A molecular marker for rapeseed black rot and its acquisition method and application

Abstract

The present invention discloses a molecular marker for rapeseed black rot, a method for obtaining the marker and an application thereof. Rapeseed black rot resistant material is identified by inoculation through leaf clipping method, an F2 population of the material and susceptible source material is constructed, and the disease resistance gene is initially located by BSA-seq technology, and SNP and InDel molecular markers that can be used for black rot resistance screening and gene localization are screened within this interval. The molecular markers include SNP molecular markers 1 to 9 and InDel molecular markers 1 to 4. The present invention provides new molecular markers for the excavation of rapeseed black rot functional genes and molecular breeding, and has important application prospects for enhancing rapeseed resistance to black rot.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology, and in particular to a molecular marker of rapeseed black rot and an acquisition method and application thereof. Background Art

[0002] Single Nucleotide Polymorphism (SNP) is widely present in the genomes of animals and plants. It is a DNA sequence polymorphism caused by the variation of a single nucleotide, including single base conversion, transversion, insertion and deletion. It is a new generation of molecular markers after microsatellite markers. Compared with microsatellite markers, SNPs have a large distribution density, a large number, and rich polymorphism; low mutation rate, high stability and accuracy; no fragment length detection is required, only the "presence or absence" detection is required to determine the polymorphism, which makes it easy to achieve automated screening. SNP markers have the following applications: 1) They can be used for the association study between genes and diseases and to locate the target genes of diseases; 2) They can be used for the screening of key genes in animal and plant breeding, and by comparing the genetic differences of different phenotypes, key SNPs such as stress resistance and high yield can be screened; 3) They can be used to infer the evolutionary relationship between species and identify the relationship within species, and have great application potential in medicine, agronomy, and forestry.

[0003] InDel (Insertion-deletion) insertion-deletion markers refer to the differences between the two parents in the whole genome. Relative to the other parent, a certain number of nucleotides are inserted or deleted in the genome of one parent. According to the insertion-deletion sites in the genome, some PCR primers are designed to amplify these insertion-deletion sites, which are InDel markers.

[0004] Plant diseases can cause huge economic and crop yield losses and pose a major threat to the global food system. A sustainable and eco-friendly control method is to cultivate more disease-resistant varieties. Black rot is an important bacterial disease in cruciferous crops. Its pathogen is Xanthomonas campestris pv. campestris. In my country, it mainly harms many important crops such as cabbage, kale, radish, rapeseed and cauliflower. It can reduce the yield of cabbage and kale by up to 30-50%, and the yield of radish and rapeseed by 20-30%, causing huge economic losses.

[0005] How to effectively prevent and control the occurrence of black rot is an urgent problem that needs to be solved in cruciferous crops. At present, the prevention and control measures for rapeseed black rot are mainly chemical control, but chemical control is not only costly, but also easy to cause secondary pollution, while physical control and biological control also have their own limitations. Comprehensively evaluating the current measures for the prevention and control of black rot, breeding disease-resistant varieties is the most economical and effective way. However, at present, Brassica vegetables do not have sufficient resistance to black rot, there are no completely immune varieties, and no major disease-resistant genes have been identified, which greatly limits the progress of black rot resistance breeding. At present, there is a lack of available molecular markers in the process of identifying black rot resistance genes. The density of the distribution of molecular markers determines the size of the gene positioning area. Therefore, there is an urgent need to develop black rot-related molecular markers for the genetic positioning of black rot resistance genes. Summary of the invention

[0006] In view of the defects in the prior art, the present invention proposes an application of identification of rapeseed black rot resistant materials, initial location of disease resistance genes and molecular marker development. The present invention inoculates rapeseed black rot resistant materials identified by the leaf clipping method, constructs an F2 population with susceptible source materials, uses BSA-seq technology to initially locate disease resistance genes, and screens out SNP and InDel molecular markers that can be used for black rot resistance screening and gene location within this interval.

[0007] The present invention provides a molecular marker for rapeseed black rot. The molecular marker comprises a SNP molecular marker and an InDel molecular marker. The SNP molecular marker comprises at least one of SNP marker 1, SNP marker 2, SNP marker 3, SNP marker 4, SNP marker 5, SNP marker 6, SNP marker 7, SNP marker 8 and SNP marker 9; the InDel molecular marker comprises at least one of InDel marker 1, InDel marker 2, InDel marker 3 and InDel marker 4.

[0008] Furthermore, the SNP markers 1 to 9 are all located on chromosome A9 of rapeseed;

[0009] The SNP marker 1 is a base G or A, the SNP marker is located at position 364 of the nucleic acid, and the nucleic acid has a nucleotide sequence shown in SEQ ID NO.1;

[0010] The SNP marker 2 is base A or G, the SNP marker is located at position 337 of the nucleic acid, and the nucleic acid has a nucleotide sequence shown in SEQ ID NO.2;

[0011] The SNP marker 3 is base A or T, the SNP marker is located at position 357 of the nucleic acid, and the nucleic acid has a nucleotide sequence shown in SEQ ID NO.3;

[0012] The SNP marker 4 is a base G or A, the SNP marker is located at position 939 of the nucleic acid, and the nucleic acid has a nucleotide sequence shown in SEQ ID NO.4;

[0013] The SNP marker 5 is a base C or T, the SNP marker is located at position 376 of the nucleic acid, and the nucleic acid has a nucleotide sequence shown in SEQ ID NO.5;

[0014] The SNP marker 6 is a base T or C, the SNP marker is located at position 222 of the nucleic acid, and the nucleic acid has a nucleotide sequence shown in SEQ ID NO.6;

[0015] The SNP marker 7 is a base C or G, the SNP marker is located at position 516 of the nucleic acid, and the nucleic acid has a nucleotide sequence shown in SEQ ID NO.7;

[0016] The SNP marker 8 is a base A or T, the SNP marker is located at position 215 of the nucleic acid, and the nucleic acid has a nucleotide sequence shown in SEQ ID NO.8;

[0017] The SNP marker 9 is base A or G, the SNP marker is located at position 653 of the nucleic acid, and the nucleic acid has a nucleotide sequence shown in SEQ ID NO.9.

[0018] Furthermore, the InDel molecular markers 1 to 4 are all located on chromosome A9 of rapeseed;

[0019] The primer pair used to amplify the InDel marker 1 has the following nucleotide sequence:

[0020] InDel-5-F:GCATTTTCATTCTTCAGTGC;

[0021] InDel-5-R:TGTTTTTCGAAGTCAAAAGGT;

[0022] The InDel marker characteristic band amplified by the InDel-5 primer pair is 170 bp, and the nucleotide sequence is shown in SEQ ID NO.10;

[0023] The primer pair used to amplify the InDel marker 2 has the following nucleotide sequence:

[0024] InDel-36-F: CTGAGTCAAGGCTCCAAATA;

[0025] InDel-36-R: CGTATTGGAGGAATGGTATG;

[0026] The InDel marker characteristic band amplified by the InDel-36 primer pair is 190 bp, and the nucleotide sequence is shown in SEQ ID NO.11;

[0027] The primer pair used to amplify the InDel marker 3 has the following nucleotide sequence:

[0028] InDel-45-F: ATCATGCATAGAAAGCCACT;

[0029] InDel-45-R: AGTTACTACGCGTCCATGTT;

[0030] The InDel marker characteristic band amplified by the InDel-45 primer pair is 143 bp, and the nucleotide sequence is shown in SEQ ID NO.12;

[0031] The primer pair used to amplify the InDel marker 4 has the following nucleotide sequence:

[0032] InDel-57-F: CCTCTTCAACTTCTTCTCCA;

[0033] InDel-57-R: CCAAGTAAACATGCGAATAA;

[0034] The InDel marker characteristic band amplified by the InDel-57 primer pair is 163 bp, and the nucleotide sequence is shown in SEQ ID NO.13.

[0035] The present invention also provides a primer pair for detecting the SNP molecular marker and the InDel molecular marker.

