A molecular marker and detection method for distinguishing bovine and melitensis Brucella

Abstract

The present invention provides a molecular marker and detection method that can distinguish bovine and melitensis Brucella, wherein the sequence of the specific nucleotide fragment that can identify all kinds of Brucella is SEQ ID NO: 1; the nucleotide sequence of the specific molecular marker used to detect bovine Brucella is SEQ ID NO: 5; the nucleotide sequence of the specific molecular marker used to detect melitensis Brucella is SEQ ID NO: 9. The present invention also provides a primer pair and a probe for detecting the above-mentioned specific nucleic acid fragment. The BSCP primers and probes prepared by the present invention are universal and can detect all kinds of Brucella. The primers and probes can not only be used independently, but also be prepared into a triple real-time fluorescence quantitative PCR method for the identification of Brucella species. The sample to be detected can be an isolated strain, or a sample such as abortion products, milk, swabs, tissues, etc. collected clinically, and has the characteristics of high sensitivity and high specificity.

Description

Technical Field

[0001] The present invention belongs to the technical field of pathogen molecular detection, and specifically relates to a molecular marker capable of distinguishing bovine and melitensis Brucella, as well as a real-time fluorescence quantitative PCR primer, a probe and a detection method for detecting the molecular marker. Background Art

[0002] Brucellosis (hereinafter referred to as brucellosis) is an important zoonotic infectious disease caused by Brucella. It is an animal epidemic disease that must be reported by the International Organization for Animal Health (OIE). The Law of the People's Republic of China on the Prevention and Control of Infectious Diseases stipulates that it is a Class B infectious disease. The disease not only harms various animals such as cattle, sheep, and pigs, causing serious economic losses, but also transmits the disease to humans through sick animals or livestock products, causing fever, orchitis, miscarriage, arthritis and other symptoms in humans. In severe cases, people may even lose their ability to work and have children, posing a major threat to my country's breeding industry, food safety and human health.

[0003] Worldwide, there are 11 species of Brucella (including 23 biotypes), the most common species are B. abortus, B. melitensis, B. suis, B. ovis, B. neotomae and B. canis. In China, the incidence of brucellosis in cattle and sheep is the highest and the geographical distribution is the widest. Their causative agents are B. bovis and B. melitensis, respectively. B. bovis and B. melitensis are also the main causative agents of human brucellosis in my country, causing 99% of human brucellosis. In my country, brucellosis in pigs and dogs is sporadic, and their causative agents are B. suis and B. canis, respectively. These two types of Brucella can occasionally infect humans, but their harm to humans is far less serious than that of B. bovis and B. melitensis. At present, except for the four types of Brucella in cattle, sheep, pigs and dogs, other types of Brucella have not been found in my country. It can be seen that in our country, eliminating brucellosis in cattle and sheep is the key to preventing the spread of brucellosis from animals to humans.

[0004] At present, the conventional means of Brucella etiology detection is pathogen isolation and identification. Because bacterial culture is required, the staff are at risk of infection, so pathogen isolation and identification must be carried out in a biosafety level 3 laboratory, which limits the promotion and application of this method. On the other hand, bacterial culture and identification take at least two weeks, which is time-consuming and laborious, and cannot meet the current requirements for rapid and efficient epidemic management. Therefore, accurate and rapid etiological diagnosis technology is one of the problems that urgently need to be solved in the prevention and control of brucellosis. Real-time fluorescence quantitative PCR (Quantitative Real-time PCR) is one of the most widely used etiological diagnostic methods, with high sensitivity and specificity. Compared with other molecular detection methods (such as digital PCR, constant temperature or isothermal PCR, etc.), real-time fluorescence quantitative PCR technology is more mature, more stable, and easier to promote. Summary of the invention

[0005] The present invention provides a molecular marker and a detection method capable of distinguishing bovine and melitensis Brucella, namely a molecular marker capable of distinguishing bovine and melitensis Brucella, and a real-time fluorescence quantitative PCR primer, a probe and a detection method for detecting the marker.

[0006] The present invention first provides a specific nucleotide fragment that can identify all species of Brucella (including cattle, sheep, pigs and dogs), and its nucleotide sequence is as follows:

[0007] CCGGAGCCTATAAGGACGTGGCGGAAACACCGACCCTTGCCGTTGCCGCACAGTGGGTGACGAGCGCCAAGCAGCCGGACGACCTCATCTATAACATCACCAAGGTTTCTCTGGAACGAGGATACACGCAA (SEQ ID NO: 1)

[0008] The present invention also provides a primer pair for amplifying the sequence fragment described in SEQ ID NO: 1, one of which has a nucleotide sequence as follows:

[0009] Upstream primer: 5′-CCGGAGCCTATAAGGACGTG-3′ (SEQ ID NO: 2);

[0010] Downstream primer: 5′-TTGCGTGTATCCTCGTTCCAG-3′ (SEQ ID NO: 3);

[0011] The present invention also provides a probe for detecting the amplification product of the above primers, the sequence of which is as follows:

[0012] 5′-ACCGACCCTTGCCGTTGCCGC-3′ (SEQ ID NO: 4);

