A PCR detection kit for the CTG region of myotonia dystrophy protein kinase gene and its application

By designing specific primer pairs and optimizing PCR amplification reactions, the difficulties in detecting the CTG repeat number of the myotonia dystrophy protein kinase gene in the existing technology have been solved, and efficient, accurate and low-cost detection of CTG repeat number has been achieved, especially for repeat numbers greater than 1000.

CN114790478BActive Publication Date: 2025-09-30SHANGHAI ANGPU BIOTECHNOLOGY CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202110103251.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-01-26
Publication Date
2025-09-30
Estimated Expiration
2041-01-26

AI Technical Summary

Technical Problem

Existing PCR amplification methods have problems such as difficulty in detection, high false negative rate, strong amplification bias, and high cost when detecting the number of CTG repeats in the myotonia dystrophy protein kinase gene, especially when the number of repeats is greater than 240. It is difficult to accurately detect the number of CTG repeats in large fragments.

Method used

Design specific primer pairs (such as SEQ ID NO: 1 and SEQ ID NO: 2) and optimize the PCR amplification reaction system (25 μL, containing 2× GC Buffer II, 2.5 mM dNTPs, 10 ng DNA sample, TaKaRa La Taq DNA polymerase, etc.), combined with a specific amplification procedure (94°C denaturation, 58°C annealing, 72°C extension) to achieve efficient amplification of the CTG region.

Benefits of technology

It achieves accurate detection of CTG regions with more than 1,000 repetitions, reduces the false negative rate, and the amplification results are intuitive, highly sensitive, and low-cost, making it suitable for a wide range of detection needs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0002916791000000041
    Figure BDA0002916791000000041
  • Figure BDA0002916791000000051
    Figure BDA0002916791000000051
  • Figure HDA0002916791010000011
    Figure HDA0002916791010000011
Patent Text Reader

Abstract

The present invention provides a PCR detection kit for the CTG region of the myotonia thoracis protein kinase gene, comprising a specific primer pair whose nucleotide sequences are shown as SEQ ID NO: 1 and SEQ ID NO: 2, respectively. The method has the characteristics of strong amplification specificity and low amplification preference. At the same time, it overcomes the technical difficulty of the existing method showing false negatives in the detection of some samples, and achieves the detection of more than 1,000 repeat variations. The present invention also provides an application of a PCR detection kit for the CTG region of the myotonia thoracis protein kinase gene. The PCR detection kit of the present invention can be used to amplify heterozygous allele samples carrying CTG repeat expansions, and can also be used to detect the number of CTG tribase repeats in the 3'-UTR of the myotonia thoracis protein kinase gene.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of PCR amplification, and in particular relates to a PCR detection kit for the CTG region of a myotonia dystrophy protein kinase gene and its application. Background Art

[0002] Myotonic dystrophy type 1 (DM1) is a hereditary disease characterized by muscle weakness, rigidity, and atrophy, accompanied by damage to other systems, including the endocrine system, heart, and eye lens. DM1 is currently known to be caused by a CTG tri-base repeat expansion in the 3'-UTR region of the DMPK gene, with the number of CTG repeats in the DMPK gene ranging from 5 to 5,000.

[0003] Numerous PCR amplification methods have been used to determine the number of CTG repeats in the DMPK gene, including triple-primer PCR (TP-PCR), heat pulse PCR (HPE-PCR), small-pool PCR (SP-PCR), and flash-small-pool PCR (FSP-PCR). These methods offer advantages over non-amplified southern blots and third-generation sequencing, such as reduced sample volume, reduced time consumption, and manageable costs. However, PCR amplification methods are influenced by factors such as primer structure, template binding strength, and target gene fragment size, resulting in significant variability in results. In the vast majority of cases, the CTG repeat number in the two DMPK alleles of DM1 patients is one large and one small. Most currently available primers exhibit a bias toward amplifying smaller fragments, making detection of larger fragments difficult.

