Antisense oligonucleotide sequences for silencing human L1-MET transcripts in tumors
By using antisense oligonucleotides targeting specific sequences of the L1-MET transcript, especially antisense oligonucleotides covering the 76bp region of MET intron 2, the problem of existing anticancer therapies being unable to selectively induce cancer cell death has been solved, achieving selective killing of tumor cells expressing L1-MET and enhanced stability of chemical modifications.
Patent Information
- Application Number
- CN202080079454.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2019-11-15
- Filing Date
- 2020-11-13
- Publication Date
- 2026-05-08
- Estimated Expiration
- 2040-11-13
AI Technical Summary
Current cancer therapies cannot effectively target cancer cells without affecting normal cells, leading to side effects. Furthermore, certain gene mutations render the drugs ineffective, necessitating a new therapy that can selectively induce cancer cell death.
Early degradation of L1-MET transcripts can be induced by targeting specific sequences of the L1-MET transcript, especially antisense oligonucleotides covering the 76 bp region of MET intron 2. Chemical modifications such as LNA and PS can be used to improve transfection efficiency and in vivo stability.
It achieves selective death of tumor cells expressing L1-MET without affecting normal cells. Chemical modification improves stability and targeting efficiency in the blood and reduces side effects.
Smart Images

Figure CN114729364B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to antisense oligonucleotide sequences for silencing human L1-MET transcripts in tumors. Background Technology
[0002] Specifically, the present invention relates to the use of antisense oligonucleotides to induce death in several types of human cancer cells by silencing human L1-MET, which is a non-coding transcript specifically transcribed in tumor cells.
[0003] Today, research focuses on finding new therapies to treat cancer, especially new therapies that are selective for cancer cells.
[0004] In fact, it is well known that anti-cancer therapies such as chemotherapy cause the death of both cancer cells and normal cells. The death of normal cells can lead to some unpleasant side effects.
[0005] To address this issue, new therapeutic strategies have been developed over the past 20 years to target specific molecules expressed more extensively in cancer cells. A patient's individual molecular landscape addresses the physical challenges of drug targeting, reducing off-target effects. However, the molecules targeted by such drugs are not only present on cancer cell membranes but also in some normal cells. Furthermore, the presence of mutations in other genes can lead to ineffectiveness; for example, in colorectal cancer, mutations in the KRAS gene render drugs that bind to EGFR and block this pathway ineffective. In lung cancer, mutations in EGFR can lead to a better response to EGFR inhibitors, but these become ineffective as resistance mutations increase.
[0006] Given the above, it is clear that there is a need to provide new anticancer therapies that can overcome the shortcomings of known anticancer therapies.
[0007] As is well known, long dispersed nuclear elements (LINE-1) are reversible transposable elements, comprising about 20% of the human genome. When activated by hypomethylation of CpG islands located in their promoter regions, LINE-1 retains the ability to transpose itself to new chromosomal regions[1]. Only a few of these sequences (usually located in non-coding regions) are capable of retrotransposition, but they are generally inactive for almost their entire lifespan[2]. When demethylated, LINE-1 promoters can act as sense promoters, guiding transcription of two open reading frames (ORF-1 and ORF-2), or as antisense promoters[3]. Antisense promoters drive the activity of transcription of the opposite strand relative to the LINE-1 orientation, resulting in transcripts that include neighboring sequences[4]. In this regard, a novel primate-specific open reading frame (ORF-0) recently discovered within the 5' UTR of a LINE-1 sequence has been shown to be the origin of proximal exon fusion transcripts using two splicing donor sites[5]. The LINE-1 sequence located within intron 2 of the human MET gene is called L1-MET. Figure 1 ), belonging to the subfamily Primateinae, and cannot be reverse transcribed transposed. However, the promoter region is completely preserved, thus allowing the antisense promoter to be activated by hypomethylation and produce alternative transcripts derived from the ORF-0 region and containing the neighboring MET sequence. The L1-MET transcript was first described in 2002[6], but its full-length characterization was only achieved in 2018, as described by Miglio et al. (2018). Figure 1 [7]. In the latter study, the transcript was shown to start at ORF-0 and end at the MET 3'UTR, including six different splicing variants derived from a combination of two splice donor sites and three different receptor sites, two of which are located in intron 2 of the MET gene. The length of the L1-MET transcript and the absence of the open reading frame indicate its function as a long non-coding RNA. It was also demonstrated that although L1-MET does not encode a functional protein, the presence of the 3'UTR and polyA region endows the transcript with the ability to be transported from the nucleus to the cytoplasm. This feature, along with its length, indicates its role as a long non-coding RNA. To date, only two studies have attempted to investigate the biological function of L1-MET. Among them, Weber et al. induced L1-MET expression by knocking down DNA methyltransferase protein and promoted transcription by hypomethylation and observed a decrease in MET protein levels [8]. On the other hand, Wolff et al. reported the presence of truncated MET isoforms after transfection of L1-MET in cell lines [9]. However, in Miglio et al., 2018[7], neither Western blotting nor informatics prediction tools demonstrated the existence of truncated MET proteins. Summary of the Invention
[0008] It has been shown that activation of the L1-MET antisense promoter is a tumor-specific mechanism, as both experimental studies and computer analysis have clearly shown that there is no evidence that L1-MET is expressed in normal tissues [7].
[0009] According to the present invention, it has now been shown that silencing the L1-MET transcript leads to significant death of tumor cells, but not of normal cells, suggesting that L1-MET is a promising target for cancer therapy.
[0010] Among the available therapeutic strategies targeting this sequence, antisense oligonucleotides, primarily used for diseases other than cancer, appear to be more appropriate
[10] .
[0011] In particular, according to the present invention, it has been shown that silencing of L1-MET transcripts by antisense oligonucleotides targeting specific regulatory sequences of L1-MET induces selective death in different types of cancer cells, while untransformed cells remain unaffected. These results support the use of these oligonucleotide sequences to induce tumor cell death.
[0012] Specifically, according to the present invention, a specific sequence has been identified that covers 76 bp of MET intron 2 and is part of the L1-MET transcript. This sequence can be advantageously targeted to induce early degradation of the human L1-MET transcript.
[0013] In particular, according to the present invention, 11 antisense oligonucleotides that can selectively silence L1-MET transcripts have been identified by computer analysis. Furthermore, three of these have been tested in vitro.
[0014] The antisense oligonucleotides of the present invention can be used alone or in combination as pharmacological compounds.
[0015] Therefore, the antisense oligonucleotides of the present invention can be advantageously used to induce massive selective death in human tumor cells that are positive for L1-MET transcript expression. The high selectivity of the antisense oligonucleotides of the present invention for tumor cells is due to the absence of L1-MET expression in normal tissues and its specific tumor transcriptional activation induced by hypomethylation.
