A shRNA for knocking down SNX10 gene, a lentiviral vector, a breast cancer cell and its application

Abstract

The present application discloses a shRNA for knocking down the expression of the SNX10 gene, and the nucleotide sequence of the shRNA is shown in SEQ ID No. 1. The present application also provides a lentiviral vector containing the above shRNA; the present invention also provides a breast cancer cell; the present invention also provides the use of the above shRNA, lentiviral vector, and breast cancer cells in the preparation of a drug for treating triple-negative breast cancer. The present invention observed the effect of shRNA that down-regulates the expression of the SNX10 gene on the growth of triple-negative breast cancer MDA-MB-231 cells and subcutaneous tumor formation in nude mice, and confirmed through experiments that after using shSNX10, cell proliferation and tumor progression were significantly inhibited.

Description

Technical Field

[0001] The present application relates to the field of molecular biology technology, and in particular to a shRNA for knocking down the SNX10 gene, a lentiviral vector, breast cancer cells and applications. Background Art

[0002] Breast cancer is one of the most common female malignancies. According to the 2020 Global Cancer Statistics Report, there are approximately 2.3 million new cases of breast cancer, and its total incidence (11.7%) ranks first in the global cancer incidence. Triple-negative breast cancer accounts for approximately 15% of all breast cancers. Since it lacks the expression of ER, PR, and HER2, it limits the effectiveness of existing breast cancer treatments, resulting in poor prognosis, high recurrence and metastasis rates, and high mortality rates.

[0003] Sorting protein SNX10 is a member of the phosphoinositide binding protein family containing a phox homology domain. It is localized in endosomes in cells and participates in regulating endosomal homeostasis. At present, research on the function of SNX10 mainly focuses on the development of cancers such as colorectal cancer, bone diseases, cardiovascular diseases, metabolic disorders, and autophagy. No relevant research has been reported in breast cancer. Summary of the invention

[0004] In order to solve the above technical problems, the present invention first provides a shRNA for knocking down the expression of the SNX10 gene; the present invention also provides a lentiviral vector containing the above shRNA; the present invention also provides a breast cancer cell; the present invention also provides the use of the above shRNA, lentiviral vector, and breast cancer cell in the preparation of a drug for treating triple-negative breast cancer.

[0005] The technical solution provided by the present invention is as follows:

[0006] A shRNA for knocking down the expression of the SNX10 gene, wherein the nucleotide sequence of the shRNA is shown in SEQ ID No. 1. Specifically, it is: CCGGGCTTTGTTACCCAGCCTAATTCTCGAGAATTAGGCTGGGTAACAAAGCTTTTT.

[0007] A lentiviral vector containing the above shRNA.

[0008] Preferably, the RNA interference target sequence of the lentiviral vector is as shown in SEQ ID No. 2. Specifically: TTTGTTACCCAGCCTAATT.

[0009] A breast cancer cell, wherein the breast cancer cell is a breast cancer cell infected with the above-mentioned lentiviral vector.

[0010] The use of the above shRNA, the above lentiviral vector, and the above breast cancer cells in the preparation of drugs for treating triple-negative breast cancer.

[0011] Preferably, the drug can inhibit triple-negative breast cancer cell growth and tumor development.

[0012] The present invention discloses the application of shRNA (shSNX10) for down-regulating the expression of SNX10 gene in the growth of triple-negative breast cancer cells and tumor development. The present invention observed the effect of shRNA for down-regulating the expression of SNX10 gene on the growth of triple-negative breast cancer MDA-MB-231 cells, and combined with nude mouse tumor formation experiment; Celigo cell counting method, clone formation experiment and MTT experiment confirmed that after using shSNX10, the proliferation of cells was significantly inhibited; animal experiments proved that knocking down SNX10 can effectively inhibit the growth of tumors; SNX10 can be used as a target for the treatment of triple-negative breast cancer; further, SNX10 is used as a target to design and develop anti-tumor drugs for the treatment of triple-negative breast cancer.

[0013] Triple-negative breast cancer is insensitive to standard treatments for breast cancer and lacks targets. The applicant has found through research that shSNX10 can significantly inhibit the growth of triple-negative breast cancer MDA-MB-231 cells and inhibit the development of subcutaneous transplanted tumors in nude mice. Therefore, SNX10 can be used as a target for genes and anti-tumor drugs for the treatment of triple-negative breast cancer. shSNX10 can be constructed in a lentiviral vector system and introduced into tumor tissue; it can also be administered by direct injection of shRNA to achieve the effect of inhibiting tumor development. The present invention confirms that shSNX10 inhibits the growth of triple-negative breast cancer cells and tumor development, and provides a new means or new drug application method for the treatment of triple-negative breast cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0015] Figure 1 RT-qPCR detection of SNX10 gene knockdown mediated by shSNX10 lentivirus;