[0036] Furthermore, the sequence of the primer pair is:

[0037]

[0038]

[0039] The primer pair Xcc-183 is used to amplify the nucleotide sequence shown in SEQ ID NO.1;

[0040] The primer pair Xcc-2010 is used to amplify the nucleotide sequence shown in SEQ ID NO.2;

[0041] The primer pair Xcc-3743 is used to amplify the nucleotide sequence shown in SEQ ID NO.3;

[0042] The primer pair Xcc-3757 is used to amplify the nucleotide sequence shown in SEQ ID NO.4;

[0043] The primer pair Xcc-3773 is used to amplify the nucleotide sequence shown in SEQ ID NO.5;

[0044] The primer pair Xcc-3920 is used to amplify the nucleotide sequence shown in SEQ ID NO.6;

[0045] The primer pair Xcc-4033 is used to amplify the nucleotide sequence shown in SEQ ID NO.7;

[0046] The primer pair Xcc-4043 is used to amplify the nucleotide sequence shown in SEQ ID NO.8;

[0047] The primer pair Xcc-4356 is used to amplify the nucleotide sequence shown in SEQ ID NO.9;

[0048] The primer pair InDel-5 is used to amplify the nucleotide sequence shown in SEQ ID NO.10;

[0049] The primer pair InDel-36 is used to amplify the nucleotide sequence shown in SEQ ID NO.11;

[0050] The primer pair InDel-45 is used to amplify the nucleotide sequence shown in SEQ ID NO.12;

[0051] The primer pair InDel-57 is used to amplify the nucleotide sequence shown in SEQ ID NO.13.

[0052] The present invention also provides a method for obtaining the molecular marker of rapeseed black rot, comprising the following steps:

[0053] (1) Screening rapeseed varieties resistant to black rot;

[0054] (2) hybridizing the black rot-resistant rapeseed varieties screened in step (1) with the susceptible varieties from which they were originally derived to obtain an F2 population;

[0055] (3) screening out several extremely black rot-resistant and extremely black rot-susceptible samples from the F2 population in step (2), extracting genomic DNA from the extremely black rot-resistant samples and the extremely black rot-susceptible samples, optimizing them to similar concentrations, and then mixing them in equal amounts to generate two extreme pools, together with the screened black rot-resistant rapeseed variety and the two parental DNAs of the original susceptible variety, a total of four samples were subjected to library construction according to a standard 125 bp double-end sequencing protocol, followed by high-throughput sequencing;

[0056] (4) Check and filter the sequencing data, annotate reliable polymorphic variants, and select high-quality SNPs / InDels with a read coverage depth of at least 4 for BSA-seq analysis;

[0057] (5) The Euclidean distance and SNP index methods were used to detect potential candidate regions associated with black rot resistance, and the overlapping sites of SNP and InDel correlation analysis based on these two methods were defined as candidate regions;

[0058] (6) Design primer pairs in the candidate region and perform PCR using black rot-resistant rapeseed varieties and susceptible varieties of the original source as templates to verify whether there are SNP sites or InDel sites.

[0059] Furthermore, when verifying whether there is a SNP site or an InDel site in step (6), if there is a SNP site, sequencing verification can obtain a difference in the single base corresponding to the SNP site; if there is an InDel site, agarose gel electrophoresis can verify that there is a difference in the fragment length of the amplified product.

[0060] Furthermore, the black rot resistant rapeseed variety is the material ZS9mXccR-1 obtained by chemically inducing EMS to the original variety ZS9, and the susceptible variety of the original source is ZS9.

[0061] The invention also provides application of the molecular marker or the primer pair in screening for resistance to black rot.

[0062] The invention also provides application of the molecular marker or the primer pair in positioning the black rot resistance gene.

[0063] In summary, compared with the prior art, the present invention achieves the following technical effects:

[0064] 1. Although the research on black rot resistance is mainly focused on cabbage, radish and cauliflower, there are few reports on black rot in rapeseed so far. The work carried out in rapeseed in the present invention enriches the research on black rot.

[0065] 2. The present invention develops molecular markers for the initial positioning interval of BSA production, and the obtained polymorphic molecular markers are helpful for the fine positioning of black rot resistance genes.

[0066] 3. The SNP molecular marker and InDel molecular marker of the present invention can be applied to the location of genes between 21.5-27.7M on rapeseed A9 chromosome.

[0067] 4. The present invention uses BSA-seq technology to initially locate disease-resistant genes in the constructed F2 population. The obtained disease-resistant gene interval provides a reference for the study of the disease-resistant function of black rot, which is of great significance.

[0068] 5. The highly resistant material ZS9mXccR-1 identified in the present invention provides a new genetic resource for disease-resistant breeding and serves as a guide and reference for the breeding of black rot-resistant varieties.

[0069] 6. The discovery of ZS9mXccR-1, a rapeseed black rot-resistant material, has important theoretical guiding significance for conducting research on the black rot resistance mechanism of crops and exploring the molecular mechanism of action of black rot resistance genes.

[0070] 7. The selection of rapeseed materials resistant to black rot has always been valued by rapeseed breeders. The identification of the disease-resistant material ZS9mXccR-1 provides breeders with an excellent source of disease-resistant materials. Since the black rot causes huge losses in rapeseed yield and quality in current production, the selection of disease-resistant varieties is particularly important. This has laid a solid foundation for the next step of cloning resistance genes; it provides new breeding materials for further breeding of rapeseed varieties with black rot resistance; and it has important practical guiding value in crop breeding practice, variety improvement and variety promotion for black rot resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0071] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0072] Figure 1 This is a comparison of the lesion lengths of ZS9 and ZS9mXccR-1 8 days after inoculation with black rot pathogens;

[0073] Figure 2 The figure shows the colony isolation results of ZS9 and ZS9mXccR-1 plants on the 8th day after the disease. The 60h and 84h show the growth of the colonies after the bacterial suspension of plant leaves was cultured on the culture medium for 60h and 84h respectively.

[0074] Figure 3 It is a statistical graph of plant height, first branch height, number of branches, main inflorescence length, number of siliques in the main inflorescence, and 1000-seed weight of ZS9 and ZS9mXccR-1;

[0075] Figure 4Comparison of the submicroscopic structure of leaves of ZS9 and ZS9mXccR-1 at different time points after inoculation with pathogens. ZS9_5 and ZS9mXccR-1_5 are the results of ZS9 and ZS9mXccR-1 on the 5th day after inoculation, respectively, and ZS9_8 and ZS9mXccR-1_8 are the results of ZS9 and ZS9mXccR-1 on the 8th day after inoculation, respectively. The arrows indicate the pathogens observed in the mesophyll cells.

[0076] Figure 5 is the SNP-index of the disease-resistant mixed pool and the disease-susceptible mixed pool in the whole genome, and their ΔSNP-index; a, SNP density; b, InDel density; c, SNP-index of the R pool; d, SNP-index of the S pool; e, SNP-index difference between the R pool and the S pool;

[0077] Figure 6 It is the SNP-index of the disease-resistant mixed pool and the disease-susceptible mixed pool on chromosome A9, as well as their ΔSNP-index. R is ZS9mXccR-1, S is ZS9;

[0078] Figure 7 It is a polymorphic molecular marker developed in the initial positioning interval and flank of the disease resistance gene. A, SNP marker, B, InDel marker. DETAILED DESCRIPTION

[0079] In order to enable those skilled in the art to better understand the scheme of the present invention, the technical scheme in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only embodiments of a part of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work should fall within the scope of protection of the present invention.

[0080] The method for obtaining the molecular marker of rapeseed black rot of the present invention comprises the following steps:

[0081] (1) Screening rapeseed varieties resistant to black rot;

[0082] (2) hybridizing the black rot-resistant rapeseed varieties screened in step (1) with the susceptible varieties from which they were originally derived to obtain an F2 population;

[0083] (3) screening out several extremely black rot-resistant and extremely black rot-susceptible samples from the F2 population in step (2), extracting genomic DNA from the extremely black rot-resistant samples and the extremely black rot-susceptible samples, optimizing them to similar concentrations, and then mixing them in equal amounts to generate two extreme pools, together with the screened black rot-resistant rapeseed variety and the two parental DNAs of the original susceptible variety, a total of four samples were subjected to library construction according to a standard 125 bp double-end sequencing protocol, followed by high-throughput sequencing;

[0084] (4) Check and filter the sequencing data, annotate reliable polymorphic variants, and select high-quality SNPs / InDels with a read coverage depth of at least 4 for BSA-seq analysis;

[0085] (5) The Euclidean distance and SNP index methods were used to detect potential candidate regions associated with black rot resistance, and the overlapping sites of SNP and InDel correlation analysis based on these two methods were defined as candidate regions;

[0086] (6) Design primer pairs in the candidate region, and perform PCR using black rot-resistant rapeseed varieties and susceptible varieties of the original source as templates to verify whether there are SNP sites or InDel sites; if there are SNP sites, the amplification product of the primer pair used is the SNP molecular marker; if there are InDel sites, the amplification product of the primer pair used is the InDel molecular marker.