[0016] Antisense oligonucleotides can be chemically modified to allow for administration to patients without a carrier or conjugation to a carrier to improve the transfection efficiency of tumor cells. Examples of carriers that can be used to administer ASOs are liposomes or nanoparticles, which allow for faster internalization but may exhibit some limitations, such as degradation of the reticuloendothelial system.
[0017] Although antisense oligonucleotides have exhibited some limitations in the past, primarily due to their short time in the blood and rapid clearance, encouraging results have been achieved due to the introduction of chemical modifications (i.e., locked nucleic acid – LNA, phosphate thioester backbone, 2'-ribose modification) that allow for direct administration of the compound
[11] . These chemical changes increase binding to serum proteins, thereby reducing hepatic clearance and increasing the time available for uptake into target cells. In the past few years, several antisense oligonucleotides have been approved by the FDA for the treatment of various diseases (i.e., spinal muscular atrophy, homozygous familial hypercholesterolemia).
[0018] Therefore, the specific objective of this invention is to target the antisense oligonucleotide of the L1-MET transcript region encoded by GCAGAAAATGTGCTAGATTGGAGGTGAAGACCCTGGAGCCAGAGAGCCTAGGCTTAGTCCTAGCCCTGCACTGAAG (SEQ ID NO:1).
[0019] According to the present invention, the antisense oligonucleotide can target the L1-MET transcript region encoded by GCAGAAAATGTGCTAGATTGGAGGTGAAGAC (SEQ ID NO:2) or TTAGTCCTAGCCCTGCACTGAAG (SEQ ID NO:3).
[0020] Furthermore, according to the present invention, the antisense oligonucleotide may comprise a sequence of 7 to 50 nucleotides, preferably 12 to 30 nucleotides, and more preferably 15 to 23 nucleotides. For example, when the antisense oligonucleotide comprises deferoxoribonucleotides and ribonucleotides, the antisense oligonucleotide may comprise 16 nucleotides.
[0021] According to the present invention, the antisense oligonucleotide is complementary to the target region of the L1-MET transcript and comprises or consists of the following: GUCUUCACCUCCAAUC (SEQ ID NO:4), GCAGGGCUAGGACUAA (SEQ ID NO:5), GCCUAGGCUCUCUGGC (SEQ ID NO:6), CUAGCACAUUUUCUGC (SEQ ID NO:7), CUCCAUCUAGCACAU (SEQ ID NO:8), ACCUCCAAUCUAGCAC (SEQ ID NO:9), CUAGGCUCUCUGGCUC (SEQ ID NO:10), CUAAGCCUAAGGCUCUC (SEQ ID NO:11), GUGCAGGGCUAGGACU (SEQ ID NO:12), AUGGCAGGGCUAGGAC (SEQ ID NO:13), or CUUCAGUGCAGGGCUA (SEQ ID NO:14), preferably SEQ ID NO:4 or SEQ ID NO:5, more preferably SEQ ID NO:5.
[0022] According to the present invention, one, more than one, or all of the above-mentioned antisense oligonucleotides can be modified, provided that the antisense oligonucleotide does not contain only deoxyribonucleotides or only nucleotides with modified deoxyribose. Specifically, the nucleotide can be a ribonucleotide, a deoxyribonucleotide, or a nucleotide with modified ribose or deoxyribose. Furthermore, the ribonucleotide, deoxyribonucleotide, or nucleotide with modified ribose and / or deoxyribose may optionally have a modified phosphate group. Therefore, each of the antisense oligonucleotides may contain a combination of ribonucleotides and deoxyribonucleotides, and / or a nucleotide with modified ribose and / or deoxyribose, wherein the phosphate group is optionally modified.
[0023] Specifically, the modified oligonucleotides can include nucleotides with sugar modifications, such as 2'-O-MOE, 2'-O-Me, LNA, (S)-cEt, 2'-F RNA, morpholino (PMO), and / or nucleotides with modifications on the phosphate group, such as phosphodiester (PO), thiophosphate (PS), dithiophosphate, and thioaminophosphate. Phosphate group modification can be applied to any nucleotide, whether it is DNA, RNA, or a nucleotide with sugar modifications.
[0024] According to embodiments of the present invention, antisense oligonucleotides may include modified nucleotides having LNA modification and phosphate thioester (PS) modification.
[0025] According to a specific embodiment, the oligonucleotide according to the invention may comprise flanking modified nucleotides with LNA and PS modifications at both ends of the molecule and DNA nucleotides in the central portion of the molecule. This structure advantageously amplifies the degradation of ASO-related targets by RNase.
[0026] LNA modification advantageously increases the binding specificity to RNA targets and confers resistance to nucleases.
[0027] PS modification advantageously increases binding to serum proteins (albumin), which is beneficial for their maintenance in the bloodstream. Furthermore, it reduces renal clearance, decreasing the rate of renal clearance when ASO is in the bloodstream.
[0028] Furthermore, the combination of the above modifications (LNA and PS) provides improved transfection efficiency, even in the absence of a carrier (e.g., lipofectamine, liposomes, or nanoparticles).
[0029] Another object of the present invention is a pharmaceutical composition comprising one or more antisense nucleotides as defined above as active ingredients, and one or more excipients and / or adjuvants.
[0030] According to the present invention, the pharmaceutical composition may further comprise one or more anticancer drugs.
[0031] The present invention also relates to antisense oligonucleotides as defined above or pharmaceutical compositions as defined above for the treatment of tumors expressing L1-MET, such as triple-negative breast cancer, lung adenocarcinoma, or colorectal cancer.
[0032] Another object of the present invention is a combination of one or more antisense oligonucleotides as defined above with one or more anticancer drugs for use alone or sequentially in the treatment of tumors expressing L1-MET (e.g., triple-negative breast cancer).
[0033] According to the present invention, "use alone" is understood to mean the simultaneous administration of two compounds according to the present invention in different pharmaceutical forms.
[0034] "Successive use" is understood to mean the continuous administration of two compounds according to the invention, each in a different pharmaceutical form.
[0035] Specific examples of antisense compounds that can be used in this invention include oligonucleotides containing a modified backbone or non-natural nucleoside internucleotides. Oligonucleotides with a modified backbone include oligonucleotides that retain a phosphorus atom in their backbone and oligonucleotides that do not have a phosphorus atom in their backbone. Modified oligonucleotides that do not have a phosphorus atom in their nucleoside internucleotide backbone can also be considered oligonucleotides.
[0036] In other oligonucleotide mimics, the sugar and nucleoside internucleotide bonds (i.e., the backbone) of the nucleotide units are replaced by novel groups. The base units are retained for hybridization with suitable nucleic acid target compounds. One such oligomeric compound, an oligonucleotide mimic that has shown excellent hybridization properties, is called peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of the oligonucleotide is replaced by an amide-containing backbone, particularly an aminoethylglycine backbone. The nucleobases are retained and directly or indirectly bound to the nitrogen atom of the amide moiety of the backbone.
