaatcg cgccgaagga tgtcgctgcc 2700 gactgggcaa tggagcgcct gccggcccag tatcagcccg tcatacttga agctagacag 2760 gcttatcttg gacaagaaga agatcgcttg gcctcgcgcg cagatcagtt ggaagaattt 2820 gtccactacg tgaaaggcga gatcaccaag gtagtcggca aataaactag taaataataa 2880 aaaagccgga ttaataatct ggctttttat attctctgca taaccctgct tcggggtcat 2940 tatagcgatt ttttcggtat atccatcctt tttcgcacga tatacaggat tttgccaaag 3000 ggttcgtgta gactttcctt ggtgtatcca acggcgtcag ccgggcagga taggtgaagt 3060 aggcccaccc gcgagcgggt gttccttctt cactgtccct tattcgcacc tggcggtgct 3120 caacgggaat cctgctctgc gaggctggcc gtaggccggc cgataatctc atgaccaaaa 3180 tcccttaacg tgagttttcg ttccactgag cgtcagaccc cgtagaaaag atcaaaggat 3240 cttcttgaga tccttttttt ctgcgcgtaa tctgctgctt gcaaacaaaa aaaccaccgc 3300 taccagcggt ggtttgtttg ccggatcaag agctaccaac tctttttccg aaggtaactg 3360 gcttcagcag agcgcagata ccaaatactg ttcttctagt gtagccgtag ttaggccacc 3420 acttcaagaa ctctgtagca ccgcctacat acctcgctct gctaatcctg ttaccagtgg 3480 ctgctgccag tggcgataag tcgtgtctta ccgggttgga ctcaagacga tagttaccgg 3540 ataaggcgca gcggtcgggc tgaacggggg gttcgtgcac acagcccagc ttggagcgaa 3600 cgacctacac cgaactgaga tacctacagc gtgagctatg agaaagcgcc acgcttcccg 3660 aagggagaaa ggcggacagg catccggtaa gcggcagggt cggaacagga gagcgcacga 3720 gggagcttcc agggggaaac gcctggtatc tttatagtcc tgtcgggttt cgccacctct 3780 gacttgagcg tcgatttttg tgatgctcgt caggggggcg gagcctatgg aaaaacgcca 3840 gcaacgcggc cgtgaaaggc aggccggtcc gtggtggcca cggcctctag gccagatcca 3900 gcggcatctg ggttagtcga gcgcgggccg cttcccatgt ctcaccaggg cgagcctgtt 3960 tcgcgatctc agcatctgaa atcttcccgg ccttgcgctt cgctggggcc ttacccaccg 4020 ccttggcggg cttcttcggt ccaaaactga acaacagatg tgtgaccttg cgcccggtct 4080 ttcgctgcgc ccactccacc tgtagcgggc tgtgctcgtt gatctgcgtc acggctggat 4140 caagcactcg caacttgaag tccttgatcg agggataccg gccttccagt tgaaaccact 4200 ttcgcagctg gtcaatttct atttcgcgct ggccgatgct gtcccattgc atgagcagct 4260 cgtaaagcct gatcgcgtgg gtgctgtcca tcttggccac gtcagccaag gcgtatttgg 4320 tgaactgttt ggtgagttcc gtcaggtacg gcagcatgtc tttggtgaac ctgagttcta 4380 cacggccctc accctcccgg tagatgattg tttgcaccca gccggtaatc atcacactcg 4440 gtcttttccc cttgccattg ggctcttggg ttaaccggac ttcccgccgt ttcaggcgca 4500 gggccgcttc tttgagctgg ttgtaggaag attcgatagg gacacccgcc atcgtcgcta 4560 tgtcctccgc cgtcactgaa tacatcactt catcggtgac aggctcgctc ctcttcacct 4620 ggctaataca ggccagaacg atccgctgtt cctgaacact gaggcgatac gcggcctcga 4680 ccagggcatt gcttttgtaa accattgggg gtgaggccac gttcgacatt ccttgtgtat 4740 aaggggacac tgtatctgcg tcccacaata caacaaatcc gtccctttac aacaacaaat 4800 ccgtcccttc ttaacaacaa atccgtccct taatggcaac aaatccgtcc ctttttaaac 4860 tctagaggcc acggattacg tggcctgtag acgtcctaaa aggtttaaaa gggaaaagga 4920 agaaaagggt ggaaacgcaa aaaacgcacc actacgtggc cccgttgggg ccgcatttgt 4980 gcccctgaag gggcggggga ggcgtctggg caatccccgt tttaccagtc ccctatcgcc 5040 gcctgagagg gcgcaggaag cgagtaatca gggtatcgag gcggattcac ccttggcgtc 5100 caaccagcgg caccagcggc gcctgagagg ggcgcgccca gct 5143

Claims

1. A method for knocking out large DNA fragments of Halomonas, wherein the large DNA fragment is 50 kb, and the method includes: The recombinant vector is introduced into the starting Halomonas to achieve the knockout of the large DNA fragment; The recombinant vectors are recombinant vector 1 and recombinant vector 2. Recombinant vector 1 is a recombinant vector obtained by inserting the DNA fragment shown in positions 21-320 of sequence 1 in the sequence listing, and the upstream and downstream homologous arms of the large DNA fragment in the starting Halomonas into the starting vector; Recombinant vector 2 is a recombinant vector obtained by inserting the expression cassettes of RecE protein and RecT protein into another starting vector capable of expressing Cas9. Recombinant vector 2 contains the DNA fragment shown in sequence 2. The 22-306th positions of sequence 2 are the araBAD promoter sequence, the 341-2941st positions are the RecE gene sequence, and the 2934-3743rd positions are the RecT gene sequence. The RecE gene sequence encodes the RecE protein shown in sequence 3, and the RecT gene sequence encodes the RecT protein shown in sequence 4; The starting Halomonas is Halomonas (< Halomonasbluephagenesis ) TD1.

0.

2. A recombinant vector, comprising the recombinant vector 1 and the recombinant vector 2 described in claim 1.

3. Use of the recombinant vector described in claim 2 for knocking out large DNA fragments of Halomonas; Or, use of the recombinant vector described in claim 2 for preparing a product for knocking out large DNA fragments of Halomonas; The large DNA fragment is 50 kb.

Citation Information

Patent Citations

  • Vector combination for quick gene editing of halomonas sp. and application of vector combination

    CN109971778A

  • Bacterial strain with self-flocculation capability as well as preparation method and application of bacterial strain

    CN114672447A