Anemia Screening Kit and Method for Targeted Capture of Long Fragment DNA by CRISPR and Cas9
Through CRISPR and CAS9 targeted capture of long fragment DNA, the problem of limited range and high error in the prior art thalassemia detection is solved, and a high-throughput and low-cost detection of various types of thalassemia is achieved, especially effective detection of large fragment structural mutations.
Patent Information
- Application Number
- CN202210524862.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-05-13
- Publication Date
- 2025-08-01
- Estimated Expiration
- 2042-05-13
AI Technical Summary
The existing thalassemia detection technology has problems such as limited detection range, cumbersome operation, high cost, high error rate and inability to effectively detect structural mutations of large fragments, especially insufficient detection of δ and δβ thalassemia.
The method of targeting long fragment DNA is adopted to capture long fragment DNA by designing sgRNA to target specific gene regions, combining Y-type linkers and primers, a long fragment sequencing library is constructed, and high-throughput detection is performed using third- or fourth-generation sequencing technology.
Accurate and rapid detection of 5 types of thalassemia, α, β, δ, δβ and εγδβ, is achieved, covering large fragment deletions and structural variations, reducing detection time and cost, and improving detection throughput and accuracy.
Smart Images

Figure CN114752668B_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of biological detection technology, and more specifically, to an anemia screening kit and method for CRISPR and CAS9 targeted capture of long fragment DNA. Background Art
[0002] Thalassemia is a group of autosomal recessive genetic blood diseases. There are 4 types of peptide chains that make up globin, namely α, β, γ, and δ chains, which are encoded by their respective genes. Deletions or point mutations in these genes can cause synthesis disorders of various peptide chains, resulting in changes in the components of hemoglobin. According to the types of globin peptide chain synthesis disorders, thalassemia is generally divided into α-thalassemia, β-thalassemia, δ-thalassemia, δβ-thalassemia, and εγδβ-thalassemia. Among them, β- and α-thalassemia are more common. The human α-globin gene cluster is located on chromosome 16 and contains a total of 7 gene loci: 5’-zeta-pseudozeta-mu-psedudoa-l-pha-1-alpha-2-alpha-1-theta-3’. The most common pathogenic variant genes causing α-thalassemia are HBA1 and HBA2. Mutations in the HBA1 and HBA2 genes include deletion mutations and non-deletion mutations. The most common deletion mutations of the HBA1 and HBA2 genes in China are -α-3.7, -α-4.2, and -SEA, and the non-deletion mutations are HBA2:c.369C>G, HBA2:c.377T>C, HBA2:c.427T>C. In addition to HBA1 and HBA2, deletions or mutations in the HS-40 regulatory region can also cause α-thalassemia, such as the deletion of 97 kb at NC_000016.10:g.56407_153678del. The human β-globin gene cluster is located on chromosome 11 and contains a total of 5 gene loci: 5’-epsilon-gamma-G-gamma-A-delta-beta-3’. The genetic variations causing β-thalassemia are mainly point mutations or small fragment deletions in the HBB gene, and a small number are large fragment deletions. However, currently, the main detections are mainly 19 mutations at 17 known common loci, including c.-82C>A, c.-80T>C, c.-79A>G, c.-78A>G, c.78A>C, c.11_8delAAAC, c.79G>A, c.92+1G>T, c.92+5G>C, c.316197C>T, c.2T>G, c.45_46insG, c.84_85insG, c.52A>T, c.94delC, c.126_129delCTTT, c.130G>T, c.216_217insA, c.216_217insT, etc. δ-thalassemia is caused by abnormal synthesis of globin δ chain. The presence of δ mutations may mask the diagnosis of β-thalassemia traits because in β-thalassemia, HbA2 is elevated, but the presence of δ may reduce the HbA2 concentration, thus masking the diagnosis of β-thalassemia traits. δβ-thalassemia mainly involves deletions of δ-globin and β-globin genes, and some deletion types include deletions of Aγ, Gγ, and ε-globin genes.The most common type of δβ thalassemia in China is Chinese Gγ+(Aγδβ)0 thalassemia. Double heterozygotes of such deletion mutations and β-thalassemia point mutations can lead to intermediate or severe thalassemia.