[0004] Currently, TP-PCR is a relatively mature technology. However, it can only detect the exact number of CTG repeats within 240 times. For cases with a larger number of repeats (>240 repeats), it cannot accurately give the number of repeats (such as a set of primers and detection kits for detecting CTG repeat sequences disclosed in Chinese patent document 201410211499.0). In addition, in recent years, there have been reports (Musova Z, Mazanec R, Krepelova A, et al. Highly unstable sequence interruptions of the CTG repeat in the myotonic dystrophy gene [J]. 2009, 149A (7): 1365-1374.) that although the TP-PCR method has high sensitivity and specificity, it has about 5% false negative samples. Possible reasons include: 1) the presence of interfering sequences such as CCG / CTC and GGC in the repeat sequence; 2) mutations in the binding region of TP-PCR specific primers to certain samples; 3) certain accidental factors during the amplification process. Summary of the Invention

[0005] The present invention addresses the shortcomings of existing DM1 genetic diagnostic technologies and provides a PCR detection kit for the CTG region of the myotonia dystrophy protein kinase gene based on conventional PCR technology. This PCR detection kit has significant advantages for detecting the number of CTG repeats in the DMPK gene, overcoming the shortcomings of TP-PCR. It can amplify samples with a repeat count greater than 240 and can calculate the number of CTG repeats in the DMPK gene of these samples. This method also has the advantages of requiring a small sample size for detection, relatively low testing costs, intuitive and targeted test results, high sensitivity, high accuracy, and the ability to detect a greater number of repeat variations. To this end, a first object of the present invention is to provide a PCR detection kit for the CTG region of the myotonia dystrophy protein kinase gene. A second object of the present invention is to provide an application of the PCR detection kit for the CTG region of the myotonia dystrophy protein kinase gene. A third object of the present invention is to provide a PCR detection method for the CTG region of the myotonia dystrophy protein kinase gene for non-disease diagnosis purposes.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] As a first aspect of the present invention, a PCR detection kit for the CTG region of the myotonia dystrophy protein kinase gene comprises specific primers, wherein the nucleotide sequences of the specific primer pair are shown as SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

[0008] According to the present invention, the PCR detection kit also includes a reaction system, which is 25 μL and includes 5 μL of 2×GC Buffer II, 3 μL of 2.5 mM dNTP, 1 μL of 10 ng DNA sample, 0.5 μL of TaKaRa La Taq DNA polymerase, 1 μL of each 10 μM specific primer pair, and the balance is water.

[0009] According to the present invention, the PCR detection kit also includes an amplification program: denaturation at 94°C for 60s; entering the cycle, denaturation at 94°C for 30s, annealing at 58°C for 30s, extension at 72°C for 1.5min, for a total of 35 cycles; extension at 72°C for 10min, and maintaining the temperature at 4°C.

[0010] As a second object of the present invention, a PCR detection kit for the CTG region of the myotonia dystrophy protein kinase gene is used, wherein the PCR detection kit is used to detect the number of CTG tribase repeats in the CTG region of the myotonia dystrophy protein kinase gene.

[0011] As the third object of the present invention, a method for amplifying the CTG region of the myotonia dystrophy protein kinase gene comprises the following steps:

[0012] In the first step, PCR amplification is performed using the DNA of the sample to be tested as a template to obtain a PCR amplification product;

[0013] The second step is to observe the electrophoresis results of the amplified products. If double bands are present in the electrophoresis graph, it indicates that the PCR method can amplify both large and small fragments simultaneously.

[0014] The nucleotide sequences of the specific primer pair used for amplification are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

[0015] According to the present invention, the method further includes a third step of calculating the number of repetitions of CTG in the sample to be tested.

[0016] According to the present invention, the PCR amplification reaction system is 25 μL, including 5 μL of 2×GC Buffer II, 3 μL of 2.5 mM dNTP, 1 μL of 10 ng DNA sample, 0.5 μL of TaKaRa La Taq DNA polymerase, 1 μL of each 10 μM specific primer pair, and the balance is water.

[0017] According to the present invention, the amplification program of the PCR amplification is: denaturation at 94°C for 60s; entering the cycle, denaturation at 94°C for 30s, annealing at 58°C for 30s, extension at 72°C for 1.5min, for a total of 35 cycles; extension at 72°C for 10min, and maintaining the temperature at 4°C.

[0018] The beneficial effects of the present invention are as follows: the method has strong amplification specificity, low amplification preference, simple operation and low cost. At the same time, it overcomes the technical difficulty of the existing method showing false negatives in the detection of some samples, and realizes the detection of more than 1,000 repeated variations, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 The figure shows the comparison of amplification specificity of different primers in Example 1 of the present invention.