[0013] The present invention also provides a specific molecular marker for detecting Brucella bovis, wherein the nucleotide sequence of the molecular marker is as follows:

[0014] CAGTTCTCGAACAAGCTGACGGGCAGCGGCACGCTTGCTGTGTCGGGTTCTGGCACGCTGATCCTTTTCGGCGGCCAATGATTATAG (SEQ ID NO: 5);

[0015] The present invention also provides a primer pair for detecting the specific molecular marker of the above-mentioned Brucella bovis, wherein one primer pair comprises:

[0016] Upstream primer: 5′-CAGTTCTCGAACAAGCTGACG-3′ (SEQ ID NO: 6);

[0017] Downstream primer: 5′-CTATAATCATTGGCCGCCGAAAG-3′ (SEQ ID NO: 7);

[0018] The present invention also provides a probe for detecting the amplification product of the above primers, the sequence of which is as follows:

[0019] 5′-CAGCGTGCCAGAACCCGACACAGC-3′ (SEQ ID NO: 8);

[0020] The present invention also provides a specific molecular marker for Brucella melitensis, wherein the nucleotide sequence of the molecular marker is as follows:

[0021] AGCGAGATTGGAATAGCTTACCCGCCAATCTTCGCCCTGCCACCAGCCAATAACGGCAATTATCGCTGTCACTGTTGCAAGTATGGCAGCGAGCGCTCTAGCGTGACGAAGCACTGTCTTTCTGACAATTTCCAGATTCACCCCTAGGGCGTGTCTGCATTCAACGTAACCAG (SEQ ID NO: 9);

[0022] The present invention also provides a primer pair for detecting the above-mentioned Brucella melitensis specific molecular marker, wherein the primer pair comprises:

[0023] Upstream primer: 5′-AGCGAGATTGGAATAGCTTACCC-3′ (SEQ ID NO: 10);

[0024] Downstream primer: 5′-CTGGTTACGTTGAATGCAGACAC-3′ (SEQ ID NO: 11);

[0025] The present invention also provides a probe for detecting the amplification product of the above primers, the sequence of which is as follows:

[0026] 5′-CGCCCTGCCACCAGCCAATAACGG-3′ (SEQ ID NO: 12);

[0027] The probe is modified with a fluorescent reporter and a quencher group, wherein the fluorescent reporter group is modified at the 5' end of the probe sequence, and the quencher group is modified at the 3' end of the probe sequence.

[0028] Furthermore, the fluorescent reporter groups are FAM, VIC and Cy5; the quencher groups are BHQ1 and BHQ2.

[0029] The primers and probes mentioned above can be used to prepare a diagnostic kit for the identification of Brucella bovis and Brucella melitensis. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 : Amplification curves of triple real-time fluorescence quantitative PCR of Brucella genome templates from bovine, ovine, porcine and canine species (FAM channel);

[0031] Figure 2 : Amplification curve of triple real-time fluorescence quantitative PCR of Brucella genome templates from bovine, ovine, porcine and canine species (VIC channel);

[0032] Figure 3 : Triple real-time fluorescence quantitative PCR amplification curves of Brucella genome templates from bovine, ovine, porcine and canine species (Cy5 channel);

[0033] Figure 4 :Sensitivity test of Brucella bovis specific primer probe and drawing of standard curve;

[0034] Figure 5 :Sensitivity test of Brucella melitensis specific primer probe and drawing of standard curve;

[0035] Figure 6 :Triple real-time fluorescence quantitative PCR amplification curve of Brucella melitensis genome;

[0036] Figure 7 : Amplification curve of triple real-time fluorescence quantitative PCR of Brucella bovis genome;

[0037] Figure 8 : Amplification curve of triple real-time fluorescence quantitative PCR of clinical isolates of Brucella;

[0038] Fig. 9 : Amplification curve of triple real-time fluorescence quantitative PCR of bovine abortion product samples;

[0039] Fig.10 : Amplification curves of triple real-time fluorescence quantitative PCR in milk and spleen;

[0040] Fig.11 : Amplification curve of triple real-time fluorescence quantitative PCR of sheep vaginal swab. DETAILED DESCRIPTION

[0041] The present invention provides a triple real-time fluorescence quantitative PCR detection method for Brucella, which can quickly identify and distinguish bovine and ovine Brucella. At the same time, it overcomes the shortcomings of traditional pathogen identification methods that are time-consuming, labor-intensive, and have high biosafety risks, and can provide important technical support for the prevention, control, and purification of brucellosis among livestock in my country.

[0042] Below in conjunction with the accompanying drawing in the embodiment of the present invention, the technical scheme in the embodiment of the present invention is clearly and completely described.If not otherwise specified, Brucella involved in the present invention is the current popular bacterial strain of my country.