[0003] The main gene diagnosis methods for thalassemia include: Sanger sequencing, next-generation sequencing, restriction fragment length polymorphism (RFLP), reverse dot blot (RDB), allele-specific PCR (ARMS-PCR), multiplex Gap-PCR, and targeted next-generation sequencing. The operation of the Sanger sequencing method is relatively cumbersome, which greatly limits its application in clinical diagnosis. The detection throughput of sequencing is also limited, and the detection results need to be manually analyzed, which is time-consuming and laborious. RFLP performs enzymatic digestion by identifying specific sequence sites. The method is simple and low-cost, but its limitation is that it can only detect a limited number of mutations that can generate enzymatic digestion sites. Incomplete or partial enzymatic digestion reactions can also lead to false positive or false negative results. The results of the reverse dot blot technique are read by the naked eye, with a high error rate, often resulting in repeated testing of a sample. ARMS-PCR requires designing corresponding primers for each mutation, and the amplification conditions for each pair of primers need to be optimized. If multiple mutations need to be detected simultaneously, the operation is cumbersome, and false positive or false negative results will also occur. Currently, common products based on multiplex Gap-PCR can only detect 3-4 common deletion-type thalassemia mutations, and the coverage for rare mutations, including some rare structural variation mutations, is limited. Next-generation sequencing technology usually requires targeted capture sequencing or multiplex PCR enrichment. The primer design is complex and the procedure is cumbersome, with high requirements for operators and high costs. The read length of next-generation sequencing is short, commonly used for detecting small fragment insertion mutations, small fragment deletion mutations, and point mutations, and there is still a possibility of missing large fragment complex structural variations. Currently, third-generation sequencing has also been used in the detection of thalassemia mutations. There is currently a third-generation sequencing technology that uses a method based on multiplex PCR amplification and third-generation sequencing to simultaneously detect multiple mutations in the HBA1 / 2 and HBB gene regions, but it does not cover the mutation sites of δβ and δ thalassemia. The presence of δ mutations may mask the diagnosis of β-thalassemia traits, and double heterozygotes of some δβ thalassemias, such as Chinese Gγ+(Aγδβ)0 thalassemia and β-thalassemia point mutations, can lead to intermediate or severe thalassemia. In addition, the combined probe-anchored polymerization sequencing method used in some α and β thalassemia gene detection kits for next-generation sequencing has limited detection of large fragment structural variations. Therefore, we propose a CRISPR, CAS9 targeted capture long fragment DNA anemia screening kit and its method to solve the above-mentioned problems Summary of the Invention
[0004] In view of the deficiencies of the prior art, the CRISPR and CAS9 systems of the present invention target and capture large fragment regions of thalassemia variants. Using long fragment sequencing technology, it can effectively detect pathogenic mutations and large fragment deletions that may cause thalassemia in the population, and can accurately, quickly and high-throughput detect all non-deletion and deletion mutations of α-globin, β-globin genes and related regulatory genes including HS-40 and βLCR genes. At the same time, it can detect 5 types of thalassemia, namely α, β, δ, δβ and εγδβ.
[0005] To achieve the above objectives, the present invention is realized through the following technical solutions: An anemia screening kit based on CRISPR and CAS9 targeted capture of long fragment DNA, including sgRNA for targeted capture of thalassemia-related genes, Y-type adapters for circular amplification, and primers for circular amplification.
[0006] The targeting capture range of the sgRNA is: chr11:5166361-5296578 (hg38), chr16:48994-210817 (hg38). The captured region of the sgRNA is as follows, and the sgRNA sequence is: UAAUACGACUCACUAUAGGGNNNNNNNNNNNNNNNNNNNNGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU.
[0007] Preferably, the Y-type adapter sequence is: Y-type universal adapter sequence: ACAATTTGCACGAT-ATGCTTAGACACCT
[0008] CCGATTACG[index]TTCG-TACGAATCTGTGG.
