A method for constructing a semi-synthetic nanobody library and a nanobody library

Abstract

The application relates to the technical field of antibody library construction, in particular to a semi-synthetic nanobody library construction method and a nanobody library, the method comprising the following steps: taking cDNA of CDR1, CDR2 and CDR3 as templates to perform first amplification, so as to obtain base sequences of CDR1, CDR2 and CDR3 respectively; connecting nucleotide sequences of FR1, FR2, FR3 and FR4 with the base sequences of CDR1, CDR2 and CDR3, and performing second amplification to obtain a target gene fragment; connecting the target gene fragment with a first carrier to obtain a second carrier; and after culturing the second carrier, target carriers containing a nanobody library are obtained through screening, wherein the base sequence connection relationship of the target gene fragment comprises FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. The semi-synthetic nanobody library is constructed by connecting the antibody skeleton of FR1, FR2, FR3 and FR4 with the synthetic CDR region, the existing nanobody can be directly screened by using antigens, human nanobodies can be quickly obtained, and the cost and time are saved.

Description

Technical Field

[0001] This application relates to the field of antibody library construction technology, and in particular to a method for constructing a semi-synthetic nanobody library and a nanobody library. Background Technology

[0002] Specific immune response refers to the reaction in which a specific antigen stimulus allows the immune system to select corresponding T cell or B cell clones from its lymphocyte pool. The binding of lymphocytes to the corresponding antigen is highly specific. Diversity refers to the high heterogeneity of the T cell or B cell pool, representing the sum of numerous cell clones that specifically recognize antigens, endowing the body with the ability to recognize and react to a vast number of antigens in the surrounding environment. B cells produce a large number of immunoglobulin genes through rearrangement of the V, D, and J genes. High-frequency mutations and class switching in somatic cells can further increase antibody diversity. Each B lymphocyte expresses a functional heavy chain and light chain. Mature antibodies consist of two identical heavy chains and two identical light chains linked by disulfide bonds. The variable regions of the antibody heavy and light chains form an antigen-binding site, and each antibody contains two antigen recognition sites.

[0003] In contrast to traditional tetrameric antibodies, which consist of two heavy chains and two light chains, camelids possess a type of heavy-chain antibody—nanobodies—that consists of two chains. These are naturally occurring antibodies lacking the light chain, containing only a single heavy-chain variable region (VHH) and two conventional CH2 and CH3 regions, forming a scaffold protein of approximately 115 amino acids. Despite their smaller molecular weight, nanobodies retain the ability to specifically and with high affinity recognize antigens. Nanobodies can recognize almost all antigens recognized by traditional antibodies, such as protein ligands, hormones, small molecule drugs, and toxins. They also exhibit unique advantages in recognizing hidden epitopes that traditional antibodies cannot recognize due to structural limitations.

[0004] Compared to conventional antibodies, nanobodies have many unique advantages: (1) their molecular weight is approximately 15 kDa, which is much smaller than that of conventional antibodies (~150 kDa) and their Fab (~50 kDa) and single-chain antibodies (~25 kDa); (2) they are highly soluble, generally have higher thermal stability, and can be expressed in large quantities in bacterial hosts; (3) due to their high homology with the amino acid sequence of the human type 3 VH domain (VH3), they have a high degree of humanization and reduced reactivity in humans; (4) due to their small size and preference for concave epitopes, they can bind to sites that are difficult for conventional antibodies to bind to. Nanobodies are usually produced by camel immunization, then peripheral blood lymphocytes are isolated, the variable region of the antibody is amplified, and a phage display immune antibody library is constructed. Antibody libraries constructed by immunizing animals can obtain high-affinity antibodies because the antibody genes are derived from in vivo and have undergone antibody affinity maturation processes.

[0005] Immunization is a time-consuming process, and raising large animals requires expensive maintenance costs. Nanobodies can also be derived from unimmunized animals. Compared to immune libraries, natural libraries constructed from unimmunized B lymphocytes lack the in vivo affinity maturation process, resulting in relatively lower antibody affinity. Natural libraries, having not undergone immunization, can be used for screening various types of antigens, making them a rapid and economical antibody screening method. Summary of the Invention

[0006] This application provides a method for constructing a semi-synthetic nanobody library and a nanobody library to solve the technical problem that existing nanobodies need to be obtained through antigen immunization.

[0007] In a first aspect, this application provides a method for constructing a semi-synthetic nanobody library, the method comprising the following steps:

[0008] cDNAs of CDR1, CDR2, and CDR3 were obtained as templates, respectively;

[0009] The nucleotide sequences of FR1, FR2, FR3 and FR4 were obtained respectively;

[0010] Using the cDNA of CDR1, CDR2, and CDR3 as templates, the first amplification was performed to obtain the base sequences of CDR1, CDR2, and CDR3, respectively.

[0011] The nucleotide sequences of FR1, FR2, FR3 and FR4 are ligated with the base sequences of CDR1, CDR2 and CDR3, and a second amplification is performed to obtain the target gene fragment;

[0012] The target gene fragment is ligated to the first vector to obtain a second vector containing the target gene fragment;

[0013] The second vector is cultured to express the target gene fragment as a nanobody, and then screened to obtain a target vector containing a nanobody library, wherein the base sequence linkage relationship of the target gene fragment includes: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.

[0014] Optionally, the first primers used for the first amplification include: a first primer pair, a second primer pair, and a third primer pair; the first primer pair includes a first upstream primer F1 and a first downstream primer R1, used to amplify CDR1; the second primer pair includes a first upstream primer F2 and a first downstream primer R2, used to amplify CDR2; the third primer pair includes a first upstream primer F3 and a first downstream primer R3, used to amplify CDR3, and the base sequences of F1, R1, F2, R2, F3, and R3 are shown in SE.Q IDNO: 1-SEQ ID NO: 6, respectively.

[0015] Optionally, the nucleotide sequences of FR1, FR2, FR3 and FR4 are shown in SEQ ID NO:7-SEQ ID NO:10, respectively.