[0043] Embodiment 1: selection of Brucella specific nucleic acid fragment and primer and probe design

[0044] Brucella 31kDa immunogenic protein gene Bcsp31 is a Brucella-specific gene, present in all types of Brucella genomes, and highly conserved. This gene is located on Brucella chromosome I (817,132-818,121), a total of 990 bases. Using AlleleID 6 software, a set of specific primers and Taqman probes for the above sequence were obtained, and the sequence amplified by the primers was:

[0045] CCGGAGCTATAAGGACGTGGCGGAAACACCGACCCTTGCCGTTGCCGCACAGTGGGTGACGAGCGCCAAGCAGCCGGACGACCTCATCTATAACATCACCAAGGTTTCTCTGGAACGAGGATACACGCAA (SEQ ID NO: 1)

[0046] Upstream primer: 5′-CCGGAGCCTATAAGGACGTG-3′ (SEQ ID NO: 2);

[0047] Downstream primer: 5′-TTGCGTGTATCCTCGTTCCAG-3′ (SEQ ID NO: 3);

[0048] Probe sequence: 5′-ACCGACCCTTGCCGTTGCCGC-3′ (SEQ ID NO: 4);

[0049] According to the performance of the real-time fluorescence quantitative PCR instrument, the fluorescent modification group of the probe can be selected as FAM, Texasd, VIC or Cy5, etc. FAM is preferred for this probe, and the quenching group is BHQ1.

[0050] This group of primer probes can detect all types of Brucella, and is also referred to as universal Brucella primer probes in the following embodiments and is represented by BCSP.

[0051] Example 2: Selection of Brucella bovis-specific nucleic acid fragments and primer and probe design

[0052] Since there are only reports of Brucella in cattle, sheep, pigs, and dogs in my country, based on the genome sequences of Brucella in cattle, sheep, dogs, and pigs in the NCBI genome database (https: / / www.ncbi.nlm.nih.gov / genome), a site that is highly conserved in the genome of Brucella in bovine species but missing in the genomes of other species of Brucella was screened out through analysis and comparison. This site is located on chromosome II of Brucella in bovine species (for example, B. abortus 2308 strain: 157624-157704), and the sequence of its nucleotide fragment is as follows:

[0053] CAGTTCTCGAACAAGCTGACGGGCAGCGGCACGCTTGCTGTGTCGGGTTCTGGCACGCTGATCCTTTCGGCGGCCAATGATTATAG (SEQ ID NO: 5). The detection results show that the sequence exists in all bovine Brucella genomes, but has very low homology with the genome sequences of other Brucella species.

[0054] Using AlleleID 6 software analysis, a pair of specific primers and Taqman probes for the above sequence were obtained:

[0055] Upstream primer: 5′-CAGTTCTCGAACAAGCTGACG-3′ (SEQ ID NO: 6);

[0056] Downstream primer: 5′-CTATAATCATTGGCCGCCGAAAG-3′ (SEQ ID NO: 7);

[0057] Probe sequence: 5′-CAGCGTGCCAGAACCCGACACAGC-3′ (SEQ ID NO: 8);

[0058] According to the performance of the real-time fluorescence PCR instrument, the fluorescent modification group of the probe can be selected as FAM, VIC or Cy5, etc. In order to establish a triple real-time fluorescence quantitative PCR detection kit, the probe is preferably labeled with VIC and the quenching group is BHQ1.

[0059] This set of primers and probes specifically recognizes Brucella bovis, and is also referred to as Brucella bovis-specific primers and probes in the following examples, and is represented by BA.

[0060] Example 3 Selection of Brucella melitensis-specific nucleic acid fragments and primer and probe design

[0061] Similarly, through comparative analysis of the sequences of the bovine, ovine, canine and swine Brucella genomes in the NCBI Brucella genome database, a site was screened out that was highly conserved in the genome of Brucella melitensis but missing in the genomes of other species of Brucella. The site is located on chromosome I of Brucella melitensis (for example, B. melitensis 16M strain: 1209463-1209635), and the sequence of its nucleotide fragment is as follows:

[0062] AGCGAGATTGGAATAGCTTACCCGCCAATCTTCGCCCTGCCACCAGCCAATAACGGCAATTATCGCTGTCACTGTTGCAAGTATGGCAGCGAGCGCTCTAGCGTGACGAAGCACTGTCTTTCTGACAATTTCCAGATTCACCCCTAGGGCGTGTCTGCATTCAACGTAACCAG (SEQ ID NO: 9). The sequence was input into the NCBI website and searched using the Blast function. The sequence was present in all Brucella melitensis genomes, but had very low homology with the genome sequences of other Brucella species.

[0063] Using AlleleID 6 software analysis, a pair of specific primers and Taqman probes for the above sequence were obtained:

[0064] Upstream primer: 5′-AGCGAGATTGGAATAGCTTACCC-3′ (SEQ ID NO: 10);

[0065] Downstream primer: 5′-CTGGTTACGTTGAATGCAGACAC-3′ (SEQ ID NO: 11);

[0066] Probe sequence: 5′-CGCCCTGCCACCAGCCAATAACGG-3′ (SEQ ID NO: 12);

[0067] According to the performance of the real-time fluorescence PCR instrument, the fluorescent modification group of the probe can be selected as FAM, VIC or Cy5, etc. In order to establish a triple real-time fluorescence quantitative PCR detection kit, this probe is preferably labeled with Cy5 and the quenching group is BHQ2.