[0009] Preferably, the primer sequences are: F: ACAATTTGCACGATATGCTTAGACACCT
[0010] R: CCACAGATTCGTA[index]CGTAATCGG.
[0011] Preferably, the sgRNA target cleavage site can target and capture, but is limited to, the thalassemia mutation-related regions of OR52Z1, OR51V1, HBB, HBD, HBBP1, BGLT3 (HS-40), HBG1, HBG2, HBE1, OR51AB1P, POLR3K, SNRNP25, RHBDF1, MPG, NPRL3, HBZ, LOC107983982, HBZP1, HBM, HBAP1, HBA2, HBA1, HBQ1, LUC7L, including any type of mutation within the regions of chr11:5167971-5295261 (hg38) and chr16:48994-210817 (hg38).
[0012] An anemia screening kit for CRISPR and CAS9 targeted capture of long fragment DNA, including the following screening methods: preparing a subject sample; using the CRISPR and CAS9 targeted capture system to capture the fragments of chr11:5166361-5296578 (hg38) and chr16:48994-210817 (hg38); constructing a long fragment sequencing library; sequencing and analyzing the thalassemia gene mutation types.
[0013] Preferably, the screening steps are specifically as follows:
[0014] Sequence design of sgDNA: Select the thalassemia-related region and use the CHOPCHOP tool to design sgRNA;
[0015] Use the NEB rapid dephosphorylation kit to dephosphorylate DNA. After incubating at 37°C for 10 minutes, incubate at 80°C for 2 minutes to terminate the reaction;
[0016] Assembly of the CRISPR and CAS9-sgRNA complex, thoroughly mix and centrifuge in a microcentrifuge, incubate at 37°C for 15 minutes, add 1 μl of proteinase K to each sample and incubate at room temperature for 10 minutes;
[0017] Add 10 μl of DNA, 1 μL of 10 mM dATP and 2 μL of Taq DNA polymerase, incubate at 37°C for 15 minutes, digest with Cas9 enzyme, then incubate at 72°C for 5 minutes, and add an A to the DNA end;
[0018] Adapter ligation, the adapter ligation system is as follows in the table, incubate at 22°C for 10 minutes;
[0019] Add 1 μl of exonuclease III, incubate at 37°C for 30 minutes, and then incubate at 70°C for 30 minutes to inactivate;
[0020] Add 30 μl of DNA enrichment magnetic beads, incubate at room temperature for 10 minutes, then place on a magnetic stand and let stand for 5 minutes. Discard the supernatant, add 100 μl of 80% ethanol, aspirate after 30 s, repeat once. Then open the lid and air-dry for 2 minutes. Add 24.5 μl of nuclease-free water, incubate for 2 minutes, then place on the magnetic stand. After the liquid becomes clear, pipette the supernatant into a new PCR tube;
[0021] Adapter ligation; incubate at 60 °C for 1 hour, then incubate at 80 °C for 10 minutes to inactivate the ligase. Then add 4.7 μl of 10X NEB restriction enzyme buffer, 1 μl each of exonuclease I and III, and incubate at 37 °C for 30 minutes;
[0022] Rolling circle amplification, incubate the reaction system at 30 °C for 6 hours, then incubate at 60 °C for 10 minutes, and then perform electrophoresis to check the amplification;
[0023] Sequence the amplified product using nanopore.
[0024] Preferably, dilute each DNA sample to 1 ng / μl, then incubate at room temperature for 10 minutes, incubate at 65 °C for 5 minutes, and incubate on ice for 1 minute;
[0025] Directly add the above reaction product to the following system, then incubate at room temperature for 10 minutes, incubate at 65 °C for 5 minutes, and incubate on ice for 1 minute;
[0026] Prepare the AMII adapter protein ligation system, incubate at room temperature for 15 min. Then add AMPure XP magnetic beads to the sample tube at a ratio of 1:1, transfer the tube to a magnetic stand, let stand for 2 min, discard the supernatant, add 200 μl of SFB to resuspend and centrifuge. Then add 15 μl of EB solution and incubate at room temperature for 2 min. Then place on the magnetic stand, let stand for 2 min. Wait until the magnetic beads are attracted to the side close to the magnetic stand or the solution becomes clear, and carefully aspirate the supernatant. Finally, obtain the library and sequence it on MinION, GridION Mk1, or PromethION P24 sequencers.