[0087] The following describes the principles and features of the present invention by taking the screening of disease-resistant materials and the specific operation of BSA-seq as examples. In the examples, the disease-resistant material ZS9mXccR-1 and its original source susceptible variety ZS9 are used as examples to illustrate the molecular marker obtaining method of the present invention. However, those skilled in the art will know that other disease-resistant materials and their original source susceptible varieties can also obtain corresponding molecular markers. The materials and reagents used in the following examples, unless otherwise specified, can be purchased from the company through commercial channels.

[0088] Example 1: Inoculation and identification of black rot pathogens in resistant material ZS9mXccR-1

[0089] Under normal conditions for rapeseed growth, 357 natural rapeseed varieties collected worldwide by our laboratory through international and domestic cooperation were sown in the greenhouse (divided by ecotype, 59 spring varieties, 255 semi-winter varieties, 43 winter varieties; divided by geographical location, 257 Asian varieties, 60 European varieties, 16 Oceania varieties, 13 South American varieties, 11 African and incomplete varieties), of which 41 were obtained through chemical mutagenesis and multi-generation self-pollination. The 357 materials were thinned out one week after germination, so that each variety retained about 15 strong seedlings. Three biological replicates were set for inoculation, and 5 seedlings were inoculated in each replicate. When the seedlings grew to 3-4 unfolded leaves, the bacterial solution used for inoculation began to be prepared. First, the black rot Xcc bacteria were inoculated into NYGA agar medium (peptone 5.0 g / L, yeast extract 3.0 g / L, glycerol 20.0 g / L, agar 1.5%, pH 7.0) and cultured at 28°C for about 2 days. Then, the colonies were rinsed into a sterile conical flask with sterile ddH2O, and the OD value of the Xcc suspension was adjusted using a spectrophotometer. 600 The value is increased to 0.4-0.5. When inoculating, first dip the sterilized scissors into the bacterial solution, and then cut the top of the leaf (about 1-1.5 cm) vertically along the main vein of the leaf to allow the bacteria to infect the plant through the wound. Mature leaves are inoculated for each plant, and young leaves and cotyledons are not inoculated. After inoculation, the greenhouse conditions are adjusted (28℃ / 24℃, 14h / 10h day / night, and relative humidity is above 90%) to promote Xcc infection. Disease surveys were conducted on the 8th day after inoculation. Among the 357 rapeseed varieties, the variety numbered ZS9mXccR-1 showed obvious resistance to the black rot Xcc fungus, and there were no lesions on the rapeseed leaves. The ZS9 variety, as the susceptible variety of its original source, was used as a control, and obvious lesions were visible. The difference in lesion length between ZS9mXccR-1 and ZS9 is as shown in the figure. Figure 1 shown.

[0090] At the same time, this embodiment also carried out a colony isolation experiment on the plants on the eighth day of the inoculation. The specific operation is as follows: collect the leaves in the inoculation room and place them in a sterile culture dish. In the clean bench, use the sterilized tweezers and blade to cut several pieces of 2×2 cm at the junction of the diseased and healthy parts, put them in 70% alcohol for 5-8 seconds, and then carefully move them into 0.1% mercuric chloride for disinfection for 90 seconds. Then wash them with sterilized ddH2O for 3 to 4 times, and finally transfer them to a new tube containing 1 ml of sterilized ddH2O. Use a 1 ml gun tip to quickly grind the leaves into a bacterial suspension. Dilute the prepared bacterial suspension in different gradients (such as 10 / 100 / 1000×, to prevent the colony density on the final plate from being too large), draw 50 μl and apply it on the NYGA plate with an inoculation loop, and culture in a 28°C incubator. Figure 2The results showed that the number of colonies isolated from the leaves of ZS9mXccR-1 plants was less than that of the susceptible variety ZS9 at different time points, indicating that the variety ZS9mXccR-1 has obvious resistance to black rot.

[0091] Example 2: Identification of other agronomic traits of the resistant material ZS9mXccR-1

[0092] At the rapeseed harvesting stage, the resistant variety ZS9mXccR-1 and its source susceptible material ZS9 were cloned for multiple traits. Figure 3 As shown. All data in the figure are the mean ± standard deviation of 3 biological replicates (10 plants were measured in each replicate). Asterisks indicate significant differences between the two lineages. As can be seen from the figure, the main inflorescence length and 1000-grain weight of the resistant variety ZS9mXccR-1 are significantly higher than those of the susceptible variety ZS9, indicating that the yield of the resistant variety ZS9mXccR-1 is better than that of the susceptible variety ZS9.

[0093] Example 3: Submicroscopic structural identification of the resistant material ZS9mXccR-1

[0094] Eight days after inoculation, the leaf tissue at the junction of diseased and healthy leaves was carefully cut into small cubes of 3×3 mm and immediately fixed in a buffer solution containing 2.5% (v / v) glutaraldehyde and 0.1M phosphate (pH 7.2). The collected samples were then vacuum treated until the leaves sank to the bottom and were completely fixed. The fixed samples were sent to the electron microscopy platform of the Institute of Virology, Chinese Academy of Sciences for subsequent processing and transmission electron microscopy observation. The results are as follows Figure 4 shown.

[0095] From the transmission electron microscopy results, it can be seen that 5 days after inoculation with the black rot pathogen, the mesophyll cells of the susceptible material ZS9 had slight plasmolysis compared with the resistant material ZS9mXccR-1, and a few chloroplasts were swollen, but the lamellar structure was still clear and evenly arranged, the chloroplasts functioned normally, and starch grains were produced; no significant differences were found in the leaf vascular bundles. 8 days after inoculation with the black rot pathogen, the protoplasts of the mesophyll cells of the susceptible material were significantly reduced, the plasmolysis phenomenon was extremely serious, the chloroplasts were severely deformed and very fluffy, and abundant snowflake-like crystal structures appeared in the cell cavity, which may be substances such as xanthan gum secreted by the pathogen after infecting the cells. At the same time, the presence of pathogens was also found in larger mesophyll cells (indicated by arrows). More small vesicles appeared in the vascular cells, which may be related to the stress response of the plant after being invaded by the pathogen.

[0096] Example 4: Initial localization analysis of disease-resistant intervals using BSA-seq technology

[0097] ZS9mXccR-1 and ZS9 were hybridized, and 30 individuals with extreme resistance to black rot and 30 individuals with extreme sensitivity to black rot were screened from the F2 population after the hybridization of ZS9mXccR-1 (female parent) × ZS9 (male parent). High-quality genomic DNA of these samples was extracted using a kit and optimized to a similar concentration, and then mixed in equal amounts to generate two extreme pools (R and S). Together with the DNA of the two parents ZS9mXccR-1 and ZS9, a total of four samples were sent to Beijing Biomike Biotechnology Co., Ltd., and the library was constructed according to the standard 125bp double-end sequencing protocol, and sequenced on the Illumina HiSeq2500 platform.

[0098] The raw data after the machine was first checked and filtered by NGS QC Toolkit software using default parameters. Then, the filtered reads were mapped to the reference genome of Brassica napus using Burrows-Wheeler Aligner (BWA) and the maximum exact match algorithm. The obtained alignment results were further processed into sorted bam files by SAMtools. Subsequently, SNP and InDel calling was performed using GATK software, and strict quality filtering was performed (parameters were QUAL<30.0||MQ<50.0||QD<2.0, --clusterSize 3--clusterWindowSize 10). The SnpEff tool was then used to annotate reliable polymorphic variants, and finally high-quality SNPs / InDels with a read coverage depth of at least 4 were screened for BSA-seq analysis.

[0099] In order to detect potential candidate regions associated with black rot resistance, the Euclidean distance (ED) and SNP index methods were used. The higher the ED value, the greater the difference between the two different populations, indicating that the corresponding variation is more closely related to the target trait. The purpose of SNP-index analysis is to find significant variations in genotype frequencies between two pools. Specifically, the SNP-index of a site is the ratio of mapped reads with variant alleles to the total reads at that exact position, while the difference of a site in the two pools can be obtained by subtracting their index values, as shown by ΔSNP-index. The overlapping sites of SNP and InDel correlation analysis based on these two methods were defined as candidate regions, between 21.5-27.7M of chromosome A9 (such as Figure 5 and 6 shown).