[0037] Further modifications may include locked nucleic acids (LNAs), wherein a 2'-hydroxyl group is attached to a 3' or 4' carbon atom of the sugar ring, thereby forming a bicyclic sugar moiety. This bond may be a methylene (-CH2-)n group connecting the 2' oxygen atom and the 4' carbon atom, where n is 1 or 2.
[0038] Other modifications may include 2'-methoxy (2'-O-CH3), 2'-aminopropoxy (2'-OCH2CH2CH2NH2), 2'-allyl (2'-CH2-CH-CH2); 2'-O-allyl (2'-O-CH2-CH-CH2) and 2'-fluorine (2'-F).
[0039] The modified nucleobases may also include those in which the purine or pyrimidine bases are substituted with other heterocyclic compounds, such as 7-deazo-adenine, 7-deazoguanosine, 2-aminopyridine, and 2-pyridone. Some modified nucleobases are particularly useful for increasing the binding affinity of the oligonucleotides of the present invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, including 2-aminopropyl-adenine, 5-propynyluracil, and 5-propynylcytosine.
[0040] The oligonucleotides of the present invention can be formed as complex structures of two or more oligonucleotides, modified oligonucleotides, oligonucleotides, and / or oligonucleotide mimics. Such oligonucleotides are also referred to in the art as hybrids or gapmers. Attached Figure Description
[0041] The invention will now be described, in an illustrative rather than restrictive manner, with particular reference to the accompanying drawings, according to preferred embodiments thereof, wherein:
[0042] Figure 1 A graphical representation of the L1-MET transcript[7] produced by the L1 element located in MET intron 2 is shown.
[0043] Figure 2The mapping site of the antisense oligonucleotide along the 76 bp target fragment of L1-MET is shown. For illustrative purposes, the figure shows nucleotides 1-420 of SEQ ID NO:15 to show the location of the 76 bp target fragment in SEQ ID NO:15.
[0044] Figure 3 The secondary structures of three designed antisense oligonucleotides predicted by computer analysis are shown.
[0045] Figure 4 The predicted secondary structure of the L1-MET sequence is shown. The complementary regions of the antisense oligonucleotides are highlighted by thick lines.
[0046] Figure 5 The expression level of the L1-MET gene in the analyzed cell lines is shown.
[0047] Figure 6 The L1-MET gene expression analysis in cell lines after silencing with L1-MET_AS1, L1-MET_AS2, and L1-MET_AS3 is shown.
[0048] Figure 7 The effect of L1-MET silencing on cell viability was demonstrated.
[0049] Figure 8 The percentage of apoptotic cells after L1-MET silencing using L1-MET_AS1, L1-MET_AS2, and L1-MET_AS3 is shown.
[0050] Figure 9 The results of Western blot analysis of L1-MET-silenced cancer cells are shown. Detailed Implementation
[0051] Example 1 The present invention relates to computer identification and characterization of oligonucleotides targeting L1-MET and in vitro silencing of L1-MET.
[0052] Materials and methods
[0053] The human biological samples used in this study came from a healthy donor who was an in-house collaborator in the laboratory and had consented to the collection of blood samples for use in the experiments.
[0054] No genetically modified organisms (GMOs) were used in the experiments described in this article.
[0055] Cancer cell line
[0056] MDA-MB231 and MCF-7 cell lines were obtained from NCI-60 panel; EBC1 (cat. JCRB0820) was obtained from the Health Science Research Resources Bank (HSRRB); A549 (cat. CCL-185) and MRC5 (cat. CCL-171) were obtained from the United States Type Culture Collection (ATCC). EBC1 and A549 were grown in RPMI supplemented with 10% FBS; for MDA-MB231, high-glucose DMEM containing 10% FBS was used; for MCF7, high-glucose DMEM containing 10% FBS and 10 μg / mL insulin was used; and for MRC5, MEM containing 10% FBS was used. Their genetic characteristics were analyzed by short tandem repeat analysis (…). The results (16 HS System, Promega, Madison, WI) confirmed mycoplasma contamination of cells, with the last replicate performed in June 2019. Mycoplasma contamination of cells was tested periodically using the Venor GM kit (Minerva Biolabs, Berlin, Germany). Normal lymphocytes from healthy donors were obtained from peripheral blood by centrifugation using Lympholyte cell separation medium (Cedarlane) and then grown in RPMI supplemented with 10% FBS.
[0057] Antisense oligonucleotide selection
[0058] Based on previously reported selection criteria
[12] , specific 76 bp sequences of L1-MET transcripts were selected and studied using computer analysis to identify optimal antisense oligonucleotides (ASOs). The most accessible ASO sequences were identified using five different ASO design tools.
[0059] The complete DNA sequence of the L1-MET transcript (SEQ ID NO:15) is shown below, with a specific 76 bp target segment of the antisense oligonucleotide highlighted (in bold and underline).
[0060]
[0061]
[0062]
[0063]
[0064]
[0065] Five antisense oligonucleotide design tools were consulted, and 11 ASOs that can target specific L1-MET regions were identified, as shown in Table 1 below.
[0066] Table 1
[0067]
[0068] Most qualitative features of ASOs (e.g., structure, chemistry, and sequence composition) are highly dependent on the accessibility of the target mRNA [13,14]. The secondary structures of potential ASOs were then characterized using the sFOLD network tool to examine oligonucleotides with optimal parameters. Furthermore, the entire mRNA secondary structure of L1-MET was characterized to visually examine the folding features of the target region. LNA-Gapmers synthesized by Exiqon (Qiagen) (L1MET_AS1, L1MET_AS2, L1MET_AS3) are characterized by a DNA core region with two flanking RNA sequences, containing locked nucleic acid modifications and a phosphate backbone added to each base pair. Figure 2 The corresponding site of ASO in the 76bp sequence is shown.
[0069] Instantaneous transfection
[0070] Following the manufacturer's protocol, all cells were cultured in whole medium before transient transfection with ASO using Lipofectamine RNAiMAX (Thermofisher Scientific). As a control, transfection with disordered LNA GapmeR was performed. On the day of transfection, cells were harvested and counted, and then 600,000 cells / dish were seeded in 10 cm tissue culture dishes using appropriate growth medium in the presence of a transfection mixture consisting of lipofectamine and antisense oligonucleotides at a final concentration of 25 nM. RNA and protein were extracted from the cells 24 hours after transfection.