[0027] The present invention provides a kit and method for anemia screening by CRISPR and CAS9 targeted capture of long fragment DNA, having the following beneficial effects:
[0028] 1. The anemia screening kit and method for CRISPR / Cas9 targeted capture of long - fragment DNA target and capture large - fragment regions with thalassemia mutations through the CRISPR / Cas9 system, covering five types of thalassemia mutation regions including α, β, δ, δβ, and εγδβ. Using third - generation or fourth - generation long - read sequencing technology, it can effectively detect pathogenic mutations, complex structural variations, and large - fragment deletions that may cause thalassemia in the population, covering non - deletion and deletion mutations of the β - globin gene and related regulatory genes including HS - 40 and βLCR genes. At the same time, it detects five types of thalassemia including α, β, δ, δβ, and εγδβ. The CRISPR / Cas9 targeted capture sequencing method can capture almost any region. Compared with multiplex PCR, the design is simpler and it can capture almost any region.
[0029] 2. The anemia screening kit and method for CRISPR / Cas9 targeted capture of long - fragment DNA, by using Cas9 to target and capture the target sequence and combining the enzymatic digestion and enzymatic digestion enrichment method of Y - type primers, can avoid non - specific amplification of ordinary multiplex PCR and the preference of PCR.
[0030] 3. The anemia screening kit and method for CRISPR / Cas9 targeted capture of long - fragment DNA, the captured region contains all mutation regions of existing thalassemia, with a high detection rate. For rare mutations, it has a good detection advantage and a low error rate. The consensus repeats formed by circular amplification can correct each other, improving the sequencing accuracy.
[0031] 4. The anemia screening kit and method for CRISPR / Cas9 targeted capture of long - fragment DNA, the detection rate of large - fragment structural variations is higher. Compared with the shorter read length of second - generation sequencing, this method can detect deletions of chromosomes > 20kb, with obvious sequencing advantages. The throughput is more flexible, and it can be sequenced on MinION, GridION Mk1, and PromethION P24 sequencers, realizing flexible sequencing with variable throughput from low to high, and can shorten the detection time to within 24 hours. BRIEF DESCRIPTION OF THE DRAWINGS
[0032] To more clearly illustrate the technical solutions in the embodiments of the present application, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the following drawings are only some embodiments of the present application. For those skilled in the art, without creative efforts, other drawings can be obtained based on these drawings.
[0033] Figure 1 FIG. shows a schematic diagram of the position of the sgRNA capture region proposed in the embodiment of the present application;
[0034] Figure 2 Shows a schematic diagram of the preparation process of the kit proposed in the embodiments of the present application;
[0035] Figure 3 Shows a schematic diagram of the target DNA sequence proposed in the embodiments of the present application;
[0036] Figure 4 Shows a schematic diagram of the Index sequence proposed in the embodiments of the present application;
[0037] Figure 5 Shows a schematic diagram of thalassemia-related mutations proposed in the embodiments of the present application;
[0038] Figure 6 Shows a schematic diagram of the genotype comparison result of thalassemia samples proposed in the embodiments of the present application. Detailed implementation manners
[0039] Next, the technical solutions in the embodiments of the present application will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present application. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without making creative efforts belong to the scope of protection of the present application.
[0040] The present invention provides a technical solution: an anemia screening kit for targeted capture of long fragment DNA based on CRISPR and CAS9, including sgRNA for targeted capture of thalassemia-related genes, Y-shaped adapters for circular amplification, and primers for circular amplification;
[0041] The targeted capture range of the sgRNA is: chr11:5166361-5296578 (hg38), chr16:48994-210817 (hg38), and the capture region of the sgRNA is as follows Figure 1 , and the sgRNA sequence is: UAAUACGACUCACUAUAGGGNNNNNNNNNNNNNNNNNNNNGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU.