[0016] Figure 2 Representative images of Celigo cell counting, showing the effect of shSNX10 infection on the growth of MDA-MB-231 cells;

[0017] Figure 3 The growth curves of the two groups of Celigo counts show the effect of shSNX10 infection on the growth of MDA-MB-231 cells;

[0018] Figure 4 The colony formation diagram of the two groups of samples shows the effect of shSNX10 infection on the colony formation of MDA-MB-231 cells;

[0019] Figure 5 It is a statistical graph of the clone numbers of the two groups of samples, showing the effect of shSNX10 infection on the clone formation of MDA-MB-231 cells;

[0020] Figure 6 The effect of shSNX10 infection on the proliferation of MDA-MB-231 cells;

[0021] Figure 7 The tumor-bearing images of two groups of mice show the effect of shSNX10 infection on subcutaneous tumor formation in triple-negative breast cancer nude mice;

[0022] Figure 8 The in vitro tumors of two groups of mice show the effect of shSNX10 infection on subcutaneous tumor formation in triple-negative breast cancer nude mice;

[0023] Fig. 9 It is a curve graph showing the change of tumor volume over time, showing the effect of shSNX10 infection on subcutaneous tumor formation in triple-negative breast cancer nude mice;

[0024] Fig.10 The statistical graph of tumor weight of the two groups of mice at the experimental endpoint shows the effect of shSNX10 infection on subcutaneous tumor formation in nude mice with triple-negative breast cancer. DETAILED DESCRIPTION

[0025] In order to enable those skilled in the art to better understand the technical solutions in this application, the technical solutions in the embodiments of this application will be clearly and completely described below. Obviously, the described embodiments are only part of the embodiments of this application, not all of them. Based on the embodiments in this application, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of this application.

[0026] Example 1: shSNX10 vector construction and lentivirus preparation

[0027] (1) Using the human SNX10 gene (NM_013322) as a template, multiple 19-21nt RNA interference target sequences were designed. After software evaluation and determination, the following sequences were selected as interference targets

[0028] SEQ ID NO.2:TTTGTTACCCAGCCTAATT

[0029] (2) Design the shRNA interference sequence according to the selected target sequence as shown in SEQ ID NO.1, and add AgeI and EcoRI restriction endonuclease sites at both ends, send it to Jierui Company to synthesize single-stranded DNA oligo, and prepare double-stranded DNA oligo.

[0030] SEQ ID NO.1: CCGGGCTTTGTTACCCAGCCTAATTCTCGAGAATTAGGCTGGGTAACAAAGCTTTTTT

[0031] (3) GV115 (Shanghai Jikai Company) was selected as the vector, and AgeI and EcoRI restriction enzymes were added to linearize it. Double-stranded DNA oligo was connected to the linearized GV115 vector using T4 DNA Ligase (Fermentas Company). The recombinant vector was transformed into TOP10 Escherichia coli competent cells (TIANGEN Company), plated and cultured, and positive clones were selected for PCR identification using the following primers, and finally verified by sequencing. (Identification primer-F: CCTATTTCCCATGATTCCTTCATA; identification primer-R: GTAATACGGTTATCCACGCG)

[0032] (4) The bacterial solution with correct sequencing was amplified and plasmids were extracted, and the plasmids that passed the quality inspection were sent to Shanghai Gene Gene Co., Ltd. for lentiviral packaging. Among them, shCtrl represents the negative control virus, and shSNX10 is the SNX10 interference lentivirus.

[0033] Example 2: MDA-MB-231 cell culture and lentiviral infection

[0034] The culture medium of triple-negative breast cancer cell line MDA-MB-231 is composed of DMEM / F12 medium (Gibco), 10% fetal bovine serum (Gibco), 100 μg / mL double antibody (penicillin / streptomycin); cultured in a cell culture incubator at 37°C and 5% CO2. When the cell density is about 30%, add shSNX10 interference lentivirus or shCtrl negative control virus at MOI=5, and change the medium after infecting the cells for 12 hours.

[0035] Example 3: Establishment of shSNX10 stably transfected cell line MDA-MB-231

[0036] After 72 hours of lentivirus infection, puromycin (final concentration of 4 μg / mL) was added to the cells. After 48 hours, the cells were passaged and puromycin was added again for selection after they adhered to the wall. The cells were collected to extract RNA, which was reversed into cDNA and then the mRNA expression level was detected by RT-qPCR experiment (see Appendix). Figure 1 ), freeze the cells for later use.