[0071] RNA extraction and qRT-PCR analysis
[0072] RNA was extracted from the cell line using the Maxwell RSC miRNA Tissue Kit (Promega) according to the manufacturer’s instructions. RNA quantification was performed using a DeNovix spectrophotometer. After reverse transcription using the reverse transcription system (Promega), L1-MET gene expression was investigated using quantitative real-time PCR (qRT-PCR) with previously reported primers and PCR conditions [7]. Briefly, the reaction mixture consisted of 1X buffer, 2.5 mM MgCl2, 0.2 mM dNTP, 0.2 μM of each primer, 2× EvaGreen dye, 0.04 U / μL Taq polymerase (Promega), and H2O, for a final volume of 25 μL, in the presence of a forward primer located at the 76 bp region of L1-MET and a reverse primer located at exon 3 of MET. The relative expression quantification (RQ) was calculated using the following formula, with GAPDH as an endogenous control: RQ = 2 - (ΔCt), where ΔCt = (Ct L1 - MET - Ct GAPDH).
[0073] RNAseq analysis
[0074] RNA-seq analysis was performed on the gene expression profiles of A549, EBC1, MDAMB-231, and MCF7 cancer cell lines. Specifically, RNA purified from cells treated with L1-MET_AS1 or with a scrambled gapmer was analyzed in three independent replication experiments, totaling 24 samples. All library preparations were performed using the TruSeq Chained mRNA Kit (Illumina), starting with 1 μg of total RNA with a RIN>8. Briefly, following a low-sample workflow, cDNA was synthesized using magnetic beads with attached poly-T oligonucleotides after purification of poly-A RNA (e.g., mRNA), followed by end repair and 3' adenylation to allow for the ligation of index adapters. Pooled libraries were then loaded onto an Illumina NextSeq 500 / 550 instrument to a final concentration of 1.1 pM for single-end 75 bp sequencing. Reads that failed to pass the filter according to the standard Illumina NextSeq 500 procedure were discarded. The filtered reads were compared with the GRCh38 primary assembled genome, which was downloaded from GENCODE (version 29)
[15] using STAR (version 2.5.4a, custom parameters --outFilterMultimapNmax10 --outFilterMultimapScoreRange 1 --outFilterMismatchNmax 999 --outFilterMismatchNoverLmax 0.08)
[16] . For gene expression quantification, reads were assigned to exons using subread featureCounts v1.6.3, discarding multimapped and ambiguous reads and summing gene names
[17] . GENCODE basic annotation (version 29) was used as the reference transcript annotation, supplemented by custom trajectories for L1-MET transcripts as described in Miglio et al., 2018 [7]. The same supplemental transcript annotations were used to construct the STAR index.
[0075] Protein extraction and Western blot analysis
[0076] Proteins were extracted from the cell line 24 hours after transfection using a thermal lysis protocol. Cells were washed three times with PBS and then lysed to the final volume with a lysis solution consisting of 1M Tris-HCl pH 6.8, 10% SDS, and H2O. The lysates were collected in 1.5 mL tubes and incubated at 95°C for 15 min. After sonication and centrifugation at 16,000 g for 5 min to remove cell debris, proteins were quantified using a spectrophotometer and a Pierce BCA protein assay kit (Thermofisher Scientific). 50 ng of protein was separated by SDS-polyacrylamide gel electrophoresis (Bolt 4-12% Bis-Tris Plus gel) (Thermofisher Scientific) and blotted on a Trans-Blot Turbo nitrocellulose membrane (Bio-Rad). Depending on the antibody used, the membrane was blocked for 45 min with a TBS-T membrane containing 10% BSA or 5% skim milk powder. The membrane was then incubated overnight at 4°C with the following antibodies: anti-AKT (2972), anti-p44 / 42MAPK (9102), anti-phosphorylated AKT Ser473 (9271), anti-phosphorylated p44 / 42MAPK Thr202 / Tyr204 (9101), anti-phosphorylated EGFR (3777), and anti-phosphorylated MET (3077) (Cell Signaling Technology); and homemade anti-MET (DL21) and anti-EGFR (1005sc-03) (Santa Cruz). All primary antibodies were diluted 1:1000. Chemiluminescence detection was performed using a Clarity Western ECL Substrate (Bio-Rad) with appropriate HRP-conjugated secondary antibody (1:10000 - Jackson ImmunoResearch Laboratories, INC.).
[0077] Cell viability and apoptosis assay
[0078] Cell viability was assessed using the Cell Titer Glow kit (Promega). Transfection was performed six times in 96-well plates at 25 nM gapmer concentration, with 3000 cells / well seeded per well. Glow was observed 24 hours after transfection using a Tecan Spark 10M instrument (TECAN).
[0079] Apoptosis was measured using propidium iodide and Annexin V APC conjugate (Thermofisher Scientific) via cytometry. Cells were transfected into 10 cm plates as described above. Twenty-four hours after transfection, cells were isolated with trypsin, washed three times with PBS, and incubated with Annexin V APC conjugate and propidium iodide using the Annexin V Apoptosis Detection Kit APC (Thermofisher Scientific) in binding buffer (0.5 M Hepes, 0.15 M NaCl, 0.005 M CaCl2). Data were acquired and analyzed using Summit v4.3 software (Dako Colorado, INC.) on a CyAn cytometry meter (Beckman Coulter). The apoptosis index, expressed as the percentage of apoptotic cells, was calculated using the following formula: (n. early apoptotic cells + n. late apoptotic cells) / total cells detected.
[0080] L1-MET's silence
[0081] Computer characterization of ASO targeting L1-MET
[0082] As described above, a specific 76 bp region of the L1-MET transcript encoded by the sequence GCAGAAAATGTGCTAGATTGGAGGTGAAGACCCTGGAGCCAGAGAGCCTAGGCTTAGTCCTAGCCCTGCACTGAAG (SEQ ID NO:1) was identified, and then the more accessible portion was detected. Taking into account all trained algorithms, two “ASO hot target” regions were revealed, located at the edges of the L1-MET-specific region. Following the numbering reported above for SEQ ID NO:15, 37% of the predicted antisense oligonucleotides were detected between nucleotides +236 and +266, representing the first 31 bases of the specific region, and 36% of the predicted ASOs were detected at the ends of the same sequence (between nucleotides +289 and +311). Therefore, the detected “ASO hot target” regions are GCAGAAAATGTGCTAGATTGGAGGTGAAGAC (SEQ ID NO:2) and TTAGTCCTAGCCCTGCACTGAAG (SEQ ID NO:3).