[0016] Optionally, the corresponding amino acid sequences of FR1, FR2, FR3 and FR4 are shown in SEQ ID NO: 11-SEQ ID NO: 14, respectively.

[0017] Optionally, the primers used for the second amplification include: a third primer pair and / or a fourth primer pair.

[0018] Optionally, the third primer pair includes F4 and NNNR1, the base sequences of which are shown in SEQ ID NO: 15-SEQ ID NO: 16 respectively.

[0019] Optionally, the fourth primer pair includes F4' and NNNR2, the base sequences of which are shown in SEQ ID NO: 17-SEQ ID NO: 18.

[0020] Optionally, the initial vector may include a bacteriophage.

[0021] Optionally, the target vector is preserved in the host bacteria.

[0022] In a second aspect, this application provides a nanobody library obtained by the method described in the first aspect, the nanobody library comprising a variety of high-affinity human nanobodies.

[0023] The technical solutions provided in this application have the following advantages compared with the prior art:

[0024] The method provided in this application embodiment obtains the base sequences of CDR1, CDR2, and CDR3 after a first amplification; the nucleotide sequences of FR1, FR2, FR3, and FR4 are ligated to the base sequences of CDR1, CDR2, and CDR3, and a second amplification is performed to obtain a target gene fragment; the target gene fragment is ligated to an initial vector to obtain a target vector containing a nanobody library, wherein the nanobodies in the nanobody library are expressed from the target gene fragment, and the base sequence linkage relationship of the target gene fragment includes:

[0025] FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4. A semi-synthetic nanobody library is constructed using the antibody backbones of FR1, FR2, FR3, and FR4 and the synthetic CDR regions. This avoids the need for antigen immunization to obtain existing nanobodies; instead, antigens can be directly screened within the nanobody library, allowing for rapid acquisition of highly affinity human nanobodies, saving cost and time, and improving efficiency. Attached Figure Description

[0026] The accompanying drawings, which are incorporated in and form part of this specification, illustrate embodiments consistent with the invention and, together with the description, serve to explain the principles of the invention.

[0027] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, for those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0028] Figure 1 A schematic flowchart illustrating a method for constructing a semi-synthetic nanobody library, provided in an embodiment of this application;

[0029] Figure 2 This is an agarose gel electrophoresis image obtained from the amplification of the CDR1 region of the antibody gene provided in the embodiments of this application;

[0030] Figure 3 This is an agarose gel electrophoresis image obtained from the amplification of the CDR2 region of the antibody gene provided in the embodiments of this application;

[0031] Figure 4 This is an agarose gel electrophoresis image obtained from the amplification of the CDR3 region of the antibody gene provided in the embodiments of this application;

[0032] Figure 5 Agarose gel electrophoresis image obtained from the amplification of antibody gene CDR3 by 12 bp extension provided in the embodiments of this application;

[0033] Figure 6 The human nanobody splicing FR1-CDR1-FR2-CDR2-FR3 provided in the embodiments of this application

[0034] Agarose gel electrophoresis image obtained from the base sequence of -CDR3-FR4;

[0035] Figure 7 The following are examples of E. coli cultures containing bacteriophages at different dilutions provided in this application.

[0036] Figure 8The diagram shows that phages containing human nanobodies, after screening for different antigens, can recognize the corresponding antigens in the embodiments of this application. Detailed Implementation

[0037] To make the objectives, technical solutions, and advantages of the embodiments of this application clearer, the technical solutions of the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of this application, not all embodiments. Based on the embodiments of this application, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this application.

[0038] Throughout this specification, unless otherwise specified, the terminology used herein should be understood to have the meaning commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. In case of any conflict, this specification shall prevail. The technical terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the scope of protection of this invention. For example, room temperature may refer to a temperature in the range of 10–35°C.

[0039] Unless otherwise specified, all raw materials, reagents, instruments and equipment used in this invention can be purchased from the market or prepared by existing methods.

[0040] The technical solution of this application embodiment is to solve the above-mentioned technical problems, and the general idea is as follows:

[0041] According to a typical embodiment of the present invention, a method for constructing a semi-synthetic nanobody library is provided, such as... Figure 1 As shown, the method includes the following steps:

[0042] S1. Use the cDNA of CDR1, CDR2 and CDR3 as templates, respectively;

[0043] S2. Obtain the nucleotide sequences of FR1, FR2, FR3 and FR4 respectively;

[0044] S3. Using the cDNA of CDR1, CDR2, and CDR3 as templates, the first amplification was performed to obtain the base sequences of CDR1, CDR2, and CDR3, respectively.

[0045] S4. The nucleotide sequences of FR1, FR2, FR3 and FR4 are linked with the base sequences of CDR1, CDR2 and CDR3, and a second amplification is performed to obtain the target gene fragment;

[0046] S5. The target gene fragment is ligated to the first vector to obtain a second vector containing the target gene fragment;

[0047] S6. The second vector is cultured to express the target gene fragment as a nanobody, and then screened to obtain a target vector containing a nanobody library, wherein the base sequence linkage relationship of the target gene fragment includes: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.

[0048] Specifically, screening includes, but is not limited to: screening-selection-detection, and antigen screening can be used.

[0049] In the method of this application embodiment, the order of the steps is not constant. As long as the raw materials for the corresponding operation are available, the steps of S1, S2, S3 and S4 can be S2, S1, S3 and S4, or S1, S3, S2 and S4. This is not an exhaustive list, but can be carried out according to this principle.

