KIR3DL3 is an inhibitory receptor of the immune system and uses thereof

Abstract

Described herein are antibodies that target killer cell immunoglobulin-like receptor protein KIR3DL3, immunogenic fragments thereof and compositions thereof, and methods of using them to treat human diseases, including cancer.

Description

[0001] Government Support Statement

[0002] This technology was made with government support under Grant Numbers R01 CA175498 and R01 DK100525 awarded by the National Institutes of Health. The government has certain rights in the technology.

[0003] Related Applications Cross Reference

[0004] This application claims the benefit of U.S. Provisional Patent Application No. 62 / 911,169, filed October 4, 2019, the contents of which are incorporated by reference in their entirety.

[0005] SEQUENCE LISTING

[0006] The instant application contains a Sequence Listing submitted via USPTO EFS-Web in ASCII format and is incorporated by reference in its entirety. The ASCII copy, created on October 1, 2020, is named SequenceListing.txt and is 140 kilobytes in size. BACKGROUND

[0008] Killer-cell immunoglobulin-like receptors (KIR) proteins include two (KIR2D) or three (KIR3D) immunoglobulin-like extracellular domains (Beziat 2017). KIR3DL3 is a member of the KIR family, but its function was previously unknown (Beziat 2017). The results provided by the present technology demonstrate that KIR3DL3 is an inhibitory receptor of the immune system. The present technology further provides antibodies and immunogenic fragments thereof directed against KIR3DL3 or one or more epitopes thereof, as well as compositions and methods of using the same. According to certain embodiments provided herein, blocking KIR3DL3 function by an antibody or immunogenic fragment thereof, a ligand fusion polypeptide, or a small molecule can be useful in treating cancer and infections, while stimulating KIR3DL3 function by an antibody or immunogenic fragment thereof, a ligand fusion polypeptide, or a small molecule can be useful in treating autoimmune diseases and transplantation.

[0009] Drugs that act to inhibit the immune response can be useful in effectively treating patients with autoimmune diseases or help prevent transplant rejection. For example, currently available treatments for rheumatoid arthritis and kidney transplantation are Abatacept and Betacept They are modified antibody fusion polypeptides that comprise the extracellular domain of human cytotoxic T-lymphocyte-associated antigen 4 (CTLA-4) linked to the Fc region of IgGl. Conversely, drugs that activate the immune response can be useful in effectively treating diseases or disorders, including cancer or infectious diseases. For example, ipilimumab is a monoclonal antibody that activates the immune response by targeting CTLA-4, and can be used to treat melanoma. Pembrolizumab (KEYTRUDA®) is a humanized antibody against the human programmed death receptor-1 (PD-1), and is employed as an anti-PD-1 immunotherapy against certain cancers. Nivolumab (OPDIVO®) is another anti-PD-1 antibody, and is used as an immunotherapy to treat certain cancers. SUMMARY

[0011] In one aspect, the technology relates to an antibody or immunogenic fragment thereof that specifically binds to a KIR3DL3 protein (SEQ ID NO: 335). In certain embodiments, the technology relates to an antibody or immunogenic fragment thereof that specifically binds to a KIR3DL3 protein, wherein the antibody or immunogenic fragment thereof specifically binds to a KIR3DL3 epitope comprising the entire extracellular domain or a portion thereof. In some embodiments, the antibody or immunogenic fragment thereof binds to a KIR3DL3 D0 domain (SEQ ID NO: 337), a KIR3DL3 D1 domain (SEQ ID NO: 338), or a KIR3DL3 D2 domain (SEQ ID NO: 339).

[0012] In one aspect, an antibody or immunogenic fragment thereof provided herein comprises a VH region comprising a CDR1, a CDR2, and a CDR3 having an amino acid sequence of SEQ ID NOs: 7, 9, 11, 31, 33, 35, 54, 56, 76, 78, 80, 100, 102, 104, 124, 126, 128, 148, 150, 152, 172, 174, 176, 196, 198, 200, 220, 222, 224, 244, 246, 248, 268, 270, 272, 292, 294, 296, 316, 318, or 320.

[0013] In one aspect, an antibody or immunogenic fragment thereof provided herein comprises a VH region comprising at least one CDR that is 80% identical to an amino acid sequence selected from SEQ ID NOs: 7, 9, 11, 31, 33, 35, 54, 56, 76, 78, 80, 100, 102, 104, 124, 126, 128, 148, 150, 152, 172, 174, 176, 196, 198, 200, 220, 222, 224, 244, 246, 248, 268, 270, 272, 292, 294, 296, 316, 318, or 320.

[0014] In one aspect, an antibody or immunogenic fragment thereof provided herein comprises a VH region comprising at least two CDRs that are 80% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 7, 9, 11, 31, 33, 35, 54, 56, 76, 78, 80, 100, 102, 104, 124, 126, 128, 148, 150, 152, 172, 174, 176, 196, 198, 200, 220, 222, 224, 244, 246, 248, 268, 270, 272, 292, 294, 296, 316, 318, or 320.

[0015] In one aspect, an antibody or immunogenic fragment thereof provided herein comprises a VH region comprising at least three CDRs that are 80% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 7, 9, 11, 31, 33, 35, 54, 56, 76, 78, 80, 100, 102, 104, 124, 126, 128, 148, 150, 152, 172, 174, 176, 196, 198, 200, 220, 222, 224, 244, 246, 248, 268, 270, 272, 292, 294, 296, 316, 318, or 320.

[0016] In one aspect, an antibody or immunogenic fragment thereof provided herein comprises a VL region comprising a CDR1, a CDR2, and a CDR3 having an amino acid sequence of SEQ ID NOs: 19, 21, 23, 43, 45, 47, 64, 66, 68, 88, 90, 92, 112, 114, 116, 136, 138, 140, 160, 162, 164, 184, 186, 188, 208, 210, 212, 232, 234, 236, 256, 258, 260, 280, 282, 284, 304, 306, 308, 328, 330, or 332.

[0017] In one aspect, an antibody or immunogenic fragment thereof provided herein comprises a VL region comprising at least one CDR that is 80% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 19, 21, 23, 43, 45, 47, 64, 66, 68, 88, 90, 92, 112, 114, 116, 136, 138, 140, 160, 162, 164, 184, 186, 188, 208, 210, 212, 232, 234, 236, 256, 258, 260, 280, 282, 284, 304, 306, 308, 328, 330, or 332.

[0018] In one aspect, an antibody or immunogenic fragment thereof provided herein comprises a VL region comprising at least two CDRs that are 80% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 19, 21, 23, 43, 45, 47, 64, 66, 68, 88, 90, 92, 112, 114, 116, 136, 138, 140, 160, 162, 164, 184, 186, 188, 208, 210, 212, 232, 234, 236, 256, 258, 260, 280, 282, 284, 304, 306, 308, 328, 330, or 332.

[0019] In one aspect, an antibody or immunogenic fragment thereof provided herein comprises a VL region comprising at least three CDRs that are 80% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 19, 21, 23, 43, 45, 47, 64, 66, 68, 88, 90, 92, 112, 114, 116, 136, 138, 140, 160, 162, 164, 184, 186, 188, 208, 210, 212, 232, 234, 236, 256, 258, 260, 280, 282, 284, 304, 306, 308, 328, 330, or 332.

[0020] In certain aspects, an antibody or immunogenic fragment thereof provided herein comprises a monoclonal antibody.

[0021] In certain aspects, an antibody or immunogenic fragment thereof provided herein comprises a chimeric antibody, a human antibody, or a humanized antibody.

[0022] In one aspect, an antibody or immunogenic fragment thereof provided herein comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 7, 9, 11, 19, 21, 23, 31, 33, 35, 43, 45, 47, 54, 56, 64, 66, 68, 76, 78, 80, 88, 90, 92, 100, 102, 104, 112, 114, 116, 124, 126, 128, 136, 138, 140, 148, 150, 152, 160, 162, 164, 172, 174, 176, 184, 186, 188, 196, 198, 200, 208, 210, 212, 220, 222, 224, 232, 234, 236, 244, 246, 248, 256, 258, 260, 268, 270, 272, 280, 282, 284, 292, 294, 296, 304, 306, 308, 316, 318, 320, 328, 330, or 332.

[0023] In one aspect, provided herein is an antibody or immunogenic fragment thereof, wherein the antibody is monoclonal 8G7, monoclonal 26E10, monoclonal 26E2, monoclonal 31C4, monoclonal 34B10, monoclonal 37A3, monoclonal 12A10, monoclonal 3B7, monoclonal 11G8, monoclonal 14F8, monoclonal 15D2, monoclonal 29H7, monoclonal 30D10, or monoclonal 51C3.

[0024] In one aspect, provided herein is an antibody or immunogenic fragment thereof, wherein the antibody is humanized 8G7, humanized 26E10, humanized 26E2, humanized 31C4, humanized 34B10, humanized 37A3, humanized 12A10, humanized 3B7, humanized 11G8, humanized 14F8, humanized 15D2, humanized 29H7, humanized 30D10, or humanized 51C3.

[0025] In another aspect, provided herein is a fusion polypeptide comprising an antibody or immunogenic fragment thereof according to the present technology.

[0026] In certain aspects, provided herein is a composition comprising an antibody or immunogenic fragment thereof, or a fusion protein according to the present technology.

[0027] In another aspect, the composition provided herein further comprises a pharmaceutically acceptable carrier.

[0028] In another aspect, the composition provided herein further comprises a pharmaceutically acceptable excipient.

[0029] In certain aspects, the antibody or immunogenic fragment thereof, fusion polypeptide, or composition according to the present technology can be or comprise a component of a chimeric antigen receptor or an antibody-drug conjugate (e.g., an antibody or immunogenic fragment thereof linked to a cytotoxic agent or molecule).

[0030] In certain aspects, provided herein is an antibody or immunogenic fragment thereof, fusion polypeptide, or composition according to the present technology for use in therapy.

[0031] In certain aspects, provided herein is an antibody or immunogenic fragment thereof, fusion polypeptide, or composition according to the present technology for use in the production of a medicament.

[0032] In another aspect, provided herein is a nucleic acid comprising a nucleic acid encoding an antibody or immunogenic fragment thereof according to the present technology.

[0033] In another aspect, provided herein is a nucleic acid comprising a nucleic acid encoding a fusion polypeptide according to the present technology.

[0034] In certain aspects, provided herein is a method of treating a subject having a disorder, comprising administering to the subject a therapeutically effective amount of an antibody or immunogenic fragment thereof, fusion polypeptide, or composition according to the present technology.

[0035] In some aspects, methods of treating a subject having a disorder are provided, comprising administering to the subject a therapeutically effective amount of an antibody or immunogenic fragment thereof, fusion polypeptide, or composition according to the present technology, wherein the subject has a disorder, and wherein the disorder is a cancer. In some embodiments, the cancer is selected from chronic lymphocytic leukemia (CLL), acute leukemia, acute lymphoid leukemia (ALL), B-cell acute lymphoid leukemia (B-ALL), T-cell lymphoma, B-cell lymphoma, T-cell acute lymphoid leukemia (T-ALL), chronic myeloid leukemia (CML), B-cell prolymphocytic leukemia, T-cell lymphoma, Hodgkin’s disease, B-cell non-Hodgkin’s lymphoma, blastic plasmacytoid dendritic cell neoplasm, Burkitt’s lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell- follicle center lymphoma, large cell-follicle center lymphoma, malignant lymphoproliferative conditions, mucosa-associated lymphoid tissue (MALT) lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndrome, non-Hodgkin’s lymphoma, Hodgkin’s lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom’s macroglobulinemia, or preleukemia. In other embodiments, the cancer is selected from colon cancer, rectal cancer, renal cancer, liver cancer, lung cancer, renal cancer, gastric cancer, gallbladder cancer, small bowel cancer, esophageal cancer, melanoma, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of the soft tissues, cancer of the urethra, cancer of the penis, solid tumors of childhood, cancer of the bladder, cancer of the kidney or ureter, carcinoma of the renal pelvis, neoplasm of the central nervous system (CNS), primary CNS lymphoma, tumor angiogenesis, spinal axis tumor, brain stem glioma, pituitary gland tumor, Kaposi’s sarcoma, epidermoid cancer, squamous cell cancer, environmentally induced cancers, combinations of cancer, and cancer metastasis. In other embodiments, the cancer is a human hematopoietic malignancy.In certain embodiments, the human hematologic malignancy is selected from myeloid neoplasms, acute myeloid leukemia (AML), AML with recurrent genetic abnormalities, AML with myelodysplasia-related changes, therapy-related AML, acute leukemias of undefined lineage, myeloproliferative neoplasms, essential thrombocythemia, polycythemia vera, myelofibrosis (MF), primary myelofibrosis, systemic mastocytosis, myelodysplastic syndromes (MDS), myeloproliferative / myelodysplastic syndromes, chronic myelogenous leukemia, chronic neutrophilic leukemia, chronic eosinophilic leukemia, myelodysplastic syndromes (MDS), refractory anemia with ring sideroblasts, refractory cytopenia with multilineage dysplasia, refractory anemia with excess blasts (type 1), refractory cytopenia with excess blasts (type 2), MDS associated with isolated del(5q), unclassifiable MDS, myeloproliferative / myelodysplastic syndromes, chronic myelomonocytic leukemia, atypical chronic myelogenous leukemia, juvenile myelomonocytic leukemia, unclassifiable myeloproliferative / myelodysplastic syndromes, lymphoid neoplasms, precursor lymphoid neoplasms, B-lymphoblastic leukemia, B-lymphoblastic lymphoma, T-lymphoblastic leukemia, T-lymphoblastic lymphoma, mature B-cell neoplasms, diffuse large B-cell lymphoma, primary central nervous system lymphoma, primary mediastinal B-cell lymphoma, Burkitt lymphoma / leukemia, follicular lymphoma, chronic lymphocytic leukemia, small lymphocytic lymphoma, B-cell prolymphocytic leukemia, lymphoplasmacytic lymphoma, Waldenstrom macroglobulinemia, mantle cell lymphoma, marginal zone lymphoma, post-transplant lymphoproliferative disorder, HIV-associated lymphoma, primary effusion lymphoma, intravascular large B-cell lymphoma, primary cutaneous B-cell lymphoma, hairy cell leukemia, multiple myeloma, monoclonal gammopathy of undetermined significance (MGUS), smoldering multiple myeloma, or solitary plasmacytoma (solitary bone and extramedullary).

[0036] In some embodiments, the cancer is a metastatic cancer.

[0037] In some embodiments, the method of treating a subject having a cancer comprises administering to the subject a therapeutically effective amount of an antibody or immunogenic fragment thereof, fusion polypeptide, or composition according to the present technology, further comprising subjecting the subject to one or more additional cancer therapies selected from chemotherapy, radiation therapy, immunotherapy, surgery, and combinations thereof.

[0038] In some aspects, methods of treating a subject having a disorder are provided, comprising administering to the subject a therapeutically effective amount of an antibody or immunogenic fragment thereof, fusion polypeptide, or composition according to the present technology, wherein the subject has a disorder, and wherein the disorder is an infection. In certain embodiments, the infection is caused by a pathogen. In certain embodiments, the pathogen is a virus. In some embodiments, the virus is selected from human immunodeficiency virus, influenza virus, papillomavirus, coronavirus, hepatitis virus, or herpes virus. In other embodiments, the pathogen is a bacterium. In some embodiments, the bacterium is Mycobacterium tuberculosis. In other embodiments, the pathogen is a prion. In other embodiments, the pathogen is a fungus. In certain embodiments, the fungus is Pneumocystis jirovecii (PJP). In other embodiments, the pathogen is a parasite.

[0039] In some aspects, methods of treating a subject having a disorder are provided, comprising administering to the subject a therapeutically effective amount of an antibody or immunogenic fragment thereof, fusion polypeptide, or composition according to the present technology, wherein the subject has a disorder, and wherein the disorder is an autoimmune disease or disorder. In some embodiments, the autoimmune disease or disorder is selected from acute disseminated encephalomyelitis (ADEM), alopecia areata, antiphospholipid syndrome, autoimmune cardiomyopathy, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune inner ear disease, autoimmune lymphoproliferative syndrome, autoimmune peripheral neuropathy, autoimmune pancreatitis, autoimmune polyendocrine syndrome, autoimmune progesterone dermatitis, autoimmune thrombocytopenic purpura, autoimmune urticarial, autoimmune uveitis, Behcet’s disease disease), celiac disease, Chagas disease, cold agglutinin disease, Crohn’s disease, dermatomyositis, diabetes mellitus type 1, eosinophilic fasciitis, gastrointestinal pemphigoid, Goodpasture’s syndrome, Grave’s syndrome, Guillain-Barre syndrome, Hashimoto’s encephalopathy, Hashimoto’s thyroiditis, lupus erythematosus, Miller-Fisher syndrome, mixed connective tissue disease, myasthenia gravis, pemphigus vulgaris, pernicious anemia, polymyositis, psoriasis, psoriatic arthritis, relapsing polychondritis, rheumatoid arthritis, rheumatic fever, Sjogren’s syndrome syndrome), temporal arteritis, transverse myelitis, ulcerative colitis, undifferentiated connective tissue disease, vasculitis, and Wegener’s granulomatosis. In certain embodiments, the autoimmune disease or disorder is adult rheumatoid arthritis.

[0040] In some aspects, methods of treating a subject having a disorder are provided, comprising administering to the subject a therapeutically effective amount of an antibody, or immunogenic fragment thereof, fusion polypeptide, or composition according to the present technology, wherein the subject has a disorder, and wherein the disorder is a transplant. In some embodiments, the transplant is selected from a stem cell transplant or a bone marrow transplant. In some embodiments, the transplant is selected from a kidney transplant, a lung transplant, a heart transplant, a pancreas transplant, a cornea transplant, or a liver transplant.

[0041] In certain aspects, compositions comprising an antibody, or immunogenic fragment thereof, fusion polypeptide, or combination thereof according to the present technology for use in treating a subject having a disorder are provided.

[0042] In some aspects, there is provided a composition comprising an antibody, immunogenic fragment, fusion polypeptide, or combination thereof according to the present technology for use in treating a subject having a disorder, wherein the disorder is a cancer. In some embodiments, the cancer is selected from chronic lymphocytic leukemia (CLL), acute leukemia, acute lymphoid leukemia (ALL), B-cell acute lymphoid leukemia (B-ALL), T-cell lymphoma, B-cell lymphoma, T-cell acute lymphoid leukemia (T-ALL), chronic myeloid leukemia (CML), B-cell prolymphocytic leukemia, T-cell lymphoma, Hodgkin’s disease, B-cell non-Hodgkin’s lymphoma, blastic plasmacytoid dendritic cell neoplasm, Burkitt’s lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell- follicle center lymphoma, large cell-follicle center lymphoma, malignant lymphoproliferative conditions, mucosa-associated lymphoid tissue (MALT) lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndrome, non-Hodgkin’s lymphoma, Hodgkin’s lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom’s macroglobulinemia, or preleukemia. In other embodiments, the cancer is selected from colon cancer, rectal cancer, renal cancer, liver cancer, lung cancer, kidney cancer, stomach cancer, gallbladder cancer, small bowel cancer, esophageal cancer, melanoma, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of the soft tissues, cancer of the urethra, cancer of the penis, solid tumors of childhood, cancer of the bladder, cancer of the kidney or ureter, carcinoma of the renal pelvis, neoplasm of the central nervous system (CNS), primary CNS lymphoma, tumor angiogenesis, spinal axis tumors, brain stem glioma, pituitary gland tumor, Kaposi’s sarcoma, epidermoid cancer, squamous cell cancer, environmentally induced cancers, combinations of cancers, and cancer metastasis. In other embodiments, the cancer is a human hematopoietic malignancy.In certain embodiments, the human hematologic malignancy is selected from myeloid neoplasms, acute myeloid leukemia (AML), AML with recurrent genetic abnormalities, AML with myelodysplasia-related changes, therapy-related AML, acute leukemias of undefined lineage, myeloproliferative neoplasms, essential thrombocythemia, polycythemia vera, myelofibrosis (MF), primary myelofibrosis, systemic mastocytosis, myelodysplastic syndromes (MDS), myeloproliferative / myelodysplastic syndromes, chronic myelogenous leukemia, chronic neutrophilic leukemia, chronic eosinophilic leukemia, myelodysplastic syndromes (MDS), refractory anemia with ring sideroblasts, refractory cytopenia with multilineage dysplasia, refractory anemia with excess blasts (type 1), refractory cytopenia with excess blasts (type 2), MDS associated with isolated del(5q), unclassifiable MDS, myeloproliferative / myelodysplastic syndromes, chronic myelomonocytic leukemia, atypical chronic myelogenous leukemia, juvenile myelomonocytic leukemia, unclassifiable myeloproliferative / myelodysplastic syndromes, lymphoid neoplasms, precursor lymphoid neoplasms, B-lymphoblastic leukemia, B-lymphoblastic lymphoma, T-lymphoblastic leukemia, T-lymphoblastic lymphoma, mature B-cell neoplasms, diffuse large B-cell lymphoma, primary central nervous system lymphoma, primary mediastinal B-cell lymphoma, Burkitt lymphoma / leukemia, follicular lymphoma, chronic lymphocytic leukemia, small lymphocytic lymphoma, B-cell prolymphocytic leukemia, lymphoplasmacytic lymphoma, Waldenstrom macroglobulinemia, mantle cell lymphoma, marginal zone lymphoma, post-transplant lymphoproliferative disorder, HIV-associated lymphoma, primary effusion lymphoma, intravascular large B-cell lymphoma, primary cutaneous B-cell lymphoma, hairy cell leukemia, multiple myeloma, monoclonal gammopathy of undetermined significance (MGUS), smoldering multiple myeloma, or solitary plasmacytoma (solitary bone and extramedullary).

[0043] In some embodiments, the cancer is a metastatic cancer.

[0044] In some embodiments, there is provided a composition comprising an antibody, immunogenic fragment, fusion polypeptide, or combination thereof according to the present technology for use in treating a subject having a disorder, wherein the composition is co-administered to the subject with one or more additional cancer therapies selected from chemotherapy, radiotherapy, immunotherapy, surgery, or a combination thereof.

[0045] In some aspects, provided are compositions comprising an antibody, immunogenic fragment thereof, fusion polypeptide, or combination thereof according to the present technology for use in treating a subject having a disorder, wherein the disorder is an infection. In certain embodiments, the infection is caused by a pathogen. In certain embodiments, the pathogen is a virus. In some embodiments, the virus is selected from the group consisting of human immunodeficiency virus, influenza virus, papillomavirus, coronavirus, hepatitis virus, or herpes virus. In other embodiments, the pathogen is a bacterium. In some embodiments, the bacterium is Mycobacterium tuberculosis. In other embodiments, the pathogen is a prion. In other embodiments, the pathogen is a fungus. In certain embodiments, the fungus is Pneumocystis jirovecii (PJP). In other embodiments, the pathogen is a parasite.

[0046] In some aspects, provided are compositions comprising an antibody, immunogenic fragment thereof, fusion polypeptide, or combination thereof according to the present technology for use in treating a subject having a disorder, wherein the disorder is an autoimmune disease or disorder. In some embodiments, the autoimmune disease or disorder is selected from the group consisting of acute disseminated encephalomyelitis (ADEM), alopecia areata, antiphospholipid syndrome, autoimmune cardiomyopathy, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune inner ear disease, autoimmune polyendocrine syndrome, autoimmune progesterone dermatitis, autoimmune thrombocytopenic purpura, autoimmune urticarial, autoimmune uveitis, Behcet’s disease, celiac disease, Chagas disease, cold agglutinin disease, Crohn’s disease, dermatomyositis, diabetes mellitus type 1, eosinophilic fasciitis, gastro-intestinal pemphigoid, Goodpasture’s syndrome, Graves’ disease, Guillain-Barre syndrome, Hashimoto’s encephalopathy, Hashimoto’s thyroiditis, lupus erythematosus, Miller-Fisher syndrome, mixed connective tissue disease, myasthenia gravis, pemphigus vulgaris, pernicious anemia, polymyositis, psoriasis, psoriatic arthritis, relapsing polychondritis, rheumatoid arthritis, rheumatic fever, Sjogren’s syndrome, temporal arteritis, transverse myelitis, ulcerative colitis, undifferentiated connective tissue disease, vasculitis, and Wegener’s granulomatosis. In certain embodiments, the autoimmune disease or disorder is adult rheumatoid arthritis.

[0047] In some aspects, provided are compositions comprising an antibody, immunogenic fragment thereof, fusion polypeptide, or combination thereof according to the present technology for use in treating a subject having a disorder, wherein the disorder is a transplantation. In some embodiments, the transplantation is selected from the group consisting of stem cell transplantation or bone marrow transplantation. In some embodiments, the transplantation is selected from the group consisting of kidney transplantation, lung transplantation, heart transplantation, pancreas transplantation, corneal transplantation, and liver transplantation.

[0048] This list is intended to be exemplary and illustrative, rather than comprehensive and limiting. Additional aspects and embodiments can be set forth or be apparent in the remainder of the present technology and in the claims.

[0049] BRIEF DESCRIPTION OF DRAWINGS

[0050] FIGS. 1A-1B show KIR3DL3 protein expression on the cell surface of human adaptive and innate immune cells. Figure 1A A series of panels depicting fluorescence-activated cell sorting (FACS) analysis of peripheral blood mononuclear cells (PBMCs) is shown. FACS analysis shows detection of KIR3DL3 protein on the cell surface of human innate immune cells, including natural killer (NK) cells, natural killer T (NKT) cells, and gd T cells, and adaptive immune cells, including CD8+ T cells and CD4+ T cells. Figure 1B A graph depicting the percentage of KIR3DL3-positive cells in different immune cell populations from PBMCs from six different donors is shown.

[0051] Figures 2A-2C HHLA2 is shown to bind to KIR3DL3, but not to its close homologs KIR3DL1 and KIR3DL2, and the D0 domain and entire extracellular portion of KIR3DL3 bind to HHLA2. Figure 2A Histograms depicting 3T3 cell lines expressing KIR3DL1, KIR3DL2, or KIR3DL3 stained with HHLA2-Ig fusion polypeptide (open histograms) or control Ig (shaded histograms) are shown. Figure 2B A panel showing the results of a cell-to-cell conjugate assay is shown, indicating that 3T3 cell lines expressing HHLA2 bind to 3T3 cell lines expressing KIR3DL3, but not to control 3T3 cell lines. Figure 2C Histograms depicting 3T3 cell lines expressing HHLA2 bound by the D0 domain (red) and entire extracellular portion (red) of KIR3DL3 are shown.

[0052] Figures 3A-3B Results shown indicate that TMIGD2 and KIR3DL3 bind to non-overlapping sites on HHLA2. Figure 3A A graph depicting the mean fluorescence intensity (MFI) of 3T3 cells expressing HHLA2 incubated with the indicated concentrations of TMIGD2-mIg fusion polypeptide or control mIgG before staining with 10 pg / ml KIR3DL3-hIg, then stained with APC-conjugated anti-human IgG Fc, is shown. Figure 3B A graph depicting the MFI of 3T3 cells expressing HHLA2 incubated with the indicated concentrations of KIR3DL3-hIg fusion polypeptide or control hIgG before staining with 10 pg / ml TMIGD2-mIg, then stained with APC anti-mouse IgG Fc, is shown.

[0053] Figures 4A-4B The results shown indicate that KIR3DL3 inhibits immune cell function. Figure 4A Plots depicting FACS analysis and quantification of specific lysis. KIR3DL3 + or KIR3DL3 - NK92 cells were sorted and KIR3DL3 expression was verified by FACS. Cytotoxicity assays were performed by incubating NK92 cells with target control K562 or KIR3DL3 Figure 4B are plots depicting the percentage of specific lysis after cytotoxicity assays of KIR3DL3 + CD8 + T cells (terminally differentiated effector cells). Cytotoxicity assays were performed by incubating KIR3DL3 + CD8 + T cells with target control K562 or HHLA2 / K562 at the indicated effector to target cell ratios. *P<0.05; **P<0.01.

[0054] Figures 5A-5B Show that anti-KIR3DL3 blocking monoclonal antibodies (mAbs) neutralize KIR3DL3-induced immune suppression. Figure 5A are plots depicting the percentage of specific lysis after cytotoxicity assays of KIR3DL3 + NK92 cells pre-incubated for 45 minutes at room temperature (RT) with anti-KIR3DL3 mAbs (clone 26E10, 34B10, 30D10, 8G7). Figure 5B are plots quantifying the percentage of specific lysis in the indicated cells after cytotoxicity assays. Target control K562 or HHLA2 / K562 were subjected to cytotoxicity assays at an E:T ratio of 5:1. *P<0.05; **P<0.01.

[0055] Figures 6A-6B Show that monoclonal antibodies against the IgV1 domain of HHLA2 can block HHLA2 binding to KIR3DL3 and neutralize KIR3DL3-induced immune suppression. Figure 6A are plots depicting the mean fluorescence intensity (MFI) of 3T3 cells expressing HHLA2 pre-incubated with anti-HHLA2 mAbs or control mouse IgG and then stained with KIR3DL3-Ig protein at different concentrations. KIR3DL3-Ig protein binding to HHLA2 was verified by FACS. Figure 6Bis a graph depicting the percent specific lysis after performing a toxicity assay on HHLA2 / K562 target cells pre-incubated with anti-HHLA2 mAb (clone B5B5, A3H11, 566.1) or isotype mlgGl. Percent specific lysis was determined by dividing the number of KIR3DL3 + Cytotoxicity assays were performed by incubating NK92 cells with control K562 or HHLA2 / K562 at an E:T ratio of 5:1 for 4 hours at 37°C. *P<0.05; **P<0.01.

[0056] Figure 7 A series of FACS blots depicting the expression pattern of two receptors, KIR3DL3 and TMIGD2, on human NK cells, CD8 + T cells, and CD4 + T cells.

[0057] Figure 8 Two graphs are depicted, which depict histograms of 3T3 cell lines expressing TMIGD2 stained with HHLA2 EC-Ig-Fc fusion polypeptide (left, red histogram), HHLA2-IgVl-hlgG fusion polypeptide (right, red histogram), or control Ig (black histogram).

[0058] Figure 9 KIR3DL3 depicts a table including the percent potential expression of KIRDL3 mRNA levels in 1425 human tumor lines. KIR3DL3 mRNA is expressed in many tumor lines of human hematopoietic malignancies. Figure 9 The top 40 lines expressing the highest levels of KIR3DL3 mRNA are depicted.

[0059] Figures 10A-10D The ITIM motif of KIR3DL3 is shown to mediate NK cell inhibition by recruiting SHR1 / 2. Figure 10A Wild type (WT) KIR3DL3 and the ITIM mutant of KIR3DL3 (Y381F) with a tyrosine (Y) to phenylalanine (F) mutation at the ITIM sequence (YAQL), and their expression by flow cytometry are depicted. Figure 10B Tyrosine phosphorylation of KIR3DL3 WT and Y381F mutant after per-vanadate treatment is depicted. Figure 10C Cytotoxicity assays performed by incubating KIR3DL3 WT or Y381F NK92 cells with K562 (top panel, control K562 or HHLA2 / K562) or Raji (bottom panel, control Raji or HHLA2 / Raji) at the indicated E:T ratios are shown. One representative of 3 independent experiments is shown. *P<0.05, **P<0.01; NS, not significant.Figure 10D Co-immunoprecipitation demonstrating KIR3DL3 interaction with both SHP-1 and SHP-2.

[0060] Figure 11 KIR3DL3 expression on tumor infiltrating immune cells in various human cancers, including renal, gastric, lung, gallbladder, and pancreatic cancers, is shown. Representative images indicate human cancers with KIR3DL3 and CD45 co-expression (DAPI: blue, CD45: red, KIR3DL3: green). Left panel: overlay of all markers; middle panel: CD45 and DAPI; right panel: KIR3DL3 and DAPI. Scale bar, 50 μm.