[0100] Example 5: Development of initial positioning interval and flanking molecular markers

[0101] First, high-quality homozygous polymorphic SNPs with at least 20 reads coverage depth and InDels longer than 10 bases in the candidate region were screened for marker development. In order to identify SNP markers with true polymorphism between the two parental lineages, multiple pairs of different primers were uniformly designed at different positions in the candidate region to amplify approximately 500-2000 bp of sequence containing the target SNP variation.

[0102] The PCR reaction system is (50 μL): 2.5 μL cDNA, 5 μL 10× Buffer, 4 μL dNTP (2.5 mM), 2.5 μL each of forward / reverse primer (10 μM), 1 μL Taq enzyme (5 U / μL) and 32.5 μL ddH2O. Add the sample on ice and mix well. The PCR reaction conditions are: 94℃5min; 94℃30sec, 52-58℃30-120sec (varies according to different product lengths); 72℃30sec, 30 cycles; 72℃10min. Detect by 1% agarose gel electrophoresis.

[0103] Sanger sequencing was performed on the products that could amplify bands in both parents. The peak results of sequencing are shown in Figure 7 A. Finally, the SNP markers with base differences between parents at the same site verified by sequencing were retained, see Table 1.

[0104] Table 1 SNP molecular markers

[0105]

[0106] (1) For Xcc-183, the 364th base of the SNP molecular marker sequence from the 5' end is the SNP site n; n is G or A.

[0107] (2) For Xcc-2010, the 337th base of the SNP molecular marker sequence from the 5' end is the SNP site n; n is A or G.

[0108] (3) For Xcc-3743, the 357th base from the 5' end of the sequence of the SNP molecular marker is the SNP site n; n is A or T.

[0109] (4) For Xcc-3757, the 939th base of the SNP molecular marker sequence from the 5' end is the SNP site n; n is G or A.

[0110] (5) For Xcc-3773, the 376th base of the SNP molecular marker sequence from the 5' end is the SNP site n; n is C or T.

[0111] (6) For Xcc-3920, the 222nd base of the SNP molecular marker sequence from the 5' end is the SNP site n; n is T or C.

[0112] (7) For Xcc-4033, the 516th base of the SNP molecular marker sequence from the 5' end is the SNP site n; n is C or G.

[0113] (8) For Xcc-4043, the 215th base of the SNP molecular marker sequence from the 5' end is the SNP site n; n is A or T.

[0114] (9) For Xcc-4356, the 653rd base of the SNP molecular marker sequence from the 5' end is the SNP site n; n is A or G.

[0115] For InDel markers, this example amplified a 150-200 bp fragment containing the InDel site and performed electrophoresis on a high concentration agarose gel (4-5%) to screen for markers with significant differences in band size between the two parents. The electrophoresis results are shown in FIG. Figure 7 B, Primers were designed using the Primer3Plus online tool (https: / / primer3plus.com / cgi-bin / dev / primer3plus.cgi), and the InDel-marked primer sequences are shown in Table 2.

[0116] Table 2 InDel molecular markers

[0117]

[0118] (10) For InDel-5, when ZS9 is used as the template, the length of the PCR product is 170 bp and the sequence is (5'-3'):

[0119] GCATTTTCATTCTTCAGTGCTATTTTTGTGACAAAAATTTAAAAAAGCTATTTGAAAAGTTGCCCGAAATATAAGACTAAAATTCATCACCATCTCATAATTTTGTATGGTTGATTACTCTATAAATATAATATTCATCACTAAACTATACCTTTTGACTTCGAAAACA

[0120] When ZS9mXccR-1 was used as the template, the length of the PCR product was 119 bp and the sequence was (5'-3'):

[0121] GCATTTTCATTCTTCAGTGCTATTTTTGTGACAAAAATTTAAAAAAGCTATTTGAAAAGTTGCCCGAAATATAAGACTAAAATTCATCACCAATCTCATACCTTTTGACTTCGAAAACA

[0122] The InDel molecule marker is an insertion / deletion fragment with a length of 51 bp.

[0123] (11) For InDel-36, when ZS9 is used as the template, the length of the PCR product is 190 bp and the sequence is (5'-3'):

[0124] CTGAGTCAAGGCTCCAAATAATTCTGATTACTCAGTAAGCAAGCACTCAGAATTTGTATCACGCAGTCAGAACTAATCATTGCTAGGAAAGGTGAATTCTGAATAATAAAAAAAACAAAAATGTTAAATCTTAACGGCCATTATGCATATTATCAGCAAGTGTTATAGATCATACCATTCCTCCAATACG

[0125] When ZS9mXccR-1 was used as the template, the length of the PCR product was 174 bp and the sequence was (5'-3'):

[0126] CTGAGTCAAGGCTCCAAATAATTCTGATTACTCAGTAAGCAAGCACTCAGAATTTGTATCACGCAGTCAGAACTAATCATTGCTAAATAATAAAAAAAACAAAAATGTTAAATCTTAACGGCCATTATGCATATTATCAGCAAGTGTTATAGATCATACCATTCCTCCAATACG

[0127] The InDel molecule marker is an insertion / deletion fragment with a length of 16 bp.

[0128] (12) For InDel-45, when ZS9 is used as the template, the length of the PCR product is 143 bp and the sequence is (5'-3'):

[0129] ATCATGCATAGAAAGCCACTCCAACTCACTTTTGCTTCCAAATTAGCTGTTTGTGATTTTAAATACAATATATGTATAGCAAATATTTTTAATCCATTGGCCAGTTCATCTGTTGAGATCTTAACATGGACGCGTAGTAACT

[0130] When ZS9mXccR-1 was used as the template, the length of the PCR product was 184 bp and the sequence was (5'-3'):

[0131] ATCATGCATGAAAGCCACTCCAACTCACTTTTGCTTCCAAATTAGCTGTTTGTGATTTTAAATACAATATATGTATAGCAAATATTTTTAATCCATTGGCCAGTTCATCTGTAGTTTATATTTTATCTAAACCCTTGAAATAAAAAAAATCTATGAGATCTTAACATGGACGCGTAGTAACT

[0132] The InDel molecule marker is an insertion / deletion fragment with a length of 41 bp.

[0133] (13) For InDel-57, when ZS9 is used as the template, the length of the PCR product is 163 bp and the sequence is (5'-3'):

[0134] CCTCTTCAACTTCTTCTCCAAAATCAAATAAAAACCCTAACCTCTCCTGTTCCTCCCTTTACATCGCTTCTCTCTTACTTGATTGTCTCCGTCTCTTAGTTTGATTTCGAGGGAAAATTAAATTAAAAAAGAAGAAGATGTTTTATTCGCATGTTTACTTGG

[0135] When ZS9mXccR-1 was used as the template, the length of the PCR product was 153 bp and the sequence was (5'-3'):

[0136] CCTCTTCAACTTCTTCTCCAAAATCAAATAAAAACCCTAACCTCTCCTGTTCCTCCCTTTACATCGCTTCTCTCTTACTTGATTCTTAGTTTGATTTCGAGGGAAAATTAAATTAAAAAAGAAGAAGATGTTTTATTCGCATGTTTACTTGG

[0137] The InDel molecule marker is an insertion / deletion fragment with a length of 10 bp.

[0138] In summary of the above embodiments, the use of the above-mentioned SNP molecular markers and InDel molecular markers can clearly distinguish between ZS9mXccR-1 resistant varieties and ZS9 susceptible varieties. The identification method is simple, efficient, has a clear selection target, is not affected by the environment, and can effectively find the exchange plants in the positioning group. It is applied to the fine positioning of disease resistance genes between A9 chromosomes 21.5-27.7M.