[0050] Overall, the target gene fragment of the antibody is entirely or partially derived from gene synthesis. The diversity of antibody genes is not limited by the number of lymphocytes, facilitating the construction of ultra-large-capacity antibody libraries for screening high-affinity antibodies. The CDR3 length of human antibody heavy chains is shorter than that of alpacas. By increasing the CDR3 length of human antibodies, semi-synthetic nanobody libraries can be constructed, with a capacity of approximately 1.88 x 10⁻⁶. 10 By transplanting three CDR3 regions from human antibodies and further lengthening the CDR3 regions, the diversity of the antibody library was increased, preserving the diversity of human genes and further enhancing the diversity of antibody sequences. Compared to the fully synthetic CDR3 approach, this approach produces shorter sequences, reducing the uncertainty caused by random codon combinations. For example, randomly combined sequences are more likely to contain new restriction enzyme sites, improving the stability of the antibodies in the nanobody library of this application.

[0051] In some embodiments, the first primers used for the first amplification include: a first primer pair, a second primer pair, and a third primer pair; the first primer pair includes a first upstream primer F1 and a first downstream primer R1 for amplifying CDR1; the second primer pair includes a first upstream primer F2 and a first downstream primer R2 for amplifying CDR2; the third primer pair includes a first upstream primer F3 and a first downstream primer R3 for amplifying CDR3, and the base sequences of F1, R1, F2, R2, F3, and R3 are shown sequentially as SE.Q ID NO: 1-SEQ ID NO: 6.

[0052] In some embodiments, the nucleotide sequences of FR1, FR2, FR3 and FR4 are shown in SEQ ID NO: 7-SEQ ID NO: 10, respectively.

[0053] In some embodiments, the corresponding amino acid sequences of FR1, FR2, FR3 and FR4 are shown in SEQ ID NO: 11-SEQ ID NO: 14, respectively.

[0054] Specifically, site-directed mutations were performed on key sites of the antibody gene to obtain a structurally stable antibody backbone, namely FR1, FR2, FR3, and FR4, which has high temperature resistance and good adaptability. Based on this antibody backbone, highly humanized nanobodies were obtained by transplanting the CDR region of a portion of the human antibody into E. coli.

[0055] In some embodiments, the primers used for the second amplification include a third primer pair and / or a fourth primer pair.

[0056] Specifically, each codon has the reverse sequence of each NNN codon, and each codon contains an "NNN" codon, such as alanine = GCT; cysteine ​​= TGC; aspartic acid = GAT; glutamic acid = GAA; phenylalanine = TTC; glycine = GGC; histidine = CAT; isoleucine = ATC; lysine = AAG; leucine = CTG; methionine = ATG; asparagine = AAC; proline = CCG; glutamine = CAG; arginine = CGT; serine = TCT; threonine = ACC; valine = GTG; tyrosine = TAC.

[0057] Therefore, using the fourth primer pair, i.e. the associated sequence of the third primer, can yield more amplification products.

[0058] In some embodiments, the third primer pair includes F4 and NNNR1, the base sequences of which are shown in SEQ ID NO: 15-SEQ ID NO: 16, respectively.

[0059] Specifically, the base sequence is as follows: F4: AGATCAGTGACACTGAGTCGTCGG;

[0060] NNR1: NNN(RC)TACGTGACTCGCAATGACATCGTATTTTTACGATGTCATT GCGAGTCACGTANNN;

[0061] In some embodiments, the fourth primer pair includes F4' and NNNR2, the base sequences of which are shown in SEQ ID NO: 17-SEQ ID NO: 18, respectively.

[0062] Specifically, the base sequence is as follows: F4':TACGATGTCATTGCGAGTCACGTA;

[0063] NNNR2: NNN(RC)CCGACGACTCAGTGTCACTGATCTTTTTAGATCAGTGACACTGAGTCGTCGGNNN;

[0064] The reason why the second amplification includes two amplifications is that the codon includes forward and reverse sequences. Amplification using the forward and reverse sequences respectively can yield a more comprehensive and richer product.

[0065] In some embodiments, the initial vector includes a bacteriophage.

[0066] Specifically, a bacteriophage is a virus that infects bacteria and also the genetic material that confers biological traits to the host bacteria. It is a commonly used tool in molecular biology research. Bacteriophages must parasitize within live bacteria and have strict host specificity, which depends on the molecular structure and complementarity of the bacteriophage's adsorption organs and the receptors on the surface of the recipient bacteria.

[0067] In some embodiments, the target vector is preserved in the host bacteria.

[0068] Specifically, the host bacteria include, but are not limited to, Escherichia coli.

[0069] The method of the present invention will now be described in detail with reference to embodiments, comparative examples and experimental data.

[0070] Example 1

[0071] This application provides a method for constructing a semi-synthetic nanobody library, such as... Figure 1 As shown, the method includes the following steps:

[0072] S1. Use the cDNA of CDR1, CDR2 and CDR3 as templates, respectively;

[0073] S2. Obtain the nucleotide sequences of FR1, FR2, FR3 and FR4 respectively;

[0074] S3. Using the cDNA of CDR1, CDR2, and CDR3 as templates, the first amplification was performed to obtain the base sequences of CDR1, CDR2, and CDR3, respectively.

[0075] S4. The nucleotide sequences of FR1, FR2, FR3 and FR4 are linked with the base sequences of CDR1, CDR2 and CDR3, and a second amplification is performed to obtain the target gene fragment;

[0076] S5. The target gene fragment is ligated to the first vector to obtain a second vector containing the target gene fragment;

[0077] S6. The second vector is cultured to express the target gene fragment as a nanobody, and then screened to obtain a target vector containing a nanobody library, wherein the base sequence linkage relationship of the target gene fragment includes: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.

[0078] Specifically as follows:

[0079] 1) Amplify the fragments of CDR1, CDR2 and CDR3 and ligate them to obtain the target gene fragment.