[0061] Figures 12A-12F KIR3DL3 blockade promotes anti-tumor immunity is shown. Figures 12A-12B Intraperitoneal tumor mouse model treated with primary NK cells and anti-KIR3DL3 mAb is shown. Figure 12A An overview of the experimental procedure is depicted. Figure 12B Bioluminescence measurements of tumor growth for the 26E10 (blue line) and mlgGl (black line) groups are depicted. Data are the mean ± SEM of total flux imaged per mouse per flank. Figures 12C-12D Lung metastasis mouse model treated with primary NK cells and anti-KIR3DL3 mAb is shown. Figure 12C An overview of the experimental procedure is depicted. Figure 12D Bioluminescence measurements of tumor growth for the 26E10 (blue) and mlgGl (black) groups are depicted. Data are the mean ± SEM of the mean of total flux imaged per mouse per flank and per abdomen. P values are two-way ANOVA. Figures 12E-12F Subcutaneous tumor mouse model treated with primary NK cells and anti-KIR3DL3 mAb is shown. Figure 12E An overview of the experimental procedure is depicted. Figure 12F Evaluation of tumor growth is depicted. Mean tumor volume ± SEM is shown. i.p., intraperitoneal. i.v., intravenous. s.c., subcutaneous. DETAILED DESCRIPTION

[0063] Killer cell immunoglobulin-like receptors (KIR) proteins include two (KIR2D) or three (KIR3D) immunoglobulin-like extracellular domains (Beziat 2017). KIR3DL3 is a member of the KIR family, but its function is not known (Beziat 2017). KIR3DL3 protein is expressed on the surface of human adaptive and innate immune cells. According to the results provided herein, KIR3DL3 inhibits the function of human immune cells. Thus, blocking KIR3DL3 function by an antibody, ligand fusion polypeptide, or small molecule can be useful for treating cancer or infection, while stimulating KIR3DL3 function by an antibody, ligand fusion polypeptide, or small molecule can be useful for treating autoimmune disease or transplantation. KIR3DL3 is expressed in a variety of human hematologic malignancies, so killing KIR3DL3 positive tumor cells using antibodies and other molecules can be useful for treating human hematologic malignancies. The present technology provides antibodies to KIR3DL3 or one or more epitopes thereof, as well as compositions and methods of using them.

[0064] The results provided by the present technology demonstrate that KIR3DL3 inhibits immune cell function. Furthermore, KIR3DL3 induced immune suppression is neutralized by administration of anti-KIR3DL3 blocking mAbs, such as those provided herein. Thus, isolated antibodies, including monoclonal antibodies, to KIR3DL3 can act to block KIR3DL3 function, thereby enhancing immune cell function. Furthermore, other results provided herein demonstrate that HHLA2 binds to KIR3DL3, but not to its close homologs KIR3DL1 and KIR3DL2. Thus, antibodies to the IgV1 domain of HHLA2 can block the binding of HHLA2 to KIR3DL3, thereby neutralizing KIR3DL3 induced immune suppression.

[0065] Definitions and Abbreviations

[0066] Unless otherwise defined, each of the following terms has the meaning set forth in this section.

[0067] The indefinite articles “a” and “an” mean at least one, and are used interchangeably with the phrases “at least one” and “one or more.” For example, the phrase “a module” means at least one module, or one or more modules.

[0068] The conjunctions “or” and “and / or” are used interchangeably.

[0069] As used herein, the term "antibody" is used to refer to both natural antibodies and genetically engineered or otherwise modified forms of immunoglobulins, including chimeric antibodies, human antibodies, humanized antibodies, or synthetic antibodies. The antibodies disclosed herein can be monoclonal or polyclonal antibodies. In those embodiments in which the antibody is an immunogenically active portion of an immunoglobulin molecule, the antibody can include, but is not limited to, a single chain Fv antibody (scFv), a disulfide-linked Fv, a single domain antibody (dAb), a Fab, a Fab', a Fab fragment, a F(ab')2, or a diabody. The antibodies disclosed herein, including those comprising an immunogenically active portion of an immunoglobulin molecule, retain the ability to bind to a particular antigen, e.g., KIR3DL3, or one or more epitopes thereof.

[0070] "Domain" is used to describe a fragment of a protein or nucleic acid. Unless otherwise specified, a domain need not have any particular functional property.

[0071] "Subject" refers to a human, a mouse, or a non-human primate. A human subject can be of any age (e.g., infant, child, young adult, or adult), and can have a disease, such as cancer. In some embodiments, a subject has a disease, disorder, or condition. In some embodiments, a subject is susceptible to a disease, disorder, or condition. In some embodiments, a subject exhibits one or more symptoms or features of a disease, disorder, or condition. In some embodiments, a subject does not exhibit any symptoms or features of a disease, disorder, or condition. In some embodiments, a subject is a human having one or more features of susceptibility or risk to a disease, disorder, or condition. In some embodiments, a subject is a patient. In some embodiments, a subject is an individual who receives and / or has received a diagnosis and / or treatment.

[0072] "Treat," "treating," and "treatment," as used herein, refer to the treatment of a disease in a subject (e.g., a human subject), including inhibiting the disease, i.e., arresting or preventing its development or progression; relieving the disease, i.e., causing the condition to regress; relieving one or more symptoms of the disease; and curing the disease.

[0073] "Prevent," "preventing," and "prevention," as used herein, refer to the prevention of a disease in a subject (e.g., a human), including (a) avoiding or preventing the disease; (b) affecting susceptibility to the disease; and (c) preventing or reducing the onset and / or frequency and / or severity of at least one symptom of the disease.

[0074] The terms "polynucleotide", "nucleotide sequence", "nucleic acid", "nucleic acid molecule", "nucleic acid sequence", and "oligonucleotide" refer to a series of nucleotide bases (also referred to as "nucleotides") in DNA and RNA and to any chain of two or more nucleotides. A polynucleotide can be a chimeric mixture or derivative or modified form thereof, single-stranded or double-stranded. Oligonucleotides can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to increase the stability of the molecule, its hybridization parameters, etc. Nucleotide sequences typically carry genetic information, including information that cellular machinery uses to make proteins and enzymes. These terms include double- or single-stranded genomic DNA, RNA, any synthetic and genetically manipulated polynucleotides, and sense and antisense polynucleotides. This also includes nucleic acids containing modified bases.

[0075] Conventional IUPAC symbols are used in the nucleotide sequences presented herein, as shown in Table 1 below (see also Cornish-Bowden 1985, incorporated by reference herein). It should be noted, however, that "T" means "thymine or uracil" because a given sequence (such as a gRNA sequence) can be encoded by DNA or RNA.

[0076] Table 1: IUPAC nucleic acid symbols

[0077] Character Base A Adenine T Thymine G Guanine C Cytosine U Uracil K G or T / U M A or C R A or G Y C or T / U S C or G W A or T / U B C, G, or T / U V A, C, or G H A, C, or T / U D A, G, or T / U N A, C, G, or T / U

[0078] The terms "protein", "peptide", and "polypeptide" are used interchangeably to refer to a chain of contiguous amino acids linked together via peptide bonds. These terms include individual proteins, groups or complexes of proteins, as well as fragments, variants, derivatives, and analogs of such proteins, bound together. Peptide sequences are represented using conventional notation, starting from the amino or N-terminus on the left, to the carboxyl or C-terminus on the right. Standard one-letter or three-letter abbreviations can be used.

[0079] Generation and Sequences of mAbs Against Human KIR3DL3

[0080] KIR3DL3 is a member of the KIR family, but its function was previously unknown (Beziat 2017). The extracellular portion of KIR3DL3 consists of three domains (D0, D1, and D2). According to the examples provided herein, the following fusion polypeptides were generated: 1) a KIR3DL3 D0-Ig fusion polypeptide by fusing the KIR3DL3 D0 coding region (Q26-A128) with a human IgGl Fc tag; and 2) a KIR3DL3 D0D1D2-Ig fusion polypeptide by fusing the KIR3DL3 D0D1D2 coding region (Q26-L325) with a human IgGl Fc tag using a previously reported method (Zhao 2013). In some embodiments, the fusion polypeptides were expressed in the S2 system and then purified. Mice were immunized with either the KIR3DL3 D0 (Q26-A128)-Ig fusion polypeptide or the KIR3DL3 D0 (Q26-A128)-Ig fusion polypeptide and hybridomas were generated from spleen cells fused to NS0 myeloma cells by standard techniques. The human KIR3DL3 sequence is shown below in Table 2.

[0081] Table 2: Human KIR3DL3 sequence

[0082]

[0083]

[0084] In some embodiments, mAbs against KIR3DL3 protein were obtained from the hybridomas discussed above, and the binding affinity of each mAb was determined as shown below in Table 3.

[0085] Table 3: mAb binding affinity

[0086]

[0087]

[0088] In some embodiments, after assessing binding affinity, the hybridomas were sequenced. Sequencing showed that each of the 14 mAbs produced had unique VH and VL sequences. Each VH or VL has three CDRs (CDR1, CDR2, and CDR3). These sequences are provided in SEQ ID NOs: 1-333 and annotated in Table 4 below.

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099]

[0100]

[0101]

[0102]

[0103]

[0104]

[0105]

[0106]

[0107]

[0108]

[0109]

[0110]

[0111]

[0112]

[0113]

[0114]

[0115]

[0116]

[0117]

[0118]

[0119]

[0120]

[0121] In some embodiments, a provided antibody or immunogenic fragment thereof comprises a sequence that is at least 80% identical (e.g., at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical) to one or more complementarity determining regions (CDRs) (e.g., CDR1, CDR2, or CDR3) listed in Table 4. In some embodiments, a provided antibody or immunogenic fragment thereof comprises a sequence that is at least 80% identical to one or more VH CDRs listed in Table 4. In some embodiments, a provided antibody or immunogenic fragment thereof comprises a sequence that is at least 80% identical to two or more VH CDRs listed in Table 4. In some embodiments, a provided antibody or immunogenic fragment thereof comprises a sequence that is at least 80% identical to three VH CDRs listed in Table 4. In some embodiments, a provided antibody or immunogenic fragment thereof comprises a sequence that is at least 80% identical to one or more VL CDRs listed in Table 4. In some embodiments, a provided antibody or immunogenic fragment thereof comprises a sequence that is at least 80% identical to two or more VL CDRs listed in Table 4. In some embodiments, a provided antibody or immunogenic fragment thereof comprises a sequence that is at least 80% identical to three VL CDRs listed in Table 4.

[0122] In some embodiments, the antibody is or comprises a humanized antibody. "Humanized" forms of non-human (e.g., rodent) antibodies are chimeric antibodies that include sequences derived from non-human antibodies. In many cases, humanized antibodies are human immunoglobulins in which residues from a highly variable domain of the recipient or donor antibody are replaced by residues from a highly variable domain of a non-human species (e.g., mouse, rat, rabbit, or non-human primate) (donor antibody) that have the desired specificity, affinity, and capacity. In some instances, residues of the framework region (FR) of a human immunoglobulin are replaced by corresponding residues from a non-human antibody. Additionally, humanized antibodies can include residues that are not found in the recipient or donor antibody. In some embodiments, such modifications can be made to further refine antibody performance. In general, a humanized antibody can comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin and all or substantially all of the FRs correspond to those of a human immunoglobulin sequence. Additionally, the humanized antibody can optionally include at least a portion of an immunoglobulin constant region (Fc), or typically the human immunoglobulin constant region. Techniques for humanizing monoclonal antibodies are well known to those of skill in the art and have been described previously. See, e.g., U.S. Patent Nos. 4,816,567; 5,807,715; 5,866,692; 6,331,415; 5,530,101; 5,693,761; 5,693,762; 5,585,089; and 6,180,370; Jones 1986; Riechmann 1988; Vaswani & Hamilton 1998; Harris 1995; Hurle & Gross 1994. In certain aspects, the present technology provides nucleic acids encoding humanized antibodies. Such nucleic acids provided herein can be present in isolated form, in partially purified form, or in substantially pure form in cells, cell lysates. Nucleic acids are "isolated," "partially purified," or "substantially pure" when separated from different cellular components or other cellular components (e.g., nucleic acids or proteins of different cells) by techniques known to those of skill in the art, including but not limited to, alkaline / SDS treatment, CsCl banding, column chromatography, agarose gel electrophoresis, or any other suitable technique. Nucleic acids according to the present technology can be, for example, DNA or RNA, and can or can not include intron sequences.

[0123] Nucleic Acid

[0124] The technology includes nucleic acids comprising one or more nucleotide sequences encoding one or more heavy chains, heavy chain variable domains, heavy chain framework regions, heavy chain CDRs, heavy chain constant domains, light chains, light chain variable domains, light chain framework regions, light chain CDRs, light chain constant domains, or other immunoglobulin-like sequences, antibodies, or binding molecules disclosed herein. In some embodiments, such nucleotide sequences can be present in a vector (e.g., a plasmid or viral vector). In some embodiments, such nucleotides can be present in the genome of a cell (e.g., a cell of a subject in need of treatment) or a cell used to produce an antibody (e.g., a mammalian cell) to produce an antibody.

[0125] KIR3DL3 Protein Expression and Binding

[0126] Fluorescence-activated cell sorting (FACS) analysis of PBMCs using the anti-KIR3DL3 mAbs provided herein showed that KIR3DL3 protein is widely expressed on the cell surface of both innate immune cells (NK cells, NKT cells, gd T cells) and adaptive immune cells (CD8 T cells and CD4 T cells) (Figure 1). In CD8 T cells, KIR3DL3 is mainly expressed on terminally differentiated effector CD8 T cells.

[0127] Previous studies found that HHLA2 is the newest member of the B7 family and demonstrated that it can inhibit T cell proliferation and function (Zhao 2013; U.S. Patent No. 10,093,737). Subsequent studies reported that HHLA2 is overexpressed in multiple types of human cancers (Cheng 2018; Cheng 2017; Koirala 2016; Janakiram 2015). To test the binding of HHLA2 to KIR3DL1, KIR3DL2, and KIR3DL3, 3T3 cell lines stably expressing cell surface KIR3DL1, KIR3DL2, or KIR3DL3 were generated. FACS assay results demonstrated that HHLA2 protein binds to 3T3 cells expressing KIR3DL3, but not to 3T3 cells expressing KIR3DL1 or KIR3DL2 Figure 2A ). In addition, cell-to-cell conjugate assays showed that 3T3 cell lines expressing HHLA2 bind to 3T3 cell lines expressing KIR3DL3, but not to control 3T3 cell lines Figure 2B ). These results demonstrate that HHLA2 binds to KIR3DL3, but not to its close homologs KIR3DL1 and KIR3DL2.

[0128] The results provided herein further demonstrate that the D0 domain and the entire extracellular portion of KIR3DL3 bind to HHLA2 (Figure 2C ), indicating that the D0 domain of KIR3DL3 is the functional domain for the interaction between KIR3DL3 and HHLA2.

[0129] Since HHLA2 can bind to KIR3DL3 and / or TMIGD2, a competitive experiment was performed using FACS and demonstrated that TMIGD2 cannot inhibit the binding of KIR3DL3 to HHLA2 Figure 3A ), and KIR3DL3 cannot inhibit the binding of TMIGD2 to HHLA2 Figure 3B ), indicating that KIR3DL3 and TMIGD2 bind to non-overlapping sites in HHLA2.

[0130] KIR3DL3 Inhibits Function of Human Immune Cells and Anti-KIR3DL3 Blocking mAbs Neutralize KIR3DL3-Induced Immune Suppression Figure 4A

[0131] KIR3DL3 binds to HHLA2, compared to KIR3DL1 and KIR3DL2 that bind to HLA-A and / or HLA-B, but the function of KIR3DL3 was previously unknown (Beziat 2017). To elucidate the function of KIR3DL3, experiments were performed using FACS to separate the human NK cell line NK92 into KIR3DL3 positive population (KIR3DL3 + NK92) and KIR3DL3 negative population (KIR3DL3 - NK92) to study NK-mediated killing function. The results showed that KIR3DL3 - NK92 cells killed HHLA2 positive K562 cells (HHLA2 + K562) and HHLA2 negative K562 cells (HHLA2 - K562) Figure 4A ) to the same extent, but KIR3DL3 + NK92 cells killed HHLA2 - K562 cells significantly more efficiently than HHLA2 + K562 cells Figure 4B ). Next, KIR3DL3 + CD8 T cells (terminally differentiated effector cells) were sorted using FACS, and these cells were expanded in vitro with anti-CD3 / CD28, IL-2, and feeder cells to generate sufficient cells. Next, CD8 T cell-mediated killing experiments were performed, which demonstrated that KIR3DL3 + CD8 T cells killed K562 cells significantly more efficiently than HHLA2 + K562 cells Figures 4A-4B ). These results demonstrate that KIR3DL3 inhibits the function of immune cells when bound to HHLA2.

[0132] Following the demonstration that KIR3DL3 induces immune suppression, Figure 4A experiments were performed to determine whether anti-KIR3DL3 mAbs, such as those provided herein, are able to block the function of KIR3DL3. To test this, KIR3DL3 + NK92 cells were pre-incubated with anti-KIR3DL3 mAbs or negative control mouse IgGl antibody. As a proof of principle, four anti-KIR3DL3 mAbs (26E10, 34B10, 30D10, 8G7) were tested. Following pre-incubation, cells were subjected to an NK cell-mediated killing assay. Figure 5A The NK cell-mediated killing assay employed. Following the cytotoxicity assay, cells pre-incubated with mouse IgGl showed no effect, whereas cells pre-incubated with anti-KIR3DL3 mAbs (26E10, 34B10, 30D10, 8G7) exhibited significantly enhanced KIR3DL3 + NK92 cell-mediated killing of HHLA2 + targeted KIR3DL3 Figure 6A

[0133] The extracellular portion of HHLA2 includes IgVl, IgC, and IgV2 domains (Zhao 2013). In previous work, an anti-HHLA2 mAb (566.1) was generated that recognizes the IgCIgV2 portion (Zhao 2013). Subsequently, two additional anti-HHLA2 mAbs (A3H11 and B5B5) were generated. These two antibodies recognize the IgVl domain. Here, binding competition assays showed that A3H11 and B5B5, but not 566.1, blocked the binding of KIR3DL3 protein to HHLA2 Figure 6B ). Additionally, A3H11 and B5B5 mAbs, but not 566.1, neutralized KIR3DL3-induced immune suppression in NK cell killing assays Figure 7 . These results demonstrate that the IgVl domain of HHLA2 can bind to KIR3DL3, thereby inhibiting immune cells, and that mAbs against the IgVl domain of HHLA2 are able to block the binding of HHLA2 to KIR3DL3 and neutralize KIR3DL3-induced immune suppression.

[0134] The different expression patterns between KIR3DL3 and TMIGD2 were unknown. Therefore, experiments were performed with FACS to examine the expression of these two receptors on human immune cells in PBMCs. These experiments showed that KIR3DL3 positive CD8 and CD4 T cells are TMIGD2 negative, whereas NK cells can be KIR3DL3 + / TMIGD2 + KIR3DL3​+ / TMIGD2 - , KIR3DL3 - / TMIGD2 + , or KIR3DL3 - / TMIGD2 - ( Figure 8 ). These results indicate that, although both are receptors for HHLA2, TMIGD2 and KIR3DL3 have different expression patterns.

[0135] To test the binding of TMIGD2 to HHLA2, a 3T3 cell line expressing TMIGD2 was stained with HHLA2 EC-Ig-Fc fusion polypeptide, HHLA-2-IgV1-hIgG fusion polypeptide, or Ig (control) ( Figure 8 ). These results show that the IgV1 domain and the entire extracellular portion of HHLA2 bind to TMIGD2 ( KIR3DL3 Inhibits Function of Human Immune Cells Through ITIM Motif Recruitment of SHP1 / 2 ), indicating that the IgV1 domain of HHLA2 is the functional domain of the interaction between HHLA2 and TMIGD2.

[0136] Figure 10A

[0137] To further explore the mechanism by which KIR3DL3 mediates immune cell suppression, a mutant of KIR3DL3, Y381F, was generated by replacing the tyrosine (Y) residue at position 381 of the YAQL sequence within the ITIM motif with a phenylalanine (F) residue ( Figure 10A ). KIR3DL3-negative (KIR3DL3 - ) NK92 cells were transduced with WT KIR3DL3 or Y381F mutant construct and KIR3DL3 expression was tested by flow cytometry. Expression of KIR3DL3 WT and Y381F was detected in cells transduced with the corresponding construct ( Figure 10B ). Next, tyrosine phosphorylation of KIR3DL3 WT and Y381F mutant was tested. Briefly, transfected NK92 cells were incubated at 37°C for 5 min in the presence (+) or absence (-) of pervanadate (VO4, 1 mM). Pervanadate is an inhibitor of protein tyrosine phosphatases that acts to promote phosphorylation of proteins at tyrosine residues. Cell lysates were immunoprecipitated with anti-KIR3DL3 antibody and tyrosine phosphorylation was tested by immunoblotting using KIR3DL3 antibody and phospho-tyrosine antibody (4G10). Results are shown for whole cell lysates (WCL) and immunoprecipitates (IP) samples ( Figure 10C ). As expected, tyrosine phosphorylation was detected in WT KIR3DL3 but not in Y381F.

[0138] Next, cytotoxicity assays were performed by incubating NK92 cells expressing KIR3DL3 WT or Y381F with K562 cells or Raji cells expressing HHLA2 or controls at different effector-to-target (E:T) ratios. Figure 10D The percentage of specific lysis was calculated and plotted against the E:T ratio. As shown, significant differences in cytotoxicity were detected in NK92 cells expressing KIR3DL3 WT incubated with HHLA2-expressing cells compared to controls in both K562 and Raji cells, consistent with previous observations. However, no difference in cytotoxicity was observed in NK92 cells expressing KIR3DL3 Y381F, suggesting that HHLA2-induced suppression of immune cell function by KIR3DL3 operates through the ITIM motif of KIR3DL3.

[0139] Finally, considering the importance of ITIM motif tyrosine phosphorylation for the function of KIR3DL3, and the role of protein tyrosine phosphatases SHP-1 / SHP-2 in immune cells, the interaction of KIR3DL3 with SHP-1 or SHP-2 was tested. In short, primary KIR3DL3 cells were treated at 37°C with (+) or (-) pervanadate / ester (VO4, 1 mM). + NK cells (35×10) 6 Cells) for 5 minutes. Immunoprecipitates (IP) and whole-cell lysates (WCL) of KIR3LD3 (lanes 2, 4) or mIgG1 (lanes 1, 3) for anti-KIR3DL3, SHP-1, and SHP-2 were analyzed sequentially by Western blotting. Expression of KIR3DL3 in Cancer As shown, the immunoprecipitation experiment demonstrated that KIR3DL3 interacts with both SHP-1 and SHP-2, indicating that KIR3DL3 recruits SHP1 / 2 through its ITIM motif to inhibit the function of human immune cells.

[0140] Figure 9

[0141] To examine KIR3DL3 mRNA expression levels in human tumors, the applicant searched 1,425 human tumor lines. The top 40 tumor lines expressing the highest levels of KIR3DL3 mRNA were... Figure 11 As shown in the figure, among the top 40 tumors examined (those exhibiting the highest levels of KIR3DL3 mRNA), many were hematologic malignancies, suggesting that targeting KIR3DL3 has a specific role in treating these conditions.

[0142] KIR3DL3 expression at the protein level in human tumors was also examined and found that KIR3DL3 is expressed on tumor-infiltrating immune cells in a variety of human cancers, including renal, gastric, lung, gallbladder, and pancreatic cancers Compositions In sum, these data suggest that the KIR3DL3 pathway represents a novel mechanism of immune suppression within the tumor microenvironment and is an attractive target for human cancer therapy.

[0143] Methods of Use and Treatment

[0144] In some aspects, the present technology provides a composition comprising an antibody, fusion polypeptide, nucleic acid, or small molecule according to the embodiments disclosed and described herein.

[0145] In some embodiments, the composition further comprises a pharmaceutically acceptable excipient. Non-limiting examples of pharmaceutically acceptable excipients include those described in, e.g., “Remington: The Science and Practice of Pharmacy,” 19th Edition (1995), or a more recent edition, Mack Publishing Company; A. Gennaro (2000) “Remington: The Science and Practice of Pharmacy,” 20th Edition, Lippincott Williams & Wilkins; “Pharmaceutical Dosage Forms and Delivery Systems” (1999) H.C. Ansel et al., eds., 7th Edition, Lippincott Williams & Wilkins; and “Pharmaceutical

[0146] In some embodiments, the composition comprises other components such as pharmaceutical grade mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium, carbonates, etc. In some embodiments, the composition comprises pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents and the like, e.g., sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate, hydrochlorides, sulfates, solvates (e.g., mixed ion salts, water, organic), hydrates (e.g., water), etc.

[0147] In some embodiments, the composition is in an aqueous solution, a powder form, a granule, a tablet, a pill, a suppository, a capsule, a suspension, a spray, etc. The composition can include pharmaceutically acceptable excipients, pharmaceutically acceptable salts, diluents, carriers, vehicles, and such other non-active agents known to those skilled in the art. Commonly used vehicles and excipients in pharmaceutical formulations include, for example, talc, acacia, lactose, starch, magnesium stearate, cocoa butter, aqueous or non-aqueous solvents, oils, paraffin derivatives, glycols, etc. Solutions can be prepared with water or physiologically compatible organic solvents such as ethanol, 1,2-propanediol, polyethylene glycol, dimethyl sulfoxide, fatty alcohols, triglycerides, partial esters of glycerol, etc. Parenteral compositions can be prepared using conventional techniques and can include sterile isotonic saline, water, 1,3-butanediol, ethanol, 1,2-propanediol, polyethylene glycol mixed with water, Ringer's solution, etc. In one aspect, a colorant is added to aid in locating the composition and properly placing it at the intended treatment site.

[0148] The composition can include a preservative and / or a stabilizer. Non-limiting examples of preservatives include methylparaben, ethylparaben, propylparaben, sodium benzoate, benzoic acid, sorbic acid, potassium sorbate, propionic acid, benzalkonium chloride, benzyl alcohol, thiomersal, phenylmercurate salts, chlorhexidine, phenol, 3-methylphenol, quaternary ammonium compounds (QACs), chlorobutanol, 2-ethoxyethanol, and imidurea.

[0149] To control tonicity, the composition can include a physiological salt, such as a sodium salt. Sodium chloride (NaCl) is preferred, which can be present in an amount between 1 and 20 mg / ml. Other salts that can be present include potassium chloride, potassium phosphate monobasic, disodium phosphate dehydrate, magnesium chloride, and calcium chloride.

[0150] The composition can include one or more buffers. Typical buffers include: phosphate buffers; Tris buffers; borate buffers; succinate buffers; histidine buffers; or citrate buffers. The concentration of the buffer is typically in the range of 5-20 mM. The pH of the composition is approximately between 5 and 8, more typically between 6 and 8, for example, between 6.5 and 7.5, or between 7.0 and 7.8.

[0151] The composition can be administered by any suitable route, as will be apparent to the skilled person, depending on the disease or condition to be treated. Typical routes of administration include intravenously, intra-arterially, intramuscularly, subcutaneously, intracranially, intranasally, or intraperitoneally.

[0152] In some embodiments, the composition can include a cryoprotectant. Non-limiting examples of cryoprotectants include glycols (e.g., ethylene glycol, propylene glycol, and glycerol), dimethyl sulfoxide (DMSO), formamide, sucrose, trehalose, dextrose, and any combination thereof.

[0153] The composition can include pharmaceutically acceptable excipients, pharmaceutically acceptable salts, diluents, carriers, vehicles, and such other non-active agents known to those skilled in the art. Vehicles and excipients commonly used in pharmaceutical preparations include, for example, talc, gum arabic, lactose, starch, magnesium stearate, cocoa butter, aqueous or non-aqueous solvents, oils, paraffin derivatives, glycols, and the like. Solutions can be prepared with water or physiologically compatible organic solvents, such as ethanol, 1,2-propanediol, polyethylene glycol, dimethyl sulfoxide, fatty alcohols, triglycerides, partial glycerides, and the like. Parenteral compositions can be prepared using conventional techniques and can include sterile isotonic saline, water, 1,3-butanediol, ethanol, 1,2-propanediol, polyethylene glycol mixed with water, Ringer's solution, and the like. In one aspect, a colorant is added to aid in the determination of the location of the composition and proper placement into the intended treatment site.

[0154] In certain aspects, provided herein are nucleic acid molecules encoding an antibody or immunogenic fragment thereof.

[0155] In one aspect, provided are vectors encoding the nucleic acid molecules described herein. In certain aspects, provided are host cells comprising the nucleic acid molecules described herein or the vectors described herein.

[0156] In certain embodiments, the antibody is humanized.

[0157] In one aspect, provided is a kit of parts comprising the compositions described above. The kit can further include a document or manual of instructions describing a protocol for preparing the antibody, fusion polypeptide, nucleic acid, and / or small molecule, and / or administering to a subject in need thereof.

[0158] Figures 12A-12B

[0159] Provided herein are methods of use and treatment of a subject in need thereof. In some embodiments, provided herein are antibodies, fusion polypeptides, nucleic acids, and / or small molecules for use in therapy. In other embodiments, provided herein are antibodies, fusion polypeptides, nucleic acids, and / or small molecules for the manufacture of a medicament.

[0160] Also provided herein are methods of treating a subject, comprising administering to the subject a therapeutically effective amount of an antibody, fusion polypeptide, nucleic acid, and / or small molecule according to the embodiments disclosed and described herein.

[0161] Also provided herein are compositions for treating a subject having a disorder comprising an antibody, immunogenic fragment thereof, fusion polypeptide, or combination thereof (e.g., in a chimeric antigen receptor and / or antibody-drug conjugate) according to the embodiments disclosed and described herein.

[0162] In certain embodiments, administration of an antibody as described herein is accomplished by administering to the subject a nucleic acid encoding the antibody. Nucleic acids encoding the antibodies described herein can be incorporated into a genetic construct for use as part of a gene therapy regimen to deliver nucleic acids that can be used to express and produce the antibodies within cells. Expression constructs of such components can be administered in any therapeutically effective carrier, e.g., any formulation or composition capable of effectively delivering the component genes to cells in vivo. Means include inserting the nucleic acids encoding the antibodies described herein into viral vectors, including recombinant retroviruses, adenoviruses, adeno-associated viruses, lentiviruses, herpes simplex virus-1 (HSV-1), or recombinant bacterial or eukaryotic plasmids. Viral vectors can transfect cells directly; plasmid DNA can be delivered with the aid of, e.g., cationic liposomes (e.g., LIPOFECTIN®, ), derivatized, polylysine-conjugated, gramicidin S, artificial viral envelopes, or other suitable intracellular carriers, direct injection, or CaP04precipitation (see, e.g., WO 04 / 060407). Examples of suitable retroviruses include, but are not limited to, pLJ, pZIP, pWE, and pEM (see, e.g., Eglitis 1985; Danos & Mulligan 1988; Wilson 1988; Armentano 1990; Huber 1991; Ferry 1991; Chowdhury 1991; van Beusechem 1992; Kay 1992; Dai 1992; Hwu 1993; U.S. Pat. Nos. 4,868,116 and 4,980,286; and PCT Publ. Nos. WO 89 / 07136; WO 89 / 02468; WO 89 / 05345; and WO 92 / 07573) known to those of skill in the art. Another viral gene delivery system useful for delivering an antibody according to the present technology or a nucleic acid encoding an antibody according to the present technology utilizes adenovirus-derived vectors (see, e.g., Berkner 1988; Rosenfeld 1991; Rosenfeld 1992). Suitable adenovirus vectors derived from adenovirus strain Ad type 5 dl324 or other adenovirus strains (e.g., Ad2, Ad3, Ad7, etc.) are known to those of skill in the art. A viral vector system useful for delivering an antibody according to the present technology or a nucleic acid encoding an antibody according to the present technology is adeno-associated virus (AAV). See, e.g., Flotte 1992; Samulski 1989; and McLaughlin 1988.

[0163] In some embodiments, the subject has a disorder that benefits from enhancement of the immune response, such as an infection, a disease, or a cancer. In these embodiments, the compositions provided herein (including antibodies, fusion polypeptides, nucleic acids, and / or small molecules) can be used to block the function of KIR3DL3. In other embodiments, the subject has a disorder that benefits from suppression of the immune response, such as an autoimmune disease or a transplant. In these embodiments, the compositions provided herein (including antibodies, fusion polypeptides, nucleic acids, and / or small molecules) can be used to stimulate the function of KIR3DL3.

[0164] In some embodiments, the cancer is selected from chronic lymphocytic leukemia (CLL), acute leukemia, acute lymphoid leukemia (ALL), B-cell acute lymphoid leukemia (B-ALL), T-cell lymphoma, B-cell lymphoma, T-cell acute lymphoid leukemia (T-ALL), chronic myeloid leukemia (CML), B-cell prolymphocytic leukemia, T-cell lymphoma, Hodgkin's disease, B-cell non-Hodgkin's lymphoma, blastic plasmacytoid dendritic cell neoplasm, Burkitt's lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell- follicle center lymphoma, large cell-follicle center lymphoma, malignant lymphoproliferative conditions, mucosa-associated lymphoid tissue (MALT) lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndrome, non-Hodgkin's lymphoma, Hodgkin's lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom's macroglobulinemia, or preleukemia.