[0139] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

[0140] Sequence Listing

[0141] SEQ ID NO.1

[0142] TCCACTTGTTCTGGAGAATGACTTTGTTCTCCTTCTCCTTTCAGGTCTACTCTATCCGTGAAGCTGCAGCAAACAACCTAAAGCGCCTTGCAGAGGAGTTCGGTTCTGAATGGGCAATGCAGCACATAGTTCCACAGGTTTGTTCTTATTAACATCGGTATTGTTTGAGCTGCATATGTAGAGTTCCATATTGACCTTTTCTTTTGTTTTCATGTAGGTACTGGACATGGTAACCAATCCGCACTACCTACATAGGATGATGGTTCTACGAGCAATATCTCTCATGGCTCCTGTAATGGGATCTGAAATTACATGCTCTAAGTTTCTTCCTGTGGTGGTTGAGGCATCAAAAGACAGGTAA GAACATTAGAGATGACTTTGGCTAACTTCTTCAAGAAAGCATCATAGTTTTTAACGTGTTTGTTGTGCTAATAATCTCTGCAGAGGTTCCAAACGTCAAGTTCAATGTTGCAAAACTTCTGCAATCCCTCATCCCCATAGTCGACCAATCAGTAAGATGAGAGATTAAAAATATAACACAAT TGCATCGAATATATAGTGCAGGTTGTTGAACTTTGGTTGTCTCAAAAATTGTAGGTGGTGGAGAAAACAATACGTCAGTGTTTGGTGGACCTGAGCGAGGACCCTGATGTTGATGTTCGATATTTTGCAAACCAAGCCCTTCGTTCCATTGACGGTGCCGCAGTGGCACAATCCTGATTT

[0143] SEQ ID NO.2

[0144] TTTTCAGAGGGAGCTTTTAAGACTTATTGGTCTCAATTTAAACGCTCATCCATTTCTATGTTTTGAGTTATATTTATTATCAACCGGATCTCTTCGCTGATCGCTCCAATACAATTTTTTTATTTCGAAGGTGATTTCATGTTCTTTAACTTTTTAATTTCTGAGTTTATGTTGATTGTAGTTATCTAGGAGTAAGATCATAGGTCAGAATGTTAATTAGTTATCTTAAATCTTTTTATTTTTTTTAAAGAACTGTAATTTAGGATGTTTCTGTGATCTAATTCGATAGGTAACTT GATCAGAACCTGTTCTTGTGTTTCTTGATTCGTATTAATTAGCATCGTATTAGCTTAATAGCTTCTTAAGTTTGGCTAAATCAAGCTCTATTATATGCCTTGGTTCTTGATCCCTGTTTGGGGCCAATGAGGCAATGAATAATAAATTGCAGTATGAATTTCCAGGAAGATATGAGTTCTGATACCAAAAGTTCACCTCCAAGTGAATCTGAGAAAACTTTGCCACCAGAGGAGTATCTAAACAAGGTATGATGATGATAAGAGGAATCACTAGCTGTGTTTGCGATGATGATAATTTGA

[0145] SEQ ID NO.3

[0146] GAGGAGGTGTTGTTGTACGCTTGGGTTAACTACATAGCAGGTGGGAAGTTTCTAGAAGTCAGGTTAAGCAAATCAGAAAGCTTTGAACATGTTGATCCTTTGATGTTCACTAGGATTGACTTGTCAGCAATGTTGAAAGGTAAGGGTGATGAGTTCATGGTTGGTGTGAAGTCGTATGGCGGGAGCTTTAATCTTCACTCGTGGAGCTTGGAAGCGAGAAGCGTCCCTAAGGGTGAGCACTCTTATGCGGCGATTATGGTGGAGAAGCTTATAGAGGAAGAAGAGGAGGCGAAGAAGAGGAGAAGAGCTAGGGCGTGGGGGATTGTGACTTGCTTTGTAATGACTTTTGGGTCTACAGGGCTTGTGTTCTTCGCCTTGATGCATATAT GGGCAGCTTTCAAAAGGAACAATCTTGCGATGGTGATGCAGGAGGAATGTGGAATCAAGACAAAAGAGTTTGAGTACGCAAAGATGGAGAAAATGGAAGCTGTTGTGAGTAAAACTGATAGCACAAAATGAAAAACAAGTGTTGTCATATCTATGTACGTGTGTGTGTGTTTAGGATATGTGATCTTTCTATGTAATCAAGTAGATTCTTCATTGGCTAATGTAATGTAGCCCACTTGTTTTCCTTTCGTGTGTGAACTTTTGCAACATTGTTTCTCTTTGGCATGATTAGTTTGTTTCAGCATGTAAAATGATCCACACCAAACTTGACTACATGGGATACTTTTGACTAGGTAGAACAGAAGAGAACAGCAAACTCAACCTCCTCCT

[0147] SEQ ID NO.4

[0148]

[0149] SEQ ID NO.5

[0150] TGCAAGCACCCTAGTAAACGTACGAACCTTGTTACAAATGAAGATTCTTAACGTTTAATTTATAAGCAAGTAATTAAGATTTAGTTTTTCTTCTTAAAAAAAATTAAGGAAAAATATTAGTAAAACAATAAACAAGCTTATGAACAAACCTTGTTAGGCTAATCGAGAACAGTGTTGTCACCAGTAGTCGTTACAAGAACAAAGACCACCTGCAAAGTGATGAAACCGAACTCTATCCCTTACAATAATATCCCTACTGAATGCTTTCGACACACATTTTGTAAACGAATGACAATCTCTGCAAACTCTGAGATTCTTTGTGATCCTGAGAGCTGTTCCTGCAGGAGTTCTCATCAATCCATAAGCAATAGCCAACTT TTCACTGTGAAACGCAGATCCTAAACACCGATCAGAGAAACCTGAACCGGTTACGTTTGACTCCTCTGGCTTGTAACCAGCTAGTACGGCGTGACGAACTACTTCCTTTAGTTCTGAGTAAATAAATGCGGACTCCGGATGCGTTTTGTCATCAACCACAAATCTGTGAACTTGATCACCAATCTCAAT CCAACTCCAACCTGGAACTGTCCGTAACTCATGACTTCTCATTAGCTTTCTCATGCTAGCAAAGCCTTGAGCATCATTAGCTGCAGAATATATCGAAGTCATAAGCACATAGTCCCCTGCATTGAAAGCCTTGAGCTGAACCAACTTCTTCATAGCTACTTCACCAAGTTCCAAATTCCTGTGGATCTTG

[0151] SEQ ID NO.6

[0152] GAGTTTGGGTGGAGAAGTGATCTGAAGATGTAAAGACTAGAGATAAATTGTAGCTAATATTTGAACAAAAAAGAATTGTAGCTAATATTACGTCAGAACTCAAATATAGATGAAAGAAAGTTGGTTGACCTAATTGAATTATAGAAAAAAGAGAAAGGGGACATTTTAAATAATGTACAAAATATAGGGGCTAGAATGAAATAAAAGAGAGAAACGCCCATTCCGTGTCCTCGTGATCATCTATCTCCTCCTTATAACACTGATAGAAAAATAAAAACAAAAATAAAATCGCTCCCAAAATTCTAACTGTATCGGGAAACATTAAAATCGCAAAAAGTTAATTTTGCGATTTGTTTTGGTTGGGGTTATTTAATTTTTCCTCTTTTAAAATCTATCTGCAACCCAAAAAAACTTGTCCTTTTGAATCTGGGAAACAGAGTTTTGG

[0153] SEQ ID NO.7

[0154] TGAGAACAACGGAGGAGAAGCTGTTGGGGACGGTGTGTCAGAGAACAAAGGGGATGTTGAGAAAACTAGTGGCGGTGGTGATGGTAACTTCTTCGATTGTAATATATGTTTGGATTTGTCAAAGGAGCCGGTTCTCACATGTTGTGGCCATCTTTACTGTTGGCCTTGTCTCTTCCAATGGCTAAACATCTCTGACGCAAAGGAATGTCCGGTTTGCAAAGGAGAGGTGACTGCTAAGACCGTGACGCCGATATACGGGCGTGGGAACCATAAGAGAGAAGTTGAGGAGAGTTTAGATACCAAGATCCCTATGAGACCACATGCTAAACGCATCGAGAGCTTGAGGAATACGATTCAACGGTCTCCTTTTACAATACCGATGGAAGAAATGATTAGACGTATACAGAGTAGGTTTGAGAGGGACTCAACACCTGTCCCTGATTTTAGCAACCGGGAGGCTTCAGAAAGAGTGAACGACCGAGCCAACTCGATTCTTAACCGGTTGATGACTTCTACAGGAGTTAGATCAGAGCAGAACCAGGCTAGTGCTGCAGCAGCAGCAGCATCTGAGGATATTAATCTAAACCCGAACATTGCTGCTCCTGATCTTGAAGGAGAGACCACGACGAGGTTCCATCCTCTGTTGATCAGGAGACAGCTACAGTCACACAGAGTCGCAAGGATCTCGAACTTCACTTCTGCGTTGAGTTCTGCTGAGCGGCTTGTAGACGCGTATTTTAGAACGCATCCATTGGGGAGGAACCACAACCACCAAGAGCTGAACCATCATTCTCCTGTTGTGGTTGATGATAGAGACTCTTTCTCAAGCATTGCAGCTGTTATAAACTCTGAGAGTCAGGTGGATACTGCAGTTGAGATTGATTCCATGGTCACTCTTTCGACGTCTTCTTCGAGGAGAAGGAATGAGAATGGGTCGAGGGTTTCTGATGTTG