[0068] This set of primers and probes specifically recognizes Brucella melitensis, and is also referred to as Brucella melitensis-specific primers and probes in the following examples, and is represented by BM.

[0069] Example 4 Brucella triple real-time fluorescence quantitative PCR laboratory verification

[0070] 1. DNA Sample Preparation

[0071] Brucella genomic DNA was stored and provided by our laboratory (Zootonic Disease Surveillance Office, China Animal Health and Epidemiology Center). One strain of Brucella in China was obtained from bovine, ovine, porcine, and canine species, with strain numbers DT20, XJ18, S20, and CQ19, respectively. The DNA sample concentration was between 0.5 and 5 ng / μL.

[0072] 2. Synthesis and modification of primers and probes. The primers and probes designed in Examples 1, 2, and 3 were synthesized by General Biosystems (Anhui) Co., Ltd. In Example 1, the universal Brucella primers were named BCSP-F and BCSP-R, the probe was named BCSP-P, and the 5' end was modified with a FAM group. In Example 2, the bovine Brucella-specific primers were named BA-F and BA-R, the probe was named BA-P, and the 5' end was modified with a VIC group. In Example 3, the melitensis-specific primers were named BM-F and BM-R, the probe was named BM-P, and the 5' end was modified with a Cy5 group. The synthesized primers and probes were dissolved in double distilled water without RNase and DNase and diluted to a working concentration of 10 μM.

[0073] 3. Preparation of reaction system: A single reaction was prepared according to Table 1, with a reaction volume of 20 μL.

[0074] Table 1: Preparation of triple real-time fluorescence quantitative PCR reaction system

[0075]

[0076] After the above reaction system is fully mixed, it is placed on the QuantStudio 5 real-time fluorescence quantitative PCR instrument and run according to the following conditions: preheat at 95°C for 5 minutes; then 95°C for 10 seconds, 60°C for 30 seconds, for a total of 40 cycles.

[0077]

[0078] The signal was collected at the end of 60°C. Double distilled water was used as a negative control, and three reactions were repeated for each genomic template.

[0079] 4. Results: The Ct values ​​of each genomic template test are shown in Table 2. The results showed that BCSP primers and probes (FAM) can effectively amplify Brucella genomic DNA from bovine, ovine, porcine and canine species, and have universality for Brucella detection ( Figure 1 BA primers and probe (VIC) only amplify the genomic DNA of Brucella bovis, but not the genomic DNA of Brucella goat, pig and dog, showing species specificity ( Figure 2 BM primers and probes (Cy3) only amplify the genomic DNA of Brucella melitensis, but not the genomic DNA of Brucella bovis, swine, and canis, and are also species-specific ( Figure 3 ). The negative control (double distilled water) showed no amplification.

[0080] The above results prove that the triple real-time fluorescence quantitative PCR designed in the present invention can not only detect all types of Brucella, but also effectively distinguish bovine and melitensis Brucella.

[0081] Table 2: Results of triple real-time fluorescence quantitative PCR of Brucella genomes from bovine, ovine, porcine and canine species. Note: - indicates no amplification.

[0082] Example 5 Brucella triple real-time fluorescence quantitative PCR and other bacteria cross-reaction test

[0083] Other bacterial pathogens common in livestock such as cattle and sheep were selected to verify the specificity of Brucella triple real-time fluorescence quantitative PCR.

[0084] 1. Preparation of Bacterial Genomic DNA Samples

[0085] The genomic DNA of pathogenic Escherichia coli (O157), Salmonella, Streptococcus, Staphylococcus, Ochrobacterium hominis, Listeria monocytogenes, and Clostridium perfringens were all preserved by this laboratory (Zootonic Disease Monitoring Office, China Animal Health and Epidemiology Center). The genomic DNA sample concentration was diluted to 10 ng / μL for standby use.

[0086] 2. The preparation and reaction conditions of the triple real-time fluorescence quantitative PCR reaction system were carried out according to the method in Example 4.

[0087] 3. The results show that the three sets of primers and probes designed by the present invention cannot amplify the genomic DNA of pathogenic Escherichia coli (O157), Salmonella, Streptococcus, Staphylococcus, Ochrobacterium hominis, Listeria monocytogenes, and Clostridium perfringens. This shows that the Brucella triple real-time fluorescence quantitative PCR established using the primers and probes of the present invention has very good specificity.

[0088] Example 6 Sensitivity analysis of triple real-time fluorescence quantitative PCR of Brucella

[0089] 1. Preparation of DNA Standards

[0090] DNA standards were prepared using Brucella melitensis XJ18 and Brucella bovis DT20 strains (stored in the biosafety level 3 laboratory of the Zoonoses Monitoring Office of the China Animal Health and Epidemiology Center). After the XJ18 and DT20 strains were cultured, the cells were recovered, and inactivated, the genomic DNA was purified using a bacterial genome extraction kit (Tiangen Biochemical Technology Co., Ltd.), and the genomic DNA content was determined using the Xinyi Biotechnology TD-1 digital PCR platform. Then, the genomes of the XJ18 and DT20 strains were diluted to 2000 copies / μL solution and diluted 10 times for standby use. The negative control was double distilled water without RNase and DNase.