[0165] In some embodiments, the cancer is a human hematologic malignancy. For example, in certain embodiments, the human hematologic malignancy can be selected from myeloid neoplasms, acute myeloid leukemia (AML), AML with recurrent genetic abnormalities, AML with myelodysplasia-related changes, therapy-related AML, acute leukemias of undefined lineage, myeloproliferative neoplasms, essential thrombocythemia, polycythemia vera, myelofibrosis (MF), primary myelofibrosis, systemic mast cell disease, myelodysplastic syndrome (MDS), myeloproliferative / myelodysplastic syndromes, chronic myelogenous leukemia, chronic neutrophilic leukemia, chronic eosinophilic leukemia, myelodysplastic syndromes (MDS), refractory anemia with ringed sideroblasts, refractory cytopenia with multilineage dysplasia, refractory anemia with excess blasts (type 1), refractory cytopenia with excess blasts (type 2), MDS associated with isolated del(5q), unclassifiable MDS, myeloproliferative / myelodysplastic syndromes, chronic myelomonocytic leukemia, atypical chronic myeloid leukemia, juvenile myelomonocytic leukemia, unclassifiable myeloproliferative / myelodysplastic syndromes, lymphoid neoplasms, precursor lymphoid neoplasms, B-lymphoblastic leukemia, B-lymphoblastic lymphoma, T-lymphoblastic leukemia, T-lymphoblastic lymphoma, mature B-cell neoplasms, diffuse large B-cell lymphoma, primary central nervous system lymphoma, primary mediastinal B-cell lymphoma, Burkitt lymphoma / leukemia, follicular lymphoma, chronic lymphocytic leukemia, small lymphocytic lymphoma, B-cell prolymphocytic leukemia, lymphoplasmacytic lymphoma, Waldenstrom macroglobulinemia, mantle cell lymphoma, marginal zone lymphoma, post-transplant lymphoproliferative disorder, HIV-associated lymphoma, primary effusion lymphoma, intravascular large B-cell lymphoma, primary cutaneous B-cell lymphoma, hairy cell leukemia, multiple myeloma, monoclonal gammopathy of undetermined significance (MGUS), smoldering multiple myeloma, or solitary plasmacytoma (solitary bone and extramedullary).

[0166] In some embodiments, the cancer is an adrenal cancer, anal cancer, basal and squamous cell skin cancer, biliary cancer, bladder cancer, bone cancer, brain and spinal cord tumors, breast cancer, cervical cancer, colorectal cancer, endometrial cancer, esophageal cancer, Ewing tumor family, eye cancer (ocular melanoma), gallbladder cancer, gastric cancer, gastrointestinal neuroendocrine (carcinoid) tumor, gastrointestinal stromal tumor (GIST), gestational trophoblastic disease, Kaposi sarcoma, kidney cancer, laryngeal and hypopharyngeal cancer, liver cancer, lung cancer, lung carcinoid tumor, malignant mesothelioma, melanoma skin cancer, Merkel cell skin cancer, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, non-small cell lung cancer, central nervous system (CNS) tumor, oral cavity and oropharyngeal cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pancreatic neuroendocrine tumor (NET), penile cancer, pituitary tumor, prostate cancer, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, skin cancer, small cell lung cancer, small intestine cancer, soft tissue sarcoma, stomach cancer, testicular cancer, thymus cancer, thyroid cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenstrom macroglobulinemia, Wilms tumor, squamous cell carcinoma, environmentally induced cancers, combinations of cancers, and cancer metastases. In some embodiments, the cancer is a leukemia or lymphoma, e.g., a lymphoblastic lymphoma or a B-cell non-Hodgkin lymphoma. In some embodiments, the cancer is a metastatic cancer.

[0167] In some embodiments, the method of treating a subject having a cancer comprises administering to the subject a therapeutically effective amount of an antibody, fusion polypeptide, nucleic acid, and / or small molecule according to embodiments disclosed and described herein in combination with one or more additional cancer therapies for the particular type of cancer to achieve improved or synergistic therapeutic effects over an extended period of time. In some embodiments, the one or more additional cancer therapies are selected from the group consisting of chemotherapy, radiation therapy, immunotherapy, surgery, and combinations thereof. For example, the antibody, fusion polypeptide, nucleic acid, small molecule, and / or combination thereof can be administered in combination with one or more additional chemotherapeutic agents. For example, the antibody, fusion polypeptide, nucleic acid, small molecule, and / or combination thereof can be administered in combination with one or more additional immunotherapeutic agents. Such methods can be used to treat any cancer or tumor type in which KIR3DL3 plays a role in modulating immune cell function, including but not limited to the primary, recurrent, and metastatic cancers listed above.

[0168] As used herein, a "therapeutically effective amount" of an antibody, fusion polypeptide, nucleic acid, and / or small molecule is an amount of the antibody, fusion polypeptide, nucleic acid, and / or small molecule that produces a desired effect (e.g., a therapeutic effect) in a subject for the treatment and / or prevention of a disorder. In certain embodiments, a therapeutically effective amount is an amount of the antibody, fusion polypeptide, nucleic acid, and / or small molecule that produces a maximal therapeutic effect. In other embodiments, a therapeutically effective amount produces a therapeutic effect that is less than a maximal therapeutic effect. For example, a therapeutically effective amount can be an amount that produces a therapeutic effect while avoiding one or more side effects associated with a dose that produces a maximal therapeutic effect. The therapeutically effective amount of a particular composition will vary based on a variety of factors, including but not limited to the properties of the therapeutic composition (e.g., activity, pharmacokinetics, pharmacodynamics, and bioavailability), the physiological condition of the subject (e.g., age, body weight, sex, disease type and stage, medical history, general physical condition, reaction to given doses, and other existing pharmacological agents), the properties of any pharmaceutically acceptable carriers, excipients, and preservatives in the composition, and the route of administration. A person of skill in the art of clinical and pharmacological sciences will be able to determine therapeutically effective amounts through routine experimentation, i.e., by monitoring the response of a subject to administration of the antibody, fusion polypeptide, nucleic acid, and / or small molecule and adjusting the dosage accordingly. See, e.g., Remington: The Science and Practice of Pharmacy, 22ndEd., Pharmaceutical Press, London, 2012, and Goodman & Gilman's The Pharmacological Basis of Therapeutics, 12thEd., McGraw-Hill, New York, NY, 2011, the entire disclosures of which are hereby incorporated by reference for their teachings on this subject.

[0169] In some embodiments, a therapeutically effective amount of an antibody, fusion polypeptide, nucleic acid, and / or small molecule disclosed herein is in the range of about 10 mg / kg to about 150 mg / kg, 30 mg / kg to about 120 mg / kg, 60 mg / kg to about 90 mg / kg. In some embodiments, a therapeutically effective amount of an antibody, fusion polypeptide, nucleic acid, and / or small molecule disclosed herein is about 15 mg / kg, about 30 mg / kg, about 45 mg / kg, about 60 mg / kg, about 75 mg / kg, about 90 mg / kg, about 105 mg / kg, about 120 mg / kg, about 135 mg / kg, or about 150 mg / kg. A single dose or multiple doses of the antibody, fusion polypeptide, nucleic acid, and / or small molecule can be administered to a subject. In some embodiments, the antibody, fusion polypeptide, nucleic acid, and / or small molecule is administered once or multiple times per day.

[0170] One of ordinary skill in the art will appreciate that a variety of routes can be used to administer to a subject (e.g., a human) where appropriate. For example, in some embodiments, administration can be systemic or local. In some embodiments, administration can be enterally or parenterally. Furthermore, it is within the knowledge of one of ordinary skill in the art to select an appropriate route of administration, such as oral administration, subcutaneous administration, intravenous administration, intramuscular administration, intradermal administration, intrathecal administration, or intraperitoneal administration. To treat a subject in need, an antibody, fusion polypeptide, nucleic acid, and / or small molecule can be administered continuously or intermittently, for immediate release, controlled release, or sustained release. Furthermore, an antibody, fusion polypeptide, nucleic acid, and / or small molecule can be administered once per day, twice per day, three times per day, or four times per day over a period of 3 days, 5 days, 7 days, 10 days, 2 weeks, 3 weeks, 4 weeks, 8 weeks, or 12 weeks. In certain embodiments, an antibody, fusion polypeptide, nucleic acid, and / or small molecule can be administered daily, every other day, every third day, every week, every two weeks (i.e., every other week), every three weeks, every month, every other month, or every three months. An antibody, fusion polypeptide, nucleic acid, and / or small molecule can be administered over a predetermined period of time. Alternatively, an antibody, fusion polypeptide, nucleic acid, and / or small molecule can be administered until a particular therapeutic benchmark is reached. In certain embodiments, the methods provided herein include the step of assessing one or more therapeutic benchmarks, such as, but not limited to, the level of certain biomarkers in a biological sample, such as circulating tumor cells in blood, a biopsy sample, or urine, to determine whether to continue administration of an antibody, fusion polypeptide, nucleic acid, and / or small molecule. In certain embodiments involving cancer, an antibody, fusion polypeptide, nucleic acid, and / or small molecule can be administered until tumor growth is halted or reversed, until one or more tumors are eliminated, or until the number of cancer cells is reduced to a particular level.

[0171] As demonstrated in the working examples, KIR3DL3 blockade using antibodies promotes anti-tumor immunity and suppresses tumor growth in a mouse model of lung adenocarcinoma. As standard of care, treatment of early stage lung cancer, including non-small cell lung cancer (NSCLC), includes surgery, photodynamic therapy, laser therapy, brachytherapy, chemotherapy, and radiotherapy, and / or any combination thereof. For more advanced stages of lung cancer, standard treatments include chemotherapy, radiotherapy, immunotherapy, and / or any combination thereof. In certain embodiments, chemotherapeutic agents for lung cancer include, but are not limited to, cisplatin (Platinol), carboplatin (Paraplatin), docetaxel (Taxotere), gemcitabine (Gemzar), paclitaxel (Taxol), vinorelbine (Navelbine), pemetrexed (Alimta), albumin-bound paclitaxel (Abraxane), etoposide (VePesid or Etopophos), doxorubicin (Adriamycin), ifosfamide (Ifex), irinotecan (Camptosar), topotecan (Hycamtin), vinblastine (Oncovir), and vincristine (Oncovin). In certain embodiments, immunotherapy agents for lung cancer include, but are not limited to, pembrolizumab (Keytruda), nivolumab (Opdivo), ipilimumab (Yervoy), bevacizumab (Avastin), atezolizumab (Tecentriq), and necitumumab (Portrazza).

[0172] In some embodiments, the infection is caused by a pathogen. In certain embodiments, the pathogen can be a virus, a bacterium, a prion, a fungus, or a parasite. Non-limiting examples of viruses suitable for use in the present technology include human immunodeficiency virus (HIV) (e.g., HIV-1 and HIV-2), influenza virus (e.g., influenza A, B, and C viruses), papillomavirus, coronavirus (e.g., human respiratory coronavirus), hepatitis virus (e.g., hepatitis viruses A-G), or herpesvirus (e.g., HSV 1-9), West Nile virus, Zika virus, encephalomyocarditis virus, dengue virus, or Ebola virus. Non-limiting examples of bacteria suitable for use in the present technology include Mycobacterium tuberculosis, Campylobacter jejuni, Staphylococcus aureus, Borrelia burgdorferi, Helicobacter pylori, Salmonella enterica, Escherichia coli, Streptococcus pyogenes, multi-drug resistant Staphylococcus aureus, Chlamydia pneumoniae, Clostridium botulinum, Vibrio vulnificus, Chlamydia parvum, Corynebacterium diphtheriae, Klebsiella pneumoniae, linezolid-resistant Enterococcus (E. faecalis and E. faecium), and multi-drug resistant Acinetobacter baumanii. Non-limiting examples of fungi suitable for use in the present technology include Pneumocystis jirovecii (PJP), Candida spp., Blastomyces spp., Coccidioides spp., Cryptococcus spp., Histoplasma spp., Paracoccidioides spp., Aspergillus spp., Talaromyces, and Sporothrix. In certain embodiments, the infection can be HIV, Pneumocystis, or Mycobacterium tuberculosis.

[0173] In some embodiments, the autoimmune disease is selected from acute disseminated encephalomyelitis (ADEM), alopecia areata, antiphospholipid syndrome, autoimmune myocarditis, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune inner ear disease, autoimmune polyglandular syndrome, autoimmune peripheral neuropathy, autoimmune pancreatitis, autoimmune polyendocrine syndrome, autoimmune progesterone dermatitis, autoimmune thrombocytopenic purpura, autoimmune urticarial, autoimmune uveitis, Behcet’s disease, celiac disease, Chagas disease, cold agglutinin disease, Crohn’s disease, dermatomyositis, diabetes mellitus type 1, eosinophilic fasciitis, gastrointestinal pemphigoid, Goodpasture’s syndrome, Graves’ disease, Guillain-Barre syndrome, Hashimoto’s encephalopathy, Hashimoto’s thyroiditis, lupus erythematosus, Miller-Fisher syndrome, mixed connective tissue disease, myasthenia gravis, pemphigus vulgaris, pernicious anemia, polymyositis, psoriasis, psoriatic arthritis, relapsing polychondritis, rheumatoid arthritis, rheumatic fever, Sjogren’s syndrome, temporal arteritis, transverse myelitis, ulcerative colitis, undifferentiated connective tissue disease, vasculitis, and Wegener’s granulomatosis.

[0174] In one embodiment, the autoimmune disease treated is adult rheumatoid arthritis.

[0175] In some embodiments, the disorder is a transplant. In these embodiments, the compositions and methods provided herein can be used to inhibit transplant rejection. In certain embodiments, the transplant is a stem cell or bone marrow transplant, e.g., in a subject with graft versus host disease. In certain embodiments, the transplant is selected from a kidney transplant, a lung transplant, a heart transplant, a pancreas transplant, a cornea transplant, or a liver transplant.

[0176] In some embodiments, an antibody as described herein can be included in a course of treatment that also includes administration of at least one additional agent to the subject.

[0177] In some embodiments, the methods provided herein can be combined with additional therapies (e.g., combination therapy). In certain embodiments, the additional therapy can be a therapy for an immune-associated disorder or condition, including those disclosed herein. For example, the compositions disclosed herein can be administered to a subject concurrently with, prior to, or after radiation therapy, chemotherapy, hormone therapy, cell therapy, and / or another anti-tumor or anti-autoimmune therapy. In some embodiments, the compositions can be administered to a subject concurrently with, prior to, or after an organ transplant.

[0178] In some embodiments, the additional agent administered in conjunction with an antibody described herein can be administered concurrently with the antibody, on the same day as the antibody, or in the same week as the antibody. In some embodiments, the additional agent administered in conjunction with an antibody described herein can be administered in a single formulation. In certain embodiments, the additional agent can be administered in a manner that is temporally separated from administration of an antibody described herein, e.g., one or more hours before or after, one or more days before or after, one or more weeks before or after, or one or more months before or after administration of the provided antibody is administered. In various embodiments, the frequency of administration of the additional agent(s) can be the same, similar, or different from the frequency of administration of an antibody as described herein.

[0179] In some embodiments, the combination therapy can be a treatment regimen that includes administration of two different antibodies as described herein and / or a treatment regimen that includes administration of an antibody as described herein via multiple formulations and / or routes of administration.

[0180] In some embodiments, the additional agent can be or comprise one or more drugs. For example, in some embodiments, the additional agent can be or comprise one or more drugs that act to suppress an immune response, e.g., effective to treat a patient with an autoimmune disease, or to help prevent transplant rejection. For example, current treatments for rheumatoid arthritis and kidney transplants are abatacept and belatacept They are modified antibody fusion polypeptides comprising the extracellular domain of human cytotoxic T-lymphocyte-associated antigen 4 (CTLA-4) linked to the Fc region of IgGl. In contrast, drugs that activate or do not activate the immune response can be used as additional agents to effectively treat diseases or disorders, including cancer or infectious diseases. For example, ipilimumab is a monoclonal antibody that activates the immune response by targeting CTLA-4 and can be used to treat melanoma. Pembrolizumab is a humanized antibody against human programmed death receptor-1 (PD-1) and is employed as an anti-PD-1 immunotherapy against certain cancers. Nivolumab is another anti-PD-1 antibody and is used as an immunotherapy to treat certain cancers.

[0181] From the foregoing, it will be appreciated that specific embodiments of the technology have been described herein for purposes of illustration, but that various modifications can be made without deviating from the scope of the technology. Accordingly, the present technology is not limited except as by the appended claims.

[0182] Example 1

[0183] This working example demonstrates the efficacy of KIR3DL3 blockade using antibodies to promote anti-tumor immunity and suppress tumor growth in a mouse model of lung adenocarcinoma Figure 12A Four x 10 6 HHLA2 + HCC827 cells transduced with luciferase (Luc2-HCC827) were injected intraperitoneally (i.p.) into NSG mice (n = 6 per group) to generate an intraperitoneal tumor mouse model Figure 12B Four days later, mice were assigned to either 26E10 (anti-KIR3DL3 mAb) or mlgGl groups based on baseline bioluminescence. Each mouse then received i.p. 1 x 10 7 expanded KIR3DL3 + NK cells and 1 pg IL-2, 1 pg IL-15, and 200 pg 26E10 (or mlgGl) every other day (total of 5 times). Bioluminescence was measured by IVIS Spectrum Imager (Caplier Perkin Elmer) starting 5-10 minutes after i.p. injection of D-luciferin (150 pg / g body weight) and analyzed with Living Image 3.0 software. Bioluminescence measurements of tumor growth showed that anti-KIR3DL3 monoclonal antibodies reduced tumor growth Figures 12C-12D compared to controls, indicating that targeting KIR3DL3-mediated immune suppression is an effective way to treat cancer by promoting anti-tumor immunity.

[0184] The efficacy of the antibody-mediated KIR3DL3 blockade was also tested in a mouse model of metastatic lung cancer. Figure 12C ). 5×10 5 Luc2-HCC827 cells were intravenously injected into NSG mice (n=4 per group). Four days later, mice were assigned to the 26E10 (anti-KIR3DL3) or mIgG1 group based on baseline bioluminescence. Each mouse then received 7 × 10⁶ cells intravenously every other day. 6 KIR3DL3 + NK cells were administered 1 μg IL-2, 1 μg IL-15, and 200 μg 26E10 (or mIgG1) three times. Bioluminescence was measured using an IVIS spectral imaging system (Capiler Perkin Elmer). Imaging began 10–18 minutes after intraperitoneal injection of D-luciferin (150 μg / g body weight) and analysis was performed using Living Image 3.0 software. Figure 12D Again, it was observed that the anti-KIR3DL3 monoclonal antibody significantly reduced tumor growth compared to the control. Figures 12E-12F This indicates that inhibiting KIR3DL3-mediated immunosuppression and the resulting increase in anti-tumor immunity is also effective in treating metastatic cancer.

[0185] Finally, the efficacy of KIR3DL3 blockade was confirmed in a mouse model of subcutaneous tumors. Figure 12E Human lung adenocarcinoma HCC827 cells (3×10⁻⁶) were used. 6 NSG was subcutaneously injected into NSG mice. Twelve days later, the tumor-bearing mice were randomly assigned to either the 26E10 or mIgG1 group (n=4 per group), and then administered KIR3DL3 every other day. + NK cells (10×10) 6 (cells), and 26E10 or isotype mIgG1 (200 μg) were treated for two weeks ( Figure 12F As previously described, tumor growth was assessed. Consistent with previous observations, the anti-KIR3DL3 monoclonal antibody significantly reduced tumor growth compared to the control. ​ This study confirms that KIR3DL3 is a potential new target for immunotherapy in cancer treatment.

[0186] An antibody or an immunogenic fragment thereof that specifically binds to the KIR3DL3 protein.

[0187] The antibody or immunogenic fragment thereof described in paragraph 129, wherein the antibody or immunogenic fragment thereof specifically binds to a KIR3DL3 epitope comprising the entire extracellular domain or a portion thereof.

[0188] The antibody or immunogenic fragment thereof of paragraph 130, wherein the antibody or immunogenic fragment thereof binds to a KIR3DL3 D0 domain, a KIR3DL3 D1 domain, or a KIR3DL3 D2 domain.

[0189] The antibody or immunogenic fragment thereof of paragraph 129 or 130, comprising a VH region comprising a CDR1, a CDR2, and a CDR3 having an amino acid sequence of SEQ ID NOs: 7, 9, 11, 31, 33, 35, 54, 56, 76, 78, 80, 100, 102, 104, 124, 126, 128, 148, 150, 152, 172, 174, 176, 196, 198, 200, 220, 222, 224, 244, 246, 248, 268, 270, 272, 292, 294, 296, 316, 318, or 320.

[0190] The antibody or immunogenic fragment thereof of paragraph 129 or 130, comprising a VH region comprising at least one CDR that is 80% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 7, 9, 11, 31, 33, 35, 54, 56, 76, 78, 80, 100, 102, 104, 124, 126, 128, 148, 150, 152, 172, 174, 176, 196, 198, 200, 220, 222, 224, 244, 246, 248, 268, 270, 272, 292, 294, 296, 316, 318, or 320.

[0191] The antibody or immunogenic fragment thereof of paragraph 129 or 130, comprising a VH region comprising at least two CDRs that are 80% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 7, 9, 11, 31, 33, 35, 54, 56, 76, 78, 80, 100, 102, 104, 124, 126, 128, 148, 150, 152, 172, 174, 176, 196, 198, 200, 220, 222, 224, 244, 246, 248, 268, 270, 272, 292, 294, 296, 316, 318, or 320.

[0192] The antibody or immunogenic fragment thereof of paragraph 129 or 130, comprising a VH region comprising at least three CDRs that are 80% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 7, 9, 11, 31, 33, 35, 54, 56, 76, 78, 80, 100, 102, 104, 124, 126, 128, 148, 150, 152, 172, 174, 176, 196, 198, 200, 220, 222, 224, 244, 246, 248, 268, 270, 272, 292, 294, 296, 316, 318, or 320.

[0193] The antibody or immunogenic fragment thereof of paragraph 129 or 130, comprising a VL region comprising a CDR1, a CDR2, and a CDR3 having an amino acid sequence of SEQ ID NOs: 19, 21, 23, 43, 45, 47, 64, 66, 68, 88, 90, 92, 112, 114, 116, 136, 138, 140, 160, 162, 164, 184, 186, 188, 208, 210, 212, 232, 234, 236, 256, 258, 260, 280, 282, 284, 304, 306, 308, 328, 330, or 332.

[0194] The antibody or immunogenic fragment thereof of paragraph 129 or 130, comprising a VL region comprising at least one CDR that is 80% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 19, 21, 23, 43, 45, 47, 64, 66, 68, 88, 90, 92, 112, 114, 116, 136, 138, 140, 160, 162, 164, 184, 186, 188, 208, 210, 212, 232, 234, 236, 256, 258, 260, 280, 282, 284, 304, 306, 308, 328, 330, or 332.

[0195] The antibody or immunogenic fragment thereof of paragraph 129 or 130, comprising a VL region comprising at least two CDRs that are 80% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 19, 21, 23, 43, 45, 47, 64, 66, 68, 88, 90, 92, 112, 114, 116, 136, 138, 140, 160, 162, 164, 184, 186, 188, 208, 210, 212, 232, 234, 236, 256, 258, 260, 280, 282, 284, 304, 306, 308, 328, 330, or 332.

[0196] The antibody or immunogenic fragment thereof according to any one of paragraphs 129-139, comprising a VL region comprising at least three CDRs that are 80% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 19, 21, 23, 43, 45, 47, 64, 66, 68, 88, 90, 92, 112, 114, 116, 136, 138, 140, 160, 162, 164, 184, 186, 188, 208, 210, 212, 232, 234, 236, 256, 258, 260, 280, 282, 284, 304, 306, 308, 328, 330, or 332.

[0197] The antibody according to any one of paragraphs 129-139, wherein the antibody is a monoclonal antibody.

[0198] The antibody according to any one of paragraphs 129-139, wherein the antibody is a chimeric antibody, a human antibody, or a humanized antibody.

[0199] The antibody or immunogenic fragment thereof according to any one of paragraphs 129-139, comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 7, 9, 11, 19, 21, 23, 31, 33, 35, 43, 45, 47, 54, 56, 64, 66, 68, 76, 78, 80, 88, 90, 92, 100, 102, 104, 112, 114, 116, 124, 126, 128, 136, 138, 140, 148, 150, 152, 160, 162, 164, 172, 174, 176, 184, 186, 188, 196, 198, 200, 208, 210, 212, 220, 222, 224, 232, 234, 236, 244, 246, 248, 256, 258, 260, 268, 270, 272, 280, 282, 284, 292, 294, 296, 304, 306, 308, 316, 318, 320, 328, 330, or 332.

[0200] The antibody according to paragraph 140, wherein the antibody is monoclonal 8G7, monoclonal 26E10, monoclonal 26E2, monoclonal 31C4, monoclonal 34B10, monoclonal 37A3, monoclonal 12A10, monoclonal 3B7, monoclonal 11G8, monoclonal 14F8, monoclonal 15D2, monoclonal 29H7, monoclonal 30D10, or monoclonal 51C3.

[0201] The antibody of paragraph 141, wherein the antibody is humanized 8G7, humanized 26E10, humanized 26E2, humanized 31C4, humanized 34B10, humanized 37A3, humanized 12A10, humanized 3B7, humanized 11G8, humanized 14F8, humanized 15D2, humanized 29H7, humanized 30D10, or humanized 51C3.

[0202] A fusion polypeptide comprising the antibody or immunogenic fragment thereof of any one of paragraphs 129-144.

[0203] A composition comprising the antibody or immunogenic fragment thereof of any one of paragraphs 129-144 or the fusion polypeptide of paragraph 145.

[0204] The composition of paragraph 146, further comprising a pharmaceutically acceptable carrier.

[0205] The composition of paragraph 146 or 147, further comprising a pharmaceutically acceptable excipient.

[0206] The antibody or immunogenic fragment thereof of any one of paragraphs 129-144, the fusion polypeptide of paragraph 145, or the composition of any one of paragraphs 146-148 for use in therapy.

[0207] The antibody or immunogenic fragment thereof of any one of paragraphs 129-144, the fusion polypeptide of paragraph 145, or the composition of any one of paragraphs 146-148 for use in the manufacture of a medicament.

[0208] A nucleic acid comprising a nucleic acid encoding an antibody or immunogenic fragment thereof, wherein the antibody or immunogenic fragment thereof is the antibody or immunogenic fragment thereof of any one of paragraphs 129-144.

[0209] A nucleic acid comprising a nucleic acid encoding a fusion polypeptide, wherein the fusion polypeptide is the fusion polypeptide of paragraph 145.

[0210] A method of treating a subject having a disorder, comprising administering to the subject a therapeutically effective amount of the antibody or immunogenic fragment thereof of any one of paragraphs 129-144, the fusion polypeptide of paragraph 145, or the composition of any one of paragraphs 146-148.

[0211] The method of paragraph 153, wherein the subject has a disorder, and wherein the disorder is a cancer.

[0212] The method of paragraph 154, wherein the cancer is selected from chronic lymphocytic leukemia (CLL), acute leukemia, acute lymphoid leukemia (ALL), B-cell acute lymphoid leukemia (B-ALL), T-cell lymphoma, B-cell lymphoma, T-cell acute lymphoid leukemia (T-ALL), chronic myeloid leukemia (CML), B-cell prolymphocytic leukemia, T-cell lymphoma, Hodgkin's disease, B-cell non-Hodgkin's lymphoma, blastic plasmacytoid dendritic cell neoplasm, Burkitt's lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell- follicle center lymphoma, large cell-follicle center lymphoma, malignant lymphoproliferative conditions, mucosa-associated lymphoid tissue (MALT) lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndrome, non-Hodgkin's lymphoma, Hodgkin's lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom's macroglobulinemia, or preleukemia.

[0213] The method of paragraph 154, wherein the cancer is selected from colon cancer, rectal cancer, renal cancer, liver cancer, lung cancer, kidney cancer, stomach cancer, gall bladder cancer, small bowel cancer, esophageal cancer, melanoma, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of the soft tissues, cancer of the urethra, cancer of the penis, solid tumors of childhood, cancer of the bladder, cancer of the kidney or ureter, carcinoma of the renal pelvis, neoplasm of the central nervous system (CNS), primary CNS lymphoma, tumor angiogenesis, spinal axis tumors, brain stem glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid cancer, squamous cell carcinoma, environmentally induced cancers, combinations of the cancers, and cancer metastasis.

[0214] The method of paragraph 154, wherein the cancer is a human hematopoietic malignancy.

[0215] The method of paragraph 157, wherein the human hematologic malignancy is selected from myeloid neoplasms, acute myeloid leukemia (AML), AML with recurrent genetic abnormalities, AML with myelodysplasia-related changes, therapy-related AML, acute leukemia of ambiguous lineage, myeloproliferative neoplasms, primary thrombocytosis, polycythemia vera, myelofibrosis (MF), primary myelofibrosis, systemic mast cell disease, myelodysplasia syndrome (MDS), myeloproliferative / myelodysplastic syndrome, chronic myelogenous leukemia, chronic neutrophilic leukemia, chronic eosinophilic leukemia, myelodysplasia syndrome (MDS), refractory anemia with ring sideroblasts, refractory cytopenia with multilineage dysplasia, refractory anemia with excess blasts (type 1), refractory cytopenia with excess blasts (type 2), MDS with isolated del(5q), unclassifiable MDS, myeloproliferative / myelodysplastic syndrome, chronic myelomonocytic leukemia, atypical chronic myeloid leukemia, juvenile myelomonocytic leukemia, unclassifiable myeloproliferative / myelodysplastic syndrome, lymphoid neoplasms, precursor lymphoid neoplasms, B-lymphoid leukemia, B-lymphoid lymphoma, T-lymphoid leukemia, T-lymphoid lymphoma, mature B-cell neoplasm, diffuse large B-cell lymphoma, primary central nervous system lymphoma, primary mediastinal B-cell lymphoma, Burkitt lymphoma / leukemia, follicular lymphoma, chronic lymphocytic leukemia, small lymphocytic lymphoma, B-cell prolymphocytic leukemia, lymphoplasmacytic lymphoma, Waldenstrom macroglobulinemia, mantle cell lymphoma, marginal zone lymphoma, post-transplant lymphoproliferative disorder, HIV-associated lymphoma, primary effusion lymphoma, intravascular large B-cell lymphoma, primary cutaneous B-cell lymphoma, hairy cell leukemia, multiple myeloma, monoclonal gammopathy of undetermined significance (MGUS), smoldering multiple myeloma, or solitary plasmacytoma (solitary bone and extramedullary).

[0216] The method of paragraph 154, wherein the cancer is a metastatic cancer.

[0217] The method of paragraph 154, further comprising subjecting the subject to one or more additional cancer therapies selected from chemotherapy, radiation therapy, immunotherapy, surgery, and combinations thereof.

[0218] The method of paragraph 153, wherein the disorder is an infection.

[0219] The method of paragraph 161, wherein the infection is caused by a pathogen.

[0220] The method of paragraph 162, wherein the pathogen is a virus.

[0221] The method according to paragraph 163, wherein the virus is selected from a human immunodeficiency virus, an influenza virus, a papillomavirus, a coronavirus, a hepatitis virus, or a herpes virus.

[0222] The method according to paragraph 162, wherein the pathogen is a bacterium.

[0223] The method according to paragraph 165, wherein the bacterium is Mycobacterium tuberculosis.

[0224] The method according to paragraph 162, wherein the pathogen is a prion.

[0225] The method according to paragraph 162, wherein the pathogen is a fungus.

[0226] The method according to paragraph 168, wherein the fungus is Pneumocystis jirovecii (PJP).

[0227] The method according to paragraph 162, wherein the pathogen is a parasite.

[0228] The method according to paragraph 153, wherein the condition is an autoimmune disease or disorder.

[0229] The method according to paragraph 171, wherein the autoimmune disease or disorder is selected from acute disseminated encephalomyelitis (ADEM), alopecia areata, antiphospholipid syndrome, autoimmune cardiomyopathy, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune inner ear disease, autoimmune lymphoproliferative syndrome, autoimmune peripheral neuropathy, autoimmune pancreatitis, autoimmune polyendocrine syndrome, autoimmune progesterone dermatitis, autoimmune thrombocytopenic purpura, autoimmune urticarial, autoimmune uveitis, Behcet's disease, celiac disease, Chagas disease, cold agglutinin disease, Crohn's disease, dermatomyositis, diabetes mellitus type 1, eosinophilic fasciitis, gastrointestinal pemphigoid, Goodpasture's syndrome, Graves' disease, Guillain-Barre syndrome, Hashimoto's encephalopathy, Hashimoto's thyroiditis, lupus erythematosus, Miller-Fisher syndrome, mixed connective tissue disease, myasthenia gravis, pemphigus vulgaris, pernicious anemia, polymyositis, psoriasis, psoriatic arthritis, relapsing polychondritis, rheumatoid arthritis, rheumatic fever, Sjogren's syndrome, temporal arteritis, transverse myelitis, ulcerative colitis, undifferentiated connective tissue disease, vasculitis, and Wegener's granulomatosis.

[0230] The method according to paragraph 171, wherein the autoimmune disease or disorder is adult rheumatoid arthritis.

[0231] The method according to paragraph 153, wherein the condition is a transplant.

[0232] The method of paragraph 174, wherein the transplant is selected from a stem cell transplant or a bone marrow transplant.