[0155] SEQ ID NO.8

[0156] AATGCAAACAGTCCAAATCCCTCGTGACTTGATACTCTTGCCATAATTACGAATTAATCACTAGTAAGACTGATGACCCTTGGTAATTACCAATGTTTTGAAACCCGACCCAGACCCGCGGTTGAACCGGTAAACCCGGCAACCCAGAAAAAATTCGGTTTAGGTTTTGTGAAAAACCCAATATTTAGAAACCCGCAAAAACCCACAAAAACCCAGTAAAACTCGGAATCCGATACCGGTTGAATCATTGGTTGAACCAATAAATAACTTTTACTTCTTTTTTTAATTTTTAATTATGTTTTTAGATTATGTTTTATATTCTAAATTTCCAATTAAGAAGTTATATACTAACAAAAAAAGTTAGGTTTTTCCTTTTTTGTTTTATATTTGTGATTTTTAGATTTTAATGAAGATTTCATTATGCCAGAGAACCAAAACTAGTTGATGTGATTTAGACTAATTACCCTTGAGAGCGTCTTTTCGAATGCCACACTGAAAGAAGC

[0157] SEQ ID NO.9

[0158]

[0159] SEQ ID NO.10

[0160] GCATTTTCATTCTTCAGTGCTATTTTTGTGACAAAAATTTAAAAAAGCTATTTGAAAAGTTGCCCGAAATATAAGACTAAAATTCATCACCAATCTCATAATTTTGTATGGTTGATTACTCTATAAATATAATATTCATCACTAAACTATACCTTTTGACTTCGAAAACA

[0161] SEQ ID NO.11

[0162] CTGAGTCAAGGCTCCAAATAATTCTGATTACTCAGTAAGCAAGCACTCAGAATTTGTATCACGCAGTCAGAACTAATCATTGCTAGGAAAGGTGAATTCTGAATAATAAAAAAAACAAAAATGTTAAATCTTAACGGCCATTATGCATATTATCAGCAAGTGTTATAGATCATACCATTCCTCCAATACG

[0163] SEQ ID NO.12

[0164] ATCATGCATAGAAAGCCACTCCAACTCACTTTTGCTTCCAAATTAGCTGTTTGTGATTTTTAAATACAATATATGTATAGCAAATATTTTTAATCCATTGGCCAGTTCATCTGTTGAGATCTTAACATGGACGCGTAGTAACT