[0042] The Y-shaped adapter sequence is: Y-shaped universal adapter sequence: ACAATTTGCACGAT-ATGCTTAGACACCT
[0043] CCGATTACG[index]TTCG-TACGAATCTGTGG.
[0044] The primer sequences are: F: ACAATTTGCACGATATGCTTAGACACCT
[0045] R: CCACAGATTCGTA[index]CGTAATCGG.
[0046] A kit for detecting 5 types of thalassemia, namely α, β, δ, δβ, and εγδβ, and its preparation steps are as follows Figure 2 :
[0047] The extracted DNA is dephosphorylated at the DNA ends under the action of a fast-acting phosphorylase;
[0048] After assembling the Cas9 enzyme cleavage complex, it is mixed with the DNA, and the target is cleaved under the guidance of the guide RNA;
[0049] Add a phosphorylated Y-shaped linker, and T4 ligase catalyzes the ligation of the linker to the target fragment. Since the 5' end of the non-target fragment has been dephosphorylated, it cannot ligate to the linker;
[0050] After ligating the linker, use an exonuclease to hydrolyze the remaining non-target fragments;
[0051] Add a single-stranded circularization enzyme to circularize the Y-shaped linker;
[0052] After circularization, rolling circle replication is performed to obtain a tandem repeat sequence, which can be used for nanopore sequencing.
[0053] The sgRNA target cleavage site can target and capture, but is limited to, thalassemia mutation-related regions of OR52Z1, OR51V1, HBB, HBD, HBBP1, BGLT3 (HS-40), HBG1, HBG2, HBE1, OR51AB1P, POLR3K, SNRNP25, RHBDF1, MPG, NPRL3, HBZ, LOC107983982, HBZP1, HBM, HBAP1, HBA2, HBA1, HBQ1, LUC7L, including any type of mutation within the regions of chr11:5167971-5295261 (hg38) and chr16:48994-210817 (hg38). Referring to the LOVD China, HbVar, Ithanet, and LOVD thalassemia databases, the thalassemia-related mutations are as follows Figure 5 , among which, at least 359 pathogenic α-thalassemia mutations, 451 pathogenic β-thalassemia mutations, 60 pathogenic δ-thalassemia mutations, and 38 pathogenic δβ-thalassemia mutations can be detected at least.
[0054] Anemia screening kit for CRISPR and CAS9 targeted capture of long fragment DNA, including the following screening methods: preparing a subject sample; using the CRISPR and CAS9 targeted capture system to capture the fragments of chr11:5166361-5296578 (hg38) and chr16:48994-210817 (hg38); constructing a long fragment sequencing library; sequencing and analyzing the gene mutation types of thalassemia.