[0233] The method of paragraph 174, wherein the transplant is selected from a kidney transplant, a lung transplant, a heart transplant, a pancreas transplant, a cornea transplant, or a liver transplant.

[0234] The composition of any one of paragraphs 146-148 for use in treating a subject having a disorder.

[0235] The composition of paragraph 177, wherein the disorder is a cancer.

[0236] The composition of paragraph 178, wherein the cancer is selected from chronic lymphocytic leukemia (CLL), acute leukemia, acute lymphoid leukemia (ALL), B-cell acute lymphoid leukemia (B-ALL), T-cell lymphoma, B-cell lymphoma, T-cell acute lymphoid leukemia (T-ALL), chronic myeloid leukemia (CML), B-cell prolymphocytic leukemia, T-cell lymphoma, Hodgkin's disease, B-cell non-Hodgkin's lymphoma, blastic plasmacytoid dendritic cell neoplasm, Burkitt's lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, hairy cell leukemia, small cell- follicle center lymphoma, large cell-follicle center lymphoma, malignant lymphoproliferative conditions, mucosa-associated lymphoid tissue (MALT) lymphoma, mantle cell lymphoma, marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndrome, non-Hodgkin's lymphoma, Hodgkin's lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom's macroglobulinemia, or preleukemia.

[0237] The composition of paragraph 178, wherein the cancer is selected from colon cancer, rectal cancer, renal cell cancer, liver cancer, lung cancer, kidney cancer, stomach cancer, gall bladder cancer, small bowel cancer, esophageal cancer, melanoma, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of soft tissue, cancer of the urethra, cancer of the penis, solid tumors of childhood, cancer of the bladder, cancer of the kidney or ureter, carcinoma of the renal pelvis, neoplasm of the central nervous system (CNS), primary CNS lymphoma, tumor angiogenesis, spinal axis tumors, brain stem glioma, pituitary gland tumor, Kaposi's sarcoma, epidermoid cancer, squamous cell cancer, environmentally induced cancers, combinations thereof, and metastatic lesions of cancer.

[0238] The composition of paragraph 178, wherein the cancer is a human hematopoietic malignancy.

[0239] The composition of paragraph 181, wherein the human hematologic malignancy is selected from myeloid neoplasms, acute myeloid leukemia (AML), AML with recurrent genetic abnormalities, AML with myelodysplasia-related changes, therapy-related AML, acute leukemia of ambiguous lineage, myeloproliferative neoplasms, primary thrombocytosis, polycythemia vera, myelofibrosis (MF), primary myelofibrosis, systemic mast cell disease, myelodysplasia syndrome (MDS), myeloproliferative / myelodysplastic syndromes, chronic myelogenous leukemia, chronic neutrophilic leukemia, chronic eosinophilic leukemia, myelodysplasia syndrome (MDS), refractory anemia with ring sideroblasts, refractory cytopenia with multilineage dysplasia, refractory anemia with excess blasts (type 1), refractory cytopenia with excess blasts (type 2), MDS with isolated del(5q), unclassifiable MDS, myeloproliferative / myelodysplastic syndromes, chronic myelomonocytic leukemia, atypical chronic myeloid leukemia, juvenile myelomonocytic leukemia, unclassifiable myeloproliferative / myelodysplastic syndromes, lymphoid neoplasms, precursor lymphoid neoplasms, B-lymphoid leukemia, B-lymphoid lymphoma, T-lymphoid leukemia, T-lymphoid lymphoma, mature B-cell neoplasm, diffuse large B-cell lymphoma, primary central nervous system lymphoma, primary mediastinal B-cell lymphoma, Burkitt lymphoma / leukemia, follicular lymphoma, chronic lymphocytic leukemia, small lymphocytic lymphoma, B-cell prolymphocytic leukemia, lymphoplasmacytic lymphoma, Waldenstrom macroglobulinemia, mantle cell lymphoma, marginal zone lymphoma, post-transplant lymphoproliferative disorder, HIV-associated lymphoma, primary effusion lymphoma, intravascular large B-cell lymphoma, primary cutaneous B-cell lymphoma, hairy cell leukemia, multiple myeloma, monoclonal gammopathy of undetermined significance (MGUS), smoldering multiple myeloma, or solitary plasmacytoma (solitary bone and extramedullary).

[0240] The composition of paragraph 178, wherein the cancer is a metastatic cancer.

[0241] The composition of paragraph 178, wherein the composition is co-administered to the subject with one or more additional cancer therapies selected from chemotherapy, radiation therapy, immunotherapy, surgery, or a combination thereof.

[0242] The composition of paragraph 177, wherein the disorder is an infection.

[0243] The composition of paragraph 185, wherein the infection is caused by a pathogen.

[0244] The method of paragraph 186, wherein the pathogen is a virus.

[0245] The composition according to paragraph 187, wherein the virus is selected from a human immunodeficiency virus, an influenza virus, a papillomavirus, a coronavirus, a hepatitis virus, or a herpesvirus.

[0246] The composition according to paragraph 186, wherein the pathogen is a bacterium.

[0247] The composition according to paragraph 189, wherein the bacterium is Mycobacterium tuberculosis.

[0248] The composition according to paragraph 186, wherein the pathogen is a prion.

[0249] The composition according to paragraph 186, wherein the pathogen is a fungus.

[0250] The composition according to paragraph 192, wherein the fungus is Pneumocystis jirovecii (PJP).

[0251] The composition according to paragraph 186, wherein the pathogen is a parasite.

[0252] The composition according to paragraph 177, wherein the condition is an autoimmune disease or disorder.

[0253] The composition according to paragraph 195, wherein the autoimmune disease or disorder is selected from acute disseminated encephalomyelitis (ADEM), alopecia areata, antiphospholipid syndrome, autoimmune cardiomyopathy, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune inner ear disease, autoimmune polyendocrine syndrome, autoimmune progesterone dermatitis, autoimmune thrombocytopenic purpura, autoimmune urticarial, autoimmune uveitis, Behcet's disease, celiac disease, Chagas disease, cold agglutinin disease, Crohn's disease, dermatomyositis, diabetes mellitus type 1, eosinophilic fasciitis, gastrointestinal pemphigoid, Goodpasture's syndrome, Graves' disease, Guillain-Barre syndrome, Hashimoto's encephalopathy, Hashimoto's thyroiditis, lupus erythematosus, Miller-Fisher syndrome, mixed connective tissue disease, myasthenia gravis, pemphigus vulgaris, pernicious anemia, polymyositis, psoriasis, psoriatic arthritis, relapsing polychondritis, rheumatoid arthritis, rheumatic fever, Sjogren's syndrome, temporal arteritis, transverse myelitis, ulcerative colitis, undifferentiated connective tissue disease, vasculitis, and Wegener's granulomatosis.

[0254] The composition according to paragraph 195, wherein the autoimmune disease or disorder is adult rheumatoid arthritis.

[0255] The composition according to paragraph 177, wherein the condition is a transplant.

[0256] The composition according to paragraph 198, wherein the transplant is selected from a stem cell transplant or a bone marrow transplant.

[0257] The composition according to paragraph 198, wherein the transplant is selected from a kidney transplant, a lung transplant, a heart transplant, a pancreas transplant, a cornea transplant, or a liver transplant.

[0258] REFERENCES

[0259] Armentano et al. Proc Natl Acad Sci USA 87(16):6141-6145 (1990)

[0260] Berkner Biotechniques 6(7):616-629 (1988)

[0261] Beziat et al. Immunology 150(3):248-264 (2017)

[0262] Cheng et al. Clin Cancer Res 24(8):1954-1964 (2018)

[0263] Cheng et al. Clin Cancer Res 23(3):825-832 (2017)

[0264] Chowdhury et al. Science 254(5039):1802-1805 (1991)

[0265] Dai et al. Proc Natl Acad Sci USA 89(22):10892-10895 (1992)

[0266] Danos & Mulligan Proc Natl Acad Sci USA 85(17):6460-6464 (1988)

[0267] Eglitis et al. Science 230(4732):1395-1398 (1985)

[0268] Ferry et al. Proc Natl Acad Sci USA 88(19):8377-8381 (1991)

[0269] Flotte et al. Am J Respir Cell Mol Biol 7(3): 349-356 (1992)

[0270] Harris Biochem Soc Trans 23(4): 1035-1038 (1995)

[0271] Huber et al. Proc Natl Acad Sci USA 88(18): 8039-8043 (1991)

[0272] Hurle & Gross Curr Opin Biotechnol 5(4): 428-433 (1994)

[0273] Hwu et al. J Immunol 150(9): 4104-4115 (1993)

[0274] Janakiram et al. Clin Cancer Res 21(10): 2359-2366 (2015)

[0275] Jones et al. Nature 321(6069): 522-525 (1986)

[0276] Kay et al. Hum Gene Ther 3(6): 641-647 (1992)

[0277] Koirala et al. Sci Rep 6: 31154 (2016)

[0278] McLaughlin et al. J Virol 62(6): 1963-1973 (1988)

[0279] Presta Curr Opin Biotechnol 3(4): 394-398 (1992)

[0280] Riechmann et al. Nature 332(6162): 323-327 (1988)

[0281] Rosenfeld et al. Science 252(5004): 431-434 (1991)

[0282] Rosenfeld et al. Cell 68(1): 143-155 (1992)

[0283] Samulski et al. J Virol 63(9):3822-3828 (1989)

[0284] van Beusechem et al. Proc Natl Acad Sci USA 89(16):7640-7644 (1992)

[0285] Vaswani & Hamilton Ann Allergy Asthma Immunol 81(2):105-115 (1998)

[0286] Wilson et al. Proc Natl Acad Sci USA 85(9):3014-3018 (1988)