[0091] 2. Preparation and amplification of single-plex real-time fluorescence quantitative PCR reaction system. According to Table 3, the universal Brucella reaction system (BCSP), the bovine Brucella reaction system (BA) and the melitensis Brucella reaction system (BM) were prepared respectively, and amplified according to the procedure shown in 3 of Example 4. Three replicates were made for each sample dilution.

[0092] Table 3: Preparation table of single-plex real-time fluorescence quantitative PCR reaction system

[0093]

[0094]

[0095] 3. Preparation and amplification of triple real-time fluorescence quantitative PCR reaction system. The system was prepared and reacted as shown in 3 of Example 4, with appropriate adjustments. The amount of template added was 5 μL, and the amount of water added was 2 μL. Three replicates were performed for each sample dilution.

[0096] 4. Single-plex real-time fluorescence quantitative PCR detection results.

[0097] (1) The detection results of the universal Brucella primer probe for different copy numbers of Brucella genomes of melittin (XJ18) and bovine (DT20) are shown in Table 4. For melittin Brucella, the average Ct value corresponding to the genome with a content of 10,000 copies / μL is 26.58, and after 10-fold serial dilution to a concentration containing 1 copy, the corresponding Ct value is 36.05. The Ct value range of dilution to less than 1 copy (equivalent to 1 copy) is 35.2-37.13. For bovine Brucella, the Ct value detected is similar to that of melittin Brucella, and the Ct value corresponding to the single copy of the bovine Brucella genome is 36.74. Therefore, the minimum limit of the Brucella genome detected by the Brucella-specific primers and probes provided by the present invention is 1 copy, and the threshold value is set to 38. Samples with a Ct value <38 can be diagnosed as positive.

[0098] Table 4: Detection results of universal primer probes on the genomes of Brucella bovis and Brucella melitensis with different genome copy numbers

[0099]

[0100] (2) The results of the detection of Brucella bovis primers and probes for different copy numbers of the Brucella bovis (DT20) genome are shown in Table 5. The average Ct value corresponding to the genome with a content of 10,000 copies / μL was 23.94. After 10-fold serial dilution to a concentration containing 1 copy, the corresponding Ct value was 37.57. The amplification curve of the genome with a serial 10-fold dilution and the standard curve are shown in Figure 4 Based on this data, the minimum genome limit for detection of Brucella bovis specific primers and probes designed by the present invention is set to 1 copy, the threshold is set to 38, and samples with Ct values ​​<38 can be diagnosed as positive.

[0101] Table 5: Detection results of Brucella bovis primers and probes for different copy numbers of Brucella bovis genome

[0102] Copy number Ct1 Ct2 Ct3 Average Ct 10000 24.06 23.81 23.94 23.94 1000 27.01 27.34 27.54 27.30 100 30.52 30.79 31.34 30.88 10 34.98 34.38 34.97 34.78 1 37.52 37.50 37.70 37.57 0.1 - - - 0.01 - - - 0.001 - - -

[0103] (3) The results of the detection of Brucella melitensis (XJ18) genome with different copy numbers by the Brucella melitensis primer probe are shown in Table 6. The average Ct value corresponding to the genome with a content of 10,000 copies / μL was 23.71. After 10-fold serial dilution to a concentration containing 1 copy, the corresponding Ct value was 37.44. The amplification curve of the genome with 10-fold serial dilution and the standard curve are shown in Table 6. Figure 5 Based on this data, the minimum genome limit for detection of Brucella bovis specific primers and probes designed by the present invention is set to 1 copy, the threshold is set to 38, and samples with Ct values ​​<38 can be diagnosed as positive.

[0104] Table 6 Detection results of Brucella melitensis primers and probes for different copy numbers of Brucella melitensis genome

[0105]

[0106]

[0107] 5. Triple real-time fluorescence quantitative PCR detection results.

[0108] (1) The results of triple real-time fluorescence quantitative PCR detection of different copy numbers of Brucella melitensis (XJ18) genome are shown in Table 7. The Brucella melitensis genome can be amplified by BCSP primers and probes and BM primers and probes at the same time, but not by BA primers and probes. Therefore, only green (FAM) and dark red (Cy5) amplification curves appear on the amplification map ( Figure 6 ). When in the reaction system, when the genome copy number of Brucella melitensis is greater than or equal to 10, characteristic amplification curves appear in both BCSP and BM primer probes, and the Ct value of BCSP is lower than that of BM. And when in the reaction system, when the genome copy number of Brucella melitensis is less than or equal to 1, BCSP primer probe has no amplification, and BM primer probe can effectively amplify, and the average Ct value is 36.82. Therefore, when the triple real-time fluorescence quantitative PCR designed by the present invention is used for the detection of Brucella melitensis, the Brucella genome minimum limit detected is 10 copies, and the threshold value is set to 38, and the sample with Ct value<38 can be diagnosed as positive.