[0165] SEQ ID NO.13

[0166] CCTCTTCAACTTCTTCTCCAAAATCAAATAAAAACCCTAACCTCTCTCTGTTCCTCCCTTTACATCGCTTCTCTCTTACTTGATTGTCTCCGTCTCTTAGTTTGATTTCGAGGGAAAATTAAATTAAAAAAGAAGAAGATGTTTTATTCGCATGTTTACTTGG SEQUENCE LISTING <110> Oil Crops Research Institute, Chinese Academy of Agricultural Sciences <120> A molecular marker for rapeseed black rot and its acquisition method and application <130> 2022-03-11 <160> 13 <170> PatentIn version 3.5 <210> 1 <211> 726 <212> DNA <213> Brassica napus L. <400> 1 tccacttgtt ctggagaatg actttgttct ccttctcctc tttcaggtct actctatccg 60 tgaagctgca gcaaacaacc taaagcgcct tgcagaggag ttcggttctg aatgggcaat 120 gcagcacata gttccacagg tttgttctta ttaacatcgg tattgtttga gctgcatatg 180 tagagttcca tattgacctt ttcttttgtt ttcatgtagg tactggacat ggtaaccaat 240 ccgcactacc tacataggat gatggttcta cgagcaatat ctctcatggc tcctgtaatg 300 ggatctgaaa ttacatgctc taagtttctt cctgtggtgg ttgaggcatc aaaagacagg 360 taagaacatt agagatgact ttggctaact tcttcaagaa agcatcatag tttttaacgt 420 gtttgttgtg ctaataatct ctgcagagtt ccaaacgtca agttcaatgt tgcaaaactt 480 ctgcaatccc tcatccccat agtcgaccaa tcagtaagat gagagattaa aaatataaca 540 caattgcatc gaatatatag tgcaggttgt tgaactttgg ttgtctcaaa aaaattgtag 600 gtggtggaga aaacaatacg tcagtgtttg gtggacctga gcgaggaccc tgatgttgat 660 gttcgatatt ttgcaaacca agcccttcgt tccattgacg gtgccgcagt ggcacaatcc 720 tgattt 726 <210> 2 <211> 601 <212> DNA <213> Brassica napus L. <400> 2 ttttcagacg ggagctttta agacttattg gtctcaattt aaacgctcat ccatttctat 60 gttttgagtt atatttatta tcaaccggat ctcttcgctg atcgctccaa tacaattttt 120 ttattcgaa ggtgatttca tgttctttaa cttttaatt tctgagttta tgttgattgt 180 agttatctag gagtaagatc ataggtcaga atgttaatta gttatcttaa atctttttat 240 tttatttttt aaagaactgt aatttaggat gtttctgtga tctaattcga taggtaactt 300 gatcagaacc tgttcttgtg tttcttgatt cgtattaatt agcatcgtat tagcttaata 360 gcttcttaag tttggctaaa atcaagctct attatatgcc ttggttcttg atccctgttt 420 ggggccaatg aggcaatgaa tataaattg cagtatgaat ttccaggaag atatgagttc 480 tgataccaaa agttcacctc caagtgaatc tgagaaaact ttgccaccag aggagtatct 540 aaacaaggta tgatgatgat aagaggaatc actagctgtg tttgcgatga tgataatttg 600 at 601 <210> 3 <211> 777 <212> DNA <213> Brassica napus L. <400> 3 gaggaggtgt tgttgtacgc ttgggttaac tacatagcag gtgggaagtt tctagaagtc 60 aggttaagca aatcagaaag ctttgaacat gttgatcctt tgatgttcac taggattgac 120 ttgtcagcaa tgttgaaagg taagggtgat gagttcatgg ttggtgtgaa gtcgtatggc 180 gggagcttta atcttcactc gtggagcttg gaagcgagaa gcgtccctaa gggtgagcac 240 tcttatgcgg cgattatggt ggagaagctt atagaggaag aagaggaggc gaagaagagg 300 agaagagcta gggcgtgggg gattgtgact tgctttgtaa tgactttttgg gtctacaggg 360 cttgtgttct tcgccttgat gcatatatgg gcagctttca aaaggaacaa tcttgcgatg 420 gtgatgcagg aggaatgtgg aatcaagaca aaagagtttg agtacgcaaa gatggagaaa 480 atggaagctg ttgtgagtaa aactgatagc acaaaatgaa aaacaagtgt tgtcatatct 540 atgtacgtgt gtgtgtgttt aggatatgtg atctttctat gtaatcaagt agattcttca 600 ttggctaatg taatgtagcc cacttgtttt cctttcgtgt gtgaactttt gcaacattgt 660 ttctctttgg catgattagt ttgtttcagc atgtaaaatg atccacacca aacttgacta 720 catgggatac ttttgactag gtagaacaga agagaacagc aaactcaacc tcctcct 777 <210> 4 <211> 2024 <212> DNA <213> Brassica napus L. <400> 4 tggtcttagt ggcggtttag ctctttttgc tttatctgaa tttaatgttc aagttttatc 60 ttccaatagt agagtcattg atgtatcagc aacaattgat ggcaataaag tttttatctc 120 tttcgtttac ggagatcctg tcattaatca aagacttcat gtttgggagc aattagctag 180 aatcagcact tcacgctctg atgcgtggtt catggttggt gactttaatg aaatcaatgg 240 caaccatgag aaatcaggag gtcgtatccg aagtgagaat tctttttctag actttagact 300 catgcagcaa aactgtggga tgattgagtt tccttactca ggagactgta tgtcttgggt 360 aggaagaagg cataactatc ttgttaaatg tcgacttgac cgagcgatgg ggaatgcaga 420 atggttcagc ttatactcaa actcatcgag tcaatatctc cgcttcatgg gatcggatca 480 ccgacctatt atcactcatt tatccaaccg caagagaaaa ggttggaaaa aatttcgctt 540 tgataagcgc tggatatcca aatctggttt tgaaaacata gtgcaagaag gttggataga 600 tatggagaac aatgttgata tacctctcca tgatcgaatt aagagatgtc gatcaaccat 660 tgcgcgatgg cgtagagagg agaactataa tacacaaaaa atcttggaag aactaaaga 720 780 aattcaactc caaaaggcat atgaagaaga agaagctttt tggcatcaaa aaagccgaaa 840 tctttggttt ataaggcg accgtaatac gaaattctac catgctacaa ccaaacaacg 900 acgggccagg aaccatatca gtggtctgaa tgatagcaga ggagtttggt acgagaatga 960 gagaaaggta aaaacaatcg ccgtggagta ttttaatgat ctctttcat cctatacgag 1020 tgctgatgtt gaagtatctc taaatcacct ggaaagttct atctctctag aaatgcataa 1080 gagcctatgt agagatataa cccctgccga aattaaaaaa gctgtttttt cgatccacccc 1140 tgagaaagct ccaggaccgg acggaatgac tggcctcttt taccagaaat attggagaac 1200 catcggccct caggtgatca aaatggttca agatttcttt aatttggatt cttttgaccc 1260 tcagctcaac gagacaaata tctgcctaat cccaaaaacg gagcggccaa gagatatgtc 1320 taatttccgg ccgattagcc tctgcaatgt gtgctgtaag attatatcta aaattctatg 1380 ccagaggcta cgaagatatc tgccgagcat tatctctgaa actcaatctg cctttgtggc 1440 aggacgtacc atcacagata acatccttct agcccaagaa gcctttcacg ctctgagaac 1500 tataataaa tgtaagaatg agttcatggc cattaaaaca gacatgagca aagcttacga 1560 tagagtggaa tgggattttt tagaagctat gatgaggaaa atgggattca gagagaaatg 1620 gatccattgg ataatgagat gtgtcaaatc agtctcctat agtgtactga taaatggaaa 1680 tcccacaggc caaataactc cctctagagg attacggcag ggagatccac tctcaccata 1740 ccttttcatt ctctgcacag aagttctgat agcaaatata agaacagctg aaaattttagg 1800 acagatcaca tgactcaagg tggcccaagc aagtcctccg atatctcatc tcctctttgc 1860 agatgacagc cttttcttct gtaaagcagt cccagaacaa tgcaacagcc tcctcaacgc 1920 gctaaacacg tatggaagtg tttctggaca aagaattaat tttgagaaat catctatcac 1980 tttcggtaaa aaagtgcctc aagaaaaaat ggaaaacctg caga 2024 <210> 5 <211> 757 <212> DNA <213> Brassica napus L. <400> 5 tgcaagcacc ctagtaaacg tacgaacctt gttacaaatg aagattctta acgtttaatt 60 tataagcaag taattaagat ttagtttttc ttcttaaaaa aaattaagga aaaattag 120 taaaacaata aacaagctta tgaacaaacc ttgttaggct aatcgagaac agtgttgtca 180 ccagtagtcg ttacaagaac aaagaccacc tgcaaagtga tgaaaccgaa ctctatccct 240 tacaataata tccctactga atgctttcga cacacattt gtaaacgaat gacaatctct 300 gcaaactctg agatctttg tgatctgag agctgttcct gcaggagttc tcatcaatcc 360 ataagcaata gccaactttt cactgtgaaa cgcagatcct aaacaccgat cagagaaacc 420 tgaaccggtt acgtttgact cctctggctt gtaccagct agtacggcgt gacgaactac 480 ttcctttagt tctgagtaaa taatgcgga ctccggatgc gttttgtcat siaccacaaa 540 tctgtgaact tgatcaccaa tctcaatcca actcaacct ggaactgtcc gtactcatg 600 acttctcatt agctttctca tgctagcaa gccttgagca tcattagctg cagaatatat 660 cgaagtcata agcacatagt cccctgcatt gaagccttg agctgaacca acttcttcat 720 agctacttca ccaagttcca aattcctgtg gatcttg 757 <210> 6 <211> 446 <212> DNA <213> Brassica napus L. <400> 6 gagtttgggt ggagaagtga tctgagatg taagactag agtaaattg tagctataat 60 ttgaacaaa aagaattgta gctaatatta cgtcagaact caataga tgaagaaag 120 ttggttgacc taattgaatt atagaaaaaa aggaaaggg gatattttaa ataatgtaca 180 aaataggg gctagaatga aaaaagag agaaacgccc attccgtgtc ctcgtgatca 240 tctatctcct ccttataca ctgatagaaa aaaaaaaaaataaat cgctcccaaa 300 attctaactg tatcgggaaa cattaaaatc gcaaaagtt aatttgcga ttgttttgg 360 ttggggttat ttaattttc ctctttaaa atctatctgc aacccaaaaa aacttgtcct 420 dotgaatctg ggaacag dot do 446 <210> 7 <211> 953 <212> DNA <213> Brassica napus L. <400> 7 tgagacaac ggaggagaag ctgttgggga cggtgtgtca gagacaag gggatgttga 60 gaaaactagt ggcggtggtg atggtaactt cttcgattgt atatatgtt tggattgtc 120 aaaggagccg gttctcat gttgtggcca tctttactgt tggccttgtc tcttchcatg 180 gctaaacatc tctgacgcaa aggaatgtcc ggtttgcaa ggagaggtga ctgctaagac 240 cgtgacgccg atatacggggc gtgggaacca taagagagaa gttgaggaga gtttagatac 300 caagatccct atgagaccac atgctaaacg catcgagagc ttgaggaata cgattcaacg 360 gtctcctttt acaataccga tggaagaat gattagacgt atacagagta ggtttgagag 420 ggactcaaca cctgtccctg atttagcaa ccgggaggct tcagaagag tgaacgaccg 480 agccaactcg attcttacc ggttgatgac ttctacagga gttagatcag agcagaacca 540 ggctagtgct gcagcagcag cagcatctga ggattaat ctaaacccga acatgctgc 600 tcctgatctt gaaggagaga ccacgacgag gttccatcct ctgttgatca ggagacagct 660 acagtcacac agagtcgcaa ggatctcgaa cttcacttct gcgttgagtt ctgctgagcg 720 gcttgtagac gcgtatttta gaacgcatcc attgggggg aaccacaacc accagagct 780 gaaccatcat tctcctgttg tggttgatga tagagactt ttctcagca tgcagctgt 840 tataaactct gagagtcagg tggatactgc agttgagat gattccatgg tcactttc 900 gacgtcttct tcgaggagaa ggaatgagaa tggtcgagg gtttctgatg ttg 953 <210> 8 <211> 503 <212> DNA <213> Brassica napus L. <400> 8 aatgcaaca gtccaaatcc ctcgtgactt gatactctg ccatattac gatttaatca 60 ctagtaagac tgatgaccct tggtaattac caatgttttg aaacccgacc cagacccgcg 120 gttgaaccgg taaacccggc aacccagaaa aaattcggtt taggttttgt gaaaaaccca 180 atatttagaa acccgcaaaa acccacaaaa acccagtaaa actcggaatc cgataccggt 240 tgaatcattg gttgaaccaa taaataactt ttacttcttt ttttaatttt taattatgtt 300 tttagattat gttttatatt ctaaatttcc aattaagaag ttatatacta acaaaaaaaag 360 ttaggttttt ccttttttgt tttatatttg tgatttttag attttaatga agatttcatt 420 atgccagaga accaaaacta gttgatgtga tttagactaa ttacccttga gagcgtcttt 480 tcgaatgcca cactgaaaga agc 503 <210> 9 <211> 1300 <212> DNA <213> Brassica napus L. <400> 9 aaattaacgc catcctcgtt samaaatgtc agataatgtg attgatacag gcacttaatt 60 aaaacttagc tgagttttta tataaattaa taaattatat atgcttattt caataatatt 120 180 ttgaaatgtc tgtaaataat tgagttaggt ttgtgcgatg tatatgtttc ttactaaaac 240 aggtataaag tactcattaa atatgtagta caaaacatta ttagtcatta atatattttt 300 aatatccaga tagcaataga atacaatata tgtacgtgtc gactaataaa cctttaacat 360 ttttaaaccc acgaacaaga caaatactag aatcggaaga agatggtcat catagtctta 420 ccaactatgt tccaactgta tgtatttaac tttgtcctaa atctttttgt tggctatata 480 aaaaatatat gtttactaaa tataaattta tgttttattt ctgcttggga tgaaaattaa 540 aatgcttgtt cataagaaag tttaaaataa taattgaaaa tccaacaatt gaaatgcagg 600 acataacata atattgggta cacaaaaaga atacttcatt gtccgggtga ttatggtcgg 660 gtgataaaaa agcgggattg gaacgctaat acgttcaacc cacctgctac gcgaactaaa 720 tgacaattat cctaattaca taacacggat atagattcat actttaaagt ccttttgaat 780 gtccagagaa atgatttatc cctcgactgc acatcttttt ggaagattag tcaatgcctc 840 tttatggacc tggaatactc caggttaatc agaaaaaaac ttcatgataa aagtatactt 900 atggaaatgc aagatctttc ttggtcgaca ctcgacacat aaaactcagt agcaattttg tccgttcaga aggcttaatg ctactaatag catgtcccgt acggccccgt atatgagctg aggagaaaa atacatactc cggaggcttg gcccatttac cacattcttg tagagtctc 1080 gtaattagag ggctagtttt aacttgtgta gatttgtgtt taattttcc aaatgtgaat aacattttat gtacatttat acattaaact ttgaattggt gatttcactt atgttttttc aaacgtctga ttaattatgt attack tgagaaatat tacataaacg atcatgtaga cgtcaattct accacgatat gagaatcacg tctgattgca <210> 10 <211> 170 <212> DNA <213> Brassica napus L. <400> 10 gcattttcat tcttcagtgc tattttgtg acaaaaattt aaaaaagcta tttgaaaagt 120. tgcccgaaat ataagactaa aattcatcac caatctcata attttgtatg gttgattact 170. ctataatat aatattcatc actaaactat accttttgac ttcgaaaaca <210> 11 <211> 190 <212> DNA <213> Brassica napus L. <400> 11 ctgagtcaag gctccaaata attctgatta ctcagtaagc aagcactcag aatttgtatc 60 acgcagtcag aactaatcat tgctaggaaa ggtgaattct gaataataaa aaaaacaaaa 120 atgttaaatc ttaacggcca ttatgcatat tatcagcaag tgttatagat cataccattc 180 ctccaatacg 190 <210> 12 <211> 143 <212> DNA <213> Brassica napus L. <400> 12 atcatgcata gaaagccact ccaactcact tttgcttcca aattagctgt ttgtgatttt 60 taaatacaat atatgtatag caaatatttt taatccattg gccagttcat ctgttgagat 120 cttaacatgg acgcgtagta act 143 <210> 13 <211> 163 <212> DNA <213> Brassica napus L. <400> 13 cctcttcaac ttcttctcca aaatcaaata aaaaccctaa cctctctctg ttcctccctt 60 tacatcgctt ctctcttact tgattgtctc cgtctcttag tttgatttcg agggaaaatt 120 aaattaaaaa agaagaagat gttttattcg catgtttact tgg 163