[0287] Zhao et al. Proc Natl Acad Sci USA 110(24):9879-9884 (2013) SEQUENCE LISTING <110> Albert Einstein College of Medicine <120> KIR3DL3 is an inhibitory receptor of the immune system and uses thereof <130> 129807-8002.WO00 <140> PCT / US20 / 053857 <141> 2020-10-01 <150> US 62 / 911,169 <151> 2019-10-04 <160> 342 <170> PatentIn version 3.5 <210> 1 <211> 411 <212> DNA <213> Artificial Sequence <220> <223> 8G7 heavy chain VH <220> <221> misc_feature <222> (1)..(57) <223> Leader sequence <220> <221> misc_feature <222> (58)..(132) <223> FR1 <220> <221> misc_feature <222> (133)..(162) <223> CDR1 <220> <221> misc_feature <222> (163)..(207) <223> FR2 <220> <221> misc_feature <222> (208)..(255) <223> CDR2 <220> <221> misc_feature <222> (256)..(345) <223> FR3 <220> <221> misc_feature <222> (346)..(378) <223> CDR3 <220> <221> misc_feature <222> (379)..(408) <223> FR4 <400> 1 atgaactttg ggttgagatt gattttcctt gtccttgttt taaaaggtgt ccagtgtgaa 60 gtgatgctgg tggagtctgg gggaggctta gtgaagcctg gagggtccct gaaactctcc 120 tgtgcagcct ctggattcac tttcagtacc tatgccatgt cttgggttcg ccagactccg 180 GAGAAGAGGC TGGAGTGGGT CGCAACCATT CTTAGTGGTG GTAATCACAC CTACTATCCA 240 GACAGTGTGA AGGGGCATTC ACCATCTCCA GAGACAATGC CAGGAACACC CTGAACCTG 300 CAAAATGAGC AGTCTGAGGT CTGAGGACAC GGCCATGTAT TCCTGTGTAA CCCCTATGGT 360 AGTAGTCCTT TTTGACTATT GGGGCAAGGC ACCACTCTCA CAGTCTCTCT A 411 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> 8G7 Heavy Chain VH: CDR1 <400> 2 GGATTCACTT TCAGTACCTA TGCCATGTCT 30 <210> 3 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> 8G7 Heavy Chain VH: CDR2 <400> 3 ATTCTTAGTG GTGGTAATTA CACCTACTAT CCAGACAGTG TGAAGGGG 48 <210> 4 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> 8G7 Heavy Chain VH: CDR3 <400> 4 GTAATCCCCT ATGGTAGTAG TCCTTTTGAC TAT 33 <210> 5 <211> 136 <212> PRT <213> Artificial sequence <220> <223> 8G7 Heavy Chain VH <220> <221> MISC_FEATURE <222> (1)..(19) <223> Leader sequence <220> <221> MISC_FEATURE <222> (20) (44) <223> FR1 <220> <221> MISC_FEATURE <222> (45) (54) <223> CDR1 <220> <221> MISC_FEATURE <222> (55) (68) <223> FR2 <220> <221> MISC_FEATURE <222> (69) (85) <223> CDR2 <220> <221> MISC_FEATURE <222> (86) (115) <223> FR3 <220> <221> MISC_FEATURE <222> (116) (126) <223> CDR3 <220> <221> MISC_FEATURE <222> (127) (136) <223> FR4 <400> 5 Met Asn Phe Gly Leu Arg Leu Ile Phe Leu Val Leu Val Leu Lys Gly 1 5 10 15 Val Gin Cys Glu Val Met Leu Val Glu Ser Gly Gly Gly Leu Val Lys 20 25 30 Pro Gly Gly Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 35 40 45 Ser Thr Tyr Ala Met Ser Trp Val Arg Gin Thr Pro Glu Lys Arg Leu 50 55 60 Glu Trp Val Ala Thr Ile Leu Ser Gly Gly Asn Tyr Thr Tyr Tyr Pro 65 70 75 80 Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn 85 90 95 Thr Leu Asn Leu Gin Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Met 100 105 110 Tyr Tyr Cys Val Ile Pro Tyr Gly Ser Ser Pro Phe Asp Tyr Trp Gly 115 120 125 Gln Gly Thr Thr Leu Thr Val Ser 130 135 <210> 6 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> 8G7 heavy chain VH: FR1 <400> 6 Glu Val Met Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly 1 5 10 15 Ser Leu Lys Leu Ser Cys Ala Ala Ser 20 25 <210> 7 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 8G7 heavy chain VH: CDR1 <400> 7 Gly Phe Thr Phe Ser Thr Tyr Ala Met Ser 1 5 10 <210> 8 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> 8G7 heavy chain VH: FR2 <400> 8 Trp Val Arg Gin Thr Pro Glu Lys Arg Leu Glu Trp Val Ala 1 5 10 <210> 9 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> 8G7 heavy chain VH: CDR2 <400> 9 Thr He Leu Ser Gly Gly Asn Tyr Thr Tyr Tyr Pro Asp Ser Val Lys 1 5 10 15 Gly <210> 10 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> 8G7 heavy chain VH: FR3 <400> 10 Arg Phe Thr lie Ser Arg Asp Asn Ala Lys Asn Thr Leu Asn Leu Gin 1 5 10 15 Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys 20 25 30 <210> 11 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> 8G7 Heavy Chain VH: CDR3 <400> 11 Val lie Pro Tyr Gly Ser Ser Pro Phe Asp Tyr 1 5 10 <210> 12 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 8G7 Heavy Chain VH: FR4 <400> 12 Trp Gly Gin Gly Thr Thr Leu Thr Val Ser 1 5 10 <210> 13 <211> 423 <212> DNA <213> Artificial Sequence <220> <223> 8G7 Light Chain VL <220> <221> misc_feature <222> (28)..(87) <223> Leader Sequence <220> <221> misc_feature <222> (88)..(156) <223> FR1 <220> <221> misc_feature <222> (157)..(183) <223> CDR1 <220> <221> misc_feature <222> (184)..(234) <223> FR2 <220> <221> misc_feature <222> (235)..(255) <223> CDR2 <220> <221> misc_feature <222> (256)..(352) <223> FR3 <220> <221> misc_feature <222> (353)..(378) <223> CDR3 <220> <221> misc_feature <222> (379)..(408) <223> FR4 <400> 13 ttattactag tcgacacggg catcaagatg aagtcacaga cccaggtctt cgtatttcta 60 ctgctctgtg tgtctggtgc tcatgggagt attgtgatga cccagactcc caaattcctg 120 cttgtatcag caggagacag ggttaccata acctgcaagg ccagtcagag tgtgagtaat 180 gatgtagctt ggtaccaaca gaagccaggg cagtctccta aactgctgat atactatgca 240 tccaatcgct acactggagt ccctgatcgc ttcactggca gtggatatgg gacggatttc 300 actttcacca tcagcactgt gcaggctgaa gacctggcag tttatttctg tcagcaggat 360 tatagctctc cgtggacgtt cggtggaggc accaagctgg aaatcaaacg ggctgatgct 420 gca 423 <210> 14 <211> 27 <212> DNA <213> Artificial sequence <220> <223> 8G7 Heavy Chain VL: CDR1 <400> 14 aaggccagtc agagtgtgag taatgat 27 <210> 15 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> 8G7 Heavy Chain VL: CDR2 <400> 15 tatgcatcca atcgctacac t 21 <210> 16 <211> 27 <212> DNA <213> Artificial sequence <220> <223> 8G7 Heavy Chain VL: CDR3 <400> 16 cagcaggatt atagctctcc gtggacg 27 <210> 17 <211> 127 <212> PRT <213> Artificial sequence <220> <223> 8G7 Light Chain VL <220> <221> MISC_FEATURE <222> (1)..(20) <223> LEADER SEQUENCE <220> <221> MISC_FEATURE <222> (21)..(43) <223> FR1 <220> <221> MISC_FEATURE <222> (44)..(52) <223> CDR1 <220> <221> MISC_FEATURE <222> (53)..(69) <223> FR2 <220> <221> MISC_FEATURE <222> (70)..(76) <223> CDR2 <220> <221> MISC_FEATURE <222> (77)..(108) <223> FR3 <220> <221> MISC_FEATURE <222> (109)..(117) <223> CDR3 <220> <221> MISC_FEATURE <222> (118)..(127) <223> FR4 <400> 17 Met Lys Ser Gin Thr Gin Val Phe Val Phe Leu Leu Leu Cys Val Ser 1 5 10 15 Gly Ala His Gly Ser Ile Val Met Thr Gin Thr Pro Lys Phe Leu Leu 20 25 30 Val Ser Ala Gly Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Ser 35 40 45 Val Ser Asn Asp Val Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro 50 55 60 Lys Leu Leu Ile Tyr Tyr Ala Ser Asn Arg Tyr Thr Gly Val Pro Asp 65 70 75 80 Arg Phe Thr Gly Ser Gly Tyr Gly Thr Asp Phe Thr Phe Thr Ile Ser 85 90 95 Thr Val Gln Ala Glu Asp Leu Ala Val Tyr Phe Cys Gln Gln Asp Tyr 100 105 110 Ser Ser Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 115 120 125 <210> 18 <211> 23 <212> PRT <213> Artificial Sequence <220> <223> 8G7 Heavy Chain VL: FR1 <400> 18 Ser Ile Val Met Thr Gln Thr Pro Lys Phe Leu Leu Val Ser Ala Gly 1 5 10 15 Asp Arg Val Thr Ile Thr Cys 20 <210> 19 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> 8G7 Heavy Chain VL: CDR1 <400> 19 Lys Ala Ser Gln Ser Val Ser Asn Asp 1 5 <210> 20 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> 8G7 Heavy Chain VL: FR2 <400> 20 Val Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile 1 5 10 15 Tyr <210> 21 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> 8G7 Heavy Chain VL: CDR2 <400> 21 Tyr Ala Ser Asn Arg Tyr Thr 1 5 <210> 22 <211> 32 <212> PRT <213> Artificial Sequence <220> <223> 8G7 Heavy Chain VL: FR3 <400> 22 Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Tyr Gly Thr Asp Phe Thr 1 5 10 15 Phe Thr Ile Ser Thr Val Gln Ala Glu Asp Leu Ala Val Tyr Phe Cys 20 25 30 <210> 23 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> 8G7 Heavy Chain VL: CDR3 <400> 23 Gln Gln Asp Tyr Ser Ser Pro Trp Thr 1 5 <210> 24 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 8G7 Heavy Chain VL: FR4 <400> 24 Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 1 5 10 <210> 25 <211> 431 <212> DNA <213> Artificial Sequence <220> <223> 26E10 Heavy Chain VH <220> <221> misc_feature <222> (11)..(67) <223> Leader Sequence <220> <221> misc_feature <222> (68)..(142) <223> FR1 <220> <221> misc_feature <222> (143)..(172) <223> CDR1 <220> <221> misc_feature <222> (173)..(214) <223> FR2 <220> <221> misc_feature <222> (215)..(265) <223> CDR2 <220> <221> misc_feature <222> (266)..(361) <223> FR3 <220> <221> misc_feature <222> (362)..(397) <223> CDR3 <220> <221> misc_feature <222> (398)..(430) <223> FR4 <400> 25 tggggaattc atggaatgga gctgggtttt tctcttcctc ctgtcaataa ctacaggtgt 60 ccactcccag gcttatctac agcagtctgg ggctgagctg gtgaggtctg gggcctcagt 120 gaagatgtcc tgcaaggctt ctggctacac atttaccagt tacaatatac actgggtaaa 180 gcagacacct ggacagggcc tggaatggat tggatatatt tatcctggag atggtgttac 240 taactacaat cagaagttca agggcaaggc cacattgact gcagacacat cctccagcac 300 agcctacatg cagatcagca gcctgacatc tgaagactct gcggtctatt tctgtgcaag 360 atcgggcaac tatggtaact acgaagggtt tgcttactgg ggccaaggga ctctggtcac 420 atcgggcaac tatggtaact acgaagggtt tgcttactgg ggccaaggga ctctggtcac 420tgtctctgct a 431 <210> 26 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> 26E10 Heavy Chain VH: CDR1 <400> 26 ggctacacat ttaccagtta caatatacac 30 <210> 27 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> 26E10 Heavy Chain VH: CDR2 <400> 27 tatatttatc ctggagatgg tgttactaac tacaatcaga agttcaaggg c 51 <210> 28 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> 26E10 Heavy Chain VH: CDR3 <400> 28 tcgggcaact atggtaacta cgaagggttt gcttac 36 <210> 29 <211> 140 <212> PRT <213> Artificial Sequence <220> <223> 26E10 Heavy Chain VH <220> <221> MISC_FEATURE <222> (1)..(19) <223> Leader Sequence <220> <221> MISC_FEATURE <222> (20)..(44) <223> FR1 <220> <221> MISC_FEATURE <222> (45)..(54) <223> CDR1 <220> <221> MISC_FEATURE <222> (55)..(68) <223> FR2 <220> <221> MISC_FEATURE <222> (69)..(85) <223> CDR2 <220> <221> MISC_FEATURE <222> (86)..(117) <223> FR3 <220> <221> MISC_FEATURE <222> (118)..(129) <223> CDR3 <220> <221> MISC_FEATURE <222> (130)..(140) <223> FR4 <400> 29 Met Glu Trp Ser Trp Val Phe Leu Phe Leu Leu Ser Ile Thr Thr Gly 1 5 10 15 Val His Ser Gln Ala Tyr Leu Gln Gln Ser Gly Ala Glu Leu Val Arg 20 25 30 Ser Gly Ala Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45 Thr Ser Tyr Asn lie His Trp Val Lys Gin Thr Pro Gly Gin Gly Leu 50 55 60 Glu Trp lie Gly Tyr lie Tyr Pro Gly Asp Gly Val Thr Asn Tyr Asn 65 70 75 80 Gln Lys Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ser Ser 85 90 95 Thr Ala Tyr Met Gin lie Ser Ser Leu Thr Ser Glu Asp Ser Ala Val 100 105 110 Tyr Phe Cys Ala Arg Ser Gly Asn Tyr Gly Asn Tyr Glu Gly Phe Ala 115 120 125 Tyr Trp Gly Gin Gly Thr Leu Val Thr Val Ser Ala 130 135 140 <210> 30 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> 26E10 Heavy Chain VH: FR1 <400> 30 Gln Ala Tyr Leu Gin Gin Ser Gly Ala Glu Leu Val Arg Ser Gly Ala 1 5 10 15 Ser Val Lys Met Ser Cys Lys Ala Ser 20 25 <210> 31 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 26E10 heavy chain VH: CDR1 <400> 31 Gly Tyr Thr Phe Thr Ser Tyr Asn Ile His 1 5 10 <210> 32 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> 26E10 heavy chain VH: FR2 <400> 32 Trp Val Lys Gln Thr Pro Gly Gln Gly Leu Glu Trp Ile Gly 1 5 10 <210> 33 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> 26E10 heavy chain VH: CDR2 <400> 33 Tyr Ile Tyr Pro Gly Asp Gly Val Thr Asn Tyr Asn Gln Lys Phe Lys 1 5 10 15 Gly <210> 34 <211> 32 <212> PRT <213> Artificial Sequence <220> <223> 26E10 heavy chain VH: FR3 <400> 34 Lys Ala Thr Leu Thr Ala Asp Thr Ser Ser Ser Thr Ala Tyr Met Gln 1 5 10 15 Ile Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys Ala Arg 20 25 30 <210> 35 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> 26E10 Heavy Chain VH: CDR3 <400> 35 Ser Gly Asn Tyr Gly Asn Tyr Glu Gly Phe Ala Tyr 1 5 10 <210> 36 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> 26E10 Heavy Chain VH: FR4 <400> 36 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ala 1 5 10 <210> 37 <211> 296 <212> DNA <213> Artificial Sequence <220> <223> 26E10 Light Chain VL <220> <221> misc_feature <222> (2)..(43) <223> FR1 <220> <221> misc_feature <222> (44)..(76) <223> CDR1 <220> <221> misc_feature <222> (77)..(121) <223> FR2 <220> <221> misc_feature <222> (122)..(142) <223> CDR2 <220> <221> misc_feature <222> (143)..(238) <223> FR3 <220> <221> misc_feature <222> (239)..(265) <223> CDR3 <220> <221> misc_feature <222> (266)..(295) <223> FR4 <400> 37 ttccatgtat gcatctctag gagagagagt cactatcact tgcaaggcga gtcaggacac 60 taatagctat ttaagctggt tccagcagaa accagggaaa tctcctaaga ccctgatcta 120 tcgtgcaaac agattggtag atggggtccc atcaaggttc agtggcagtg gatctgggca 180 agattattct ctcaccatca gcagcctgga gtatgaagat atgggaattt attattgtct 240 acagtatgat gagtttccgt acacgttcgg aggggggacc aagctggaaa taaaac 296 <210> 38 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> 26E10 light chain VL: CDR1 <400> 38 aaggcgagtc aggacactaa tagctattta agc 33 <210> 39 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 26E10 Heavy Chain VL: CDR2 <400> 39 cgtgcaaaca gattggtaga t 21 <210> 40 <211> 27 <212> PRT <213> Artificial Sequence <220> <223> 26E10 Heavy Chain VL: CDR3 <400> 40 ctacagtatg atgagtttcc gtacacg 27 <210> 41 <211> 98 <212> PRT <213> Artificial Sequence <220> <223> 26E10 Heavy Chain VL <220> <221> MISC_FEATURE <222> (1)..(14) <223> FR1 <220> <221> MISC_FEATURE <222> (15)..(25) <223> CDR1 <220> <221> MISC_FEATURE <222> (26)..(40) <223> FR2 <220> <221> MISC_FEATURE <222> (41)..(47) <223> CDR2 <220> <221> MISC_FEATURE <222> (48)..(79) <223> FR3 <220> <221> MISC_FEATURE <222> (80)..(88) <223> CDR3 <220> <221> MISC_FEATURE <222> (89)..(98) <223> FR4 <400> 41 Ser Met Tyr Ala Ser Leu Gly Glu Arg Val Thr Ile Thr Cys Lys Ala 1 5 10 15 Ser Gln Asp Thr Asn Ser Tyr Leu Ser Trp Phe Gln Gln Lys Pro Gly 20 25 30 Lys Ser Pro Lys Thr Leu Ile Tyr Arg Ala Asn Arg Leu Val Asp Gly 35 40 45 Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Gln Asp Tyr Ser Leu 50 55 60 Thr Ile Ser Ser Leu Glu Tyr Glu Asp Met Gly Ile Tyr Tyr Cys Leu 65 70 75 80 Gln Tyr Asp Glu Phe Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu 85 90 95 Ile Lys <210> 42 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> 26E10 Heavy Chain VL: FR1 <400> 42 Ser Met Tyr Ala Ser Leu Gly Glu Arg Val Thr Ile Thr Cys 1 5 10 <210> 43 <211 > 11 <212> PRT <213> Artificial Sequence <220> <223> 26E10 Heavy Chain VL: CDR1 <400> 43 Lys Ala Ser Gln Asp Thr Asn Ser Tyr Leu Ser 1 5 10 <210> 44 <211 > 15 <212> PRT <213> Artificial Sequence <220> <223> 26E10 Heavy Chain VL: FR2 <400> 44 Trp Phe Gln Gln Lys Pro Gly Lys Ser Pro Lys Thr Leu Ile Tyr 1 5 10 15 <210> 45 <211 > 7 <212> PRT <213> Artificial Sequence <220> <223> 26E10 Heavy Chain VL: CDR2 <400> 45 Arg Ala Asn Arg Leu Val Asp 1 5 <210> 46 <211 > 32 <212> PRT <213> Artificial Sequence <220> <223> 26E10 Heavy Chain VL: FR3 <400> 46 Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Gin Asp Tyr Ser 1 5 10 15 Leu Thr Ile Ser Ser Leu Glu Tyr Glu Asp Met Gly Ile Tyr Tyr Cys 20 25 30 <210> 47 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> 26E10 VL Chain CDR3 <400> 47 Leu Gin Tyr Asp Glu Phe Pro Tyr Thr 1 5 <210> 48 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 26E10 VL Chain FR4 <400> 48 Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 1 5 10 <210> 49 <211> 264 <212> DNA <213> Artificial Sequence <220> <223> 26E2 Heavy Chain VH <220> <221> misc_feature <222> (2)..(46) <223> FR2 <220> <221> misc_feature <222> (47)..(97) <223> CDR2 <400> 49<220> <221> misc_feature <222> (98)..(193) <223> FR3 <220> <221> misc_feature <222> (194)..(229) <223> CDR3 <220> <221> misc_feature <222> (230)..(262) <223> FR4 <400> 49 gcgctgggta aagcagacac ctggacaggg cctggaatgg attggatata tttatcctgg 60 agatggtggt actaactgca atcagaagtt ccagggcaag gccacattga ctgcagacac 120 atcctccagc acagcctaca tgcagatcag cagcctgaca tctgaagact ctgcggtcta 180 tttctgtgca agatcgggca actatggtaa ctacgaaggg tttgctttct ggggccaagg 240 gactctggtc actgtctctg cagc 264 <210> 50 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> 26E2 heavy chain VH: CDR2 <400> 50 tatatttatc ctggagatgg tggtactaac tgcaatcaga agttccaggg c 51 <210> 51 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> 26E2 Heavy Chain VH: CDR3 <400> 51 tcgggcaact atggtaacta cgaagggttt gctttc 36 <210> 52 <211> 87 <212> PRT <213> Artificial Sequence <220> <223> 26E2 Heavy Chain VH <220> <221> MISC_FEATURE <222> (1)..(15) <223> FR2 <220> <221> MISC_FEATURE <222> (16)..(32) <223> CDR2 <220> <221> MISC_FEATURE <222> (33)..(64) <223> FR3 <220> <221> MISC_FEATURE <222> (65)..(76) <223> CDR3 <220> <221> MISC_FEATURE <222> (77)..(87) <223> FR4 <400> 52 Arg Trp Val Lys Gln Thr Pro Gly Gin Gly Leu Glu Trp He Gly Tyr 1 5 10 15 He Tyr Pro Gly Asp Gly Gly Thr Asn Cys Asn Gin Lys Phe Gin Gly 20 25 30 Lys Ala Thr Leu Thr Ala Asp Thr Ser Ser Ser Thr Ala Tyr Met Gin 35 40 45 Ile Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys Ala Arg 50 55 60 Ser Gly Asn Tyr Gly Asn Tyr Glu Gly Phe Ala Phe Trp Gly Gln Gly 65 70 75 80 Thr Leu Val Thr Val Ser Ala 85 <210> 53 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> 26E2 heavy chain VH: FR2 <400> 53 Arg Trp Val Lys Gin Thr Pro Gly Gin Gly Leu Glu Trp He Gly 1 5 10 15 <210> 54 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> 26E2 heavy chain VH: CDR2 <400> 54 Tyr He Tyr Pro Gly Asp Gly Gly Thr Asn Cys Asn Gin Lys Phe Gin 1 5 10 15 Gly <210> 55 <211> 32 <212> PRT <213> Artificial Sequence <220> <223> 26E2 heavy chain VH: FR3 <400> 55 Lys Ala Thr Leu Thr Ala Asp Thr Ser Ser Ser Thr Ala Tyr Met Gin 1 5 10 15 Ile Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys Ala Arg 20 25 30 <210> 56 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> 26E2 heavy chain VH: CDR3 <400> 56 Ser Gly Asn Tyr Gly Asn Tyr Glu Gly Phe Ala Phe 1 5 10 <210> 57 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> 26E2 heavy chain VH: FR4 <400> 57 Trp Gly Gin Gly Thr Leu Val Thr Val Ser Ala 1 5 10 <210> 58 <211> 394 <212> DNA <213> Artificial Sequence <220> <223> 26E2 light chain VL <220> <221> misc_feature <222> (1)..(60) <223> leader sequence <220> <221> misc_feature <222> (61)..(129) <223> FR1 <220> <221> misc_feature <222> (130)..(162) <223> CDR1 <220> <221> misc_feature <222> (163)..(207) <223> FR2 <220> <221> misc_feature <222> (208)..(228) <223> CDR2 <220> <221> misc_feature <222> (229)..(324) <223> FR3 <220> <221> misc_feature <222> (325)..(351) <223> CDR3 <220> <221> misc_feature <222> (352)..(393) <223> FR4 <400> 58 atgagggccc ctgctcagtt ttttgggatc ttgttgctct ggtttccagg tatcaaatgt 60 gacatcaaga tgacccagtc tccatcctcc atgtatgcat ctctaggaga gagagtcact 120 atcacttgca aggcgagtca ggacactaat agctatttaa gctggttcca gcagaaacca 180 gggaaatctc ctaagaccct gatctatcgt gcaaacagat tggtagatgg ggtcccatca 240 aggttcagtg gcagtggatc tgggcaagat tattctctca ccatcagccg cctggagtat 300 gaagatatgg gaatttatta ttgtctacag tataatgagt ttccgtacac gttcggaggg 360 gggaccaagc tggaaataaa acgggctgat gctg 394 <210> 59 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> 26E2 Light Chain VL: CDR1 <400> 59 aaggcgagtc aggacactaa tagctattta agc 33 <210> 60 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 26E2 Light Chain VL: CDR2 <400> 60 cgtgcaaaca gattggtaga t 21 <210> 61 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> 26E2 Light Chain VL: CDR3 <400> 61 ctacagtata atgagtttcc gtacacg 27 <210> 62 <211> 131 <212> PRT <213> Artificial Sequence <220> <223> 26E2 Light Chain VL <220> <221> MISC_FEATURE <222> (1)..(20) <223> Leader sequence <220> <221> MISC_FEATURE <222> (21)..(43) <223> FR1 <220> <221> MISC_FEATURE <222> (44) (54) <223> CDR1 <220> <221> MISC_FEATURE <222> (55) (69) <223> FR2 <220> <221> MISC_FEATURE <222> (70) (76) <223> CDR2 <220> <221> MISC_FEATURE <222> (77) (108) <223> FR3 <220> <221> MISC_FEATURE <222> (109) (117) <223> CDR3 <220> <221> MISC_FEATURE <222> (118) (131) <223> FR4 <400> 62 Met Arg Ala Pro Ala Gln Phe Phe Gly Ile Leu Leu Leu Trp Phe Pro 1 5 10 15 Gly lie Lys Cys Asp lie Lys Met Thr Gin Ser Pro Ser Ser Met Tyr Ala Ser Leu Gly Glu Arg Val Thr lie Thr Cys Lys Ala Ser Gin Asp 20 25 30 Ala Ser Leu Gly Glu Arg Val Thr lie Thr Cys Lys Ala Ser Gin Asp 35 40 45 Thr Asn Ser Tyr Leu Ser Trp Phe Gin Gin Lys Pro Gly Lys Ser Pro 50 55 60 Lys Thr Leu lie Tyr Arg Ala Asn Arg Leu Val Asp Gly Val Pro Ser 65 70 75 80 Arg Phe Ser Gly Ser Gly Ser Gly Gin Asp Tyr Ser Leu Thr lie Ser 85 90 95 Arg Leu Glu Tyr Gin Asp Met Gly lie Tyr Tyr Cys Leu Gin Tyr Asn 100 105 110 Glu Phe Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu lie Lys Arg 115 120 125 Ala Asp Ala 130 <210> 63 <211> 23 <212> PRT <213> Artificial Sequence <220> <223> 26E2 Light Chain VL: FR1 <400> 63 Asp lie Lys Met Thr Gin Ser Pro Ser Ser Met Tyr Ala Ser Leu Gly 1 5 10 15 Glu Arg Val Thr lie Thr Cys 20 <210> 64 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> 26E2 Light Chain VL: CDR1 <400> 64 Lys Ala Ser Gin Asp Thr Asn Ser Tyr Leu Ser 1 5 10 <210> 65 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> 26E2 Light Chain VL: FR2 <400> 65 Trp Phe Gin Gin Lys Pro Gly Lys Ser Pro Lys Thr Leu lie Tyr 1 5 10 15 <210> 66 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> 26E2 Light Chain VL: CDR2 <400> 66 Arg Ala Asn Arg Leu Val Asp 1 5 <210> 67 <211> 32 <212> PRT <213> Artificial Sequence <220> <223> 26E2 Light Chain VL: FR3 <400> 67 Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Gin Asp Tyr Ser 1 5 10 15 Leu Thr lie Ser Arg Leu Glu Tyr Glu Asp Met Gly lie Tyr Tyr Cys 20 25 30 <210> 68 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> 26E2 Light Chain VL: CDR3 <400> 68 Leu Gin Tyr Asn Glu Phe Pro Tyr Thr 1 5 <210> 69 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> 26E2 Light Chain VL: FR4 <400> 69 Phe Gly Gly Gly Thr Lys Leu Glu lie Lys Arg Ala Asp Ala 1 5 10 <210> 70 <211> 435 <212> DNA <213> Artificial Sequence <220> <223> 31C4 Heavy Chain VH <220> <221> misc_feature <222> (14)..(70) <223> Leader Sequence <220> <221> misc_feature <222> (71)..(145) <223> FR1 <220> <221> misc_feature <222> (146)..(175) <223> CDR1 <220> <221> misc_feature <222> (176)..(217) <223> FR2 <220> <221> misc_feature <222> (218)..(268) <223> CDR2 <220> <221> misc_feature <222> (269)..(358) <223> FR3 <220> <221> misc_feature <222> (359)..(400) <223> CDR3 <220> <221> misc_feature <222> (401)..(433) <223> FR4 <400> 70 tgtggggaat tccatggaat ggagctgggt ttttctcttc ctcctgtcaa taactacagg 60 tgtccactcc caggcttatc tacagcagtc tggggctgag ctggtgaggt ctggggcctc 120 agtgaagatg tcctgcaagg cttctggcta cacatttacc agttacaata tgcactgggt 180 aaagcagaca cctggacagg gcctggaatg gattggatat atttttcctg gagatggtgg 240 tactaactac aatcagaagt tcaagggcaa ggccacattg actgcagaca catcctccag 300 cacagcctac atgcagatca gcagcctgac atctgaagac tctgcggtct atttctgtgc 360 aagatcgggc aactatggta actacgaagg gtttgcttac tggggccaag ggactctggt 420 cactgtctct gctag 435 <210> 71 <211> 30 <212> DNA <213> Artificial sequence <220> <223> 31C4 Heavy chain VH: CDR1 <400> 71 ggctacacat ttaccagtta caatatgcac 30 <210> 72 <211> 51 <212> DNA <213> Artificial sequence <220> <223> 31C4 Heavy chain VH: CDR2 <400> 72 tatatttttc ctggagatgg tggtactaac tacaatcaga agttcaaggg c 51 <210> 73 <211> 42 <212> DNA <213> Artificial sequence <220> <223> 31C4 Heavy chain VH: CDR3 <400> 73 gcaagatcgg gcaactatgg taactacgaa gggtttgctt ac 42 <210> 74 <211> 140 <212> PRT <213> Artificial sequence <220> <223> 31C4 Heavy chain VH <220> <221> MISC_FEATURE <222> (1)..(19) <223> Leader sequence <220> <221> MISC_FEATURE <222> (20)..(44) <223> FR1 <220> <221> MISC_FEATURE <222> (45)..(54) <223> CDR1 <220> <221> MISC_FEATURE <222> (55)..(68) <223> FR2 <220> <221> MISC_FEATURE <222> (69)..(85) <223> CDR2 <220> <221> MISC_FEATURE <222> (86)..(115) <223> FR3 <220> <221> MISC_FEATURE <222> (116)..(129) <223> CDR3 <220> <221> MISC_FEATURE <222> (130)..(140) <223> FR4 <400> 74 Met Glu Trp Ser Trp Val Phe Leu Phe Leu Leu Ser Ile Thr Thr Gly 1 5 10 15 Val His Ser Gln Ala Tyr Leu Gln Gln Ser Gly Ala Glu Leu Val Arg 20 25 30 Ser Gly Ala Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45 Thr Ser Tyr Asn Met His Trp Val Lys Gln Thr Pro Gly Gln Gly Leu 50 55 60 Glu Trp Ile Gly Tyr Ile Phe Pro Gly Asp Gly Gly Thr Asn Tyr Asn 65 70 75 80 Gln Lys Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ser Ser 85 90 95 Thr Ala Tyr Met Gln Ile Ser Ser Leu Thr Ser Glu Asp Ser Ala Val 100 105 110 Tyr Phe Cys Ala Arg Ser Gly Asn Tyr Gly Asn Tyr Glu Gly Phe Ala 115 120 125 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ala 130 135 140 <210> 75 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> 31C4 Heavy Chain VH: FR1 <400> 75 Gln Ala Tyr Leu Gln Gln Ser Gly Ala Glu Leu Val Arg Ser Gly Ala 1 5 10 15 Ser Val Lys Met Ser Cys Lys Ala Ser 20 25 <210> 76 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 31C4 Heavy chain VH: CDR1 <400> 76 Gly Tyr Thr Phe Thr Ser Tyr Asn Met His 1 5 10 <210> 77 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> 31C4 Heavy chain VH: FR2 <400> 77 Trp Val Lys Gln Thr Pro Gly Gln Gly Leu Glu Trp Ile Gly 1 5 10 <210> 78 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> 31C4 Heavy chain VH: CDR2 <400> 78 Tyr Ile Phe Pro Gly Asp Gly Gly Thr Asn Tyr Asn Gln Lys Phe Lys 1 5 10 15 Gly <210> 79 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> 31C4 Heavy chain VH: FR3 <400> 79 Lys Ala Thr Leu Thr Ala Asp Thr Ser Ser Ser Thr Ala Tyr Met Gln 1 5 10 15 Ile Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys 20 25 30 <210> 80 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> 31C4 heavy chain VH: CDR3 <400> 80 Ala Arg Ser Gly Asn Tyr Gly Asn Tyr Glu Gly Phe Ala Tyr 1 5 10 <210> 81 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> 31C4 heavy chain VH: FR4 <400> 81 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ala 1 5 10 <210> 82 <211> 407 <212> DNA <213> Artificial Sequence <220> <223> 31C4 light chain VL <220> <221> misc_feature <222> (3)..(71) <223> leader sequence <220> <221> misc_feature <222> (72)..(140) <223> FR1 <220> <221> misc_feature <222> (141)..(173) <223> CDR1 <220> <221> misc_feature <222> (174)..(218) <223> FR2 <220> <221> misc_feature <222> (219)..(239) <223> CDR2 <220> <221> misc_feature <222> (240)..(335) <223> FR3 <220> <221> misc_feature <222> (336)..(362) <223> CDR3 <220> <221> misc_feature <222> (363)..(407) <223> FR4 <400> 82 tactagtcga catgaggccc cctgctcagt tttttgggat cttgttgctc tggtttccag 60 gtatcaaatg tgacatcaag atgacccagt ctccatcttc catgtatgca tctctaggag 120 agagagtcac tatcacttgc aaggcgagtc aggacattaa tagctattta agctggttcc 180 agcagaaacc agggaaatct cctaagaccc tgatctatcg tgcaaacaga ttggtagatg 240 gggtcccatc aaggttcagt ggcagtggat ctgggcaaga ttattctctc accatcagca 300 GCTGGAGTAT GAAGATATGG GAATTTCCTT ATGTCTACAG TATGATGAAT TTCCTTAC 360 CGTTTGGAGG GGGGACCAAG CTGGAAATGA AACGGGCTGA TGCTGCA 407 <210> 83 <211> 33 <212> PRT <213> Artificial Sequence <220> <223> 31C4 Heavy Chain VH: CDR1 <400> 83 AAGGCGAGTC AGGACATCAA TAGCTATTTA AGC 33 <210> 84 <211> 21 <212> PRT <213> Artificial Sequence <220> <223> 31C4 Heavy Chain VH: CDR2 <400> 84 CGTGCAAACA GATTGGTAGA T 21 <210> 85 <211> 27 <212> PRT <213> Artificial Sequence <220> <223> 31C4 Heavy Chain VH: CDR3 <400> 85 CTACAGTATG ATGAATTTCC GTACACG 27 <210> 86 <211> 135 <212> PRT <213> Artificial Sequence <220> <223> 31C4 Heavy Chain Vh <220> <221> MISC_FEATURE <222> (1)..(23) <223> Leader Sequence <220> <221> MISC_FEATURE <222> (24)..(46) <223> FR1 <220> <221> MISC_FEATURE <222> (47)..(57) <223> CDR1 <220> <221> MISC_FEATURE <222> (58)..(72) <223> FR2 <220> <221> MISC_FEATURE <222> (73)..(79) <223> CDR2 <220> <221> MISC_FEATURE <222> (80)..(111) <223> FR3 <220> <221> MISC_FEATURE <222> (112)..(120) <223> CDR3 <220> <221> MISC_FEATURE <222> (121)..