[0080] The natural human antibody library CDR1 (preserved in our laboratory) was amplified using primers F1 / R1 to obtain fragment 1 (e.g. Figure 2 Fragment 2 (approximately 150bp in size) was amplified from the natural human antibody library CDR2 using primers F2 / R2 to obtain fragment 2. Figure 3 (Approximately 200bp in size), the natural human antibody library CDR3 was amplified using primers F3 / R3 to obtain fragment 3 (e.g., ...). Figure 4 (Approximately 150bp in size)

[0081] The amplification system used for CDR1, CDR2, and CDR3 was as follows: 0.5 μL template, 0.5 μL each primer, 5 μL Taq polymerase 10x buffer, 4 μL DNTP, 0.5 μL PFU, and water to a final volume of 50 μL. The reaction conditions were 94℃ for 30 s, 54℃ for 30 s, and 72℃ for 30 s for 25 cycles. The PCR products were analyzed by 2% agarose gel electrophoresis, and the target fragment was excised and recovered using a Tiangen gel recovery column.

[0082] The specific sequence contents of CDR1, CDR2 and CDR3 are shown in the table below, and there are 6 groups.

[0083]

[0084] Fragment 3 was digested with mlyi enzyme, and the digestion product was recovered using a Tiangen recovery kit. 10 pmol of NNNR1 was then mixed with the product (A = 3%, D = 6%, E = 3%, F = 3%, G = 15%, H = 2%, I = 3%, K = 3%, L = 4%, N = 3%, P = 3%, Q = 3%).

[0085] (R=6%, S=15%, T=3%, V=3%, W=4%, Y=18%) was ligated to fragment 3 digested with 3.3 pmol of enzyme in a reaction volume of 20 μl. The ligation product was diluted 1000 times and amplified by PCR using primers F4 / R3 and 100 μl of high-fidelity polymerase (Pfu). The PCR product was recovered using the Tiangen DNA purification kit. The obtained DNA was resuspended in 30 μl of water, and 25 μl of the product was digested with 10 units of rapid digestion MlyI in a 50 μl reaction volume, followed by heat inactivation.

[0086] Then, the process is repeated using the next set of primers (the primers used in the next cycle are similar to the NNNR2 and F4' primer pairs, i.e., the sequence NNNR3 primer and F5, the sequence of NNNR3 is NNN(RC)AGATGGACTCCCTAAGTGCC TGTTTTTTAACAGGCACTTAGGGAGTCCATCTNNN; the base sequence of F5 is TAACAGG CACTTAGGGAGTCCATCT), except that in the ligation phase, 5 μl of mlyi restriction DNA (estimated to be 3.3 pmol of DNA) from the previous cycle replaces the previous receptor. This process continues with splicing, adding 4 amino acids of a certain length (e.g., ...). Figure 5 (Approximately 150bp in size), then connect the four added segments of different lengths to segment 1 and segment 2 respectively (e.g., ...). Figure 6 The target fragment (approximately 400 bp in size) was amplified by PCR using 100 μl of high-fidelity polymerase (Pfu). The PCR product was analyzed by 2% agarose gel electrophoresis, and the target fragment was excised and recovered using a Tiangen gel recovery column for later use.

[0087] 2) The pCANTAB5E vector and the target antibody gene were digested with SfiⅠ and NotⅠ double enzymes.

[0088] The amplified product of the target gene fragment obtained above was digested with 1.5% agarose gel, and the target fragment was recovered using the Tiangen DNA recovery kit. After aliquoting, it was stored at -20℃ for later use. The reaction system was prepared by ligating the antibody gene into the enzyme-digested pCANTAB5E vector. The ligation system was prepared as follows: 1.5 μg vector, 0.5 μg antibody, 2 μL T4 ligase, 10 μL 10x buffer, and water to a final volume of 100 μL. Ligation was performed overnight at 16℃ on a PCR instrument.

[0089] TG1 was streaked onto a Minimal culture plate and incubated overnight at 37°C; a single TG1 colony was inoculated into 5 mL of 2YT culture medium and incubated overnight at 37°C with shaking; the next day, 5 mL of the inoculated overnight culture was added to 300 mL of 2YT culture medium and incubated with shaking until the OD600 reached 0.4-0.5. After incubating the bacterial culture on ice for 30 min, centrifuge at 4000g for 15 min at 4°C in a pre-chilled centrifuge. Gently resuspend the precipitate in 300 mL of pre-chilled sterile deionized water in ice water until the cells are completely and uniformly dispersed in the water. Centrifuge at 4000g for 15 min at 4°C in a pre-chilled centrifuge. Resuspend the cells twice as described above, using 150 mL of pre-chilled sterile deionized water and 30 mL of pre-chilled 10% glycerol (prepared with sterile deionized water). Finally, resuspend the cells in 1 mL of pre-chilled 10% glycerol and use immediately on ice or aliquot. Store at -80°C for later use. Add 5 μL of ligation product to 100 μL of competent cells, pre-chill on ice, and transfer to a pre-chilled electroporation cuvette. Adjust the electroporator voltage to 2.5 kV and the electroporation time to 5 ms. After electroporation, quickly add 0.9 mL of ligation product. Incubate in 2YT medium at 37°C with shaking for 2 hours; take 10 μL of serially diluted solution and spread it on SOBAG plates, calculate the volume of the culture, spread the remaining bacterial solution on 10 SOBAG plates, and incubate overnight at 37°C.

[0090] Colony counts were performed on serially diluted samples to calculate the volume of the constructed antibody library. Twenty clones were randomly selected from SOBAG plates, and colony PCR was used to detect the efficiency of antibody gene insertion into the vector. The 20 randomly selected clones were then sent for sequencing analysis to detect the antibody library volume, the integrity of the antibody genes, and their diversity.