[0109] Table 7: Results of triple real-time fluorescence quantitative PCR detection of Brucella melitensis genome

[0110]

[0111] (2) The results of triple real-time fluorescence quantitative PCR detection of different copy numbers of the Brucella bovis (DT20) genome are shown in Table 8. The Brucella melitensis genome can be amplified by both BCSP and BA primers and probes, but not by BM primers and probes. Therefore, only green (FAM) and pink (VIC) amplification curves appear on the amplification map ( Figure 7). When in the reaction system, when the genome copy number of Brucella melitensis was greater than or equal to 10, characteristic amplification curves appeared in both BCSP and BA primer probes, and the Ct value of BCSP was lower than that of BA. And when in the reaction system, when the genome copy number of Brucella melitensis was less than or equal to 1, three repetitions of BA primer probes could be effectively amplified, and the average Ct value was 37.51, but although BCSP primer probes had amplification, only 1 amplification occurred in the repeated samples. Therefore, when the triple real-time fluorescence quantitative PCR designed by the present invention was used for the detection of Brucella melitensis, the Brucella genome minimum limit detected was 10 copies, and the threshold value was set to 38, and the sample with Ct value<38 could be diagnosed as positive.

[0112] Table 8: Results of triple real-time fluorescence quantitative PCR detection of Brucella bovis genome

[0113]

[0114] In summary, if three pairs of primers and probes designed by the present invention are used alone to increase the genomic DNA of Brucella, their sensitivity is very high, and a genome of one copy can be effectively detected. When these three pairs of primers and probes are used in the same system, when the genomic DNA of Brucella is amplified in triple real-time fluorescence quantitative PCR mode, the genomic DNA of at least 10 copies can be effectively detected. Considering that the amplification efficiency of multiple PCR primers and probes to different target fragments can have slight differences, when the target genome content is extremely low, as only one or several genome copies, the primers and probes with high amplification efficiency can preferentially combine with the target fragment and amplify, thereby covering up the amplification of another pair of primers and probes. And triple real-time fluorescence quantitative PCR provided by the present invention can still effectively amplify the target genome DNA of at least 10 copies, compared with common PCR method and traditional pathogen separation and identification method, has very high advantages, can meet the needs of detection fully.

[0115] Example 7: Detection of Brucella by triple real-time fluorescence quantitative PCR

[0116] 1. Preparation of Clinically Isolated Brucella Strains

[0117] Brucella epidemic strains in China were preserved and provided by our laboratory (Zootonic Disease Monitoring Office, China Animal Health and Epidemiology Center). 25 strains of B. melitensis, 10 strains of B. bovis, 2 strains of B. suis, 2 strains of B. canis, and vaccine strains of B. a19 (bovine), Rev1 (meat), M5 (meat), and S2 (meat) were selected. The species and biotypes of these epidemic strains were identified by traditional biochemical methods, including H2S production test, oxidase reaction test, dye inhibition test, CO2 requirement test, etc. At the same time, they were also matched by traditional multiplex PCR (Bruce-ladder) method. After these epidemic strains and vaccine strains were revived and expanded in the biosafety level 3 laboratory of the Zootonic Disease Monitoring Office, China Animal Health and Epidemiology Center, the genomic DNA was extracted and purified and diluted to a concentration of about 1 to 10 μg / μL for use.

[0118] 2. The PCR system was prepared and the reaction was carried out as shown in 3 of Example 4. Each sample was repeated once. Double distilled water containing RNase and DNase was used as a negative control.

[0119] 3. Result determination: There is no amplification in the negative control, and the test sample has a standard amplification curve with a Ct value less than 38.

[0120] The results showed that triple real-time fluorescence quantitative PCR could effectively identify all epidemic strains and vaccine species, with positive Ct values ​​ranging from 13 to 22 ( Figure 8 ). The FAM channel can identify all Brucella epidemic strains and vaccine strains, the VIC channel specifically identifies the bovine Brucella epidemic strain and A19 vaccine strain, the Cy5 channel specifically identifies the melitensis Brucella epidemic strain and Rev1, M5 vaccine strains, while the porcine and canine Brucella are not identified. The specific results are shown in Table 9 below.

[0121] Table 9: Results of triple real-time fluorescence quantitative PCR detection of Brucella epidemic strains and vaccine strains

[0122]

[0123]

[0124] Note: + indicates positive result; n / n indicates the number of positive strains; - indicates no amplification.

[0125] The above results prove that the primers and probes designed by the present invention can replace the traditional etiological identification methods (biochemical identification and multiplex PCR) to identify the species of Brucella.

[0126] Example 8 Brucella triple real-time fluorescence quantitative PCR for detection of clinical samples

[0127] 1. Selection of clinical samples. The abortion products, milk, vaginal secretions, liver and spleen tissues of animals infected with brucellosis contain a large number of pathogens and are ideal samples for real-time fluorescence quantitative PCR detection. This experiment selected 34 samples of abortion products (afterbirth or amniotic fluid), 8 samples of milk, 8 samples of spleen, and 10 samples of vaginal swabs from a flock of sick sheep in a certain place. Through traditional Brucella pathogen isolation and identification, wild strains of Brucella bovis have been isolated from these samples of sick cattle, and wild strains of Brucella melitensis have been isolated from the uterine tissues of sick sheep in the flock, confirming that the flock is infected with Brucella.