(135) <223> FR4 <400> 86 Leu Val Asp Met Arg Pro Pro Ala Gln Phe Phe Gly Ile Leu Leu Leu 1 5 10 15 Trp Phe Pro Gly Ile Lys Cys Asp Ile Lys Met Thr Gln Ser Pro Ser 20 25 30 Ser Met Tyr Ala Ser Leu Gly Glu Arg Val Thr Ile Thr Cys Lys Ala 35 40 45 Ser Gln Asp Ile Asn Ser Tyr Leu Ser Trp Phe Gln Gln Lys Pro Gly 50 55 60 Lys Ser Pro Lys Thr Leu Ile Tyr Arg Ala Asn Arg Leu Val Asp Gly 65 70 75 80 Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Gln Asp Tyr Ser Leu 85 90 95 Thr Ile Ser Ser Leu Glu Tyr Glu Asp Met Gly Ile Tyr Tyr Cys Leu 100 105 110 Gln Tyr Asp Glu Phe Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu 115 120 125 Ile Lys Arg Ala Asp Ala Ala 130 135 <210> 87 <211> 23 <212> PRT <213> Artificial Sequence <220> <223> 31C4 Light Chain VL: FR1 <400> 87 Asp Ile Lys Met Thr Gln Ser Pro Ser Ser Met Tyr Ala Ser Leu Gly 1 5 10 15 Glu Arg Val Thr Ile Thr Cys 20 <210> 88 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> 31C4 heavy chain VH: CDR1 <400> 88 Lys Ala Ser Gln Asp Ile Asn Ser Tyr Leu Ser 1 5 10 <210> 89 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> 31C4 heavy chain VH: FR2 <400> 89 Trp Phe Gln Gln Lys Pro Gly Lys Ser Pro Lys Thr Leu Ile Tyr 1 5 10 15 <210> 90 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> 31C4 heavy chain VH: CDR2 <400> 90 Arg Ala Asn Arg Leu Val Asp 1 5 <210> 91 <211> 32 <212> PRT <213> Artificial Sequence <220> <223> 31C4 heavy chain VH: FR3 <400> 91 Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Gln Asp Tyr Ser 1 5 10 15 Leu Thr Ile Ser Ser Leu Glu Tyr Glu Asp Met Gly Ile Tyr Tyr Cys 20 25 30 <210> 92 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> 31C4 Heavy Chain VH: CDR3 <400> 92 Leu Gln Tyr Asp Glu Phe Pro Tyr Thr 1 5 <210> 93 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> 31C4 Heavy Chain VH: FR4 <400> 93 Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg Ala Asp Ala Ala 1 5 10 15 <210> 94 <211> 430 <212> DNA <213> Artificial Sequence <220> <223> 34B10 Heavy Chain VH <220> <221> misc_feature <222> (11)..(67) <223> Leader Sequence <220> <221> misc_feature <222> (68)..(142) <223> FR1 <220> <221> misc_feature <222> (143)..(172) <223> CDR1 <220> <221> misc_feature <222> (173)..(214) <223> FR2 <220> <221> misc_feature <222> (215)..(271) <223> CDR2 <220> <221> misc_feature <222> (272)..(367) <223> FR3 <220> <221> misc_feature <222> (368)..(397) <223> CDR3 <220> <221> misc_feature <222> (398)..(430) <223> FR4 <400> 94 tggggaattc atggagttgg ggttcagctg gattttcctt ggaacacttt taaatggtat 60 ccagtgtgag gtgaagctgg tggagtctgg aggagtcttg gtacagcctg ggggttctct 120 gagactctcc tgtgcaactt ctggattcac cttcactgat tactacatgg gctgggtccg 180 ccagcctcca ggaaaggcgc ttgagtggtt gggttttatt agaaacaaag ctaatggtta 240 cacaacagag tccagtgcat ctgtgaaggg tcggttcacc atctccagag ataattccca 300 aagcatcctc tatcttcaaa tgaacaccct gagagctgag gacagtgcca cttattactg 360 tgcaagagat tactactccg gtagtagcct tgactactgg ggccaaggca ccactctcac 420 agtctcctca 430 <210> 95 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> 34B10 Heavy Chain VH: CDR1 <400> 95 ggattcacct tcactgatta ctacatgggc 30 <210> 96 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> 34B10 Heavy Chain VH: CDR2 <400> 96 tttattagaa acaaagctaa tggttacaca acagagtcca gtgcatctgt gaagggt 57 <210> 97 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> 34B10 Heavy Chain VH: CDR3 <400> 97 gattactact ccggtagtag ccttgactac 30 <210> 98 <211> 140 <212> PRT <213> Artificial Sequence <220> <223> 34B10 Heavy Chain VH <220> <221> MISC_FEATURE <222> (1)..(19) <223> Leader Sequence <220> <221> MISC_FEATURE <222> (20)..(44) <223> FR1 <220> <221> MISC_FEATURE <222> (45)..(54) <223> CDR1 <220> <221> MISC_FEATURE <222> (55)..(68) <223> FR2 <220> <221> MISC_FEATURE <222> (69)..(87) <223> CDR2 <220> <221> MISC_FEATURE <222> (88)..(119) <223> FR3 <220> <221> MISC_FEATURE <222> (120)..(129) <223> CDR3 <220> <221> MISC_FEATURE <222> (130)..(140) <223> FR4 <400> 98 Met Glu Leu Gly Phe Ser Trp Ile Phe Leu Gly Thr Leu Leu Asn Gly 1 5 10 15 Ile Gln Cys Glu Val Lys Leu Val Glu Ser Gly Gly Val Leu Val Gln 20 25 30 Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Thr Ser Gly Phe Thr Phe 35 40 45 Thr Asp Tyr Tyr Met Gly Trp Val Arg Gin Pro Pro Gly Lys Ala Leu 50 55 60 Glu Trp Leu Gly Phe He Arg Asn Lys Ala Asn Gly Tyr Thr Thr Glu 65 70 75 80 Ser Ser Ala Ser Val Lys Gly Arg Phe Thr He Ser Arg Asp Asn Ser 85 90 95 Gln Ser He Leu Tyr Leu Gin Met Asn Thr Leu Arg Ala Glu Asp Ser 100 105 110 Ala Thr Tyr Tyr Cys Ala Arg Asp Tyr Tyr Ser Gly Ser Ser Leu Asp 115 120 125 Tyr Trp Gly Gin Gly Thr Thr Leu Thr Val Ser Ser 130 135 140 <210> 99 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> 34B10 Heavy Chain VH: FR1 <400> 99 Glu Val Lys Leu Val Glu Ser Gly Gly Val Leu Val Gin Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Thr Ser 20 25 <210> 100 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 34B10 heavy chain VH: CDR1 <400> 100 Gly Phe Thr Phe Thr Asp Tyr Tyr Met Gly 1 5 10 <210> 101 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> 34B10 heavy chain VH: FR2 <400> 101 Trp Val Arg Gln Pro Pro Gly Lys Ala Leu Glu Trp Leu Gly 1 5 10 <210> 102 <211> 19 <212> PRT <213> Artificial Sequence <220> <223> 34B10 heavy chain VH: CDR2 <400> 102 Phe Ile Arg Asn Lys Ala Asn Gly Tyr Thr Thr Glu Ser Ser Ala Ser 1 5 10 15 Val Lys Gly <210> 103 <211> 32 <212> PRT <213> Artificial Sequence <220> <223> 34B10 heavy chain VH: FR3 <400> 103 Arg Phe Thr Ile Ser Arg Asp Asn Ser Gln Ser Ile Leu Tyr Leu Gln 1 5 10 15 Met Asn Thr Leu Arg Ala Glu Asp Ser Ala Thr Tyr Tyr Cys Ala Arg 20 25 30 <210> 104 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 34B10 Heavy Chain VH: CDR3 <400> 104 Asp Tyr Tyr Ser Gly Ser Ser Leu Asp Tyr 1 5 10 <210> 105 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> 34B10 Heavy Chain VH: FR4 <400> 105 Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser 1 5 10 <210> 106 <211> 406 <212> DNA <213> Artificial Sequence <220> <223> 34B10 Light Chain VL <220> <221> misc_feature <222> (1)..(75) <223> Leader Sequence <220> <221> misc_feature <222> (76)..(144) <223> FR1 <220> <221> misc_feature <222> (145)..(177) <223> CDR1 <220> <221> misc_feature <222> (178)..(222) <223> FR2 <220> <221> misc_feature <222> (223)..(243) <223> CDR2 <220> <221> misc_feature <222> (244)..(339) <223> FR3 <220> <221> misc_feature <222> (340)..(366) <223> CDR3 <220> <221> misc_feature <222> (367)..(405) <223> FR4 <400> 106 tctatactag tcgacaggag gaccccggct cagatttgtg gtctcctgtt gctctttttt 60 caaggtacca gatgtgatat ccagatgaca cagactacat cctccctgtc tgcctctctg 120 ggagacagag tcaccatcag ttgcagggca agtcaggaca ttagcaatta tttaaattgg 180 tatcagcaga aaccagatgg aactgttaaa ctcctgatct actacacatc aagattacac 240 tcaggagtcc catcaaggtt cagtggcagt gggtctggaa cagattattc tctctccatt 300 agcaacctgg agcaagaaga tattgccact tacttttgcc aacagggtta tacgcttccg 360 tacacgttcg gaggggggac caagcttgaa ataaaacggg ctgatg 406 <210> 107 <211> 33 <212> DNA <213> Artificial sequence <220> <223> 34B10 Light Chain VL: CDR1 <400> 107 agggcaagtc aggacattag caattattta aat 33 <210> 108 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> 34B10 Light Chain VL: CDR2 <400> 108 tacacatcaa gattacactc a 21 <210> 109 <211> 27 <212> DNA <213> Artificial sequence <220> <223> 34B10 Light Chain VL: CDR3 <400> 109 caacagggtt atacgcttcc gtacacg 27 <210> 110 <211> 135 <212> PRT <213> Artificial sequence <220> <223> 34B10 Light Chain VL <220> <221> MISC_FEATURE <222> (1)..(25) <223> Leader sequence <220> <221> MISC_FEATURE <222> (26) (48) <223> FR1 <220> <221> MISC_FEATURE <222> (49)..(59) <223> CDR1 <220> <221> MISC_FEATURE <222> (60)..(74) <223> FR2 <220> <221> MISC_FEATURE <222> (75)..(81) <223> CDR2 <220> <221> MISC_FEATURE <222> (82)..(113) <223> FR3 <220> <221> MISC_FEATURE <222> (114)..(122) <223> CDR3 <220> <221> MISC_FEATURE <222> (123)..(135) <223> FR4 <400> 110 Ser Ile Leu Val Asp Arg Arg Thr Pro Ala Gln Ile Cys Gly Leu Leu 1 5 10 15 Leu Leu Phe Phe Gln Gly Thr Arg Cys Asp Ile Gln Met Thr Gln Thr 20 25 30 Thr Ser Ser Leu Ser Ala Ser Leu Gly Asp Arg Val Thr Ile Ser Cys 35 40 45 Arg Ala Ser Gin Asp He Ser Asn Tyr Leu Asn Trp Tyr Gin Gin Lys 50 55 60 Pro Asp Gly Thr Val Lys Leu Leu He Tyr Tyr Thr Ser Arg Leu His 65 70 75 80 Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr 85 90 95 Ser Leu Ser He Ser Asn Leu Glu Gin Glu Asp He Ala Thr Tyr Phe 100 105 110 Cys Gin Gin Gly Tyr Thr Leu Pro Tyr Thr Phe Gly Gly Gly Thr Lys 115 120 125 Leu Glu He Lys Arg Ala Asp 130 135 <210> 111 <211> 23 <212> PRT <213> Artificial Sequence <220> <223> 34B10 Light Chain VL: FR1 <400> 111 Asp He Gin Met Thr Gin Thr Thr Ser Ser Leu Ser Ala Ser Leu Gly 1 5 10 15 Asp Arg Val Thr He Ser Cys 20 <210> 112 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> 34B10 Light Chain VL: CDR1 <400> 112 Arg Ala Ser Gln Asp lie Ser Asn Tyr Leu Asn 1 5 10 <210> 113 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> 34B10 Light Chain VL: FR2 <400> 113 Trp Tyr Gln Gln Lys Pro Asp Gly Thr Val Lys Leu Leu Ile Tyr 1 5 10 15 <210> 114 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> 34B10 Light Chain VL: CDR2 <400> 114 Tyr Thr Ser Arg Leu His Ser 1 5 <210> 115 <211> 32 <212> PRT <213> Artificial Sequence <220> <223> 34B10 Light Chain VL: FR3 <400> 115 Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Tyr Ser 1 5 10 15 Leu Ser Ile Ser Asn Leu Glu Gin Gin Asp lie Ala Thr Tyr Phe Cys 20 25 30 <210> 116 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> 34B10 Heavy Chain VH: CDR3 <400> 116 Gln Gln Gly Tyr Thr Leu Pro Tyr Thr 1 5 <210> 117 <211> 13 <212> PRT <213> Artificial Sequence <220> <223> 34B10 Heavy Chain VH: FR4 <400> 116 Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg Ala Asp 1 5 10 <210> 118 <211> 411 <212> DNA <213> Artificial Sequence <220> <223> 37A3 Heavy Chain VH <220> <221> misc_feature <222> (1)..(57) <223> Leader Sequence <220> <221> misc_feature <222> (58)..(132) <223> FR1 <220> <221> misc_feature <222> (133)..(162) <223> CDR1 <220> <221> misc_feature <222> (163)..(204) <223> FR2 <220> <221> misc_feature <222> (205)..(261) <223> CDR2 <220> <221> misc_feature <222> (262)..(351) <223> FR3 <220> <221> misc_feature <222> (352)..(381) <223> CDR3 <220> <221> misc_feature <222> (382)..(411) <223> FR4 <400> 118 atgtacttgg gactgagctg tgtatttctt gtggctcttt tgaatggtgt ccagtgtcag 60 gtgcagcttg tagagaccgg gggaggcttg gtgaggcctg gaaattctct gaaactctcc 120 tgtgttacct cgggattcac tttcagtaac taccggatgc actggcttcg ccagcctcca 180 gggaagaggc tggagtggat tgctgtaatt acagtcaaat ctgataatta tggagcaaat 240 tttgcagagt ctgtgaaagg cagattcact atttcaagag atgattcaaa aagcagtgtc 300 tacctgcaga tgaacagatt aagagaggaa gacactgcca cttattattg tagtagaggt 360 agtggcccag ggtttgctta ctggggccaa gggactctgg tcactgtctc t 411 <210> 119 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> 37A3 Heavy Chain VH: CDR1 <400> 119 ggattcactt tcagtaacta ccggatgcac 30 <210> 120 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> 37A3 Heavy Chain VH: CDR2 <400> 120 gtaattacag tcaaatctga taattatgga gcaaattttg cagagtctgt gaaaggc 57 <210> 121 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> 37A3 Heavy Chain VH: CDR3 <400> 121 agtagaggta gtggcccagg gtttgcttac 30 <210> 122 <211> 137 <212> PRT <213> Artificial Sequence <220> <223> 37A3 Heavy Chain VH <220> <221> MISC_FEATURE <222> (1)..(19) <223> Leader Sequence <220> <221> MISC_FEATURE <222> (20)..(44) <223> FR1 <220> <221> MISC_FEATURE <222> (45)..(54) <223> CDR1 <220> <221> MISC_FEATURE <222> (55)..(68) <223> FR2 <220> <221> MISC_FEATURE <222> (69)..(87) <223> CDR2 <220> <221> MISC_FEATURE <222> (88)..(117) <223> FR3 <220> <221> MISC_FEATURE <222> (118)..(127) <223> CDR3 <220> <221> MISC_FEATURE <222> (128)..(137) <223> FR4 <400> 122 Met Tyr Leu Gly Leu Ser Cys Val Phe Leu Val Ala Leu Leu Asn Gly 1 5 10 15 Val Gln Cys Gln Val Gln Leu Val Glu Thr Gly Gly Gly Leu Val Arg 20 25 30 Pro Gly Asn Ser Leu Lys Leu Ser Cys Val Thr Ser Gly Phe Thr Phe 35 40 45 Ser Asn Tyr Arg Met His Trp Leu Arg Gln Pro Pro Gly Lys Arg Leu 50 55 60 Glu Trp lie Ala Val lie Thr Val Lys Ser Asp Asn Tyr Gly Ala Asn 65 70 75 80 Phe Ala Glu Ser Val Lys Gly Arg Phe Thr lie Ser Arg Asp Asp Ser 85 90 95 Lys Ser Ser Val Tyr Leu Gin Met Asn Arg Leu Arg Glu Glu Asp Thr 100 105 110 Ala Thr Tyr Tyr Cys Ser Arg Gly Ser Gly Pro Gly Phe Ala Tyr Trp 115 120 125 Gly Gin Gly Thr Leu Val Thr Val Ser 130 135 <210> 123 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> 37A3 Heavy Chain VH: FR1 <400> 123 Gln Val Gin Leu Val Glu Thr Gly Gly Gly Leu Val Arg Pro Gly Asn 1 5 10 15 Ser Leu Lys Leu Ser Cys Val Thr Ser 20 25 <210> 124 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 37A3 Heavy Chain VH: CDR1 <400> 124 Gly Phe Thr Phe Ser Asn Tyr Arg Met His 1 5 10 <210> 125 <211> 14 <212> PRT <213> Artificial sequence <220> <223> 37A3 Heavy chain VH: FR2 <400> 125 Trp Leu Arg Gln Pro Pro Gly Lys Arg Leu Glu Trp Ile Ala 1 5 10 <210> 126 <211> 19 <212> PRT <213> Artificial sequence <220> <223> 37A3 Heavy chain VH: CDR2 <400> 126 Val Ile Thr Val Lys Ser Asp Asn Tyr Gly Ala Asn Phe Ala Glu Ser 1 5 10 15 Val Lys Gly <210> 127 <211> 30 <212> PRT <213> Artificial sequence <220> <223> 37A3 Heavy Chain VH: FR3 <400> 127 Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Ser Ser Val Tyr Leu Gln 1 5 10 15 Met Asn Arg Leu Arg Glu Glu Asp Thr Ala Thr Tyr Tyr Cys 20 25 30 <210> 128 <211> 10 <212> PRT <213> Artificial sequence <220> <223> 37A3 heavy chain VH: CDR3 <400> 128 Ser Arg Gly Ser Gly Pro Gly Phe Ala Tyr 1 5 10 <210> 129 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 37A3 heavy chain VH: FR4 <400> 129 Trp Gly Gln Gly Thr Leu Val Thr Val Ser 1 5 10 <210> 130 <211> 411 <212> DNA <213> Artificial Sequence <220> <223> 37A3 light chain VL <220> <221> misc_feature <222> (1)..(72) <223> leader sequence <220> <221> misc_feature <222> (73)..(141) <223> FR1 <220> <221> misc_feature <222> (142)..(192) <223> CDR1 <220> <221> misc_feature <222> (193)..(237) <223> FR2 <220> <221> misc_feature <222> (238)..(258) <223> CDR2 <220> <221> misc_feature <222> (259)..(354) <223> FR3 <220> <221> misc_feature <222> (355)..(381) <223> CDR3 <220> <221> misc_feature <222> (382)..(411) <223> FR4 <400> 130 atgggcttca agatggagtc acagactcag gtcctcatct ccttgctgtt ctgggtatct 60 ggtacctgtg gggacattgt gatgacacag tctccatcct ccctgagtgt gtcagcagga 120 gagaaggtca ctatgagctg caagtccagt cagagtctgt taaacagtgg aaatcaaaag 180 aactacttgg cctggtacca gcagaaacca gggcagcctc ctaaactgtt gatctacggg 240 gcatccacta gggaatctgg ggtccctgat cgcttcacag gcagtggatc tggaaccgat 300 ttcactctta ccatcagcag tgtgcaggct gaagacctgg cagtttatta ctgtcagaat 360 gatcatagtt atccattcac gttcggctcg gggacaaagt tggaaataaa a 411 <210> 131 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> 37A3 heavy chain VH: CDR1 <400> 131 aagtccagtc agagtctgtt aaacagtgga aatcaaaaga actacttggc c 51 <210> 132 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 37A3 heavy chain VH: CDR2 <400> 132 ggggcatcca ctagggaatc t 21 <210> 133 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> 37A3 heavy chain VH: CDR3 <400> 133 cagaatgatc atagttatcc attcacg 27 <210> 134 <211> 137 <212> PRT <213> Artificial Sequence <220> <223> 37A3 heavy chain VL <220> <221> MISC_FEATURE <222> (1)..(24) <223> Leader Sequence <220> <221> MISC_FEATURE <222> (25)..(47) <223> FR1 <220> <221> MISC_FEATURE <222> (48)..(64) <223> CDR1 <220> <221> MISC_FEATURE <222> (65)..(79) <223> FR2 <220> <221> MISC_FEATURE <222> (80)..(86) <223> CDR2 <220> <221> MISC_FEATURE <222> (87)..(118) <223> FR3 <220> <221> MISC_FEATURE <222> (119)..(127) <223> CDR3 <220> <221> MISC_FEATURE <222> (128)..(137) <223> FR4 <400> 134 Met Gly Phe Lys Met Glu Ser Gln Thr Gln Val Leu Ile Ser Leu Leu 1 5 10 15 Phe Trp Val Ser Gly Thr Cys Gly Asp Ile Val Met Thr Gln Ser Pro 20 25 30 Ser Ser Leu Ser Val Ser Ala Gly Glu Lys Val Thr Met Ser Cys Lys 35 40 45 Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Gln Lys Asn Tyr Leu Ala 50 55 60 Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Gly 65 70 75 80 Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe Thr Gly Ser Gly 85 90 95 Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Val Gln Ala Glu Asp 100 105 110 Leu Ala Val Tyr Tyr Cys Gln Asn Asp His Ser Tyr Pro Phe Thr Phe 115 120 125 Gly Ser Gly Thr Lys Leu Glu Ile Lys 130 135 <210> 135 <211> 23 <212> PRT <213> Artificial Sequence <220> <223> 37A3 Light Chain VL: FR1 <400> 135 Asp Ile Val Met Thr Gln Ser Pro Ser Ser Leu Ser Val Ser Ala Gly 1 5 10 15 Glu Lys Val Thr Met Ser Cys 20 <210> 136 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> 37A3 Light Chain VL: CDR1 <400> 136 Lys Ser Ser Gln Ser Leu Leu Asn Ser Gly Asn Gln Lys Asn Tyr Leu 1 5 10 15 Ala <210> 137 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> 37A3 Light Chain VL: FR2 <400> 137 Trp Tyr Gin Gin Lys Pro Gly Gin Pro Pro Lys Leu Leu lie Tyr 1 5 10 15 <210> 138 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> 37A3 Light Chain VL: CDR2 <400> 138 Gly Ala Ser Thr Arg Gin Ser 1 5 <210> 139 <211> 32 <212> PRT <213> Artificial Sequence <220> <223> 37A3 Light Chain VL: FR3 <400> 139 Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr 1 5 10 15 Leu Thr lie Ser Ser Val Gin Ala Gin Asp Leu Ala Val Tyr Tyr Cys 20 25 30 <210> 140 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> 37A3 Light Chain VL: CDR3 <400> 140 Gln Asn Asp His Ser Tyr Pro Phe Thr 1 5 <210> 141 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 37A3 Light Chain VL: FR4 <400> 141 Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys 1 5 10 <210> 142 <211> 432 <212> DNA <213> Artificial Sequence <220> <223> 12A10 Heavy Chain VH <220> <221> misc_feature <222> (12)..(68) <223> Leader Sequence <220> <221> misc_feature <222> (69)..(143) <223> FR1 <220> <221> misc_feature <222> (144)..(173) <223> CDR1 <220> <221> misc_feature <222> (174)..(215) <223> FR2 <220> <221> misc_feature <222> (216)..(266) <223> CDR2 <220> <221> misc_feature <222> (267)..(356) <223> FR3 <220> <221> misc_feature <222> (357)..(398) <223> CDR3 <220> <221> misc_feature <222> (399)..(431) <223> FR4 <400> 142 tggggaattc catggaatgg agctgggttt ttctcttcct cctgtcaata actacaggtg 60 tccactccca ggcttatcta cagcagtctg gggctgagct ggtgaggtct ggggcctcag 120 tgaagatgtc ctgcaaggct tctggctaca catttaccag ttacaatatg cactgggtaa 180 agcagacacc tggacagggc ctggaatgga ttggatatat ttttcctgga gatggtggta 240 ctaactacaa tcagaagttc aagggcaagg ccacattgac tgcagacaca tcctccagca 300 cagcctacat gcagatcagc agcctgacat ctgaagactc tgcggtctat ttctgtgcaa 360 gatcgggcta ctatggtaac tacgaagggt ttgcttactg gggccaaggg actctggtca 420 ctgtctctgc ag 432 <210> 143 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> 12A10 heavy chain VH: CDR1 <400> 143 ggctacacat ttaccagtta caatatgcac 30 <210> 144 <211> 51 <212> PRT <213> Artificial Sequence <220> <223> 12A10 heavy chain VH: CDR2 <400> 144 tatatttttc ctggagatgg tggtactaac tacaatcaga agttcaaggg c 51 <210> 145 <211> 42 <212> PRT <213> Artificial Sequence <220> <223> 12A10 heavy chain VH: CDR3 <400> 145 gcaagatcgg gctactatgg taactacgaa gggtttgctt ac 42 <210> 146 <211> 140 <212> PRT <213> Artificial Sequence <220> <223> 12A10 heavy chain VH <220> <221> MISC_FEATURE <222> (1)..(19) <223> leader sequence <220> <221> MISC_FEATURE <222> (20)..(44) <223> FR1 <220> <221> MISC_FEATURE <222> (45)..(54) <223> CDR1 <220> <221> MISC_FEATURE <222> (55)..(68) <223> FR2 <220> <221> MISC_FEATURE <222> (69)..(85) <223> CDR2 <220> <221> MISC_FEATURE <222> (86)..(115) <223> FR3 <220> <221> MISC_FEATURE <222> (116)..(129) <223> CDR3 <220> <221> MISC_FEATURE <222> (130)..(140) <223> FR4 <400> 146 Met Glu Trp Ser Trp Val Phe Leu Phe Leu Leu Ser Ile Thr Thr Gly 1 5 10 15 Val His Ser Gln Ala Tyr Leu Gln Gln Ser Gly Ala Glu Leu Val Arg 20 25 30 Ser Gly Ala Ser Val Lys Met Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45 Thr Ser Tyr Asn Met His Trp Val Lys Gln Thr Pro Gly Gln Gly Leu 50 55 60 Glu Trp Ile Gly Tyr Ile Phe Pro Gly Asp Gly Gly Thr Asn Tyr Asn 65 70 75 80 Gln Lys Phe Lys Gly Lys Ala Thr Leu Thr Ala Asp Thr Ser Ser Ser 85 90 95 Thr Ala Tyr Met Gln Ile Ser Ser Leu Thr Ser Glu Asp Ser Ala Val 100 105 110 Tyr Phe Cys Ala Arg Ser Gly Tyr Tyr Gly Asn Tyr Glu Gly Phe Ala 115 120 125 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ala 130 135 140 <210> 147 <211> 25 <212> PRT <213> Artificial sequence <220> <223> 12A10 Heavy chain VH: FR1 <400> 147 Gln Ala Tyr Leu Gln Gln Ser Gly Ala Glu Leu Val Arg Ser Gly Ala 1 5 10 15 Ser Val Lys Met Ser Cys Lys Ala Ser 20 25 <210> 148 <211> 10 <212> PRT <213> Artificial sequence <220> <223> 12A10 Heavy chain VH: CDR1 <400> 148 Gly Tyr Thr Phe Thr Ser Tyr Asn Met His 1 5 10 <210> 149 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> 12A10 Heavy Chain VH: FR2 <400> 149 Trp Val Lys Gln Thr Pro Gly Gln Gly Leu Glu Trp Ile Gly 1 5 10 <210> 150 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> 12A10 Heavy Chain VH: CDR2 <400> 150 Tyr Ile Phe Pro Gly Asp Gly Gly Thr Asn Tyr Asn Gln Lys Phe Lys 1 5 10 15 Gly <210> 151 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> 12A10 Heavy Chain VH: FR3 <400> 151 Lys Ala Thr Leu Thr Ala Asp Thr Ser Ser Ser Thr Ala Tyr Met Gln 1 5 10 15 Ile Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Phe Cys 20 25 30 <210> 152 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> 12A10 Heavy Chain VH: CDR3 <400> 152 Ala Arg Ser Gly Tyr Tyr Gly Asn Tyr Glu Gly Phe Ala Tyr 1 5 10 <210> 153 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> 12A10 heavy chain VH: FR4 <400> 153 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ala 1 5 10 <210> 154 <211> 303 <212> DNA <213> Artificial Sequence <220> <223> 12A10 light chain VL <220> <221> misc_feature <222> (3)..(44) <223> FR1 <220> <221> misc_feature <222> (45)..(77) <223> CDR1 <220> <221> misc_feature <222> (78)..(122) <223> FR2 <220> <221> misc_feature <222> (123)..(143) <223> CDR2 <220> <221> misc_feature <222> (144)..(239) <223> FR3 <220> <221> misc_feature <222> (240)..(266) <223> CDR3 <220> <221> misc_feature <222> (267)..(302) <223> FR4 <400> 154 cttccatgta tgcatctcta ggagagagag tcactatcac ttgcaaggcg agtcaggaca 60 ttaatagcta tttaagctgg ttccagcaga aaccagggaa atctcctaag accctgatct 120 atcgtgcaaa cagattggta gatggggtcc catcaaggtt cagtggcagt ggatctgggc 180 aagattattc tctcaccatc agcagcctgg aatatgaaga tatgggaatt tattattgtc 240 tacattatgc tgagtttccg tacacgttcg gaggggggac caagctggaa ataaaacggg 300 ctg 303 <210> 155 <211> 33 <212> DNA <213> artificial sequence <220> <223> 12A10 light chain VL: CDR1 <400> 155 aaggcgagtc aggacattaa tagctattta agc 33 <210> 156 <211> 21 <212> DNA <213> artificial sequence <220> <223> 12A10 light chain VL: CDR2 <400> 156 cgtgcaaaca gattggtaga t 21 <210> 157 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> 12A10 VL CDR3 <400> 157 ctacattatg ctgagtttcc gtacacg 27 <210> 158 <211> 100 <212> PRT <213> Artificial Sequence <220> <223> 12A10 VL <220> <221> MISC_FEATURE <222> (1)..(14) <223> FR1 <220> <221> MISC_FEATURE <222> (15)..(25) <223> CDR1 <220> <221> MISC_FEATURE <222> (26)..(40) <223> FR2 <220> <221> MISC_FEATURE <222> (41)..(47) <223> CDR2 <220> <221> MISC_FEATURE <222> (48)..(79) <223> FR3 <220> <221> MISC_FEATURE <222> (80)..(88) <223> CDR3 <220> <221> MISC_FEATURE <222> (89)..(100) <223> FR4 <400> 158 Ser Met Tyr Ala Ser Leu Gly Glu Arg Val Thr Ile Thr Cys Lys Ala 1 5 10 15 Ser Gln Asp Ile Asn Ser Tyr Leu Ser Trp Phe Gln Gln Lys Pro Gly 20 25 30 Lys Ser Pro Lys Thr Leu Ile Tyr Arg Ala Asn Arg Leu Val Asp Gly 35 40 45 Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Gln Asp Tyr Ser Leu 50 55 60 Thr Ile Ser Ser Leu Glu Tyr Glu Asp Met Gly Ile Tyr Tyr Cys Leu 65 70 75 80 His Tyr Ala Glu Phe Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu 85 90 95 Ile Lys Arg Ala 100 <210> 159 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> 12A10 Light Chain VL: FR1 <400> 159 Ser Met Tyr Ala Ser Leu Gly Glu Arg Val Thr Ile Thr Cys 1 5 10 <210> 160 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> 12A10 Light Chain VL: CDR1 <400> 160 Lys Ala Ser Gln Asp Ile Asn Ser Tyr Leu Ser 1 5 10 <210> 161 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> 12A10 Light Chain VL: FR2 <400> 161 Trp Phe Gln Gln Lys Pro Gly Lys Ser Pro Lys Thr Leu Ile Tyr 1 5 10 15 <210> 162 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> 12A10 Light Chain VL: CDR2 <400> 162 Arg Ala Asn Arg Leu Val Asp 1 5 <210> 163 <211> 32 <212> PRT <213> Artificial Sequence <220> <223> 12A10 Light Chain VL: FR3 <400> 163 Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Gln Asp Tyr Ser 1 5 10 15 Leu Thr Ile Ser Ser Leu Glu Tyr Glu Asp Met Gly Ile Tyr Tyr Cys 20 25 30 <210> 164 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> 12A10 VL Chain: CDR3 <400> 164 Leu His Tyr Ala Glu Phe Pro Tyr Thr 1 5 <210> 165 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> 12A10 VL Chain: FR4 <400> 165 Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg Ala 1 5 10 <210> 166 <211> 434 <212> DNA <213> Artificial Sequence <220> <223> 3B7 VH Hain <220> <221> misc_feature <222> (12)..(68) <223> Leader Sequence <220> <221> misc_feature <222> (69)..(143) <223> FR1 <220> <221> misc_feature <222> (144)..(173) <223> CDR1 <220> <221> misc_feature <222> (174)..(215) <223> FR2 <220> <221> misc_feature <222> (216)..(266) <223> CDR2 <220> <221> misc_feature <222> (267)..(356) <223> FR3 <220> <221> misc_feature <222> (357)..(401) <223> CDR3 <220> <221> misc_feature <222> (402)..(431) <223> FR4 <400> 166 tactagtcga catgggatgg agctgtatca tgttctttct ggtagcaaca gctacaggtg 60 tgcactccca ggtccagctg cagcagtctg ggcctgaggt ggtgaggcct ggggtctcag 120 tgaagatttc ctgcaagggt tccggctaca cattcagtga ttatactatg cactgggtga 180 agcagagtca tgcaaagagt ctagagtgga ttggagttat tagtactgac aatggtaata 240 caaactataa ccagaagttt aagggcaagg ccacaatgac tgtagacaaa tcctccagca 300 ctgcctatat ggaacttgcc agattgacat ctgaggattc tgccatctat tactgtgcaa 360 gggaggcccg ggactacggt agtatctatg ctttggacta ctggggtcaa ggaacctcag 420 tcaccgtctc tcag 434 <210> 167 <211> 30 <212> DNA <213> Artificial sequence <220> <223> 3B7 Heavy Chain VH: CDR1 <400> 167 ggctacacat tcagtgatta tactatgcac 30 <210> 168 <211> 51 <212> DNA <213> Artificial sequence <220> <223> 3B7 Heavy Chain VH: CDR2 <400> 168 gttattagta ctgacaatgg taatacaaac tataaccaga agtttaaggg c 51 <210> 169 <211> 45 <212> DNA <213> Artificial sequence <220> <223> 3B7 Heavy Chain VH: CDR3 <400> 169 gcaagggagg cccgggacta cggtagtatc tatgctttgg actac 45 <210> 170 <211> 140 <212> PRT <213> Artificial sequence <220> <223> 3B7 Heavy Chain VH <220> <221> MISC_FEATURE <222> (1)..(19) <223> LEADER SEQUENCE <220> <221> MISC_FEATURE <222> (20)..(44) <223> FR1 <220> <221> MISC_FEATURE <222> (45)..(54) <223> CDR1 <220> <221> MISC_FEATURE <222> (55)..(68) <223> FR2 <220> <221> MISC_FEATURE <222> (69)..(85) <223> CDR2 <220> <221> MISC_FEATURE <222> (86)..(115) <223> FR3 <220> <221> MISC_FEATURE <222> (116)..(130) <223> CDR3 <220> <221> MISC_FEATURE <222> (131)..(140) <223> FR4 <400> 170 Met Gly Trp Ser Cys Ile Met Phe Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser Gln Val Gln Leu Gln Gln Ser Gly Pro Glu Val Val Arg 20 25 30 Pro Gly Val Ser Val Lys Ile Ser Cys Lys Gly Ser Gly Tyr Thr Phe 35 40 45 Ser Asp Tyr Thr Met His Trp Val Lys Gln Ser His Ala Lys Ser Leu 50 55 60 Glu Trp Ile Gly Val Ile Ser Thr Asp Asn Gly Asn Thr Asn Tyr Asn 65 70 75 80 Gln Lys Phe Lys Gly Lys Ala Thr Met Thr Val Asp Lys Ser Ser Ser 85 90 95 Thr Ala Tyr Met Glu Leu Ala Arg Leu Thr Ser Glu Asp Ser Ala Ile 100 105 110 Tyr Tyr Cys Ala Arg Glu Ala Arg Asp Tyr Gly Ser Ile Tyr Ala Leu 115 120 125 Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser 130 135 140 <210> 171 <211> 25 <212> PRT <213> Synthetic Sequence <220> <223> 3B7 Heavy Chain VH: FR1 <400> 171 Gln Val Gln Leu Gln Gln Ser Gly Pro Glu Val Val Arg Pro Gly Val 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Gly Ser 20 25 <210> 172 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 3B7 Heavy chain VH: CDR1 <400> 172 Gly Tyr Thr Phe Ser Asp Tyr Thr Met His 1 5 10 <210> 173 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> 3B7 Heavy chain VH: FR2 <400> 173 Trp Val Lys Gln Ser His Ala Lys Ser Leu Glu Trp Ile Gly 1 5 10 <210> 174 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> 3B7 Heavy chain VH: CDR2 <400> 174 Val Ile Ser Thr Asp Asn Gly Asn Thr Asn Tyr Asn Gln Lys Phe Lys 1 5 10 15 Gly <210> 175 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> 3B7 Heavy chain VH: FR3 <400> 175 Lys Ala Thr Met Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Glu 1 5 10 15 Leu Ala Arg Leu Thr Ser Glu Asp Ser Ala Ile Tyr Tyr Cys 20 25 30 <210> 176 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> 3B7 Heavy Chain VH: CDR3 <400> 176 Ala Arg Glu Ala Arg Asp Tyr Gly Ser Ile Tyr Ala Leu Asp Tyr 1 5 10 15 <210> 177 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 3B7 Heavy Chain VH: FR4 <400> 177 Trp Gly Gln Gly Thr Ser Val Thr Val Ser 1 5 10 <210> 178 <211> 395 <212> DNA <213> Artificial Sequence <220> <223> 3B7 Light Chain VL <220> <221> misc_feature <222> (15)..(59) <223> Leader Sequence <220> <221> misc_feature <222> (60)..(128) <223> FR1 <220> <221> misc_feature <222> (129)..(155) <223> CDR1 <220> <221> misc_feature <222> (156)..(206) <223> FR2 <220> <221> misc_feature <222> (207)..(227) <223> CDR2 <220> <221> misc_feature <222> (228)..(323) <223> FR3 <220> <221> misc_feature <222> (324)..(350) <223> CDR3 <220> <221> misc_feature <222> (351)..