[0055] The specific screening steps are as follows:
[0056] Sequence design of sgDNA: Select the region related to thalassemia and use the CHOPCHOP tool to design sgRNA;
[0057] Use the NEB rapid dephosphorylation kit to dephosphorylate DNA. Prepare the reagents according to the following table. After incubating at 37°C for 10 minutes, incubate at 80°C for 2 minutes to terminate the reaction;
[0058]
[0059] Assembly of the CRISPR and CAS9-sgRNA complex, mix thoroughly and centrifuge in a microcentrifuge, incubate at 37°C for 15 minutes, add 1 μl of proteinase K to each sample and incubate at room temperature for 10 minutes;
[0060]
[0061] Add 10 μl of DNA, 1 μL of 10 mM dATP and 2 μL of Taq DNA polymerase, incubate at 37°C for 15 minutes, digest with Cas9 enzyme, then incubate at 72°C for 5 minutes, and add an A to the DNA end;
[0062] Adapter ligation, and the adapter ligation system is as follows in the table, incubate at 22°C for 10 minutes;
[0063]
[0064] Add 1 μl of exonuclease III, incubate at 37°C for 30 minutes, and then incubate at 70°C for 30 minutes to inactivate;
[0065] Add 30 μl of DNA enrichment magnetic beads, incubate at room temperature for 10 minutes, then place on a magnetic stand and let stand for 5 minutes. Discard the supernatant, add 100 μl of 80% ethanol, aspirate after 30 s, repeat once, then open the lid and air dry for 2 minutes. Add 24.5 μl of nuclease-free water, incubate for 2 minutes and then place on the magnetic stand. Wait until the liquid is clear, and wash out the supernatant into a new PCR tube;
[0066] Ligation of the adapter; Configure the cyclization system according to the following table, incubate at 60 °C for 1 hour, then inactivate the cyclase by incubating at 80 °C for 10 minutes. Then add 4.7 μl of 10X NEB restriction enzyme buffer and 1 μl each of exonuclease I and III, and then incubate at 37 °C for 30 minutes;
[0067]
[0068] Rolling circle amplification; Configure the rolling circle replication system according to the following table. Incubate the reaction system at 30 °C for 6 hours, then at 60 °C for 10 minutes, and then check the amplification by electrophoresis;
[0069]
[0070] Sequence the amplified product using nanopore.
[0071] The specific method for sequencing the amplified product using nanopore is as follows: Dilute each DNA sample to 1 ng / μl, and then configure the reaction system as follows. Then incubate at room temperature for 10 minutes, at 65 °C for 5 minutes, and on ice for 1 minute;
[0072]
[0073] Directly add the above reaction product to the following system, then incubate at room temperature for 10 minutes, at 65 °C for 5 minutes, and on ice for 1 minute;
[0074]
[0075] Prepare the AMII adapter protein ligation system according to the following system, incubate at room temperature for 15 min, then add AMPure XP magnetic beads to the sample tube at a ratio of 1:1, transfer the test tube to a magnetic rack, let it stand for 2 min, discard the supernatant, add 200 μl of SFB to resuspend and centrifuge, then add 15 μl of EB solution and incubate at room temperature for 2 min, then place it on the magnetic rack and let it stand for 2 min. Wait until the magnetic beads are attracted to the side close to the magnetic rack or the solution becomes clear, and carefully aspirate the supernatant. Finally, obtain the library and sequence it on MinION, GridION Mk1, and PromethION P24 sequencers.
[0076]
[0077] Example 1: Detection and verification of thalassemia gene mutations;
[0078] 1257 blood specimens diagnosed with thalassemia were collected from a certain region, including 302 healthy individuals, 589 with α-thalassemia, 337 with β-thalassemia, 22 with both α and β thalassemia mutations, 4 with δ-thalassemia, and 3 with δβ-thalassemia.
[0079] These samples with positive screening results were detected using this method;
[0080] At the same time, an α-thalassemia gene detection kit (Gap-PCR method) was used to detect 3 common deletion-type genes of α-thalassemia (-SEA, -α3.7, and -α4.2);
[0081] A non-deletion-type α-thalassemia gene mutation detection kit (PCR-reverse dot blot method) was used to detect 3 gene mutations of α-thalassemia (αCSα, αWSα, and αQSα);
[0082] A β-thalassemia gene detection kit (PCR-reverse dot blot method) was used to detect 17 common gene mutations of β-thalassemia (CD41-42, CD17, IVS-II-654, CD26CD71-72, IVS-I-1, -28, CD31, CD43, -29, CD27-28, CD14-15, -32, Int, IVS-I-5, -30, and Cap).
[0083] Clinical samples of δ-thalassemia were sequenced using next-generation sequencing to verify their mutations, and δβ-thalassemia was verified by the Gap-PCR method.
[0084] All known δβ-thalassemias are Gγ(Aγδβ)0 thalassemia deletions, and the common upstream primer for Gγ(Aγδβ)0 thalassemia deletion is: CCAGCCTCATGGTAGCAGAATC, and the downstream primer is: TGGTATCTGCAGCAGTTGCC.