[0020] Figure 2 This is the TP-PCR result of sample P1 in Example 2.

[0021] Figure 3 This is the TP-PCR result of sample P2 in Example 2.

[0022] Figure 4 and Figure 5 This is the PCR amplification result of sample P1 in Example 2 using primer pair 1 in Example 1.

[0023] Figure 6 and Figure 7 This is the PCR amplification result of sample P2 in Example 2 using primer pair 1 in Example 1.

[0024] Figure 8 PCR product length diagram.

[0025] Figure 9 This is the reverse result of first-generation sequencing of sample P1.

[0026] Figure 10 This is the positive result of the first-generation sequencing of sample P2. DETAILED DESCRIPTION

[0027] The present invention will be further described below with reference to specific examples. It should be understood that the following examples are intended only to illustrate the present invention and are not intended to limit the scope of the present invention. Experimental methods in the following examples where specific conditions are not specified are generally performed under conventional conditions or conditions provided by the manufacturer. For example, the TP-PCR method in the following examples is described in the literature: Warner JP, Barron LH, Goudie D, et al. A general method for the detection of large CAG repeat expansions by fluorescent PCR. [J]. Journal of Medical Genetics, 1997, 33(12): 1022-1026.

[0028] Example 1 Design of specific primer pairs and comparison of amplification efficiency

[0029] The purpose of this example is to optimize specific primer pairs for amplification of the CTG repeat region of the 3'-UTR of the DMPK gene. To this end, the applicant designed two sets of specific primer pairs on both sides of the target gene based on the universal primer design principles and set the optimal PCR amplification reaction conditions. The target gene fragments amplified by the two sets of reactions were different in size. It was found that the use of a specific primer pair 1 for amplification of blood samples from patients suspected of DM1 was more effective.

[0030] (1) The nucleotide sequences of specific primer pair 1 are shown in SEQ ID NO: 1 and SEQ ID NO: 2. The target gene fragment amplified by this primer pair is approximately 660 bp in size. The reaction system and reaction conditions are shown in Tables 1 and 2, respectively.

[0031] TYB-DMKf4:TCGCGAATGCATCTAGATCAGTTTGCCCATCCACGTCAG, SEQ ID NO: 1;

[0032] TYB-DMKr4: ACGGGCCCGGGATCCGATCGTGCGAGTGGACTAACAACAG, SEQ ID NO: 2.

[0033] Table 1 Reaction system

[0034] Reagents Dosage 2×GC BufferⅡ 5μL 2.5mM dNTP 3μL 10ng DNA sample 1 μL 10 μM forward primer 1 μL 10 μM reverse primer 1 μL TaKaRa La Taq DNA Polymerase 0.5μL water Fill to 25 μL

[0035] Table 2 Reaction procedure

[0036]

[0037] (2) Specific primer pair 2, the nucleotide sequences of which are shown in SEQ ID NO: 3 and SEQ ID NO: 4, amplifies a target gene fragment of approximately 300 bp. The reaction system and reaction conditions are shown in Tables 3 and 4, respectively.

[0038] DMKf: 5'-GCCAGTTCACAACCGCTCCGAGCGTGGGTC-3', SEQ ID NO: 3;

[0039] DMKr: 5'-ACGCTCCCCAGAGCAGGGCGTCATGC-3', SEQ ID NO: 4.

[0040] Table 3 Reaction system

[0041] Reagents Dosage LongAmp Taq DNA Polymerase 1 μL 5x GC buffer 5μL 10mM dNTPs 0.75μL DNA samples 2ng 10 μM forward primer 1 μL 10 μM forward primer 1 μL water Fill to 25 μL

[0042] Table 4 Reaction procedure

[0043]

[0044] 3. PCR amplification results.

[0045] PCR amplification experiments were performed on 9 samples, numbered 1 to 9, using the two sets of primers mentioned above. The samples in this example were all blood samples from patients clinically diagnosed with suspected DM1. The sample DNA was extracted using a Blood Genomic DNA Mini Kit (brand: Fangkang Century, model: CW2087M). The PCR results were tested using agarose electrophoresis. The results are shown in Table 1. Figure 1 .