(395) <223> FR4 <400> 178 tattactagt cgacatggtt cttatgttgc tgctgctatg gcttacaggt gccagatgtg 60 acatccagat gactcagtct ccagcctccc tatctgcatc tgtgggagaa actgtcacca 120 tcacatgtcg agcaagtggg aatattcaca attatttagc atggtatcag cagaaacagg 180 gaaaatctcc tcagctcctg gtctataatg caaaaacctt agcagatggt gtgccatcaa 240 ggttcagtgg cagtggatca ggaacacaat attctctcaa gatcaacaac ctgcagcctg 300 aggattttgg gaattattac tgtcaacatt tttggagtac tccgtggacg ttcggtggag 360 gcaccaagct ggaaatcaaa cgggctgatg ctgca 395 <210> 179 <211> 27 <212> DNA <213> Artificial sequence <220> <223> 3B7 Light Chain VL: CDR1 <400> 179 cgagcaagtg ggaatattca caattat 27 <210> 180 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> 3B7 Light Chain VL: CDR2 <400> 180 aatgcaaaaa ccttagcaga t 21 <210> 181 <211> 27 <212> DNA <213> Artificial sequence <220> <223> 3B7 Light Chain VL: CDR3 <400> 181 caacattttt ggagtactcc gtggacg 27 <210> 182 <211> 127 <212> PRT <213> Artificial sequence <220> <223> 3B7 Light Chain VL <220> <221> MISC_FEATURE <222> (1)..(15) <223> LEADER SEQUENCE <220> <221> MISC_FEATURE <222> (16)..(38) <223> FR1 <220> <221> MISC_FEATURE <222> (39)..(47) <223> CDR1 <220> <221> MISC_FEATURE <222> (48)..(64) <223> FR2 <220> <221> MISC_FEATURE <222> (65)..(71) <223> CDR2 <220> <221> MISC_FEATURE <222> (72)..(103) <223> FR3 <220> <221> MISC_FEATURE <222> (104)..(112) <223> CDR3 <220> <221> MISC_FEATURE <222> (113)..(127) <223> FR4 <400> 182 Met Val Leu Met Leu Leu Leu Leu Trp Leu Thr Gly Ala Arg Cys Asp 1 5 10 15 Ile Gln Met Thr Gln Ser Pro Ala Ser Leu Ser Ala Ser Val Gly Glu 20 25 30 Thr Val Thr Ile Thr Cys Arg Ala Ser Gly Asn Ile His Asn Tyr Leu 35 40 45 Ala Trp Tyr Gln Gln Lys Gln Gly Lys Ser Pro Gln Leu Leu Val Tyr 50 55 60 Asn Ala Lys Thr Leu Ala Asp Gly Val Pro Ser Arg Phe Ser Gly Ser 65 70 75 80 Gly Ser Gly Thr Gln Tyr Ser Leu Lys Ile Asn Asn Leu Gln Pro Glu 85 90 95 Asp Phe Gly Asn Tyr Tyr Cys Gln His Phe Trp Ser Thr Pro Trp Thr 100 105 110 Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg Ala Asp Ala Ala 115 120 125 <210> 183 <211> 23 <212> PRT <213> Artificial Sequence <220> <223> 3B7 VL: FR1 <400> 183 Asp Ile Gln Met Thr Gln Ser Pro Ala Ser Leu Ser Ala Ser Val Gly 1 5 10 15 Glu Thr Val Thr Ile Thr Cys 20 <210> 184 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> 3B7 Heavy Chain HAl: CDR1 <400> 184 Arg Ala Ser Gly Asn lie His Asn Tyr 1 5 <210> 185 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> 3B7 Heavy Chain HA1: FR2 <400> 185 Leu Ala Trp Tyr Gin Gin Lys Gin Gly Lys Ser Pro Gin Leu Leu Val 1 5 10 15 Tyr <210> 186 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> 3B7 Heavy Chain HA1: CDR2 <400> 186 Asn Ala Lys Thr Leu Ala Asp 1 5 <210> 187 <211> 32 <212> PRT <213> Artificial Sequence <220> <223> 3B7 Heavy Chain HA1: FR3 <400> 187 Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Gin Tyr Ser 1 5 10 15 Leu Lys lie Asn Asn Leu Gin Pro Glu Asp Phe Gly Asn Tyr Tyr Cys 20 25 30 <210> 188 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> 3B7 Heavy Chain VH: CDR3 <400> 188 Gln His Phe Trp Ser Thr Pro Trp Thr 1 5 <210> 189 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> 3B7 Heavy Chain VH: FR4 <400> 189 Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg Ala Asp Ala Ala 1 5 10 15 <210> 190 <211> 425 <212> DNA <213> Artificial Sequence <220> <223> 11G8 Heavy Chain VH <220> <221> misc_feature <222> (11)..(67) <223> Leader Sequence <220> <221> misc_feature <222> (68)..(142) <223> FR1 <220> <221> misc_feature <222> (143)..(172) <223> CDR1 <220> <221> misc_feature <222> (173)..(214) <223> FR2 <220> <221> misc_feature <222> (215)..(259) <223> CDR2 <220> <221> misc_feature <222> (260)..(355) <223> FR3 <220> <221> misc_feature <222> (356)..(391) <223> CDR3 <220> <221> misc_feature <222> (392)..(424) <223> FR4 <400> 190 tactagtcga atgggatgga gctgtatcat gttctttctg gtagctacag ctacaggtgt 60 gcactcccag gtccagctgc agcagtctgg gcctgacctg gtgaggcctg gggtctcagt 120 gaagatttcc tgcaagggtt ccggctacac attcactgat tatgctatgc actgggtaaa 180 gcagagtcat gcaaagagtc tagagtggat tggagttatt agtactgact ctggtactac 240 aaactacaac cagaagttta agggcaaggc cacaatgact gtagacaaat cctccagtac 300 agcctatatg gaccttgcca gattgacatc tgaggattct gccatctatt actgtgcaag 360 agacagctcg tactacgtgc gattttctta ctggggccaa ggaactctgg tcactgtctc 420 tgcag 425 <210> 191 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> 11G8 Heavy Chain VH: CDR1 <400> 191 ggctacacat tcactgatta tgctatgcac 30 <210> 192 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> 11G8 Heavy Chain VH: CDR2 <400> 192 gttattagta ctgactctgg tactacaaac tacaaccaga agttt 45 <210> 193 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> 11G8 Heavy Chain VH: CDR3 <400> 193 gcaagagaca gctcgtacta cgtgcgattt tcttac 36 <210> 194 <211> 138 <212> PRT <213> Artificial Sequence <220> <223> 11G8 Heavy Chain VH <220> <221> MISC_FEATURE <222> (1)..(19) <223> Leader Sequence <220> <221> MISC_FEATURE <222> (20)..(44) <223> FR1 <220> <221> MISC_FEATURE <222> (45)..(54) <223> CDR1 <220> <221> MISC_FEATURE <222> (55)..(68) <223> FR2 <220> <221> MISC_FEATURE <222> (69)..(83) <223> CDR2 <220> <221> MISC_FEATURE <222> (84)..(115) <223> FR3 <220> <221> MISC_FEATURE <222> (116)..(127) <223> CDR3 <220> <221> MISC_FEATURE <222> (128)..(138) <223> FR4 <400> 194 Met Gly Trp Ser Cys Ile Met Phe Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser Gln Val Gln Leu Gln Gln Ser Gly Pro Asp Leu Val Arg 20 25 30 Pro Gly Val Ser Val Lys Ile Ser Cys Lys Gly Ser Gly Tyr Thr Phe 35 40 45 Thr Asp Tyr Ala Met His Trp Val Lys Gin Ser His Ala Lys Ser Leu 50 55 60 Glu Trp He Gly Val He Ser Thr Asp Ser Gly Thr Thr Asn Tyr Asn 65 70 75 80 Gln Lys Phe Lys Gly Lys Ala Thr Met Thr Val Asp Lys Ser Ser Ser 85 90 95 Thr Ala Tyr Met Asp Leu Ala Arg Leu Thr Ser Glu Asp Ser Ala He 100 105 110 Tyr Tyr Cys Ala Arg Asp Ser Ser Tyr Tyr Val Arg Phe Ser Tyr Trp 115 120 125 Gly Gin Gly Thr Leu Val Thr Val Ser Ala 130 135 <210> 195 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> 11G8 Heavy Chain VH: FR1 <400> 195 Gln Val Gin Leu Gin Gin Ser Gly Pro Asp Leu Val Arg Pro Gly Val 1 5 10 15 Ser Val Lys He Ser Cys Lys Gly Ser 20 25 <210> 196 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 11G8 Heavy Chain VH: CDR1 <400> 196 Gly Tyr Thr Phe Thr Asp Tyr Ala Met His 1 5 10 <210> 197 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> 11G8 Heavy Chain VH: FR2 <400> 197 Trp Val Lys Gln Ser His Ala Lys Ser Leu Glu Trp Ile Gly 1 5 10 <210> 198 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> 11G8 Heavy Chain VH: CDR2 <400> 198 Val Ile Ser Thr Asp Ser Gly Thr Thr Asn Tyr Asn Gln Lys Phe 1 5 10 15 <210> 199 <211> 32 <212> PRT <213> Artificial Sequence <220> <223> 11G8 Heavy Chain VH: FR3 <400> 199 Lys Gly Lys Ala Thr Met Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr 1 5 10 15 Met Asp Leu Ala Arg Leu Thr Ser Glu Asp Ser Ala Ile Tyr Tyr Cys 20 25 30 <210> 200 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> 11G8 heavy chain VH: CDR3 <400> 200 Ala Arg Asp Ser Ser Tyr Tyr Val Arg Phe Ser Tyr 1 5 10 <210> 201 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> 11G8 heavy chain VH: FR4 <400> 201 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ala 1 5 10 <210> 202 <211> 420 <212> DNA <213> Artificial Sequence <220> <223> 11G8 light chain VL <220> <221> misc_feature <222> (25)..(84) <223> leader sequence <220> <221> misc_feature <222> (85)..(153) <223> FR1 <220> <221> misc_feature <222> (154)..(180) <223> CDR1 <220> <221> misc_feature <222> (181)..(231) <223> FR2 <220> <221> misc_feature <222> (232)..(252) <223> CDR2 <220> <221> misc_feature <222> (253)..(360) <223> FR3 <220> <221> misc_feature <222> (361)..(375) <223> CDR3 <220> <221> misc_feature <222> (376)..(420) <223> FR4 <400> 202 tactagttgt atattggctt caagatggag tcacagaccc aggtcttcgt atttctactg 60 ctctgtgtgt ctggtgctca tgggagtatt gtgatgaccc agactcccaa attcctgctt 120 gtttcagtag gagacagggt taccataacc tgtaaggcca gtcagagtgt gagtaatgat 180 gtagcttggt accaacagaa gccagggcag tctcctaaac tgctaatata ctatgcatcc 240 aatcgctaca ctggagtccc tgatcgcttc actggcagtg gatatgggac ggatttcact 300 ttcaccatca gcactgtgca ggctgaagac ctggcagttt atttctgtca gcaggattat 360 agttctccgt ggacgttcgg tggaggcacc aagctggaaa tcaaacgggc tgatgctgca 420 <210> 203 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> 11G8 VL CDR1 <400> 203 aaggccagtc agagtgtgag taatgat 27 <210> 204 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 11G8 VL CDR2 <400> 204 tatgcatcca atcgctacac t 21 <210> 205 <211> 15 <212> DNA <213> Artificial Sequence <220> <223> 11G8 VL CDR3 <400> 205 agttctccgt ggacg 15 <210> 206 <211> 132 <212> PRT <213> Artificial Sequence <220> <223> 11G8 VL <220> <221> MISC_FEATURE <222> (1)..(20) <223> leader sequence <220> <221> MISC_FEATURE <222> (21)..(43) <223> FR1 <220> <221> MISC_FEATURE <222> (44)..(52) <223> CDR1 <220> <221> MISC_FEATURE <222> (53)..(69) <223> FR2 <220> <221> MISC_FEATURE <222> (70)..(76) <223> CDR2 <220> <221> MISC_FEATURE <222> (77)..(108) <223> FR3 <220> <221> MISC_FEATURE <222> (109)..(117) <223> CDR3 <220> <221> MISC_FEATURE <222> (118)..(132) <223> FR4 <400> 206 Met Glu Ser Gin Thr Gin Val Phe Val Phe Leu Leu Leu Cys Val Ser 1 5 10 15 Gly Ala His Gly Ser Ile Val Met Thr Gin Thr Pro Lys Phe Leu Leu 20 25 30 Val Ser Val Gly Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gin Ser 35 40 45 Val Ser Asn Asp Val Ala Trp Tyr Gin Gin Lys Pro Gly Gin Ser Pro 50 55 60 Lys Leu Leu lie Tyr Tyr Ala Ser Asn Arg Tyr Thr Gly Val Pro Asp 65 70 75 80 Arg Phe Thr Gly Ser Gly Tyr Gly Thr Asp Phe Thr Phe Thr lie Ser 85 90 95 Thr Val Gin Ala Glu Asp Leu Ala Val Tyr Phe Cys Gin Gin Asp Tyr 100 105 110 Ser Ser Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu lie Lys Arg 115 120 125 Ala Asp Ala Ala 130 <210> 207 <211> 23 <212> PRT <213> Artificial Sequence <220> <223> 11G8 Light Chain VL: FR1 <400> 207 Ser lie Val Met Thr Gin Thr Pro Lys Phe Leu Leu Val Ser Val Gly 1 5 10 15 Asp Arg Val Thr lie Thr Cys 20 <210> 208 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> 11G8 Light Chain VL: CDR1 <400> 208 Lys Ala Ser Gln Ser Val Ser Asn Asp 1 5 <210> 209 <211> 17 <212> PRT <213> Artificial sequence <220> <223> 11G8 Light Chain VL: FR2 <400> 209 Val Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile 1 5 10 15 Tyr <210> 210 <211> 7 <212> PRT <213> Artificial sequence <220> <223> 11G8 Light Chain VL: CDR2 <400> 210 Tyr Ala Ser Asn Arg Tyr Thr 1 5 <210> 211 <211> 32 <212> PRT <213> Artificial sequence <220> <223> 11G8 Light Chain VL: FR3 <400> 211 Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Tyr Gly Thr Asp Phe Thr 1 5 10 15 Phe Thr Ile Ser Thr Val Gln Ala Glu Asp Leu Ala Val Tyr Phe Cys 20 25 30 <210> 212 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> 11G8 Heavy Chain VL: CDR3 <400> 212 Gln Gln Asp Tyr Ser Ser Pro Trp Thr 1 5 <210> 213 <211 > 15 <212> PRT <213> Artificial Sequence <220> <223> 11G8 Heavy Chain VL: FR4 <400> 213 Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg Ala Asp Ala Ala 1 5 10 15 <210> 214 <211 > 434 <212> DNA <213> Artificial Sequence <220> <223> 14F8 Heavy Chain VH <220> <221 > misc_feature <222> (12)..(68) <223> Leader Sequence <220> <221 > misc_feature <222> (69)..(143) <223> FR1 <220> <221 > misc_feature <222> (144)..(173) <223> CDR1 <220> <221 > misc_feature <222> (174)..(215) <223> FR2 <220> <221 > misc_feature <222> (216)..(266) <223> CDR2 <220> <221> misc_feature <222> (267)..(356) <223> FR3 <220> <221> misc_feature <222> (357)..(401) <223> CDR3 <220> <221> misc_feature <222> (402)..(431) <223> FR4 <400> 214 tacttgtcga catgggatgg agctgtatca tgttctttct ggtagcaaca gctacaggtg 60 tgcactccca ggtccagctg cagcagtctg ggcctgaggt ggtgaggcct ggggtctcag 120 tgaagatttc ctgcaagggt tccggctaca cattcactga ttatactatg cactgggtga 180 agcagagtca tgcaaagagt ctagagtgga ttggagttat tagtacttac aatggtaata 240 caaactacaa ccagaacttt gagggcaagg ccacaatgac tgtagacaaa tcctccagca 300 cagcctatat ggaacttgcc agattgacat ctgaggattc tgccatctat tactgtgcaa 360 gagagagggg gggggatggt tactacagtg ctgtggacta ctggggtcaa ggaacctcag 420 tcaccgtctc tcag 434 <210> 215 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> 14F8 Heavy Chain VH: CDR1 <400> 215 ggctacacattcactgattatactatgcac 30 <210> 216 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> 14F8 Heavy Chain VH: CDR2 <400> 216 gttattagtacttacaatggtatacaaac tacaaccag aactttgagggc 51 <210> 217 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> 14F8 Heavy Chain VH: CDR3 <400> 217 gcaagagaggggggggggga tggttactac agtgctgtgg actac 45 <210> 218 <211> 140 <212> PRT <213> Artificial Sequence <220> <223> 14F8 Heavy Chain VH <220> <221> MISC_FEATURE <222> (1)..(19) <223> Leader Sequence <220> <221> MISC_FEATURE <222> (20)..(44) <223> FR1 <220> <221> MISC_FEATURE <222> (45)..(54) <223> CDR1 <220> <221> MISC_FEATURE <222> (55)..(68) <223> FR2 <220> <221> MISC_FEATURE <222> (69)..(85) <223> CDR2 <220> <221> MISC_FEATURE <222> (86)..(115) <223> FR3 <220> <221> MISC_FEATURE <222> (116)..(130) <223> CDR3 <220> <221> MISC_FEATURE <222> (131)..(140) <223> FR4 <400> 218 Met Gly Trp Ser Cys Ile Met Phe Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser Gln Val Gln Leu Gln Gln Ser Gly Pro Glu Val Val Arg 20 25 30 Pro Gly Val Ser Val Lys Ile Ser Cys Lys Gly Ser Gly Tyr Thr Phe 35 40 45 Thr Asp Tyr Thr Met His Trp Val Lys Gln Ser His Ala Lys Ser Leu 50 55 60 Glu Trp Ile Gly Val Ile Ser Thr Tyr Asn Gly Asn Thr Asn Tyr Asn 65 70 75 80 Gln Asn Phe Glu Gly Lys Ala Thr Met Thr Val Asp Lys Ser Ser Ser 85 90 95 Thr Ala Tyr Met Glu Leu Ala Arg Leu Thr Ser Glu Asp Ser Ala Ile 100 105 110 Tyr Tyr Cys Ala Arg Glu Arg Gly Gly Asp Gly Tyr Tyr Ser Ala Val 115 120 125 Asp Tyr Trp Gly Gln Gly Thr Ser Val Thr Val Ser 130 135 140 <210> 219 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> 14F8 Heavy Chain VH: FR1 <400> 219 Gln Val Gln Leu Gln Gln Ser Gly Pro Glu Val Val Arg Pro Gly Val 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Gly Ser 20 25 <210> 220 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 14F8 Heavy Chain VH: CDR1 <400> 220 Gly Tyr Thr Phe Thr Asp Tyr Thr Met His 1 5 10 <210> 221 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> 14F8 Heavy chain VH: FR2 <400> 221 Trp Val Lys Gln Ser His Ala Lys Ser Leu Glu Trp Ile Gly 1 5 10 <210> 222 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> 14F8 Heavy chain VH: CDR2 <400> 222 Val Ile Ser Thr Tyr Asn Gly Asn Thr Asn Tyr Asn Gln Asn Phe Glu 1 5 10 15 Gly <210> 223 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> 14F8 Heavy chain VH: FR3 <400> 223 Lys Ala Thr Met Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Glu 1 5 10 15 Leu Ala Arg Leu Thr Ser Glu Asp Ser Ala Ile Tyr Tyr Cys 20 25 30 <210> 224 <211> 15 <212> PRT <213> artificial sequence <220> <223> 14F8 heavy chain VH: CDR3 <400> 224 Ala Arg Glu Arg Gly Gly Asp Gly Tyr Tyr Ser Ala Val Asp Tyr 1 5 10 15 <210> 225 <211> 10 <212> PRT <213> artificial sequence <220> <223> 14F8 heavy chain VH: FR4 <400> 225 Trp Gly Gln Gly Thr Ser Val Thr Val Ser 1 5 10 <210> 226 <211> 313 <212> DNA <213> artificial sequence <220> <223> 14F8 light chain VL <220> <221> misc_feature <222> (3)..(47) <223> FR1 <220> <221> misc_feature <222> (48)..(74) <223> CDR1 <220> <221> misc_feature <222> (75)..(125) <223> FR2 <220> <221> misc_feature <222> (126)..(146) <223> CDR2 <220> <221> misc_feature <222> (147)..(242) <223> FR3 <220> <221> misc_feature <222> (243)..(269) <223> CDR3 <220> <221> misc_feature <222> (270)..(311) <223> FR4 <400> 226 ccaaattcct gcttgtatca gcaggagaca gggttaccat aacctgcaag gccagtcaga 60 gtgtgattaa tgatgtagct tggtaccaac agaagccagg gcagtctcct aaactgctga 120 tatactatgc atccaatcgc tacactggag tccctgatcg cttcactggc agtggatatg 180 ggacggattt cactttcacc atcagcactg tgcaggctga agacctggca gtttatttct 240 gtcagcagga ttatagctct ccgtacacgt tcggaggggg gaccaagctg gaaataaaac 300 gggctgatgc tgc 313 <210> 227 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> 14F8 light chain VL: CDR1 <400> 227 aaggccagtc agagtgtgat taatgat 27 <210> 228 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 14F8 Heavy Chain VL: CDR2 <400> 228 tatgcatcca atcgctacac t 21 <210> 229 <211> 27 <212> PRT <213> Artificial Sequence <220> <223> 14F8 Heavy Chain VL: CDR3 <400> 229 cagcaggatt atagctctcc gtacacg 27 <210> 230 <211> 103 <212> PRT <213> Artificial Sequence <220> <223> 14F8 Heavy Chain VL <220> <221> MISC_FEATURE <222> (1)..(15) <223> FR1 <220> <221> MISC_FEATURE <222> (16)..(24) <223> CDR1 <220> <221> MISC_FEATURE <222> (25)..(41) <223> FR2 <220> <221> MISC_FEATURE <222> (42)..(48) <223> CDR2 <220> <221> MISC_FEATURE <222> (49)..(80) <223> FR3 <220> <221> MISC_FEATURE <222> (81)..(89) <223> CDR3 <220> <221> MISC_FEATURE <222> (90)..(103) <223> FR4 <400> 230 Lys Phe Leu Leu Val Ser Ala Gly Asp Arg Val Thr Ile Thr Cys Lys 1 5 10 15 Ala Ser Gln Ser Val Ile Asn Asp Val Ala Trp Tyr Gln Gln Lys Pro 20 25 30 Gly Gln Ser Pro Lys Leu Leu Ile Tyr Tyr Ala Ser Asn Arg Tyr Thr 35 40 45 Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Tyr Gly Thr Asp Phe Thr 50 55 60 Phe Thr Ile Ser Thr Val Gln Ala Glu Asp Leu Ala Val Tyr Phe Cys 65 70 75 80 Gln Gln Asp Tyr Ser Ser Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu 85 90 95 Glu Ile Lys Arg Ala Asp Ala 100 <210> 231 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> 14F8 heavy chain VL: FR1 <400> 231 Lys Phe Leu Leu Val Ser Ala Gly Asp Arg Val Thr Ile Thr Cys 1 5 10 15 <210> 232 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> 14F8 heavy chain VL: CDR1 <400> 232 Lys Ala Ser Gln Ser Val Ile Asn Asp 1 5 <210> 233 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> 14F8 heavy chain VL: FR2 <400> 233 Val Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Lys Leu Leu Ile 1 5 10 15 Tyr <210> 234 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> 14F8 heavy chain VL: CDR2 <400> 234 Tyr Ala Ser Asn Arg Tyr Thr 1 5 <210> 235 <211> 32 <212> PRT <213> Artificial Sequence <220> <223> 14F8 heavy chain VL: FR3 <400> 235 Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Tyr Gly Thr Asp Phe Thr 1 5 10 15 Phe Thr Ile Ser Thr Val Gln Ala Glu Asp Leu Ala Val Tyr Phe Cys 20 25 30 <210> 236 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> 14F8 Light Chain VL: CDR3 <400> 236 Gln Gln Asp Tyr Ser Ser Pro Tyr Thr 1 5 <210> 237 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> 14F8 Light Chain VL: FR4 <400> 237 Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg Ala Asp Ala 1 5 10 <210> 238 <211> 421 <212> DNA <213> Artificial Sequence <220> <223> 15D2 Heavy Chain VH <220> <221> misc_feature <222> (11)..(67) <223> Leader Sequence <220> <221> misc_feature <222> (68)..(142) <223> FR1 <220> <221> misc_feature <222> (143)..(172) <223> CDR1 <220> <221> misc_feature <222> (173)..(214) <223> FR2 <220> <221> misc_feature <222> (215)..(265) <223> CDR2 <220> <221> misc_feature <222> (266)..(355) <223> FR3 <220> <221> misc_feature <222> (356)..(388) <223> CDR3 <220> <221> misc_feature <222> (389)..(418) <223> FR4 <400> 238 tggggaattc atggagttgg ggttcagctt gattttcctt gtccttgttt taaaaggtgt 60 ccagtgtgaa gtgatgctgg tggagtctgg gggaggctta gtgaagcctg gagggtccct 120 gaaactctcc tgtgcagcct ctggattcac tttcagtaac tatgccatgt cttgggttcg 180 ccagactccg gagaagaggc tggagtgggt cgcaacctct cttagtggtg gtaattacac 240 ctactatcca gacagtgtga aggggcgatt caccatctcc agagacaatg ccaagagcac 300 cctgtacctg caaatgagca gtctgaggtc tgaggacacg gccatgtatt actgtgtaat 360 cccccaaggt agtagtcctt ttgactattg gggccaaggc accactctca cagtctctca 420 g 421 <210> 239 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> 15D2 Heavy Chain VH: CDR1 <400> 239 ggattcactt tcagtaacta tgccatgtct 30 <210> 240 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> 15D2 Heavy Chain VH: CDR2 <400> 240 acctctctta gtggtggtaa ttacacctac tatccagaca gtgtgaaggg g 51 <210> 241 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> 15D2 Heavy Chain VH: CDR3 <400> 241 gtaatccccc aaggtagtag tccttttgac tat 33 <210> 242 <211> 136 <212> PRT <213> Artificial Sequence <220> <223> 15D2 Heavy Chain VH <220> <221> MISC_FEATURE <222> (1)..(19) <223> Leader Sequence <220> <221> MISC_FEATURE <222> (20)..(44) <223> FR1 <220> <221> MISC_FEATURE <222> (45)..(54) <223> CDR1 <220> <221> MISC_FEATURE <222> (55)..(68) <223> FR2 <220> <221> MISC_FEATURE <222> (69)..(85) <223> CDR2 <220> <221> MISC_FEATURE <222> (86)..(115) <223> FR3 <220> <221> MISC_FEATURE <222> (116)..(126) <223> CDR3 <220> <221> MISC_FEATURE <222> (127)..(136) <223> FR4 <400> 242 Met Glu Leu Gly Phe Ser Leu lie Phe Leu Val Leu Val Leu Lys Gly 1 5 10 15 Val Gin Cys Glu Val Met Leu Val Glu Ser Gly Gly Gly Leu Val Lys 20 25 30 Pro Gly Gly Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 35 40 45 Ser Asn Tyr Ala Met Ser Trp Val Arg Gin Thr Pro Glu Lys Arg Leu 50 55 60 Glu Trp Val Ala Thr Ser Leu Ser Gly Gly Asn Tyr Thr Tyr Tyr Pro 65 70 75 80 Asp Ser Val Lys Gly Arg Phe Thr lie Ser Arg Asp Asn Ala Lys Ser 85 90 95 Thr Leu Tyr Leu Gin Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Met 100 105 110 Tyr Tyr Cys Val lie Pro Gin Gly Ser Ser Pro Phe Asp Tyr Trp Gly 115 120 125 Gln Gly Thr Thr Leu Thr Val Ser 130 135 <210> 243 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> 15D2 Heavy Chain VH: FR1 <400> 243 Glu Val Met Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly 1 5 10 15 Ser Leu Lys Leu Ser Cys Ala Ala Ser 20 25 <210> 244 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 15D2 heavy chain VH: CDR1 <400> 244 Gly Phe Thr Phe Ser Asn Tyr Ala Met Ser 1 5 10 <210> 245 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> 15D2 heavy chain VH: FR2 <400> 245 Trp Val Arg Gin Thr Pro Glu Lys Arg Leu Glu Trp Val Ala 1 5 10 <210> 246 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> 15D2 heavy chain VH: CDR2 <400> 246 Thr Ser Leu Ser Gly Gly Asn Tyr Thr Tyr Tyr Pro Asp Ser Val Lys 1 5 10 15 Gly <210> 247 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> 15D2 Heavy Chain VH: FR3 <400> 247 Arg Phe Thr lie Ser Arg Asp Asn Ala Lys Ser Thr Leu Tyr Leu Gin 1 5 10 15 Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Met Tyr Tyr Cys 20 25 30 <210> 248 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> 15D2 Heavy Chain VH: CDR3 <400> 248 Val lie Pro Gin Gly Ser Ser Pro Phe Asp Tyr 1 5 10 <210> 249 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 15D2 Heavy Chain VH: FR4 <400> 249 Trp Gly Gin Gly Thr Thr Leu Thr Val Ser 1 5 10 <210> 250 <211> 417 <212> DNA <213> Artificial Sequence <220> <223> 15D2 Light Chain VL <220> <221> misc_feature <222> (12)..(83) <223> Leader Sequence <220> <221> misc_feature <222> (84)..(152) <223> FR1 <220> <221> misc_feature <222> (153)..(185) <223> CDR1 <220> <221> misc_feature <222> (186)..(230) <223> FR2 <220> <221> misc_feature <222> (231)..(251) <223> CDR2 <220> <221> misc_feature <222> (252)..(347) <223> FR3 <220> <221> misc_feature <222> (348)..(374) <223> CDR3 <220> <221> misc_feature <222> (375)..(404) <223> FR4 <400> 250 tactagtcga catgggcttc aagatggagt cacagattca ggttttggta tttttactgc 60 tctgtgtgtg tggtggtcat gggagtattg tgatgaccca gactcccaaa ttccctattg 120 tttcagtagg agacagggtt accataacct gtaaggccag tcagagtgtg aaaaatgatg 180 TGGTA CCAACAGAAG CCAG GGCAGT CTGGTAAAAT GTTAATATAT TATG CATGCA 240 ATCGCTACAC GGGAGTCCTT GATCGCTTCA CTGTCAGTGG ATATGTGACG GATTTCACTT 300 TCACCATCAC CACTGTGCA GGCTGAAGA CCTGGCAGT TTACTTTGT CAGCAGGA TCATA 360 GTTATCCGTG GACGTTCGGT GCTGGGACC AAGCTGGAGC TGAAACGGGC TGATGCTG 417 <210> 251 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> 15D2 Heavy Chain VL: CDR1 <400> 251 AAGGCCAGTC AGAGTGTGAA AAATGATGTA GCA 33 <210> 252 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 15D2 Heavy Chain VL: CDR2 <400> 252 TATG CATGCA ATCGCTACAC G 21 <210> 253 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> 15D2 Heavy Chain VL: CDR3 <400> 253 CAGCAGGA TCATAGTTAT CC GTGGACG 27 <210> 254 <211> 131 <212> PRT <213> Artificial sequence <220> <223> 15D2 Light Chain VL <220> <221> MISC_FEATURE <222> (1)..(24) <223> Leader sequence <220> <221> MISC_FEATURE <222> (25) (47) <223> FR1 <220> <221> MISC_FEATURE <222> (48) (58) <223> CDR1 <220> <221> MISC_FEATURE <222> (59) (73) <223> FR2 <220> <221> MISC_FEATURE <222> (74) (80) <223> CDR2 <220> <221> MISC_FEATURE <222> (81)..(112) <223> FR3 <220> <221> MISC_FEATURE <222> (113) (121) <223> CDR3 <220> <221> MISC_FEATURE <222> (122) (131) <223> FR4 <400> 254 Met Gly Phe Lys Met Glu Ser Gln Ile Gln Val Leu Val Phe Leu Leu 1 5 10 15 Leu Cys Val Cys Gly Gly His Gly Ser Ile Val Met Thr Gln Thr Pro 20 25 30 Lys Phe Pro Ile Val Ser Val Gly Asp Arg Val Thr Ile Thr Cys Lys 35 40 45 Ala Ser Gln Ser Val Lys Asn Asp Val Ala Trp Tyr Gln Gln Lys Pro 50 55 60 Gly Gln Ser Gly Lys Met Leu Ile Tyr Tyr Ala Cys Asn Arg Tyr Thr 65 70 75 80 Gly Val Leu Asp Arg Phe Thr Val Ser Gly Tyr Val Thr Asp Phe Thr 85 90 95 Phe Thr Ile Thr Thr Val Gln Ala Glu Asp Leu Ala Val Tyr Phe Cys 100 105 110 Gln Gln Asp His Ser Tyr Pro Trp Thr Phe Gly Ala Gly Thr Lys Leu 115 120 125 Glu Leu Lys 130 <210> 255 <211> 23 <212> PRT <213> Artificial Sequence <220> <223> 15D2 Light Chain VL: FR1 <400> 255 Ser Ile Val Met Thr Gln Thr Pro Lys Phe Pro Ile Val Ser Val Gly 1 5 10 15 Asp Arg Val Thr lie Thr Cys 20 <210> 256 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> 15D2 Light Chain VL: CDR1 <400> 256 Lys Ala Ser Gin Ser Val Lys Asn Asp Val Ala 1 5 10 <210> 257 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> 15D2 Light Chain VL: FR2 <400> 257 Trp Tyr Gin Gin Lys Pro Gly Gin Ser Gly Lys Met Leu lie Tyr 1 5 10 15 <210> 258 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> 15D2 Light Chain VL: CDR2 <400> 258 Tyr Ala Cys Asn Arg Tyr Thr 1 5 <210> 259 <211> 32 <212> PRT <213> Artificial Sequence <220> <223> 15D2 Light Chain VL: FR3 <400> 259 Gly Val Leu Asp Arg Phe Thr Val Ser Gly Tyr Val Thr Asp Phe Thr 1 5 10 15 Phe Thr Ile Thr Thr Val Gln Ala Glu Asp Leu Ala Val Tyr Phe Cys 20 25 30 <210> 260 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> 15D2 Light Chain VL: CDR3 <400> 260 Gln Gln Asp His Ser Tyr Pro Trp Thr 1 5 <210> 261 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 15D2 Light Chain VL: FR4 <400> 261 Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys 1 5 10 <210> 262 <211> 438 <212> DNA <213> Artificial Sequence <220> <223> 29H7 Heavy Chain VH <220> <221> misc_feature <222> (15)..(71) <223> Leader Sequence <220> <221> misc_feature <222> (72)..(146) <223> FR1 <220> <221> misc_feature <222> (147)..(176) <223> CDR1 <220> <221> misc_feature <222> (177)..(218) <223> FR2 <220> <221> misc_feature <222> (219)..(269) <223> CDR2 <220> <221> misc_feature <222> (270)..(359) <223> FR3 <220> <221> misc_feature <222> (360)..(404) <223> CDR3 <220> <221> misc_feature <222> (405)..(437) <223> FR4 <400> 262 tattactagt cgccatggga tggagctgta tcatgttctt tctggtagca acagctacag 60 gtgtgcactc ccaggtccag ctgcagcagt ctgggcctga ggtggtgagg cctggggtct 120 cagtgaagat ttcctgcaag ggttccggct acacattcac tgattatgtt atgcactggg 180 tgaagcagag tcatggaaag agtctagagt ggattggagt tattagtact tacaatggta 240 atacaaacta caaccagaag tttaagggca aggccacaat gactgtagac aaatcctcca 300 gcacagccta tatggaactt gccagattga catctgagga ttctgccatc tattactgtg 360 caagagagagggggggggat ggttactaca gtgctatgga ctactggggt caaggaacct 420 cagtcaccgt ctcctcag 438 <210> 263 <211> 30 <212> DNA <213> Artificial sequence <220> <223> 29H7 Heavy chain VH: CDR1 <400> 263 ggctacacat tcactgatta tgttatgcac 30 <210> 264 <211> 51 <212> DNA <213> Artificial sequence <220> <223> 29H7 Heavy chain VH: CDR2 <400> 264 gttattagta cttacaatgg taatacaaac tacaaccaga agtttaaggg c 51 <210> 265 <211> 45 <212> DNA <213> Artificial sequence <220> <223> 29H7 Heavy chain VH: CDR3 <400> 265 gcaagagaga ggggggggga tggttatactac agtgctatgg actac 45 <210> 266 <211> 141 <212> PRT <213> Artificial sequence <220> <223> 29H7 Heavy chain VH <220> <221> MISC_FEATURE <222> (1)..