[0091] Example 2: Rescuing bacteriophage surface-displaying nanobody library

[0092] The nanobody library constructed in Example 1 was preserved in host bacteria in the form of phage particles. Before the panning process began, the library should be rescued to become a phage-displayed nanobody library. The specific method is as follows:

[0093] 1.5 mL of the antibody library with the E-tag was inoculated into 300 mL of 2YT-AG medium and incubated until OD500 was reached. 600nm Approximately 0.3-0.4; incubate at 37℃ with shaking for approximately 1.5 hours until OD reaches [value missing]. 600nm＝0.5-0.6; Add helper phage (M13K07) at a bacteria:phage ratio of 1:5, and incubate at 37°C with shaking for approximately 1 hour; centrifuge at 4000 rpm for 15 minutes at 15°C, and remove the medium; resuspend the bacteria in 200 mL of 2YT-AK medium (100 μg / mL Amp, 50 μg / mL Kan), and incubate at 37°C for 2 hours; centrifuge at 10000 rpm for 20 minutes to remove the precipitate; add 40 mL of PEG / NaCl to the supernatant to precipitate the phage, and incubate overnight on ice; centrifuge at 10000 rpm for 20 minutes, and remove the supernatant; resuspend the phage in 0.6 mL of 2YT medium and store at 4°C. For large-scale phage preparation, after replacing the medium with Kan-resistant medium, extend the incubation time from two hours to overnight. The obtained phages are serially diluted, used to infect TG1 bacteria, plated on SOBAG plates, and the phage display antibody library capacity is calculated by colony counting. Amp is an abbreviation for adenosine monophosphate, also known as adenosine monophosphate or adenosine monophosphate. Kan represents kanamycin.

[0094] Nanobody library volume determination: After electroporation, *E. coli* was revived for one hour, and 20 μL was then serially diluted into 180 μL of 2YT medium to obtain 10 nanobody libraries. -2 10 -3 10 -4 10 -5 10 -6 10 -7 10 -8 Several dilution concentrations, where 5, 6, 7, and 8 in the figure below correspond to 10⁻⁶. -5 10 -6 10 -7 10 -8 Several dilution levels. From Figure 7 It can be seen that the number of bacteria in 1 ml of bacterial solution is approximately 4.0 x 10⁻⁶. 8 Therefore, the entire reservoir was rotated 47 times, resulting in a reservoir capacity of approximately 1.88 x 10⁻⁶. 10 .

[0095] Example 3 Antibody Screening

[0096] 1) Antibodies were panned from the phage-displayed nanobody library obtained in Example 2 using His Bind Resin to bind antigen proteins. The specific process is as follows: Activate His Bind Resin: Take 200 μL of His Bind Resin into a 1.5 mL centrifuge tube, centrifuge at 1000g for 1 min, and remove the storage solution; add 200 μL of ddH2O to wash the resin once, centrifuge at 1000g for 1 min, remove the supernatant, and repeat this step once; add 200 μL of ionization buffer, resuspend the resin, let stand for 10 min, centrifuge and remove the supernatant; add 200 μL of binding buffer, resuspend the resin, and let stand for 10 min; take 40 μL of resin and add it into a 1.5 mL centrifuge tube, centrifuge and remove the supernatant.

[0097] 2) Screening for nanobodies that identify the target protein

[0098] Take 35 μL (about 10 μg) of purified PG1 protein, add it to 165 μL of PBS, mix well, and then add it to an EP tube containing activated resin. Mix by rotation for 1 hour, centrifuge at 1000g for 1 minute, and remove the supernatant. Add 200 μL of wash buffer, resuspend the resin, centrifuge at 1000g for 1 minute, and remove the supernatant. Repeat this step once. Take 300 μL of the rescued phage display antibody library solution, add 0.3 μL of Triton X-100, and gently mix with a micropipette; add 40 μL of unactivated resin, and gently rotate for 1 h; centrifuge at 1000g for 1 min, collect the supernatant, add 40 μL of resin coated with antigen protein, and gently rotate for 2 h; centrifuge at 1000g for 1 min, and remove the supernatant; add 500 μL of wash buffer (containing 0.1% Triton X-100), resuspend the resin, gently vortex and wash for 5 min, centrifuge at 1000g for 1 min, and remove the supernatant. Repeat this step 5 times; add 500 μL of wash buffer (containing 0.1% Triton X-100)... Tween-20), resuspend the resin, gently vortex and rinse for 5 min, centrifuge at 1000g for 1 min, remove the supernatant, repeat this step 5 times; after the last rinse, transfer the resin to a new EP tube, centrifuge at 1000g for 1 min, remove the supernatant; add 200 μL of elution buffer, gently rotate and elute for 20 min; centrifuge at 1000g for 1 min, take the supernatant, add it to 5 mL of TG1 bacterial culture, infect at 37℃ for 1 h; spread the infected bacterial culture on SOBAG plates, incubate upside down at 30℃ overnight; the next day, scrape the colonies on the plate with 2YT-AG medium and rescue them into bacteriophages for the next round of panning.

[0099] 3) Phage testing after selection

[0100] After the third round of screening, the bacteria were infected with TG1. One hour after recovery, 10 μL of bacteria were inoculated into 1 ml of 2YT-AG medium. M13K07 was added, and the medium was replaced with 2YT-AK medium. The culture was incubated overnight at 37°C. After incubation at 10,000 rpm for 10 min, the supernatant was collected and used for the antigen protein. The plate was then coated overnight at 4°C. After discarding the coating solution, the plate was washed three times with PBS and blocked with 4% PBSM (PBS containing 4% skim milk) for 1 h. After washing once with PBS, 50 μL of phage culture supernatant and 50 μL of 4% PBSM were added to each well, and the plate was incubated at 37°C for 1 h. After washing three times with PBS and PBST, 100 μL of anti-M13 / HRP conjugation solution (diluted 1:5000 with 4% PBSM) was added to each well, and the plate was incubated at 37°C for 1 h. After washing three times with PBST and PBS, 100 μL of TMB substrate solution was added, and the plate was incubated in the dark for 15 min. Finally, 25 μL of TMB substrate solution was added. The reaction was terminated with 2 mol / L H2SO4, and the OD was measured using an enzyme-linked immunosorbent assay (ELISA) reader. 450nm value.