[0046] The results showed that when primer pair 1 was used for PCR, all samples showed two bands, and the negative reference showed no band. When primer pair 2 was used for PCR, the negative reference showed no band, but only samples 6, 7, and 9 showed two faint bands in the PCR results, while the remaining samples showed only one band. Comparing the PCR results of these two primer pairs shows that primer pair 1 produces better amplification results than primer pair 2.

[0047] Example 2: Amplification of some TP-PCR false-negative samples and verification of amplification results by first-generation sequencing

[0048] (1) Amplification of TP-PCR false negative samples

[0049] In this example, two samples (samples P1 and P2) from patients with a clinical diagnosis of DM1 were selected. The negative samples were tested using the TP-PCR method. Primer pair 1, the reaction system in Table 1, and the amplification program in Table 2 were used to amplify the CTG region of the myotonia dystrophy protein kinase gene. Both samples were blood DNA samples from DM1 patients. The amplification results are shown in Table 2. Figure 2-5 .

[0050] Figure 2 The results showed that one of the alleles contained 13 repeats of CTG, and the peak value of the other allele was too low to be detected.

[0051] Figure 3 The results showed that one of the alleles contained 5 repeats of CTG, and the peak value of the other allele was too low to be detected.

[0052] Figure 4 and Figure 5 The results showed that when PCR was performed using primer sequence 1, sample P1 had two bright bands on the gel electrophoresis plot. The positive sample also had two bright bands, the negative sample had only one band, and the blank sample had no band. Capillary electrophoresis determined that the number of CTG repeats in the larger allele of sample P1 was 458 ± 153.

[0053] Likewise, Figure 6 、 Figure 7 The results showed that the gel electrophoresis of sample P2 showed two bright bands, the positive sample also had two bright bands, the negative sample had only one band, and the blank sample had no bands. Using capillary electrophoresis, the number of CTG repeats of the larger allele in sample P2 was 1542 ± 407.

[0054] The calculation principle of the number of CTG repeats is as follows: the fragment size L1 is calculated based on the migration distance of the larger fragment, and the number of CTG repeats is further calculated (e.g. Figure 8 As shown in the figure: number of repetitions N = L3 / 3, L3 = L1-[L2+L4], L2+L4 = 626). Note that in capillary electrophoresis, the larger fragment has an area range, i.e., there is a migration distance a on the far left of the peak graph and a migration distance b on the right. Based on these migration distances, two fragment sizes, L1.1 and L1.2, can actually be derived. The final fragment size is (L1.1+L1.2) / 2±(L1.1-L1.2) / 2.

[0055] (2) First-generation sequencing verification

[0056] In order to further confirm that the larger bands in samples P1 and P2 amplified by the method in Example 2 are the target bands, first-generation sequencing was performed on them.

[0057] The reverse sequencing results of sample P1 are as follows Figure 9 shown.

[0058] The positive results of the first-generation sequencing of sample P2 are as follows Figure 10 shown.

[0059] Figure 9 and Figure 10 The results showed that there were CTG repeat sequences in the forward sequencing results, and the specific sequence at the 5' end was also consistent, so the larger fragment obtained by our method was the target band.

[0060] Based on the above experiments, we obtained the following results:

[0061] (1) For samples P1 and P2, the TP-PCR method has false negatives. Its amplification efficiency is extremely low for the larger repeated fragments in some samples, and only the smaller repeated fragments can be detected. Using the method of this embodiment, the amplification efficiency is better. The agarose gel electrophoresis results can show large fragments and small fragments. Through the determination of the number of CTG repeats, it can be detected that the number of repetitions of the large fragment of sample P1 is 458±153 times, and the number of repetitions of the large fragment of sample P2 is 1542±407 times.

[0062] (2) For sample P2, the method of the present invention has little preference; the agarose gel electrophoresis results can show large fragments and small fragments, and through the determination of the number of CTG repeats, it can be detected that the number of repetitions of the large fragment is 1542±407 times, which indicates that the PCR method of the present invention has exceeded 1000 times in determining the number of CTG repeats of the myotonia dystrophy protein kinase gene.