[0083] Only three predicted ASOs covered nucleotide positions between +267 and +288. To complete the ASO evaluation, the tool sRNA of the network software sFOLD was applied to predict the secondary structures of the designed antisense oligonucleotides to determine their thermal stability levels. Literature indicates that high-speed folding ASOs can be considered less efficient, with increased target binding associated with a reduced likelihood of secondary structure formation. Therefore, to define the efficiency of ASOs, the Gibbs free energy (ΔG) was calculated. ΔG represents the energy released by the molecule as it fully unfolds from its fold. Lower levels of ΔG are suitable for potentially high-speed folding molecules, and the fewer hydrogen bonds formed by the nucleotides of a single ASO, the less likely the ASO is to form secondary structures. In this case, more stable antisense oligonucleotides (e.g., those with positive ΔG) can be considered most efficient. A cutoff value of ΔG ≤ -1.1 was defined in the literature. Furthermore, the heteroduplex formed by the ASO and target mRNA also depends on the secondary folding of the transcript. Long RNA molecules are always overfolded, and in contrast to small ASOs, regions with secondary structures are reported to be more prone to hybridization, especially when located at the ends of the sequence. To examine the complete sequence folding of L1-MET, the sRNA algorithm on the sFOLD webpage was consulted. Table 2 reports the predicted ASO and associated ΔG values for all 11 targets of L1-MET.
[0084] Table 2
[0085]
[0086]
[0087]
[0088] To evaluate the silencing effect of L1-MET, Exiqon was commissioned to design three different ASOs covering two hotspot regions and also covering the nucleotides in the middle of a 76 bp region that were expected to be less accessible; specifically, L1-MET_AS1 (SEQ ID NO:4) is complementary to the region between nucleotides +251 and +266, L1-MET_AS2 (SEQ ID NO:5) covers the sequence between +289 and +304, and the third ASO (L1-MET_AS3 (SEQ ID NO:6)) overlaps with a more central portion of the sequence (between +273 and +288). Figure 3The secondary structure of the ASO of this invention is shown as follows: Apart from two downsheeted molecules (L1-MET_AS1 / 2), L1-MET_AS3 exhibits only 37.5% unbound bases, displaying a distinct hairpin structure. Regarding ΔG, L1-MET_AS3 was identified as having the most negative value (ΔG = -2.7), while L1-MET_AS2 had ΔG = 0.6. As for this characteristic, L1-MET_AS1 was evaluated as a better-designed ASO (ΔG = 2.5). Figure 4 The findings regarding the secondary structure of L1-MET are summarized. The first figure, A, shows a circular diagram of the secondary structure: L1-MET consists of sequences exceeding 5000 bp, thus this figure stylizes the secondary structure. Specific target sequences are contained within the lower half of the figure. Figure 4 Figure B shows an amplified secondary structure. More detailed, Figure C reports the amplified secondary structure of a specific 76 bp sequence. Supplementary portions of the three ASO designs are circled. All target regions exhibit either internal loops (L1-MET_AS1 and AS2) or hairpins (L1-MET_AS3), confirming the predictions. However, L1-MET_AS1 and AS2 target the most favorable regions, characterized by secondary structures with free ends. In summary, putting all previous data together, regardless of ΔG, L1-MET_AS3 is included, but with lower potential activity.
[0089] As reported in Table 2, ΔG was calculated for all other predicted ASOs, although there are other ASOs with better ΔG, but the three experiments described herein were designed by Exiqon because they were generated using their own design tools. However, the efficiency of other ASOs reported in this invention is not excluded.
[0090] Gene expression analysis
[0091] L1-MET silencing was achieved by transfecting cell lines with variable L1-MET and MET mRNA expression. Experiments were performed in lung cancer cells (EBC1, A549: L1-MET+ / MET+) and breast cancer cells (MDA-MB231: L1-MET± / MET+; MCF7: L1-MET+ / MET-). Untransformed fibroblasts, i.e., MRC5, and normal lymphocytes derived from peripheral blood from healthy donors were also used as normal controls. L1-MET expression was found to be generally high in EBC1, A549, and MCF7, weaker in MDA-MB231, and undetectable transcription in MRC5 and normal lymphocytes. Figure 5 24 hours after transfection, qRT-PCR showed decreased L1-MET gene expression in all cancer cell lines, but no decrease in normal cells (MRC5 and lymphocytes), confirming the efficacy of the silencing effect. Figure 6As shown, the silencing effect of the three gapmers was reduced, with L1-MET_AS2 being the most effective, followed by L1-MET_AS1. As mentioned above, L1-MET_AS3 was less effective at silencing L1-MET transcripts.
[0092] Cell viability and apoptosis assay
[0093] To investigate the biological effects of L1-MET silencing, cell viability assays were performed. Significantly reduced viability was observed in EBC1 and A549 cell lines when treated with L1-MET_AS2 (p<0.0001) and L1-MET_AS1 (EBC1 p<0.0001 and A549 p=0.0001), while only EBC1 treated with L1-MET_AS3 showed lower cell viability compared to the control (p=0.002). Figure 8 L1-MET_AS2 significantly affected MDA-MB231 (p<0.0001) and MCF7 (p=0.028). As expected, the viability of control cells was not affected by the silencing of the three gapmers. Figure 7 ).
[0094] Finally, flow cytometry assessment of apoptosis in cancer cells showed significant cell death in EBC1 and A549 cells after L1-MET silencing with either L1-MET_AS1 or L1-MET_AS2 oligonucleotides. Silencing with L1-MET_AS2 was stronger than that with L1-MET_AS1 and was also detectable in MCF7 and MDA-MB231 cells. Silencing with L1-MET_AS3 had no effect on apoptosis. Figure 8 ).
[0095] RNAseq analysis
[0096] NGS analysis was performed on cancer cells treated with L1-MET_AS1, without considering the other two ASOs, as they have opposite and extreme genotypic and phenotypic effects. An RNA-seq mRNA Illumina kit was used, meaning that, based on evidence revealed in di Miglio et al., Int J Cancer, 2018, L1-MET also preserves PolyA, PolyA tail RNA from the cells treated with L1-MET_AS1 was selected. A depth of 30 million reads was determined to: a) definitively confirm the decrease in L1-MET after treatment; b) assess gene expression regulation after treatment and identify more interesting genes affected after treatment; and c) perform off-target analysis on the RNA-seq data. qRT-PCR confirmed the detection of L1-MET expression in all cells. The same decrease in L1-MET was detected in cells treated with ASOs, confirming the efficacy of the silencing. Regarding differential gene expression, a select group of genes underwent specific regulation 24 hours after treatment. Among them, EGFR and MET oncogenes were reduced in all treated cells, except for MCF7. In this context, potential off-target sequences must be evaluated. Although computer alignment using the BLASTN tool identified only a few perfectly matching, potential off-target sequences, an empirically perfect 4-base mismatch alignment was set between L1-MET_AS1 and the reads obtained from all samples. This alignment procedure revealed the putative off-target genes and examined gene regulation. Interestingly, none of the predicted off-target sequences suffered from a decrease in read count, confirming the absence of unwanted gene expression alterations. Indirectly, this confirms that EGFR and MET gene regulation can both be considered non-silencing side effects.