[0128] 2. DNA extraction.

[0129] Treatment of abortion products: Take 200 μL of amniotic fluid or ground placenta, centrifuge at 12,000 rpm for 10 minutes, discard the upper liquid, and precipitate to extract DNA according to the method of Bacterial Genome Extraction Kit (Tiangen Biochemical Technology Co., Ltd.).

[0130] Milk treatment: Take 200 μL of milk and transfer it to a 1 mL centrifuge tube, add 800 μL of saline, mix well, centrifuge at 12,000 rpm for 10 minutes, discard the upper liquid, wipe the fat layer clean with a sterile cotton swab, and extract DNA from the remaining precipitate using a bacterial genome extraction kit.

[0131] Treatment of vaginal swabs: immerse the swab in 1 mL of sterile saline, shake for 10 seconds, discard the swab, centrifuge at 12,000 rpm for 5 minutes, discard the supernatant, and precipitate to extract DNA using a bacterial genome extraction kit.

[0132] Spleen treatment: Take 10 g of liver and place it in a 25 mL grinding tube, add 5 mL of sterile saline, and grind for 1 minute; take 200 μL of the grinding supernatant, centrifuge at 12,000 rpm for 5 minutes, discard the supernatant, and use the precipitate to extract DNA using a bacterial genome extraction kit.

[0133] 3. The PCR system was prepared and the reaction was carried out as described in 3 of Example 4, except that the amount of template added was changed to 5 μL and the volume was made up to 20 μL with 2 μL of double distilled water.

[0134] 4. Results.

[0135] (1) 30 of the 34 abortion products (afterbirth or amniotic fluid) of cattle were tested by triple real-time fluorescence quantitative PCR, and they were positive for BSCP and BA, confirming that these animals were infected with Brucella bovis; 3 samples were negative for both BSCP and BA, indicating that no Brucella nucleic acid was detected in the samples; 1 sample was positive for BSCP but negative for BA, indicating that other Brucella nucleic acid was present in the sample (see Table 10). 23 of the 34 samples were isolated from Brucella bovis by pathogen isolation and identification, which was consistent with the real-time fluorescence quantitative PCR detection method; 11 samples that did not isolate Brucella included 3 samples that were negative for triple real-time fluorescence quantitative PCR (samples 5, 12, and 18), and 1 sample that was positive for BSCP and negative for BA (sample 14). The other 7 samples were positive for triple real-time fluorescence quantitative PCR, but no Brucella was isolated, which was due to the low sensitivity of traditional pathogen isolation and identification. The Ct value of real-time fluorescence quantitative PCR detection ranges from 24.24 to 35.35. According to the standard curve, the content of Brucella in the sample can be estimated, which is approximately between 5 and 7000 CFU. The triple real-time fluorescence quantitative PCR amplification curve is shown in Fig. 9 .

[0136] Table 10: Triple real-time fluorescence quantitative PCR test results for bovine abortion product samples

[0137]

[0138]

[0139] (2) Milk sample and spleen test results. After triple real-time fluorescence quantitative PCR testing, 7 out of 8 milk samples were positive for Brucella bovis, and Brucella bovis nucleic acid was detected in all 8 bovine spleen samples (Table 11). Brucella bovis was isolated in all samples. Therefore, the real-time fluorescence quantitative PCR test results were basically consistent with the results of pathogen isolation and identification. The Ct values ​​of milk sample and spleen real-time fluorescence quantitative PCR detection ranged from 25.07 to 37.57, indicating that the bacterial content in the samples was lower than that in the aborted product. The triple real-time fluorescence quantitative PCR amplification curve is shown in Fig.10 .

[0140] Table 11: Results of triple real-time fluorescence quantitative PCR test on milk and bovine spleen samples

[0141] Milk Sample BSCP BA BM spleen BSCP BA BM 1 28.61 29.12 - 1 25.75 25.07 - 2 36.62 37.05 - 2 31.96 30.08 - 3 33.45 32.83 - 3 29.11 29.12 - 4 33.63 33.25 - 4 30.27 29.66 - 5 37.13 37.57 - 5 34.32 34.53 - 6 - - - 6 33.12 33.65 - 7 30.56 31.09 - 7 27.14 27.46 - 8 33.22 33.28 - 8 29.89 29.34 -

[0142] (3) Results of sheep vaginal swab test. Five of the 10 sheep vaginal swabs were positive for BSCP, while only one sample (sample 1) was positive for both BSCP and BM, and only the wild strain of Brucella melitensis was isolated from the uterine horn of this sheep. Although these 10 swabs came from a brucellosis-positive flock, it does not mean that every sheep is infected with Brucella. Moreover, even if a sheep is infected with brucellosis, it does not mean that Brucella can be excreted from the vagina, because vaginal bacterial excretion is closely related to the sheep's pregnancy status. The amount of bacteria excreted is large in the late pregnancy and perinatal period, while there is no bacterial excretion or less bacterial excretion in non-pregnant or early pregnancy. Therefore, the detection of Brucella in only some vaginal swabs is consistent with the pathogenesis of the disease. Moreover, the data show that the sensitivity of the real-time fluorescence quantitative PCR detection method is greater than that of traditional pathogen isolation and identification. The triple real-time fluorescence quantitative PCR amplification curve is shown in Fig.11 .