Claims

1. A molecular marker for rapeseed black rot, characterized in that: The molecular markers include SNP molecular markers and InDel molecular markers, wherein the SNP molecular markers include SNP marker 1, SNP marker 2, SNP marker 3, SNP marker 4, SNP marker 5, SNP marker 6, SNP marker 7, SNP marker 8 and SNP marker 9; the InDel molecular markers include InDel marker 1, InDel marker 2, InDel marker 3 and InDel marker 4; The SNP markers 1 to 9 are all located on chromosome A9 of rapeseed; The SNP marker 1 is the nucleotide sequence shown in SEQ ID NO.1, and the nucleotide sequence shown in SEQ ID NO.1 has a G / A base mutation at position 364 from the 5' end; The SNP marker 2 is the nucleotide sequence shown in SEQ ID NO.2, and the nucleotide sequence shown in SEQ ID NO.2 has an A / G base mutation at position 337 from the 5' end; The SNP marker 3 is the nucleotide sequence shown in SEQ ID NO.3, and the nucleotide sequence shown in SEQ ID NO.3 has an A / T base mutation at position 357 from the 5' end; The SNP marker 4 is a nucleotide sequence shown in SEQ ID NO.4, and the nucleotide sequence shown in SEQ ID NO.4 has a G / A base mutation at position 939 from the 5' end; The SNP marker 5 is the nucleotide sequence shown in SEQ ID NO.5, and the nucleotide sequence shown in SEQ ID NO.5 has a C / T base mutation at position 376 from the 5' end; The SNP marker 6 is a nucleotide sequence shown in SEQ ID NO.6, and the nucleotide sequence shown in SEQ ID NO.6 has a T / C base mutation at position 222 from the 5' end; The SNP marker 7 is the nucleotide sequence shown in SEQ ID NO.7, and the nucleotide sequence shown in SEQ ID NO.7 has a C / G base mutation at position 516 from the 5' end; The SNP marker 8 is a nucleotide sequence shown in SEQ ID NO.8, and the nucleotide sequence shown in SEQ ID NO.8 has an A / T base mutation at position 215 from the 5' end; The SNP marker 9 is a nucleotide sequence shown in SEQ ID NO.9, and the nucleotide sequence shown in SEQ ID NO.9 has an A / G base mutation at position 653 from the 5' end; The InDel molecular markers 1 to 4 are all located on chromosome A9 of rapeseed; The primer pair used to amplify the InDel marker 1 has the following nucleotide sequence: InDel-5-F:GCATTTTCATTCTTCAGTGC; InDel-5-R:TGTTTTTCGAAGTCAAAAGGT; The characteristic band of the InDel marker amplified by the InDel-5 primer pair is 170 bp, and the nucleotide sequence of the InDel marker 1 is shown in SEQ ID NO.10; The primer pair used to amplify the InDel marker 2 has the following nucleotide sequence: InDel-36-F: CTGAGTCAAGGCTCCAAATA; InDel-36-R: CGTATTGGAGGAATGGTATG; The characteristic band of the InDel marker amplified by the InDel-36 primer pair is 190 bp, and the nucleotide sequence of the InDel marker 2 is shown in SEQ ID NO.11; The primer pair used to amplify the InDel marker 3 has the following nucleotide sequence: InDel-45-F: ATCATGCATAGAAAGCCACT; InDel-45-R: AGTTACTACGCGTCCATGTT; The characteristic band of the InDel marker amplified by the InDel-45 primer pair is 143 bp, and the nucleotide sequence of the InDel marker 3 is shown in SEQ ID NO.12; The primer pair used to amplify the InDel marker 4 has the following nucleotide sequence: InDel-57-F: CCTCTTCAACTTCTTCTCCA; InDel-57-R:CCAAGTAAACATGCGAATAA; The characteristic band of the InDel marker amplified by the InDel-57 primer pair is 163 bp, and the nucleotide sequence of the InDel marker 4 is shown in SEQ ID NO.

13.

2. A primer pair for detecting the SNP molecular marker and InDel molecular marker according to claim 1, wherein the sequence of the primer pair is: The primer pair Xcc-183 is used to amplify the nucleotide sequence shown in SEQ ID NO.1; the primer pair Xcc-2010 is used to amplify the nucleotide sequence shown in SEQ ID NO.2; the primer pair Xcc-3743 is used to amplify the nucleotide sequence shown in SEQ ID NO.3; the primer pair Xcc-3757 is used to amplify the nucleotide sequence shown in SEQ ID NO.4; the primer pair Xcc-3773 is used to amplify the nucleotide sequence shown in SEQ ID NO.5; the primer pair Xcc-3920 is used to amplify the nucleotide sequence shown in SEQ ID NO.6; the primer pair Xcc-4033 is used to amplify the nucleotide sequence shown in SEQ ID NO.7; the primer pair Xcc-4043 is used to amplify the nucleotide sequence shown in SEQ ID NO.8; the primer pair Xcc-4356 is used to amplify the nucleotide sequence shown in SEQ ID NO.9; the primer pair InDel-5 is used to amplify the nucleotide sequence shown in SEQ ID NO.10; the primer pair InDel-36 is used to amplify the nucleotide sequence shown in SEQ ID NO.11; The primer pair InDel-45 is used to amplify the nucleotide sequence shown in SEQ ID NO.12; The primer pair InDel-57 is used to amplify the nucleotide sequence shown in SEQ ID NO.

13.

3. Use of the molecular marker according to claim 1 or the primer pair according to claim 2 in screening for black rot resistance in rapeseed.

4. Use of the molecular marker according to claim 1 or the primer pair according to claim 2 in localizing a gene resistant to black rot in rapeseed.

Images