[0097] Western blot analysis
[0098] To validate the data obtained from RNAseq, the expression of MET and EGFR proteins, as well as downstream effectors of the signaling pathway, AKT and ERK, were evaluated. Western blot analysis results are shown below. Figure 9As shown. In summary, L1-MET silencing in EBC1 cells resulted in decreased protein expression of MET and EGFR, as well as their corresponding phosphorylated proteins, for all three ASOs, exhibiting the same efficacy as observed above, with L1-MET_AS2 being the most effective, followed by L1-MET_AS1 and L1-MET_AS3. Since the EBC1 cell line is dependent on MET phosphorylation, a reduction in AKT and ERK activation was also detected. Similar results were found in A549, except that no changes in ERK phosphorylation were observed. In MDA-MB231, L1-MET silencing using L1-MET_AS1 and L1-MET_AS2, but not L1-MET_AS3, induced a reduction in EGFR protein. A decrease in MET expression was only observed when cells were treated with L1-MET_AS2. As reported in the literature, MCF7 cells do not express either MET or EGFR, and silencing did not cause any changes. No differences in protein expression were observed in normal cells.
[0099] Overall, these results clearly demonstrate the efficacy of L1-MET silencing in cells expressing L1-MET with MET and / or EGFR. Furthermore, three antisense oligonucleotides were found to induce cell death differently. Specifically, L1-MET_AS2 yielded the most potent results, followed by L1-MET_AS1 and L1-MET_AS3. This evidence suggests the possibility of translating L1-MET silencing into in vivo models, thereby enabling the development of selective therapies for human cancers.
[0100] References
[0101] 1.Beck, CR, et al., LINE-1retrotransposition activity in humangenomes. Cell, 2010.141(7):p.1159-70.
[0102] 2. Brouha, B., et al., Hot L1s account for the bulk of retrotransposition in the human population. Proc Natl Acad Sci USA, 2003.100(9):p.5280-5.
[0103] 3.Swergold,G.D.,Identification,characterization,and cell specificityof a human LINE-1promoter.Mol Cell Biol,1990.10(12):p.6718-29.
[0104] 4.Speek,M.,Antisense promoter of human L1 retrotransposon drivestranscription of adjacent cellular genes.Mol Cell Biol,2001.21(6):p.1973-85.
[0105] 5.Denli,A.M.,et al.,Primate-specific ORF0 contributes toretrotransposon-mediated diversity.Cell,2015.163(3):p.583-93.
[0106] 6.Nigumann,P.,K.Redik,K.Matlik,and M.Speek,Many human genes aretranscribed from the antisense promoter of L1 retrotransposon.Genomics,2002.79(5):p.628-34.
[0107] 7.Miglio,U.,et al.,The expression of LINE1-MET chimeric transcriptidentifies a subgroup of aggressive breast cancers.Int J Cancer,2018.143(11):p.2838-2848.
[0108] 8.Weber,B.,S.Kimhi,G.Howard,A.Eden,and F.Lyko,Demethylation of aLINE-1antisense promoter in the cMet locus impairs Met signalling throughinduction of illegitimate transcription.Oncogene,2010.29(43):p.5775-84.
[0109] 9.Wolff,E.M.,et al.,Hypomethylation of a LINE-1promoter activates analternate transcript of the MET oncogene in bladders with cancer.PLoS Genet,2010.6(4):p.e1000917.
[0110] 10.Crooke,S.T.,Molecular Mechanisms of AntisenseOligonucleotides.Nucleic Acid Ther,2017.27(2):p.70-77.
[0111] 11.Shen,X.and D.R.Corey,Chemistry,mechanism and clinical status ofantisense oligonucleotides and duplex RNAs.Nucleic Acids Res,2018.46(4):p.1584-1600.
[0112] 12.Di Fusco,D.,et al.,Antisense Oligonucleotide:Basic Concepts andTherapeutic Application in Inflammatory Bowel Disease.Front Pharmacol,2019.10:p.305.
[0113] 13.Bo,X.,et al.,Selection of antisense oligonucleotides based on multiple predicted target mRNA structures.BMC Bioinformatics,2006.7:p.122.
[0114] 14. Shao, Y., Y. Wu, CYChan, K. McDonough, and Y. Ding, Rational design and rapid screening of antisense oligonucleotides for prokaryotic genemodulation. Nucleic Acids Res, 2006.34(19):p.5660-9.
[0115] 15. Frankish, A., et al., GENCODE reference annotation for the human and mouse genomes. Nucleic Acids Res, 2019.47(D1):p.D766-D773.
[0116] 16.Dobin, A., et al., STAR: ultrafast universal RNA-seqaligner. Bioinformatics, 2013.29(1):p.15-21.