[0037] The primer sequences of SNX10 and GAPDH are shown in Table 1

[0038] Table 1

[0039]

[0040]

[0041] Example 4: Effect of shSNX10 on the growth of MDA-MB-231 cells

[0042] Celigo cell counting experiment: 1000 MDA-MB-231 cells were inoculated in a 96-well plate. After 24 hours, the cells were counted by Celigo. The test was performed every 24 hours, with 3 replicates each time, until 120 hours. The growth curve was drawn and it was found that compared with shCtrl, shSNX10 could significantly inhibit the growth of MDA-MB-231 cells (see Appendix). Figure 2-3 ).

[0043] Clone formation experiment: 800 MDA-MB-231 cells were inoculated in a 6-well plate, with 3 replicates per group, and the medium was changed every 3 days. After 20 days, 4% paraformaldehyde was added to fix the cells, washed with PBS, and stained with GIEMSA staining solution (Shanghai Dingguo Biological), rinsed with water and dried, and photographed and counted. Compared with shCtrl, shSNX10 significantly inhibited the clone formation ability of MDA-MB-231 cells (see Figure 2). Figure 4-5 ).

[0044] MTT assay: 2000 MDA-MB-231 cells were seeded in a 96-well plate. After 24 hours, MTT was added and incubated for 4 hours. After discarding the medium, DMSO was added and OD490 was measured. The test was performed every 24 hours, with 5 replicates each time, until 120 hours. By plotting the growth curve, it can be found that compared with shCtrl, shSNX10 can significantly inhibit the proliferation of MDA-MB-231 cells (see Figure 2). Figure 6 ).

[0045] From the attached Figure 2-6It can be seen that in the present invention, the tumor cell MDA-MB-231 was infected with shSNX10 lentivirus, and cell proliferation and growth were detected by various experimental methods. It was found that knockdown of SNX10 inhibited the growth of triple-negative breast cancer cells MDA-MB-231.

[0046] Example 5: Effect of shSNX10 on subcutaneous tumorigenesis of MDA-MB-231 cells in nude mice

[0047] Nude mouse tumorigenesis experiment: The shSNX10 and shCtrl stable transfected cell lines MDA-MB-231 in the logarithmic growth phase were prepared into a cell suspension and inoculated into the right axilla of female BALB / c nude mice (SCXK (Shanghai) 2018-0003, Shanghai Lingchang Biotechnology). Each mouse was inoculated with 200 μL of cell suspension (containing 1×10 7 cells), 10 mice in each group. After 25 days, the tumor diameter and animal weight were measured twice a week. After 49 days, the animals were euthanized by intraperitoneal injection of an overdose of 2% sodium pentobarbital, and the animals were arranged in groups and photographed. The tumors were then removed, weighed, photographed, and stored. The tumor volume was calculated according to the tumor diameter according to the tumor volume formula, and a tumor growth curve and a tumor weight scatter plot were drawn. Among them, tumor volume = π / 6×L×W×W, L represents the long diameter, and W represents the short diameter. Compared with the shCtrl group, the tumor growth curve of the shSNX10 group of mice was at the bottom, and the tumor weight was significantly decreased (Appendix Figure 7-10 ), indicating that knockdown of SNX10 has an inhibitory effect on the development of triple-negative breast cancer.

[0048] From the attached Figure 7-10 It can be seen that the present invention used the SNX10 gene knockdown stable transfection cell line MDA-MB-231 to conduct animal experiments, injected the cells subcutaneously into nude mice, and observed the effect of shSNX10 on tumor size. The results showed that shSNX10 significantly inhibited the subcutaneous tumor formation of triple-negative breast cancer.

[0049] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein. Sequence Listing <110> The First Affiliated Hospital of University of South China <120> A shRNA for knocking down SNX10 gene, a lentiviral vector, a breast cancer cell and its application <130> MP22008015 <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 57 <212> DNA / RNA <213> Artificial Sequence <400> 1 ccgggctttg ttacccagcc taattctcga gaattaggct gggtaacaaa gcttttt 57 <210> 2 <211> 19 <212> DNA / RNA <213> Artificial Sequence <400> 2 tttgttaccc agcctaatt 19

Claims

1. A shRNA for knocking down SNX10 gene expression, characterized in that: The nucleotide sequence of the shRNA is shown as SEQ ID No.

1.

2. A lentiviral vector containing the shRNA according to claim 1.

3. The lentiviral vector according to claim 2, characterized in that The RNA interference target sequence of the lentiviral vector is shown in SEQ ID No.

2.

4. A breast cancer cell, characterized in that The breast cancer cells are breast cancer cells infected with the lentiviral vector according to claim 3.

5. Use of the shRNA according to claim 1 and the lentiviral vector according to claim 2 in the preparation of a drug for treating triple-negative breast cancer.

6. The use according to claim 5, characterized in that: The drug can inhibit triple-negative breast cancer cell growth and tumor development.

Images