[0101] The antibody library screening efficiency was tested by selecting 15 antigens. The antibody library obtained in Example 2 was screened, and the antibody library after screening by His Bind Resin binding antigen protein and purified PG1 protein was also used to screen 15 antigens. The 15 antigens are ACTB, EGFR, PD-L1, AFB1, cortisol, capsaicin, malachite green, PG1, PG2, PCT, IL-6, CG419MY, SEMA4d, MMP3-134Ay, and N. Among them, ACTB (cytoplasmic 1) is cytosolic actin 1; EGFR (epidermal growth factor receptor) is epidermal growth factor receptor; PD-L1 (programmed cell death ligand 1) is programmed cell death ligand 1; AFB1 (aflatoxin B1) is aflatoxin B1; PG1 (pepsinogen 1) is pepsinogen 1; PG2 (pepsinogen 2) is pepsinogen 2; PCT (procalcitonin) is procalcitonin; IL-6 (interleukin-6) is interleukin-6; and CG419MY (Lutropin-choriogonadotropic...) is... The mutations are: 419 site mutation of the human chorionic gonadotropin receptor (hCG receptor); SEMA4d (Semaphorin-4D); 3134Ay (Stromelysin-1) matrix metalloproteinase mutation; and N is the SARS-CoV-2 N protein antigen.

[0102] Antibody library validation: After three rounds of phage screening, helper phages were prepared according to Example 3, and the antigens were detected by ELISA. The results are as follows. Figure 8 As shown, all phages screened for antigens can recognize the corresponding antigens, yielding low-antigenic and high-affinity human nanobodies respectively. For example, the specific sequence of the high-affinity human nanobodies obtained from the MMP3-134Ay antigen is shown in SEQ ID NO: 19-37. The amino acid sequence in this nanobodies also has this linkage relationship: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.

[0103] Appendix Figure 2-8 Detailed explanation:

[0104] like Figure 2 The image shown is an agarose gel electrophoresis diagram obtained from the amplification of the CDR1 region of the antibody gene provided in Example 1, illustrating that the CDR1 gene fragment was obtained.

[0105] like Figure 3 The image shown is an agarose gel electrophoresis diagram obtained from the amplification of the CDR2 region of the antibody gene provided in Example 1, illustrating that the CDR2 gene fragment was obtained.

[0106] like Figure 4 The image shown is an agarose gel electrophoresis diagram obtained from the amplification of the CDR3 region of the antibody gene provided in Example 1, illustrating that the CDR3 gene fragment was obtained.

[0107] like Figure 5 The image shown is an agarose gel electrophoresis diagram of the amplified antibody gene CDR3 extended by 12 bp provided in Example 1, illustrating that a gene fragment of CDR3 extended by 12 bp was obtained.

[0108] like Figure 6 As shown, the target gene fragment FR1-CDR1-FR2-CDR2-FR3 provided in Example 1 is shown.

[0109] The agarose gel electrophoresis image obtained from the base sequence of -CDR3-FR4 shows that FR1-CDR1-FR2-

[0110] The base sequence of CDR2-FR3-CDR3-FR4.

[0111] like Figure 7 The figure shows the culture results of E. coli containing bacteriophages at different dilutions provided in Example 2; 5, 6, 7, and 8 in the figure correspond to 10 -5 10 -6 10 -7 10 -8 Several dilutions show that the number of bacteria in 1 ml of bacterial culture is approximately 4.0 x 10⁻⁶.8 Therefore, the entire reservoir was rotated 47 times, resulting in a reservoir capacity of approximately 1.88 x 10⁻⁶. 10 .

[0112] like Figure 8 The diagram shown illustrates that phages containing human nanobodies, after screening for different antigens as provided in Example 2, can recognize the corresponding antigens, demonstrating that different antigens can be directly screened for corresponding antibodies through a synthesized nanobodies library.

[0113] It should be noted that, in this document, relational terms such as "first" and "second" are used merely to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the terms "comprising," "including," or any other variations are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Without further limitations, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes said element.