[0117] 17. Liao, Y., GKSmyth, and W. Shi, featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics, 2014.30(7): p.923-30. sequence list <110> Piedmont Oncology Foundation <120> Antisense oligonucleotide sequence for silencing human L1-MET transcripts in tumors <130> PCT42789 <150> IT102019000021327 <151> 2019-11-15 <160> 15 <170> PatentIn version 3.5 <210> 1 <211> 76 <212> DNA <213> Homo sapiens <400> 1 gcagaaaatg tgctagattg gaggtgaaga ccctggagcc agagagccta ggcttagtcc 60 tagccctgca ctgaag 76 <210> 2 <211> 31 <212> DNA <213> Homo sapiens <400> 2 gcagaaaatg tgctagattg gaggtgaaga c 31 <210> 3 <211> twenty three <212> DNA <213> Homo sapiens <400> 3 ttagtcctag ccctgcactg aag 23 <210> 4 <211> 16 <212> RNA <213> Artificial sequence <220> <223> Antisense oligonucleotides targeting L1-MET transcripts <400> 4 gucuucaccu ccaauc 16 <210> 5 <211> 16 <212> RNA <213> Artificial sequence <220> <223> Antisense oligonucleotides targeting L1-MET transcripts <400> 5 gcagggcuag gacuaa 16 <210> 6 <211> 16 <212> RNA <213> Artificial sequence <220> <223> Antisense oligonucleotides targeting L1-MET transcripts <400> 6 gccuaggcuc ucuggc 16 <210> 7 <211> 16 <212> RNA <213> Artificial sequence <220> <223> Antisense oligonucleotides targeting L1-MET transcripts <400> 7 cuagcacauu uucugc 16 <210> 8 <211> 16 <212> RNA <213> Artificial sequence <220> <223> Antisense oligonucleotides targeting L1-MET transcripts <400> 8 cuccaaucua gcacau 16 <210> 9 <211> 16 <212> RNA <213> Artificial sequence <220> <223> Antisense oligonucleotides targeting L1-MET transcripts <400> 9 accuccaauc uagcac 16 <210> 10 <211> 16 <212> RNA <213> Artificial sequence <220> <223> Antisense oligonucleotides targeting L1-MET transcripts <400> 10 cuaggcucuc uggcuc 16 <210> 11 <211> 17 <212> RNA <213> Artificial sequence <220> <223> Antisense oligonucleotides targeting L1-MET transcripts <400> 11 cuaagccuaa ggcucuc 17 <210> 12 <211> 16 <212> RNA <213> Artificial sequence <220> <223> Antisense oligonucleotides targeting L1-MET transcripts <400> 12 gugcagggcu aggacu 16 <210> 13 <211> 16 <212> RNA <213> Artificial sequence <220> <223> Antisense oligonucleotides targeting L1-MET transcripts <400> 13 agugcagggc uaggac 16 <210> 14 <211> 16 <212> RNA <213> Artificial sequence <220> <223> Antisense oligonucleotides targeting L1-MET transcripts <400> 14 cuucagugca gggcua 16 <210> 15 <211> 5546 <212> DNA <213> Homo sapiens <400> 15 ctttttgttt gtctgtgccc tgccccgaga ggtggagcct acagaggcag gcaggcctcc 60 ttgagctctg gtgggctcca cccagttcta gcttccaggc tgctttgttt acctaagcaa 120 gcctgggcaa tggcgggtgc cctccccca gcctcgctgc cgccttgcgg tttgatctca 180 gactgctgtg ctagcaatca gcgggactcc gtgggcgtag gaccctccga gccaggcaga 240 aaatgtgcta gattggaggt gaagaccctg gagccagaga gcctaggctt agtcctagcc 300 ctgcactgaa gacacttctg agaaattcat caggctgtga agcgcgccgt gatgaatatc 360 gaacagagtt taccacagct ttgcagcgcg ttgacttatt catgggtcaa ttcagcgaag 420 tcctcttaac atctatatcc accttcatta aaggagacct caccatagct aatcttggga 480 catcagaggg tcgcttcatg caggttgtgg tttctcgatc aggaccatca acccctcatg 540 tgaatttct cctggactcc catccagtgt ctccagaagt gattgtggag catacattaa 600 accaaaatgg ctacacactg gttatcactg ggaagaagat cacgaagatc ccattgaatg 660 gcttgggctg cagacatttc cagtcctgca gtcaatgcct ctctgcccca cccttttgttc 720 agtgtggctg gtgccacgac aaatgtgtgc gatcggagga atgcctgagc gggacatgga 780 ctcaacagat ctgtctgcct gcaatctaca aggttttccc aaatagtgca ccccttgaag 840 gagggacaag gctgaccata tgtggctggg actttggatt tcggaggaat aataaatttg 900 atttaaagaa aactagagtt ctccttggaa atgagagctg caccttgact ttaagtgaga 960 gcacgatgaa tacattgaaa tgcacagttg gtcctgccat gaataagcat ttcaatatgt 1020 ccataattat ttcaaatggc cacgggacaa cacaatacag tacattctcc tatgtggatc 1080 ctgtaataac aagtatttcg ccgaaatacg gtcctatggc tggtggcact ttacttactt 1140 taactggaaa ttacctaaac agtgggaatt ctagacacat ttcaattggt ggaaaaacat 1200 gtactttaaa aagtgtgtca aacagtattc ttgaatgtta taccccagcc caaaccattt 1260 caactgagtt tgctgttaaa ttgaaaattg acttagccaa ccgagagaca agcatcttca 1320 gttaccgtga agatcccatt gtctatgaaa ttcatccaac caaatctttt attagtggtg 1380 ggagcacaat aacaggtgtt gggaaaaacc tgaattcagt tagtgtcccg agaatggtca 1440 taaatgtgca tgaagcagga aggaacttta cagtggcatg tcaacatcgc tctaattcag 1500 agataatctg ttgtaccact ccttccctgc aacagctgaa tctgcaactc cccctgaaaa 1560 ccaaagcctt tttcatgtta gatgggatcc tttccaaata ctttgatctc attatgtac 1620 ataatcctgt gttaagcct tttgaaaagc cagtgatgat ctcaatgggc aatgaaaatg 1680 tactggaaat tagggaaat gatattgacc ctgaagcagt taaaggtgaa gtgttaaaag 1740 ttggaaataa gagctgtgag aatacact tacattctga agccgtttta tgcacggtcc 1800 ccaatgacct gctgaaattg aacagcgagc taaatataga gtggaagcaa gcaatttctt 1860 caaccgtcct tggaaaagta atagttcaac cagatcagaa tttcacagga ttgattgctg 1920 gtgttgtctc aatatcaaca gcactgttat tactacttgg gtttttcctg tggctgaaaa 1980 agagaaagca aattaaagat ctgggcagtg aattagttcg ctacgatgca agagtacaca 2040 ctcctcattt ggataggctt gtaagtgccc gaagtgtaag cccaactaca gaaatggttt 2100 caaatgaatc tgtagactac cgagctactt ttccagaaga tcagtttcct aattcatctc 2160 agaacggttc atgccgacaa gtgcagtatc ctctgacaga catgtccccc atcctaacta 2220 gtggggactc tgatatatcc agtccattac tgcaaaatac tgtccacatt gacctcagtg 2280 ctctaaatcc agagctggtc caggcagtgc agcatgtagt gattgggccc agtagcctga 2340 ttgtgcattt caatgaagtc ataggaagag ggcattttgg ttgtgtatat catgggactt 2400 tgttggacaa tgatggcaag aaaattcact gtgctgtgaa atccttgaac agaatcactg 2460 acataggaga agtttcccaa tttctgaccg agggaatcat catgaaagat tttagtcatc 2520 ccaatgtcct ctcgctcctg ggaatctgcc tgcgaagtga agggtctccg ctggtggtcc 2580 taccatacat gaaacatgga gatcttcgaa atttcattcg aaatgagact cataatccaa 2640 ctgtaaaaga tcttattggc tttggtcttc aagtagccaa