[0085] The downstream primer for the normal control: GTGATTGTTGAGTTGCAAGATCG[1], and all experimental results are as Figure 6 . All detected α and β thalassemia mutations are completely consistent with this method. However, due to the limited detection range of the kit in the existing technology, which only covers 17 common gene mutations and the range is not that wide, 6 genotypes from genotype 58 - 63 were not detected. The detection results of δ and δβ thalassemia are consistent with the results of next-generation sequencing and Gap-PCR.
[0086] In the description of the present invention, it should be noted that the orientation or positional relationship indicated by the terms "center", "upper", "lower", "left", "right", "vertical", "horizontal", "inner", "outer", etc. is based on the orientation or positional relationship shown in the drawings. It is only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operated in a specific orientation, and therefore should not be construed as a limitation to the present invention; the terms "first", "second", "third" are only used for descriptive purposes and cannot be construed as indicating or implying relative importance. In addition, unless otherwise clearly defined and limited, the terms "installed", "connected", "connected" should be understood in a broad sense. For example, it can be a fixed connection, a detachable connection, or an integral connection; it can be a mechanical connection or an electrical connection; it can be directly connected or indirectly connected through an intermediate medium, and it can be the communication inside two elements. For those of ordinary skill in the art, the specific meanings of the above terms in the present invention can be understood according to specific circumstances. Moreover, the term "comprising", "including" or any other variation thereof is intended to cover a non-exclusive inclusion, so that a process, method, article or device including a series of elements not only includes those elements, but also includes other elements not expressly listed, or further includes elements inherent to such process, method, article or device.
[0087] Although the embodiments of the present invention have been shown and described, for those of ordinary skill in the art, it can be understood that various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principles and spirit of the present invention. The scope of the present invention is defined by the appended claims and their equivalents.
Claims
1. Anemia screening kit for CRISPR and Cas9 targeted capture of long fragment DNA, characterized in that: It includes an sgRNA for targeted capture of thalassemia-related genes, a Y-type linker for circular amplification, and primers for circular amplification; The targeting capture range of the sgRNA is: chr11: 5166361, 5175819, 5186463, 5196184, 5206473, 5215665, 5225592, 5236423, 5245970, 5255973, 5266872, 5272953, 5296578 hg38, chr16: 47526, 67922, 84334, 93483, 102737 (-), 113267, 124165, 134569, 144989, 154472, 165538, 175647, 185449, 187269, 212316 hg38. The sgRNA sequence is: UAAUACGACUCACUAUAGGGNNNNNNNNNNNNNNNNNNNNGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCU; The Y-type linker sequence is: Y-type universal linker sequence: ACAATTTGCACGAT ATGCTTAGACACCT CCGATTACG[index]TTCG TACGAATCTGTGG; The primer sequences are: F: ACAATTTGCACGATATGCTTAGACACCT, R: CCACAGATTCGTA[index]CGTAATCGG; The sgRNA target cleavage sites can target and capture, but are limited to, the thalassemia mutation-related regions of OR52Z1, OR51V1, HBB, HBD, HBBP1, BGLT3HS-40, HBG1, HBG2, HBE1, OR51AB1P, POLR3K, SNRNP25, RHBDF1, MPG, NPRL3, HBZ, LOC107983982, HBZP1, HBM, HBAP1, HBA2, HBA1, HBQ1, LUC7L, including any type of mutation within the regions of chr11: 5166361, 5175819, 5186463, 5196184, 5206473, 5215665, 5225592, 5236423, 5245970, 5255973, 5266872, 5272953, 5296578 hg38 and chr16: 47526, 67922, 84334, 93483, 102737 (-), 113267, 124165, 134569, 144989, 154472, 165538, 175647, 185449, 187269, 212316 hg38.