[0114] The above description is merely a specific embodiment of the present invention, enabling those skilled in the art to understand or implement the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the present invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features claimed herein. sequence list <110> Wuhan Huamei Bioengineering Co., Ltd. <120> A method for constructing a semi-synthetic nanobody library and a nanobody library <130> G1WH2161604-1E2 <140> 202210447689.7 <141> 2022-04-22 <160> 37 <170> SIPOSequenceListing 1.0 <210> 1 <211> 47 <212> DNA <213> Artificial Sequence <400> 1 atgcggccca gccggccatg gccgaggtgc agctgctgga gagcggc 47 <210> 2 <211> 25 <212> DNA <213> Artificial Sequence <400> 2 cgggggcctg gcggaaccag ctcat 25 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <400> 3 atgagctggt tccgccaggc ccccg 25 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <400> 4 acagtagtac acggcggtgtcctcg 25 <210> 5 <211> 30 <212> DNA <213> Artificial Sequence <400> 5 gaggacaccg ccgtgtacta ctgtgctgca 30 <210> 6 <211> 51 <212> DNA <213> Artificial Sequence <400> 6 cgcacctgcg gccgcgctgc tcacggtcac ctgggtgccc tgaccccagt a 51 <210> 7 <211> 75 <212> DNA <213> Artificial Sequence <400> 7 60. gaggtgcagc tgctggagag cggcggcggc ctggtgcagc ccggcggcag cctgcgcctg agctgcgccg ccagc <210> 8 <211> 54 <212> DNA <213> Artificial Sequence <400> 8 atgagctggt tccgccaggc ccccggcaag gagcgtgagt tcgtgagcgc catc 54 <210> 9 <211> 114 <212> DNA <213> Artificial Sequence <400> 9 60. tactacgccg acagcgtga gggccgcttc accatcagcc gcgacaacag caagacacc ctgtacctgc agatgaacaa cctgcgcgcc gaggacaccg ccgtgtacta ctgt <210> 10 <211> 33 <212> DNA <213> Artificial Sequence <400> 10 tggggtcagg gcacccaggt gaccgtgagc agc <210> 11 <211> 114 <212> DNA <213> Artificial Sequence <400> 11 tactacgccg acagcgtgaa gggccgcttc accatcagcc gcgacaacag caagaacacc 60 ctgtacctgc agatgaacaa cctgcgcgcc gaggacaccg ccgtgtacta ctgt 114 <210> 12 <211> 18 <212> PRT <213> Artificial Sequence <400> 12 Met Ser Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Glu Val Ser 1 5 10 15 Ala Ile <210> 13 <211> 38 <212> PRT <213> Artificial Sequence <400> 13 Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn 1 5 10 15 Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp 20 25 30 Thr Ala Val Tyr Tyr Cys 35 <210> 14 <211> 11 <212> PRT <213> Artificial Sequence <400> 14 Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 1 5 10 <210> 15 <211> 55 <212> DNA <213> Artificial Sequence <400> 15 tacgtgactc gcaatgacat cgtattttta cgatgtcatt gcgagtcacg tannn 55 <210> 16 <211> twenty four <212> DNA <213> Artificial Sequence <400> 16 tacgatgtca ttgcgagtca cgta 24 <210> 17 <211> 55 <212> DNA <213> Artificial Sequence <400> 17 ccgacgactc agtgtcactg atctttttag atcagtgaca ctgagtcgtc ggnnn 55 <210> 18 <211> twenty four <212> DNA <213> Artificial Sequence <400> 18 agatcagtga cactgagtcg tcgg 24 <210> 19 <211> 121 <212> PRT <213> Artificial Sequence <400> 19 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Ile Phe Ser Ser Tyr 20 25 30 Val Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Ala Ile Ser Gly Gly Gly Lys Ser Thr Asp Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Gly Tyr Tyr Pro Tyr Gly Tyr Leu Tyr Tyr Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 20 <211> 117 <212> PRT <213> Artificial Sequence <400> 20 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ala His Tyr 20 25 30 Trp Met Tyr Trp Phe Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Tyr Ile Asn Val Glu Gly Arg Thr Tyr Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Ala Pro Asn Tyr Asn Tyr Pro Tyr Asp Tyr Trp Gly Gln Gly Thr Gln 100 105 110 Val Thr Val Ser Ser 115 <210> 21 <211> 122 <212> PRT <213> Artificial Sequence <400> 21 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Thr Ser Ser Ser Tyr 20 25 30 Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Ala Ile Asn Arg Ser Gly Ser Ser Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Asp Ser Tyr Tyr Arg Tyr Asn Ser Tyr Gly Tyr Asp Tyr Trp 100 105 110 Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 22 <211> 123 <212> PRT <213> Artificial Sequence <400> 22 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Thr Phe Ser Ser Tyr 20 25 30 Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Ala Ile Ser Trp Asp Gly Gly Ser Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Tyr Arg Ser Tyr Arg Arg Pro Ser Pro Tyr Arg Tyr Gly Tyr 100 105 110 Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 23 <211> 124 <212> PRT <213> Artificial Sequence <400> 23 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Thr Phe Ser Ser Tyr 20 25 30 Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Ala Ile Asn Ser Ser Gly Ser Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Tyr Tyr Ser Tyr Arg Tyr Arg Pro Asp Leu Tyr Ser Tyr Gly 100 105 110 Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 24 <211> 121 <212> PRT <213> Artificial Sequence(Artificial Sequence) <400> 24 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr Thr Phe Ser Ser Asn 20 25 30 Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Ala Ile Asn Arg Ser Gly Ser Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Asn Tyr Tyr Tyr Gly Tyr Ser Asn Arg Tyr Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 25 <211> 122 <212> PRT <213> Artificial Sequence(Artificial Sequence) <400> 25 Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Ala Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Val Ala Ser Gly Arg Ile Phe Ser Ile Arg 20 25 30 Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Ala Ile Ser Arg Gly Ser Ser Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Arg Leu Arg Leu Arg Tyr Tyr Arg Leu Arg Tyr Gly Tyr Trp 100 105 110 Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 26 <211> 118 <212> PRT <213> Artificial Sequence <400> 26 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ala Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Thr Leu Ser Cys Ala Val Ser Gly Leu Arg Phe Asp Tyr Tyr 20 25 30 Ala Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Gly Arg Glu Gly Val 35 40 45 Ser Tyr Ile Ser Ser Ser Gly Arg Thr Thr Asn Ser Arg Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Arg Leu Ala Gly Ala Arg Tyr Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Gln Val Thr Val Ser Ser 115 <210> 27 <211> 118[[ID=4⑨]] <212> PRT <213> Artificial Sequence <400> 27 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr Thr Phe Ser Ser Asn 20 25 30 Val Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Asp Ile Leu Ser Gly Ser Gly Asp Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Ser Ser Gly Arg Leu Pro Tyr Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Gln Val Thr Val Ser Ser 115 <210> 28 <211> 120 <212> PRT <213> Artificial Sequence <400> 28 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Arg Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn Tyr 20 25 30 Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Pro Glu Trp Val 35 40 45 Ser Thr Ile Gly Gly Gly Ser Val Arg Tyr Ala Asp Ser Val Lys Gly 50 55 60 Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Asp Leu Gln 65 70 75 80 Met Thr Ser Leu Lys Pro Glu Asp Thr Ala Leu Tyr Tyr Cys His Ala 85 90 95 Leu Ala Arg Arg Thr Ala Leu Arg Asn Pro Asn Ala Tyr Trp Gly Gln 100 105 110 Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 29 <211> 121 <212> PRT <213> Artificial Sequence <400> 29 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Asp Phe Thr Phe Ser Tyr Tyr 20 25 30 Tyr Met Gly Trp Leu Arg Gln Ala Asp Gly Lys Glu Leu Glu Trp Val 35 40 45 Ser Asp Ile Ser Thr Asp Gly Ser Arg Val His Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Ser Tyr Asp Arg Leu Arg Arg Ala Tyr Tyr Gly Tyr Trp Gly 100 105 110 Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 30 <211> 116 <212> PRT <213> Artificial Sequence <400> 30 Gln Val Thr Leu Lys Glu Ser Gly Gly Gly Leu Val Gln Ser Gly Thr 1 5 10 15 Ser Leu Thr Leu Ser Cys Thr Ser Ser Gly Pro Arg Phe Asn Val Met 20 25 30 Gly Trp Phe Arg Gln Ala Pro Gly Lys Asp Arg Glu Phe Val Gly Met 35 40 45 Ile Pro Arg Ser Ala Tyr Lys Val Phe Tyr Ala Asp Ser Leu Lys Gly 50 55 60 Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr Leu Gln 65 70 75 80 Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala Ala 85 90 95 Gly Leu Ser Leu Asn Leu Tyr Asp Tyr Trp Gly Gln Gly Thr Gln Val 100 105 110 Thr Val Ser Ser 115 <210> 31 <211> 122 <212> PRT <213> Artificial Sequence <400> 31 Gln Val Gln Leu Val Gln Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Thr Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Asp Met Ser Trp Ala Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Ser Asn Ser Gly Lys Glu Val Asp Tyr Ala Asp Thr Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Ser Leu Tyr Pro Ser Tyr Ser Arg Tyr Asp Tyr Asp Tyr Trp 100 105 110 Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 32 <211> 121 <212> PRT <213> Artificial Sequence <400> 32 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val His Pro Gly Glu 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Thr Ser Gly Phe Thr Phe Asn Lys Tyr 20 25 30 Trp Met Tyr Trp Ala Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Ala Ile Asn Thr Gly Gly Gly Ser Thr Tyr Tyr Ala Asp Pro Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Ala Ala Tyr Ser Tyr Arg Arg Tyr Gly Tyr Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 33 <211> 123 <212> PRT <213> Artificial Sequence <400> 33 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Thr Phe Ser Ile Asn 20 25 30 Val Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Ala Arg Glu Leu Val 35 40 45 Ala Lys Ile Thr Gly Pro Pro Thr Arg Thr Asn Tyr Ala Glu Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Arg Asp Arg Tyr Gly Leu Tyr Tyr Arg Ala Tyr Tyr Asp Tyr 100 105 110 Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 34 <211> 121 <212> PRT <213> Artificial Sequence(Artificial Sequence) <400> 34 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Thr Ser Ser Ile Tyr 20 25 30 Val Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Ala Ile Ser Arg Ser Gly Ser Ile Ile Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Arg Gly Leu Asp Arg Ser Gly Asp Asp Tyr Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 35 <211> 118 <212> PRT <213> Artificial Sequence <400> 35 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Phe Ser Arg Asn 20 25 30 Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Ala Ile Ser Arg Ser Gly Gly Ser Ile Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Arg Ser Tyr Tyr Leu Arg Tyr Gly Tyr Trp Gly Gln Gly Thr 100 105 110 Gln Val Thr Val Ser Ser 115 <210> 36 <211> 121 <212> PRT <213> Artificial Sequence <400> 36 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr Thr Phe Ser Arg Tyr 20 25 30 Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Ala Ile Asn Ser Ser Gly Ser Ile Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Arg Tyr Arg Leu Tyr Arg Asp Tyr Pro Tyr Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 37 <21 (end) 121 <212> PRT <213> Artificial Sequence <400> 37 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Arg Thr Phe Ser Arg Tyr 20 25 30 Ala Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ala Ala Ile Ser Trp Ser Ser Ser Ile Ile Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Arg Tyr Arg Gly Arg Asp Ala Arg Ser Tyr Gly Tyr Trp Gly 100 105 110 Gln Gly Thr Gln Val Thr Val Ser Ser 115 120