aggcatgaaa tatcttgcaa 2700 gcaaaaagtt tgtccacaga gacttggctg caagaaactg tatgctggat gaaaaattca 2760 cagtcaaggt tgctgatttt ggtcttgcca gagacatgta tgataaagaa tactatagtg 2820 tacacaacaa aacaggtgca aagctgccag tgaagtggat ggctttggaa agtctgcaaa 2880 ctcaaaagtt taccaccaag tcagatgtgt ggtcctttgg cgtgctcctc tgggagctga 2940 tgacaagagg agccccacct tatcctgacg taaacacctt tgatataact gtttacttgt 3000 tgcaagggag aagactccta caacccgaat actgcccaga ccccttatat gaagtaatgc 3060 taaaatgctg gcaccctaaa gccgaaatgc gcccatcctt ttctgaactg gtgtcccgga 3120 tatcagcgat cttctctact ttcattgggg agcactatgt ccatgtgaac gctacttatg 3180 tgaacgtaaa atgtgtcgct ccgtatcctt ctctgttgtc atcagaagat aacgctgatg 3240 atgaggtgga cacacgacca gcctccttct gggagacatc atagtgctag tactatgtca 3300 aagcaacagt ccacactttg tccaatggtt tttcactgc ctgaccttta aaaggccatc 3360 gatattcttt gctcttgcca aaattgcact attaggac ttgtattgtt attaaatta 3420 ctggattcta aggaatttct tatctgacag agcatcagaa ccagaggctt ggtcccacag 3480 gccacggacc aatggcctgc agccgtgaca acactcctgt catattggag tccaaaactt 3540 gaattctggg ttgaattttt taaaaatcag gtaccacttg atttcatatg ggaaattgaa 3600 gcaggaaata ttgagggctt cttgatcaca gaaaactcag aagagatagt aatgctcagg 3660 acaggagcgg cagccccaga acaggccact cattagaat tctagtgttt caaaacactt 3720 ttgtgtgttg tatggtcaat aacatttttc attactgatg gtgtcattca cccattaggt 3780 aaacattccc ttttaaatgt ttgtttgttt tttgagacag gatctcactc tgttgccagg 3840 gctgtagtgc agtggtgtga tcatagctca ctgcaacctc cacctcccag gctcaagcct 3900 cccgaatagc tgggactaca ggcgcacacc accatccccg gctaattttt gtattttttg 3960 tagagacggg gttttgccat gttgccaagg ctggtttcaa actcctggac tcaagaaatc 4020 cacccacctc agcctcccaa agtgctagga ttacaggcat gagccactgc gcccagccct 4080 tataaatttt tgtatagaca ttcctttggt tggaagaata tttataggca atacagtcaa 4140 agttcaaaa tagcatcaca caaaacatgt ttataaatga acaggatgta atgtacatag 4200 atgacattaa gaaaatttgt atgaaataat ttagtcatca tgaaatattt agttgtcata 4260 taaaaaccca ctgtttgaga atgatgctac tctgatctaa tgaatgtgaa catgtagatg 4320 ttttgtgtgt atttttttaa atgaaaactc aaaataagac aagtaatttg ttgataaata 4380 tttttaaaga taactcagca tgtttgtaaa gcaggataca ttttactaaa aggttcattg 4440 gttccaatca cagctcatag gtagagcaaa gaaagggtgg atggattgaa aagattagcc 4500 tctgtctcgg tggcaggttc ccacctcgca agcaattgga aacaaaactt ttggggagtt 4560 ttattttgca ttagggtgtg ttttatgtta agcaaaacat actttagaaa caaatgaaaa 4620 aggcaattga aaatcccagc tatttcacct agatggaata gccaccctga gcagaacttt 4680 gtgatgcttc attctgtgga attttgtgct tgctactgta tagtgcatgt ggtgtaggtt 4740 actctaactg gttttgtcga cgtaaacatt taaagtgtta tattttttat aaaaatgttt 4800 atttttaatg atatgagaaa aattttgtta ggccacaaaa acactgcact gtgaacattt 4860 tagaaaaggt atgtcagact gggattaatg acagcatgat tttcaatgac tgtaaattgc 4920 gataaggaaa tgtactgatt gccaatacac cccaccctca ttacatcatc aggacttgaa 4980 gccaagggtt aacccagcaa gctacaaaga gggtgtgtca cactgaaact caatagttga 5040 gtttggctgt tgttgcagga aaatgattat aactaaaagc tctctgatag tgcagagact 5100 taccagaaga cacaaggaat tgtactgaag agctattaca atccaaatat tgccgtttca 5160 taaatgtaat aagtaatact attcacaga gtattgtaaa tggtggatga CAAAAAAA 5220 tctgctctgt ggaagaaag aactgtctct accaggtca agagcatgaa cgcatcaata 5280 gaagaactc ggggaaacat cccatcaca ggactacaca cttgtatata cattcttgag 5340 aacactgcaa tgtgaaaatc acgtttgcta tttataaact tgtccttaga ttaatgtgtc 5400 tggacagatt gtgggagtaa gtgattctc tagaattag attacktgtca ctgcctatac 5460 ctgcagctga actgaatggt acttcgtatg ttaatagttg ttctgataaa tcatgcaatt 5520 aaagtaagt gadget cttgta 5546
Claims
1. An antisense oligonucleotide that targets the L1-MET transcript region encoded by SEQ ID NO:1, wherein the antisense oligonucleotide is composed of SEQ ID NO:4 or SEQ ID NO:
5.
2. The antisense oligonucleotide of claim 1, wherein each of the antisense oligonucleotides comprises a combination of ribonucleotides and deoxyribonucleotides, and / or a nucleotide having modified ribose and / or deoxyribose, wherein the phosphate group is modified or not modified.
3. A pharmaceutical composition comprising one or more antisense nucleotides as defined in any one of claims 1-2 as an active ingredient, and one or more excipients.
4. The pharmaceutical composition according to claim 3, wherein the pharmaceutical composition further comprises one or more anticancer drugs.
5. Use of the antisense oligonucleotide as defined in any one of claims 1-2 or the pharmaceutical composition as defined in any one of claims 3-4 in the preparation of a medicament for treating tumors expressing L1-MET, wherein when the antisense oligonucleotide is composed of SEQ ID NO:4, the tumor expressing L1-MET is lung adenocarcinoma, and when the antisense oligonucleotide is composed of SEQ ID NO:5, the tumor expressing L1-MET is lung adenocarcinoma and breast cancer.
6. Use of one or more antisense oligonucleotides as defined in any one of claims 1-2 in combination with one or more anticancer drugs in the preparation of a medicament for treating tumors expressing L1-MET, wherein when the antisense oligonucleotide is composed of SEQ ID NO:4, the tumor expressing L1-MET is lung adenocarcinoma, and when the antisense oligonucleotide is composed of SEQ ID NO:5, the tumor expressing L1-MET is lung adenocarcinoma and breast cancer, and wherein the one or more antisense oligonucleotides are used alone or sequentially with the one or more anticancer drugs.
7. The use according to claim 6, wherein the breast cancer is triple-negative breast cancer.
Citation Information
Patent Citations
ANTISENSE OLIGONUCLEOTIDE SEQUENCES TO SILENCE THE HUMAN L1-MET TRANSCRIPT IN TUMORS.
IT102019000021327
Methods for measuring biomarkers in gastrointestinal cancer
CN106103739A