2. The anemia screening kit for CRISPR and Cas9 targeted capture of long fragment DNA according to claim 1, wherein, Including the following screening methods: preparing a subject sample; the capture range of the CRISPR, CAS9 target capture system is: chr11:5166361, 5175819, 5186463, 5196184, 5206473, 5215665, 5225592, 5236423, 5245970, 5255973, 5266872, 5272953, 5296578 hg38, chr16: 47526, 67922, 84334, 93483, 102737(-), 113267, 124165, 134569, 144989, 154472, 165538, 175647, 185449, 187269, 212316 hg38 sites; constructing a long-fragment sequencing library; sequencing and analyzing the types of thalassemia gene mutations.
3. The anemia screening kit for CRISPR and Cas9 targeted capture of long fragment DNA according to claim 1, wherein The specific screening steps are as follows: Sequence design of sgRNA: Select the thalassemia-related region and use the CHOPCHOP tool to design sgRNA; Dephosphorylate the DNA using the NEB Quick Dephosphorylation Kit, incubate at 37°C for 10 minutes, then incubate at 80°C for 2 minutes to terminate the reaction; Assembly of the CRISPR, CAS9-sgRNA complex, thoroughly mix and centrifuge in a microcentrifuge, incubate at 37°C for 15 minutes, add 1 μl of proteinase K to each sample and incubate at room temperature for 10 minutes; Add 10 ul of DNA, 1 µL of 10 mM dATP and 2 uL of Taq DNA polymerase, incubate at 37°C for 15 minutes, digest with Cas9, then incubate at 72°C for 5 minutes, and add an A to the DNA end. Ligation of the adapter. The adapter ligation system is as follows in the table. Incubate at 22 °C for 10 minutes. ; Add 1 μl of exonuclease III, incubate at 37 °C for 30 minutes, and then incubate at 70 °C for 30 minutes to inactivate. Add 30 μl of DNA enrichment magnetic beads, incubate at room temperature for 10 minutes, then place on a magnetic stand and let stand for 5 minutes. Discard the supernatant, add 100 μl of 80% ethanol, aspirate after 30 s, repeat once, then open the lid and air-dry for 2 minutes. Add 24.5 μl of nuclease-free water, incubate for 2 minutes and then place on the magnetic stand. Wait until the liquid is clear, and wash out the supernatant into a new PCR tube. Adapter circularization. Incubate at 60 °C for 1 hour, then incubate at 80 °C for 10 minutes to inactivate the circularization enzyme. Then add 4.7 μl of 10X NEB restriction enzyme buffer and 1 μl each of exonuclease I and III, and then incubate at 37 °C for 30 minutes. Rolling circle amplification. Incubate the reaction system at 30 °C for 6 hours, then incubate at 60 °C for 10 minutes, and then perform electrophoresis to check the amplification situation. Sequence the amplification product using nanopore.
4. The anemia screening kit for CRISPR and Cas9 targeted capture of long fragment DNA according to claim 3, characterized in that, The specific method for sequencing the amplification product using nanopore is as follows: Dilute each DNA sample to 1 ng / μl, prepare the reaction system, then incubate at room temperature for 10 minutes, incubate at 65 °C for 5 minutes, and incubate on ice for 1 minute. The reaction system is as follows: ; Directly add the above reaction product to the following system, then incubate at room temperature for 10 minutes, incubate at 65 °C for 5 minutes, and incubate on ice for 1 minute. The system is as follows: ; Prepare the AMII adaptor protein ligation system, incubate at room temperature for 15 min, then add AMPure XP magnetic beads to the sample tube at a ratio of 1:
1. Transfer the tube to a magnetic stand, let stand for 2 min, discard the supernatant, add 200 μl of SFB to resuspend and centrifuge, then add 15 μl of EB solution and incubate at room temperature for 2 min, then place on the magnetic stand and let stand for 2 min. Wait until the magnetic beads are attracted to the side close to the magnetic stand or the solution becomes clear, and carefully aspirate the supernatant. Finally, obtain the library and sequence it on a MinION, GridION Mk1, or PromethION P24 sequencer.
Citation Information
Patent Citations
Methods and reagents for enrichment of nucleic acid material for sequencing applications and other nucleic acid material interrogations
CN111868255A
Identification of genomic structural variants using long-read sequencing
WO2021072394A1