[0143] Table 12: Sheep vaginal swab triple real-time fluorescence quantitative PCR test results

[0144] Sample No. BCSP BM BA Pathogen Isolation 1 29.03 31.27 - + 2 36.59 - - - 3 34.38 - - - 4 - - - - 5 36.45 - - - 6 - - - - 7 36.86 - - - 8 - - - - 9 - - - - 10 - - - -

[0145] In summary, the BSCP primers and probes prepared by the present invention are versatile and can detect all kinds of Brucella, and the BA and BM primers and probes are species-specific and can detect bovine and meliaceous Brucella, respectively. These three pairs of primers and probes can not only be used independently, but also can be prepared into a triple real-time fluorescence quantitative PCR method for the identification of Brucella species. The sample detected can be an isolated strain, or a sample such as abortion products, milk, swabs, and tissues collected clinically, and has the characteristics of high sensitivity and high specificity. The real-time fluorescence quantitative PCR established by the invention can not only be used for the etiological detection of brucellosis, but most importantly, it can specifically identify bovine and meliaceous Brucella, providing important technical support for the detection and prevention of brucellosis in my country. Based on this, the embodiments described herein are only a part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those skilled in the art without making creative work are within the scope of protection of the present invention. Sequence Listing <110> China Animal Health and Epidemiology Center <120> A molecular marker and detection method for distinguishing bovine and melitensis Brucella <160> 12 <170> SIPOSequenceListing 1.0 <210> 1 <211> 130 <212> DNA <213> Artificial Sequence <400> 1 ccggagccta tagcgtg gcggaacac cgacccttgc cgttgccgca cagtgggtga cgagcgccaa gcagccggac gacctcatct atacatcac caaggttctc tggaacgagg 130 attacks <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 ccggagccta tagcgtg <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <400> 3 ttgcgtgtat cctcgttcca g <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <400> 4 accgaccctt gccgttgccg c <210> 5 <211> 86 <212> DNA <213> Artificial Sequence <400> 5 60. cagttctcga acaagctgac gggcagcggc acgcttgctg tgtcgggttc tggcacgctg atcctttcgg cggccaatga ttatag <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <400> 6 cagttctcga acaagctgac g 21 <210> 7 <211> twenty three <212> DNA <213> Artificial Sequence <400> 7 ctataatcat tggccgccga aag 23 <210> 8 <211> twenty four <212> DNA <213> Artificial Sequence <400> 8 cagcgtgcca gaacccgaca cagc 24 <210> 9 <211> 173 <212> DNA <213> Artificial Sequence <400> 9 agcgagattg gaatagctta cccgccaatc ttcgccctgc caccagccaa taacggcaat 60 tatcgctgtc actgttgcaa gtatggcagc gagcgctcta gcgtgacgaa gcactgtctt 120 tctgacaatt tccagattca cccctagggc gtgtctgcat tcaacgtaac cag 173 <210> 10 <211> twenty three <212> DNA <213> Artificial Sequence <400> 10 agcgagattg gaatagctta ccc 23 <210> 11 <211> twenty three <212> DNA <213> Artificial Sequence <400> 11 ctggttacgt tgaatgcaga cac 23 <210> 12 <211> twenty four <212> DNA <213> Artificial Sequence <400> 12 cgccctgcca ccagccaata acgg 24

Claims

1. A triple PCR detection primer probe set for identifying Brucella, characterized in that, The triple PCR detection primer probe set comprises: 1) A universal primer pair and probe for identifying Brucella bovis, ovis, suis and canis, wherein the sequence of the upstream primer is SEQ ID NO: 2, the sequence of the downstream primer is SEQ ID NO: 3, and the sequence of the probe is SEQ ID NO: 4; 2) A primer pair and a probe for detecting Brucella bovis, wherein the sequence of the upstream primer is SEQ ID NO: 6, the sequence of the downstream primer is SEQ ID NO: 7; and the sequence of the probe is SEQ ID NO: 8; 3) A primer pair and a probe for detecting Brucella melitensis, wherein the sequence of the upstream primer is SEQ ID NO: 10, the sequence of the downstream primer is SEQ ID NO: 11; and the sequence of the probe is SEQ ID NO:

12.

2. The primer probe set according to claim 1, characterized in that: The probe is modified with a fluorescent reporter and a quencher group, wherein the fluorescent reporter group is modified at the 5' end of the probe sequence, and the quencher group is modified at the 3' end of the probe sequence.

3. Use of the primer probe set according to claim 1 or claim 2 in preparing a diagnostic kit for Brucella bovis and Brucella melitensis.

4. A diagnostic kit for Brucella bovis and Brucella melitensis, characterized in that: The kit comprises the primer probe set according to claim 1 or claim 2.

Images