Claims

1. A method for constructing a semi-synthetic nanobody library, characterized in that, The method comprises the following steps: The cDNAs of CDR1, CDR2 and CDR3 are obtained as templates respectively; The nucleotide sequences of FR1, FR2, FR3 and FR4 are obtained respectively; The base sequences of CDR1, CDR2 and CDR3 are obtained by performing first amplification with the cDNAs of CDR1, CDR2 and CDR3 as templates respectively; The nucleotide sequences of FR1, FR2, FR3 and FR4 are connected with the base sequences of CDR1, CDR2 and CDR3, and second amplification is performed to obtain a target gene fragment; The target gene fragment is connected with a first carrier to obtain a second carrier containing the target gene fragment; The second carrier is cultured to express the target gene fragment into a nanobody, and screening is performed to obtain a target carrier containing a nanobody library, wherein the base sequence connection relationship of the target gene fragment comprises FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4; The first primer for the first amplification comprises a first primer pair, a second primer pair and a third primer pair; the first primer pair comprises a first upstream primer F1 and a first downstream primer R1, and is used for amplifying CDR1; the second primer pair comprises a first upstream primer F2 and a first downstream primer R2, and is used for amplifying CDR2; the third primer pair comprises a first upstream primer F3 and a first downstream primer R3, and is used for amplifying CDR3, and the base sequences of F1, R1, F2, R2, F3 and R3 are sequentially shown in SEQ ID NO: 1-SEQ ID NO: 6; The nucleotide sequences of FR1, FR2, FR3 and FR4 are sequentially shown in SEQ ID NO: 7-SEQ ID NO: 10; The primer for the second amplification comprises a third primer pair and a fourth primer pair; The third primer pair comprises F4 and NNNR1, and the base sequences of F4 and NNNR1 are sequentially shown in SEQ ID NO: 15-SEQ ID NO: 16; The fourth primer pair comprises F4' and NNNR2, and the base sequences of F4' and NNNR2 are sequentially shown in SEQ ID NO: 17-SEQ ID NO:

18.

2. The method of claim 1, wherein, The first carrier comprises a bacteriophage.

3. The method of claim 1, wherein, The target carrier is stored in a host bacterium.

4. A library of nanobodies obtained by the method according to any one of claims 1 to 3, characterized in that, The nanobody library comprises a plurality of high-affinity human-derived nanobodies. The nanobody library comprises a plurality of high-affinity human-derived nanobodies.

Images