[0063] Conclusion: PCR amplification was performed according to the specific primer pair 1 of Example 1 and the PCR amplification conditions in Tables 2 and 3. This amplification method overcomes the problem of false negative results in some samples detected by existing methods, while maintaining the characteristics of low amplification bias, simple operation, and low cost. It can also detect mutations with more than 1000 repeats and has a wider range of applications.

[0064] In summary, the reaction system and amplification conditions designed by the present invention are used for PCR detection, which can simultaneously detect large and small fragments in the CTG region of the myotonic dystrophy protein kinase gene, with relatively low amplification preference and detection cost, intuitive test results, strong pertinence, high sensitivity, and high accuracy. At the same time, it overcomes the technical difficulties of the existing methods in showing false negatives for some sample detections, and achieves the detection of more than 1000 repeated variations. Therefore, the PCR amplification method of the present invention has good application prospects in the detection of the number of CTG tribase repeats in the myotonic dystrophy protein kinase gene (DMPK) of myotonic dystrophy type 1 (DM1). The specific primer pairs and reaction conditions can be further prepared into a PCR detection kit using methods known in the art, which is obvious to those skilled in the art.

[0065] The above description is merely an example of the implementation of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the technical principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention. Sequence Listing <110> Shanghai Angpu Biotechnology Co., Ltd. <120> A PCR detection kit for the CTG region of myotonia dystrophy protein kinase gene and its application <130> 211019 <141> 2021-01-26 <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 39 <212> DNA <213> Artificial Sequence <400> 1 tcgcgaatgc atctagatca gtttgcccat ccacgtcag 39 <210> 2 <211> 40 <212> DNA <213> Artificial Sequence <400> 2 acgggcccgg gatccgatcg tgcgagtgga ctaacaacag 40 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <400> 3 gccagttcac aaccgctccg agcgtgggtc 30 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <400> 4 acgctcccca gagcagggcg tcatgc 26

Claims

1. A PCR detection kit for the CTG region of the myotonia dystrophy protein kinase gene, characterized in that: The specific primer pair comprises nucleotide sequences shown as SEQ ID NO: 1 and SEQ ID NO: 2 respectively.

2. The PCR detection kit according to claim 1, wherein A reaction system is also included. The reaction system is 25 µL and includes 5 µL of 2×GC Buffer II, 3 µL of 2.5 mM dNTP, 1 µL of a 10 ng DNA sample, 0.5 µL of TaKaRa La Taq DNA polymerase, 1 µL of each 10 µM specific primer pair, and the balance is water.

3. The PCR detection kit according to claim 1, wherein The amplification program also includes: denaturation at 94°C for 60s; entering the cycle, denaturation at 94°C for 30s, annealing at 58°C for 30s, extension at 72°C for 1.5min, for a total of 35 cycles; extension at 72°C for 10min, and maintaining the temperature at 4°C.

4. A method for amplifying the CTG region of the myotonia dystrophy protein kinase gene for non-disease diagnosis purposes, characterized in that: The steps include: In the first step, PCR amplification is performed using the DNA of the sample to be tested as a template to obtain a PCR amplification product; The second step is to observe the electrophoresis results of the amplified products. If double bands are present in the electrophoresis graph, it indicates that the PCR method can amplify both large and small fragments simultaneously. The nucleotide sequences of the specific primer pair used for amplification are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

5. The amplification method according to claim 4, wherein The method further includes a third step of calculating the number of repetitions of CTG in the sample to be tested.

6. The amplification method according to claim 4, wherein The PCR amplification reaction system is 25 μL, including 5 μL of 2×GC Buffer II, 3 μL of 2.5 mM dNTPs, 1 μL of 10 ng DNA sample, 0.5 μL of TaKaRa La Taq DNA polymerase, 1 μL of each 10 μM specific primer pair, and the balance is water.

7. The amplification method according to claim 4, wherein The PCR amplification program was as follows: denaturation at 94°C for 60 seconds; entering the cycle, denaturation at 94°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 1.5 minutes, for a total of 35 cycles; extension at 72°C for 10 minutes, and maintaining the temperature at 4°C.

Citation Information

Patent Citations

  • A set of primers for detecting ctg repeat sequence and its detection kit

    CN103966332B

  • Modulation of dystrophia myotonica-protein kinase (dmpk) expression

    CN103167883A

  • Primers for detecting CTG repetitive sequence and detection kit of primers

    CN103966332A