(19) <223> Leader sequence <220> <221> MISC_FEATURE <222> (20) (44) <223> FR1 <220> <221> MISC_FEATURE <222> (45) (54) <223> CDR1 <220> <221> MISC_FEATURE <222> (55) (68) <223> FR2 <220> <221> MISC_FEATURE <222> (69) (85) <223> CDR2 <220> <221> MISC_FEATURE <222> (86) (115) <223> FR3 <220> <221> MISC_FEATURE <222> (116) (130) <223> CDR3 <220> <221> MISC_FEATURE <222> (131) (141) <223> FR4 <400> 266 Met Gly Trp Ser Cys Ile Met Phe Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser Gin Val Gin Leu Gin Gin Ser Gly Pro Glu Val Val Arg 20 25 30 Pro Gly Val Ser Val Lys lie Ser Cys Lys Gly Ser Gly Tyr Thr Phe 35 40 45 Thr Asp Tyr Val Met His Trp Val Lys Gin Ser His Gly Lys Ser Leu 50 55 60 Glu Trp lie Gly Val lie Ser Thr Tyr Asn Gly Asn Thr Asn Tyr Asn 65 70 75 80 Gln Lys Phe Lys Gly Lys Ala Thr Met Thr Val Asp Lys Ser Ser Ser 85 90 95 Thr Ala Tyr Met Glu Leu Ala Arg Leu Thr Ser Glu Asp Ser Ala lie 100 105 110 Tyr Tyr Cys Ala Arg Glu Arg Gly Gly Asp Gly Tyr Tyr Ser Ala Met 115 120 125 Asp Tyr Trp Gly Gin Gly Thr Ser Val Thr Val Ser Ser 130 135 140 <210> 267 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> 29H7 heavy chain VH: FR1 <400> 267 Gln Val Gln Leu Gln Gln Ser Gly Pro Glu Val Val Arg Pro Gly Val 1 5 10 15 Ser Val Lys Ile Ser Cys Lys Gly Ser 20 25 <210> 268 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 29H7 heavy chain VH: CDR1 <400> 268 Gly Tyr Thr Phe Thr Asp Tyr Val Met His 1 5 10 <210> 269 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> 29H7 heavy chain VH: FR2 <400> 269 Trp Val Lys Gln Ser His Gly Lys Ser Leu Glu Trp Ile Gly 1 5 10 <210> 270 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> 29H7 heavy chain VH: CDR2 <400> 270 Val Ile Ser Thr Tyr Asn Gly Asn Thr Asn Tyr Asn Gln Lys Phe Lys 1 5 10 15 Gly <210> 271 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> 29H7 heavy chain VH: FR3 <400> 271 Lys Ala Thr Met Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Glu 1 5 10 15 Leu Ala Arg Leu Thr Ser Glu Asp Ser Ala Ile Tyr Tyr Cys 20 25 30 <210> 272 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> 29H7 heavy chain VH: CDR3 <400> 272 Ala Arg Glu Arg Gly Gly Asp Gly Tyr Tyr Ser Ala Met Asp Tyr 1 5 10 15 <210> 273 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> 29H7 heavy chain VH: FR4 <400> 273 Trp Gly Gln Gly Thr Ser Val Thr Val Ser Ser 1 5 10 <210> 274 <211> 389 <212> DNA <213> Artificial Sequence <220> <223> 29H7 light chain VL <220> <221> misc_feature <222> (3)..(53) <223> leader sequence <220> <221> misc_feature <222> (54)..(122) <223> FR1 <220> <221> misc_feature <222> (123)..(149) <223> CDR1 <220> <221> misc_feature <222> (150)..(200) <223> FR2 <220> <221> misc_feature <222> (201)..(221) <223> CDR2 <220> <221> misc_feature <222> (222)..(317) <223> FR3 <220> <221> misc_feature <222> (318)..(344) <223> CDR3 <220> <221> misc_feature <222> (345)..(389) <223> FR4 <400> 274 acaggagccg ggtgttggta tttctactgc tctgtgtgtc tggtgctcat gggagtattg 60 tgatgaccca gactcccaaa ttcctgcttg tttcagcagg agacagggtt accatagcct 120 gcaaggccag tcagagtgtg attaataatg tagcttggta ccaacagaag ccagggcagt 180 GAGGTGCAGCTGGAGTCTGGAGGCATCCTGTGAACTGCCTCTGTTGTCTCCTTCTCA 60 CTGGCAGTTG ATATGGGAC GGATTTCAC TTTCACCATC ACCTGTGCA GGCTGAAGA CC 300 TGGCAGTTTA TTTCGTTCAG CAGGATTAT AGCTCTCCGT ACACGTTCGG AGGGGGGAC CA 360 AGCTGGAAGT AAAACGGGCT GATGCTGCA 389 <210> 275 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> 29H7 Heavy Chain VL: CDR1 <400> 275 AAGGCCAGTC AGAGTGTGAT TAATAAT 27 <210> 276 <211> 21 <212> PRT <213> Artificial Sequence <220> <223> 29H7 Heavy Chain VL: CDR2 <400> 276 Thr Ala Thr Gly Cys Ala Thr Cys Cys Ala Ala Thr Cys Gly Cys Thr 1 5 10 15 Ala Cys Ala Cys Thr 20 <210> 277 <211> 27 <212> PRT <213> Artificial Sequence <220> <223> 29H7 Heavy Chain VL: CDR3 <400> 277 Cys Ala Gly Cys Ala Gly Gly Ala Thr Thr Ala Thr Ala Gly Cys Thr 1 5 10 15 Cys Thr Cys Cys Gly Thr Ala Cys Ala Cys Gly 20 25 <210> 278 <211> 129 <212> PRT <213> Artificial Sequence <220> <223> 29H7 Light Chain VL <220> <221> MISC_FEATURE <222> (1)..(17) <223> Leader Sequence <220> <221> MISC_FEATURE <222> (18)..(40) <223> FR1 <220> <221> MISC_FEATURE <222> (41)..(49) <223> CDR1 <220> <221> MISC_FEATURE <222> (50)..(66) <223> FR2 <220> <221> MISC_FEATURE <222> (67)..(73) <223> CDR2 <220> <221> MISC_FEATURE <222> (74)..(105) <223> FR3 <220> <221> MISC_FEATURE <222> (106)..(114) <223> CDR3 <220> <221> MISC_FEATURE <222> (115)..(129) <223> FR4 <400> 278 Arg Ser Arg Val Leu Val Phe Leu Leu Leu Cys Val Ser Gly Ala His 1 5 10 15 Gly Ser Ile Val Met Thr Gln Thr Pro Lys Phe Leu Leu Val Ser Ala 20 25 30 Gly Asp Arg Val Thr Ile Ala Cys Lys Ala Ser Gln Ser Val Ile Asn 35 40 45 Asn Val Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Glu Leu Leu 50 55 60 Ile Tyr Tyr Ala Ser Asn Arg Tyr Thr Gly Val Pro Asp Arg Phe Thr 65 70 75 80 Gly Ser Gly Tyr Gly Thr Asp Phe Thr Phe Thr Ile Thr Thr Val Gln 85 90 95 Ala Glu Asp Leu Ala Val Tyr Phe Cys Gln Gln Asp Tyr Ser Ser Pro 100 105 110 Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg Ala Asp Ala 115 120 125 Ala <210> 279 <211> 23 <212> PRT <213> Artificial Sequence <220> <223> 29H7 Heavy Chain VL: FR1 <400> 279 Ser lie Val Met Thr Gin Thr Pro Lys Phe Leu Leu Val Ser Ala Gly 1 5 10 15 Asp Arg Val Thr lie Ala Cys 20 <210> 280 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> 29H7 Heavy Chain VL: CDR1 <400> 280 Lys Ala Ser Gin Ser Val lie Asn Asn 1 5 <210> 281 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> 29H7 Heavy Chain VL: FR2 <400> 281 Val Ala Trp Tyr Gin Gin Lys Pro Gly Gin Ser Pro Glu Leu Leu lie 1 5 10 15 Tyr <210> 282 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> 29H7 Heavy Chain VL: CDR2 <400> 282 Tyr Ala Ser Asn Arg Tyr Thr 1 5 <210> 283 <211> 32 <212> PRT <213> Artificial sequence <220> <223> 29H7 Light Chain VL: FR3 <400> 283 Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Tyr Gly Thr Asp Phe Thr 1 5 10 15 Phe Thr Ile Thr Thr Val Gln Ala Glu Asp Leu Ala Val Tyr Phe Cys 20 25 30 <210> 284 <211> 9 <212> PRT <213> Artificial sequence <220> <223> 29H7 Light Chain VL: CDR3 <400> 284 Gln Gln Asp Tyr Ser Ser Pro Tyr Thr 1 5 <210> 285 <211> 15 <212> PRT <213> Artificial sequence <220> <223> 29H7 Light Chain VL: FR4 <400> 285 Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Arg Ala Asp Ala Ala 1 5 10 15 <210> 286 <211> 424 <212> DNA <213> Artificial sequence <220> <223> 30D10 Heavy Chain VH <220> <221> misc_feature <222> (2)..(67) <223> leader sequence <220> <221> misc_feature <222> (68)..(142) <223> FR1 <220> <221> misc_feature <222> (143)..(172) <223> CDR1 <220> <221> misc_feature <222> (173)..(217) <223> FR2 <220> <221> misc_feature <222> (218)..(265) <223> CDR2 <220> <221> misc_feature <222> (266)..(355) <223> FR3 <220> <221> misc_feature <222> (356)..(391) <223> CDR3 <220> <221> misc_feature <222> (392)..(421) <223> FR4 <400> 286 tggggaattc caggaatgga gctgggtttt tctcttcctg atggcagtgg ttacaggggt 60 caattcagag gttcagctgc agcagtctgg ggctgagctt gtgaggccag gggccttagt 120 caagttgtcc tgcaaagctt ctggcttcaa ctttaaagac tactttatgc actgggtgaa 180 gcagaggcct gaacagggcc tggagtggat tggatggatt gatcctgaaa atggtaatac 240 tatatatgaa ccgaagttcc agggcaaggc cagtataaca gcagacacat cctccaacac 300 agcctacctg cagctcagca gcctgacatc tgaggacact gccgtctatt actgtgctag 360 agggggggta ggtcactggt acttcgatgt ctggggcgca gggaccacgg tcaccgtctc 420 tcag 424 <210> 287 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> 30D10 Heavy Chain VH: CDR1 <400> 287 ggcttcaact ttaaagacta ctttatgcac 30 <210> 288 <211> 48 <212> DNA <213> Artificial Sequence <220> <223> 30D10 Heavy Chain VH: CDR2 <400> 288 attgatcctg aaaatggtaa tactatatat gaaccgaagt tccagggc 48 <210> 289 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> 30D10 heavy chain VH: CDR3 <400> 289 gctagagggg gggtaggtca ctggtacttc gatgtc 36 <210> 290 <211> 140 <212> PRT <213> Artificial Sequence <220> <223> 30D10 heavy chain VH <220> <221> MISC FEATURE <222> (1)..(22) <223> leader sequence <220> <221> MISC FEATURE <222> (23)..(47) <223> FR1 <220> <221> MISC FEATURE <222> (48)..(57) <223> CDR1 <220> <221> MISC FEATURE <222> (58)..(72) <223> FR2 <220> <221> MISC FEATURE <222> (73)..(88) <223> CDR2 <220> <221> MISC FEATURE <222> (89)..(118) <223> FR3 <220> <221> MISC FEATURE <222> (119)..(130) <223> CDR3 <220> <221> MISC FEATURE <222> (131)..(140) <223> FR4 <400> 290 Gly Glu Phe Gln Glu Trp Ser Trp Val Phe Leu Phe Leu Met Ala Val 1 5 10 15 Val Thr Gly Val Asn Ser Glu Val Gln Leu Gln Gln Ser Gly Ala Glu 20 25 30 Leu Val Arg Pro Gly Ala Leu Val Lys Leu Ser Cys Lys Ala Ser Gly 35 40 45 Phe Asn Phe Lys Asp Tyr Phe Met His Trp Val Lys Gln Arg Pro Glu 50 55 60 Gln Gly Leu Glu Trp Ile Gly Trp Ile Asp Pro Glu Asn Gly Asn Thr 65 70 75 80 Ile Tyr Glu Pro Lys Phe Gln Gly Lys Ala Ser Ile Thr Ala Asp Thr 85 90 95 Ser Ser Asn Thr Ala Tyr Leu Gln Leu Ser Ser Leu Thr Ser Glu Asp 100 105 110 Thr Ala Val Tyr Tyr Cys Ala Arg Gly Gly Val Gly His Trp Tyr Phe 115 120 125 Asp Val Trp Gly Ala Gly Thr Thr Val Thr Val Ser 130 135 140 <210> 291 <211> 25 <212> PRT <213> Artificial Sequence <220> <223> 30D10 Heavy Chain VH: FR1 <400> 291 Glu Val Gin Leu Gin Gin Ser Gly Ala Glu Leu Val Arg Pro Gly Ala 1 5 10 15 Leu Val Lys Leu Ser Cys Lys Ala Ser 20 25 <210> 292 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 30D10 Heavy Chain VH: CDR1 <400> 292 Gly Phe Asn Phe Lys Asp Tyr Phe Met His 1 5 10 <210> 293 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> 30D10 Heavy Chain VH: FR2 <400> 293 Trp Val Lys Gin Arg Pro Glu Gin Gly Leu Glu Trp He Gly Trp 1 5 10 15 <210> 294 <211> 16 <212> PRT <213> Artificial Sequence <220> <223> 30D10 Heavy Chain VH: CDR2 <400> 294 Ile Asp Pro Glu Asn Gly Asn Thr lie Tyr Glu Pro Lys Phe Gin Gly 1 5 10 15 <210> 295 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> 30D10 Heavy chain VH: FR3 <400> 295 Lys Ala Ser lie Thr Ala Asp Thr Ser Ser Asn Thr Ala Tyr Leu Gin 1 5 10 15 Leu Ser Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr Tyr Cys 20 25 30 <210> 296 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> 30D10 Heavy chain VH: CDR3 <400> 296 Ala Arg Gly Gly Val Gly His Trp Tyr Phe Asp Val 1 5 10 <210> 297 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 30D10 Heavy chain VH: FR4 <400> 297 Trp Gly Ala Gly Thr Thr Val Thr Val Ser 1 5 10 <210> 298 <211> 417 <212> PRT <213> Artificial Sequence <220> <223> 30D10 light chain VL <220> <221> MISC_FEATURE <222> (10)..(69) <223> Leader sequence <220> <221> MISC_FEATURE <222> (70)..(138) <223> FR1 <220> <221> MISC_FEATURE <222> (139)..(177) <223> CDR1 <220> <221> MISC_FEATURE <222> (178)..(228) <223> FR2 <220> <221> MISC_FEATURE <222> (229)..(249) <223> CDR2 <220> <221> MISC_FEATURE <222> (250)..(345) <223> FR3 <220> <221> MISC_FEATURE <222> (346)..(372) <223> CDR3 <220> <221> MISC_FEATURE <222> (373)..(402) <223> FR4 <400> 298 Thr Gly Gly Gly Ala Ala Thr Thr Cys Ala Thr Gly Gly Ala Gly Ala 1 5 10 15 Cys Ala Gly Ala Cys Ala Cys Ala Cys Thr Cys Cys Thr Gly Cys Thr 20 25 30 Ala Thr Gly Gly Gly Thr Gly Cys Thr Gly Cys Thr Gly Cys Thr Thr 35 40 45 Thr Gly Gly Gly Thr Thr Cys Cys Ala Gly Gly Cys Thr Cys Cys Ala 50 55 60 Cys Thr Gly Gly Thr Gly Ala Cys Ala Thr Thr Gly Thr Gly Cys Thr 65 70 75 80 Gly Ala Cys Cys Cys Ala Ala Thr Cys Thr Cys Cys Ala Gly Cys Thr 85 90 95 Thr Cys Thr Thr Thr Gly Gly Cys Thr Gly Thr Gly Thr Cys Thr Cys 100 105 110 Thr Ala Gly Gly Gly Cys Ala Gly Ala Gly Gly Gly Cys Cys Ala Cys 115 120 125 Cys Ala Thr Cys Thr Cys Thr Thr Gly Cys Ala Ala Gly Gly Cys Cys 130 135 140 Ala Gly Cys Cys Ala Ala Ala Gly Thr Gly Thr Thr Gly Ala Thr Thr 145 150 155 160 Ala Thr Gly Ala Thr Gly Gly Thr Gly Ala Thr Ala Gly Thr Thr Ala 165 170 175 Thr Ala Thr Gly Ala Ala Cys Thr Gly Gly Thr Ala Cys Cys Ala Ala 180 185 190 Cys Ala Gly Ala Ala Ala Cys Cys Ala Gly Gly Ala Cys Ala Gly Cys 195 200 205 Cys Ala Cys Cys Cys Cys Ala Ala Ala Cys Thr Cys Cys Thr Cys Ala Thr 210 215 220 Thr Thr Ala Thr Gly Thr Thr Gly Cys Ala Thr Cys Cys Ala Ala Thr 225 230 235 240 Cys Thr Ala Ala Ala Ala Thr Cys Thr Gly Gly Gly Ala Thr Cys Cys 245 250 255 Cys Ala Gly Cys Cys Ala Gly Gly Thr Thr Thr Ala Gly Thr Gly Gly 260 265 270 Cys Ala Gly Thr Gly Gly Gly Thr Gly Thr Gly Gly Gly Ala Cys Ala 275 280 285 Gly Ala Cys Thr Thr Cys Ala Cys Cys Cys Thr Cys Ala Ala Cys Ala 290 295 300 Thr Cys Cys Ala Thr Cys Cys Thr Gly Thr Gly Gly Ala Gly Gly Ala 305 310 315 320 Gly Gly Ala Gly Gly Ala Thr Gly Gly Thr Gly Cys Ala Ala Cys Cys 325 330 335 Thr Ala Thr Thr Ala Cys Thr Gly Thr Cys Ala Gly Cys Ala Ala Ala 340 345 350 Cys Thr Ala Ala Thr Gly Ala Gly Gly Ala Thr Cys Cys Gly Thr Gly 355 360 365 Gly Ala Cys Gly Thr Thr Cys Gly Gly Thr Gly Gly Ala Gly Gly Cys 370 375 380 Ala Cys Cys Ala Ala Gly Cys Thr Gly Gly Ala Ala Ala Thr Cys Ala 385 390 395 400 Ala Ala Cys Gly Gly Gly Cys Thr Gly Ala Thr Gly Cys Thr Gly Cys 405 410 415 Ala <210> 299 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> 30D10 VL CDR1 <400> 299 aaggccagcc aaagtgttga ttatgatggt gatagttat 39 <210> 300 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> 30D10 VL CDR2 <400> 300 gttgcatcca atctaaaatc t 21 <210> 301 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> 30D10 Heavy Chain VL: CDR3 <400> 301 cagcaaacta atgaggatcc gtggacg 27 <210> 302 <211> 131 <212> PRT <213> Artificial Sequence <220> <223> 30D10 Heavy Chain VL <220> <221> MISC_FEATURE <222> (1)..(20) <223> Leader Sequence <220> <221> MISC_FEATURE <222> (21)..(43) <223> FR1 <220> <221> MISC_FEATURE <222> (44)..(56) <223> CDR1 <220> <221> MISC_FEATURE <222> (57)..(73) <223> FR2 <220> <221> MISC_FEATURE <222> (74)..(80) <223> CDR2 <220> <221> MISC_FEATURE <222> (81)..(112) <223> FR3 <220> <221> MISC_FEATURE <222> (113)..(121) <223> CDR3 <220> <221> MISC_FEATURE <222> (122)..(131) <223> FR4 <400> 302 Met Glu Thr Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp Val Pro 1 5 10 15 Gly Ser Thr Gly Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala 20 25 30 Val Ser Leu Gly Gln Arg Ala Thr Ile Ser Cys Lys Ala Ser Gln Ser 35 40 45 Val Asp Tyr Asp Gly Asp Ser Tyr Met Asn Trp Tyr Gln Gln Lys Pro 50 55 60 Gly Gln Pro Pro Lys Leu Leu Ile Tyr Val Ala Ser Asn Leu Lys Ser 65 70 75 80 Gly Ile Pro Ala Arg Phe Ser Gly Ser Gly Cys Gly Thr Asp Phe Thr 85 90 95 Leu Asn Ile His Pro Val Glu Glu Glu Asp Gly Ala Thr Tyr Tyr Cys 100 105 110 Gln Gln Thr Asn Glu Asp Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu 115 120 125 Glu Ile Lys 130 <210> 303 <211> 23 <212> PRT <213> Artificial Sequence <220> <223> 30D10 Heavy Chain VL: FR1 <400> 303 Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Gln Arg Ala Thr Ile Ser Cys 20 <210> 304 <211> 13 <212> PRT <213> Artificial Sequence <220> <223> 30D10 Heavy Chain VL: CDR1 <400> 304 Lys Ala Ser Gln Ser Val Asp Tyr Asp Gly Asp Ser Tyr 1 5 10 <210> 305 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> 30D10 Heavy Chain VL: FR2 <400> 305 Met Asn Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile 1 5 10 15 Tyr <210> 306 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> 30D10 Heavy Chain VL: CDR2 <400> 306 Val Ala Ser Asn Leu Lys Ser 1 5 <210> 307 <211> 32 <212> PRT <213> Artificial Sequence <220> <223> 30D10 VL: FR3 <400> 307 Gly Ile Pro Ala Arg Phe Ser Gly Ser Gly Cys Gly Thr Asp Phe Thr 1 5 10 15 Leu Asn Ile His Pro Val Glu Glu Glu Asp Gly Ala Thr Tyr Tyr Cys 20 25 30 <210> 308 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> 30D10 VL: CDR3 <400> 308 Gln Gln Thr Asn Glu Asp Pro Trp Thr 1 5 <210> 309 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> 30D10 VL: FR4 <400> 309 Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 1 5 10 <210> 310 <211> 424 <212> DNA <213> Artificial Sequence <220> <223> 51C3 VH <220> <221> misc_feature <222> (1)..(66) <223> leader sequence <220> <221> misc_feature <222> (67)..(138) <223> FR1 <220> <221> misc_feature <222> (139)..(171) <223> CDR1 <220> <221> misc_feature <222> (172)..(213) <223> FR2 <220> <221> misc_feature <222> (214)..(264) <223> CDR2 <220> <221> misc_feature <222> (265)..(354) <223> FR3 <220> <221> misc_feature <222> (355)..(390) <223> CDR3 <220> <221> misc_feature <222> (391)..(423) <223> FR4 <400> 310 tggggaattc aggaatggag ctgggttttt ctctttctcc tgtcaggaac tgcaggtgtc 60 ctctctgagg tccagctgca acagtctgga cctgagctgg tgaagcctgg ggcttcagtg 120 aagatatcct gcaagacttc tggatacaca ttcactgaat acatcatgca ctgggtgaaa 180 cagagccatg gaaagagcct tgagtggatt ggaggtatta atcctaataa tggtggtact 240 aactacaacc agaagtttaa gggcaaggcc acattgactg tagacacgtc ctccagcata 300 gcctacatgg aactccgcag cctgacatct gaagattctg cagtctatta ttgtgcaaga 360 gacgatggtt actacgtaaa gttcgcttac tggggccaag ggactctggt cactgtctct 420 gcag 424 <210> 311 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> 51C3 Heavy Chain VH: CDR1 <400> 311 tctggataca cattcactga atacatcatg cac 33 <210> 312 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> 51C3 Heavy Chain VH: CDR2 <400> 312 ggtattaatc ctaataatgg tggtactaac tacaaccaga agtttaaggg c 51 <210> 313 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> 51C3 heavy chain VH: CDR3 <400> 313 gcaagagacg atggttacta cgtaaagttc gcttac 36 <210> 314 <211> 141 <212> PRT <213> Artificial sequence <220> <223> 51C3 heavy chain VH <220> <221> MISC_FEATURE <222> (1)..(22) <223> leader sequence <220> <221> MISC_FEATURE <222> (23)..(46) <223> FR1 <220> <221> MISC_FEATURE <222> (47)..(57) <223> CDR1 <220> <221> MISC_FEATURE <222> (58)..(71) <223> FR2 <220> <221> MISC_FEATURE <222> (72)..(88) <223> CDR2 <220> <221> MISC_FEATURE <222> (89)..(118) <223> FR3 <220> <221> MISC_FEATURE <222> (119)..(130) <223> CDR3 <220> <221> MISC_FEATURE <222> (131)..(141) <223> FR4 <400> 314 Trp Gly Ile Gln Glu Trp Ser Trp Val Phe Leu Phe Leu Leu Ser Gly 1 5 10 15 Thr Ala Gly Val Leu Ser Glu Val Gln Leu Gln Gln Ser Gly Pro Glu 20 25 30 Leu Val Lys Pro Gly Ala Ser Val Lys Ile Ser Cys Lys Thr Ser Gly 35 40 45 Tyr Thr Phe Thr Glu Tyr Ile Met His Trp Val Lys Gln Ser His Gly 50 55 60 Lys Ser Leu Glu Trp Ile Gly Gly Ile Asn Pro Asn Asn Gly Gly Thr 65 70 75 80 Asn Tyr Asn Gln Lys Phe Lys Gly Lys Ala Thr Leu Thr Val Asp Thr 85 90 95 Ser Ser Ser Ile Ala Tyr Met Glu Leu Arg Ser Leu Thr Ser Glu Asp 100 105 110 Ser Ala Val Tyr Tyr Cys Ala Arg Asp Asp Gly Tyr Tyr Val Lys Phe 115 120 125 Ala Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ala 130 135 140 <210> 315 <211> 24 <212> PRT <213> Artificial Sequence <220> <223> 51C3 heavy chain VH: FR1 <400> 315 Glu Val Gin Leu Gin Gin Ser Gly Pro Glu Leu Val Lys Pro Gly Ala 1 5 10 15 Ser Val Lys lie Ser Cys Lys Thr 20 <210> 316 <211> 27 <212> PRT <213> Artificial Sequence <220> <223> 51C3 heavy chain VH: CDR1 <400> 316 Cys His Glu Ala Val Tyr Cys His Ala lie Asn Val His Cys Asp Arg 1 5 10 15 Ser Gly Tyr Thr Phe Thr Glu Tyr lie Met His 20 25 <210> 317 <211> 14 <212> PRT <213> Artificial Sequence <220> <223> 51C3 heavy chain VH: FR2 <400> 317 Trp Val Lys Gin Ser His Gly Lys Ser Leu Glu Trp lie Gly 1 5 10 <210> 318 <211> 17 <212> PRT <213> Artificial Sequence <220> <223> 51C3 heavy chain VH: CDR2 <400> 318 Gly lie Asn Pro Asn Asn Gly Gly Thr Asn Tyr Asn Gin lie Phe Lys 1 5 10 15 Gly <210> 319 <211> 30 <212> PRT <213> Artificial Sequence <220> <223> 51C3 heavy chain VH: FR3 <400> 319 Lys Ala Thr Leu Thr Val Asp Thr Ser Ser Ser lie Ala Tyr Met Glu 1 5 10 15 Leu Arg Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 20 25 30 <210> 320 <211> 12 <212> PRT <213> Artificial Sequence <220> <223> 51C3 heavy chain VH: CDR3 <400> 320 Ala Arg Asp Asp Gly Tyr Tyr Val Lys Phe Ala Tyr 1 5 10 <210> 321 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> 51C3 heavy chain VH: FR4 <400> 321 Trp Gly Gin Gly Thr Leu Val Thr Val Ser Ala 1 5 10 <210> 322 <211> 419 <223> 51C3 heavy chain VH: CDR1<212> DNA <213> Artificial Sequence <220> <223> 51C3 Heavy Chain VL <220> <221> misc_feature <222> (12)..(83) <223> Leader Sequence <220> <221> misc_feature <222> (84)..(152) <223> FR1 <220> <221> misc_feature <222> (153)..(179) <223> CDR1 <220> <221> misc_feature <222> (180)..(230) <223> FR2 <220> <221> misc_feature <222> (231)..(251) <223> CDR2 <220> <221> misc_feature <222> (252)..(347) <223> FR3 <220> <221> misc_feature <222> (348)..(374) <223> CDR3 <220> <221> misc_feature <222> (375)..(419) <223> FR4 <400> 322 tactagttga catgggcttc aagatggagt cacagactca ggtcttcgta tttctactgc 60 tctgtgtgtc tggtgctcat gggagtattg tgatgaccca gactcccaaa ttcctgcttg 120 tatcagcagg agacagggtt accataacct gcaaggccag tcagagtgtg attaatgatg 180 tagcttggta ccaacagaag ccagggcagt ctcctaaact gctgatatac tatgcatcca 240 atcgctacac tggagtccct gatcgcttca ctggcagtgg atatgggacg gatttcactt 300 tcaccatcag cactgtgcag gctgaagacc tggcagttta tttctgtcag caggattata 360 gctctccatt cacgttcggc tcggggacaa agttggaaat aaaacgggct gatgctgca 419 <210> 323 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> CDR1 of 51C3 VL light chain <400> 323 aaggccagtc agagtgtgat taatgat 27 <210> 324 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> CDR2 of 51C3 VL light chain <400> 324 tatgcatcca atcgctacac t 21 <210> 325 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> 51C3 light chain VL: CDR3 <400> 325 cagcaggatt atagctctcc attcacg 27 <210> 326 <211> 136 <212> PRT <213> Artificial sequence <220> <223> 51C3 light chain VL <220> <221> MISC_FEATURE <222> (1)..(24) <223> Leader sequence <220> <221> MISC_FEATURE <222> (25)..(47) <223> FR1 <220> <221> MISC_FEATURE <222> (48)..(56) <223> CDR1 <220> <221> MISC_FEATURE <222> (57)..(73) <223> FR2 <220> <221> MISC_FEATURE <222> (74)..(80) <223> CDR2 <220> <221> MISC_FEATURE <222> (81)..(112) <223> FR3 <220> <221> MISC_FEATURE <222> (113)..(121) <223> CDR3 <220> <221> MISC_FEATURE <222> (122)..(136) <223> FR4 <400> 326 Met Gly Phe Lys Met Glu Ser Gin Thr Gin Val Phe Val Phe Leu Leu 1 5 10 15 Leu Cys Val Ser Gly Ala His Gly Ser Ile Val Met Thr Gin Thr Pro 20 25 30 Lys Phe Leu Leu Val Ser Ala Gly Asp Arg Val Thr Ile Thr Cys Lys 35 40 45 Ala Ser Gin Ser Val Ile Asn Asp Val Ala Trp Tyr Gin Gin Lys Pro 50 55 60 Gly Gin Ser Pro Lys Leu Leu Ile Tyr Tyr Ala Ser Asn Arg Tyr Thr 65 70 75 80 Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Tyr Gly Thr Asp Phe Thr 85 90 95 Phe Thr Ile Ser Thr Val Gin Ala Gin Asp Leu Ala Val Tyr Phe Cys 100 105 110 Gln Gin Asp Tyr Ser Ser Pro Phe Thr Phe Gly Ser Gly Thr Lys Leu 115 120 125 Glu Ile Lys Arg Ala Asp Ala Ala 130 135 <210> 327 <211> 23 <212> PRT <213> Artificial Sequence <220> <223> 51C3 Heavy Chain VL: FR1 <400> 327 Ser lie Val Met Thr Gin Thr Pro Lys Phe Leu Leu Val Ser Ala Gly 1 5 10 15 Asp Arg Val Thr lie Thr Cys 20 <210> 328 <211 > 9 <212> PRT <213> Artificial Sequence <220> <223> 51C3 Heavy Chain VL: CDR1 <400> 328 Lys Ala Ser Gin Ser Val lie Asn Asp 1 5 <210> 329 <211 > 17 <212> PRT <213> Artificial Sequence <220> <223> 51C3 Heavy Chain VL: FR2 <400> 329 Val Ala Trp Tyr Gin Gin Lys Pro Gly Gin Ser Pro Lys Leu Leu lie 1 5 10 15 Tyr <210> 330 <211 > 7 <212> PRT <213> Artificial Sequence <220> <223> 51C3 Heavy Chain VL: CDR2 <400> 330 Tyr Ala Ser Asn Arg Tyr Thr 1 5 <210> 331 <211 > 32 <212> PRT <213> Artificial Sequence <220> <223> 51C3 Light Chain VL: FR3 <400> 331 Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Tyr Gly Thr Asp Phe Thr 1 5 10 15 Phe Thr Ile Ser Thr Val Gln Ala Glu Asp Leu Ala Val Tyr Phe Cys 20 25 30 <210> 332 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> 51C3 Light Chain VL: CDR3 <400> 332 Gln Gln Asp Tyr Ser Ser Pro Phe Thr 1 5 <210> 333 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> 51C3 Light Chain VL: FR4 <400> 333 Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys Arg Ala Asp Ala Ala 1 5 10 15 <210> 334 <211> 1233 <212> DNA <213> Homo sapiens <400> 334 atgtcgctca tggtcgtcag catggcgtgt gttgggttct tcttgctgga ggggccctgg 60 ccacatgtgg gtggtcagga caagcccttc ctctctgcct ggcccggcac tgtggtgtct 120 gaaggacaac atgtgactct tcagtgtcgc tctcgtcttg ggtttaatga attcagtctg 180 tccaaagaag acgggatgcc tgtccctgag ctctacaaca gaatattccg gaacagcttt 240 ctcatgggcc ctgtgacccc agcacatgca gggacctaca gatgttgcag ttcacaccca 300 cactccccca ctgggtggtc ggcacccagc aaccctgtgg tgatcatggt cacaggagtc 360 cacagaaaac cttccctcct ggcccaccca ggtcccctgg tgaaatcagg agagacggtc 420 atcctgcaat gttggtcaga tgtcaggttt gagcgcttcc ttctgcacag agaggggatc 480 actgaggacc ccttgcgcct cgttggacag ctccacgatg cgggttccca ggtcaactat 540 tccatgggtc ccatgacacc tgcccttgca gggacctaca gatgctttgg ttctgtcact 600 cacttaccct atgagttgtc ggctcccagt gaccctctgg acatcgtggt cgtaggtcta 660 tatgggaaac cttctctctc agcccagccg ggccccacgg ttcaggcagg agagaatgtg 720 accttgtcct gcagctcccg gagcttgttt gacatttacc atctatccag ggaggcggag 780 gccggtgaac ttaggctcac tgcagtgctg agggtcaatg gaacattcca ggccaacttc 840 cctctgggcc ctgtgaccca cggagggaac tacagatgct tcggctcttt ccgtgccctg 900 ccccatgcgt ggtcagaccc gagtgaccca ctgcccgttt ctgtcacagg taactccaga 960 aacctgcacg ttctgattgg gacctcagtg gtcatcatcc cctttgctat cctcctcttc 1020 tttctccttc atcgctggtg tgccaacaaa aagaatgctg ttgtaatgga ccaagagcct 1080 gcagggaaca gaacagtgaa cagggaggac tctgatgaac aagaccctca ggaggtgaca 1140 tacgcacagt tgaatcactg cgttttcaca cagagaaaaa tcactcgccc ttctcagagg 1200 cccaagacac ccccaacaga taccagcgtg taa 1233 <210> 335 <211> 410 <212> PRT <213> Homo sapiens <220> <221> MISC_FEATURE <222> (1)..(25) <223> SIGNAL PEPTIDE <220> <221> MISC_FEATURE <222> (34)..(118) <223> DOMAIN D0 <220> <221> MISC_FEATURE <222> (129)..(218) <223> D1 domain <220> <221> MISC_FEATURE <222> (229)..(325) <223> D2 domain <220> <221> MISC_FEATURE <222> (321)..(343) <223> transmembrane domain <220> <221> MISC_FEATURE <222> (344)..(403) <223> cytoplasmic tail <220> <221> MISC_FEATURE <222> (379)..(384) <223> immunoreceptor Tyr-based inhibition motif (ITIM) <400> 335 Met Ser Leu Met Val Val Ser Met Ala Cys Val Gly Phe Phe Leu Leu 1 5 10 15 Glu Gly Pro Trp Pro His Val Gly Gly Gln Asp Lys Pro Phe Leu Ser 20 25 30 Ala Trp Pro Gly Thr Val Val Ser Glu Gly Gln His Val Thr Leu Gln 35 40 45 Cys Arg Ser Arg Leu Gly Phe Asn Glu Phe Ser Leu Ser Lys Glu Asp 50 55 60 Gly Met Pro Val Pro Glu Leu Tyr Asn Arg Ile Phe Arg Asn Ser Phe 65 70 75 80 Leu Met Gly Pro Val Thr Pro Ala His Ala Gly Thr Tyr Arg Cys Cys 85 90 95 Ser Ser His Pro His Ser Pro Thr Gly Trp Ser Ala Pro Ser Asn Pro 100 105 110 Val Val Ile Met Val Thr Gly Val His Arg Lys Pro Ser Leu Leu Ala 115 120 125 His Pro Gly Pro Leu Val Lys Ser Gly Glu Thr Val Ile Leu Gln Cys 130 135 140 Trp Ser Asp Val Arg Phe Glu Arg Phe Leu Leu His Arg Glu Gly Ile 145 150 155 160 Thr Glu Asp Pro Leu Arg Leu Val Gly Gln Leu His Asp Ala Gly Ser 165 170 175 Gln Val Asn Tyr Ser Met Gly Pro Met Thr Pro Ala Leu Ala Gly Thr 180 185 190 Tyr Arg Cys Phe Gly Ser Val Thr His Leu Pro Tyr Glu Leu Ser Ala 195 200 205 Pro Ser Asp Pro Leu Asp Ile Val Val Val Gly Leu Tyr Gly Lys Pro 210 215 220 Ser Leu Ser Ala Gln Pro Gly Pro Thr Val Gln Ala Gly Glu Asn Val 225 230 235 240 Thr Leu Ser Cys Ser Ser Arg Ser Leu Phe Asp Ile Tyr His Leu Ser 245 250 255 Arg Glu Ala Glu Ala Gly Glu Leu Arg Leu Thr Ala Val Leu Arg Val 260 265 270 Asn Gly Thr Phe Gln Ala Asn Phe Pro Leu Gly Pro Val Thr His Gly 275 280 285 Gly Asn Tyr Arg Cys Phe Gly Ser Phe Arg Ala Leu Pro His Ala Trp 290 295 300 Ser Asp Pro Ser Asp Pro Leu Pro Val Ser Val Thr Gly Asn Ser Arg 305 310 315 320 Asn Leu His Val Leu Ile Gly Thr Ser Val Val Ile Ile Pro Phe Ala 325 330 335 Ile Leu Leu Phe Phe Leu Leu His Arg Trp Cys Ala Asn Lys Lys Asn 340 345 350 Ala Val Val Met Asp Gln Glu Pro Ala Gly Asn Arg Thr Val Asn Arg 355 360 365 Glu Asp Ser Asp Glu Gln Asp Pro Gln Glu Val Thr Tyr Ala Gln Leu 370 375 380 Asn His Cys Val Phe Thr Gln Arg Lys Ile Thr Arg Pro Ser Gln Arg 385 390 395 400 Pro Lys Thr Pro Pro Thr Asp Thr Ser Val 405 410 <210> 336 <211> 25 <212> PRT <213> Homo sapiens <400> 336 Met Ser Leu Met Val Val Ser Met Ala Cys Val Gly Phe Phe Leu Leu 1 5 10 15 Glu Gly Pro Trp Pro His Val Gly Gly 20 25 <210> 337 <211> 85 <212> PRT <213> Homo sapiens <400> 337 Trp Pro Gly Thr Val Val Ser Glu Gly Gln His Val Thr Leu Gln Cys 1 5 10 15 Arg Ser Arg Leu Gly Phe Asn Glu Phe Ser Leu Ser Lys Glu Asp Gly 20 25 30 Met Pro Val Pro Glu Leu Tyr Asn Arg Ile Phe Arg Asn Ser Phe Leu 35 40 45 Met Gly Pro Val Thr Pro Ala His Ala Gly Thr Tyr Arg Cys Cys Ser 50 55 60 Ser His Pro His Ser Pro Thr Gly Trp Ser Ala Pro Ser Asn Pro Val 65 70 75 80 Val Ile Met Val Thr 85 <210> 338 <211> 90 <212> PRT <213> Homo sapiens <400> 338 His Pro Gly Pro Leu Val Lys Ser Gly Glu Thr Val Ile Leu Gin Cys 1 5 10 15 Trp Ser Asp Val Arg Phe Glu Arg Phe Leu Leu His Arg Glu Gly Ile 20 25 30 Thr Glu Asp Pro Leu Arg Leu Val Gly Gin Leu His Asp Ala Gly Ser 35 40 45 Gln Val Asn Tyr Ser Met Gly Pro Met Thr Pro Ala Leu Ala Gly Thr 50 55 60 Tyr Arg Cys Phe Gly Ser Val Thr His Leu Pro Tyr Glu Leu Ser Ala 65 70 75 80 Pro Ser Asp Pro Leu Asp Ile Val Val Val 85 90 <210> 339 <211> 97 <212> PRT <213> Homo sapiens <400> 339 Gln Pro Gly Pro Thr Val Gin Ala Gly Glu Asn Val Thr Leu Ser Cys 1 5 10 15 Ser Ser Arg Ser Leu Phe Asp Ile Tyr His Leu Ser Arg Glu Ala Glu 20 25 30 Ala Gly Glu Leu Arg Leu Thr Ala Val Leu Arg Val Asn Gly Thr Phe 35 40 45 Gln Ala Asn Phe Pro Leu Gly Pro Val Thr His Gly Gly Asn Tyr Arg 50 55 60 Cys Phe Gly Ser Phe Arg Ala Leu Pro His Ala Trp Ser Asp Pro Ser 65 70 75 80 Asp Pro Leu Pro Val Ser Val Thr Gly Asn Ser Arg Asn Leu His Val 85 90 95 Leu <210> 340 <211> 23 <212> PRT <213> Homo sapiens <400> 340 Asn Leu His Val Leu Ile Gly Thr Ser Val Val Ile Ile Pro Phe Ala 1 5 10 15 Ile Leu Leu Phe Phe Leu Leu 20 <210> 341 <211> 60 <212> PRT <213> Homo sapiens <400> 341 His Arg Trp Cys Ala Asn Lys Lys Asn Ala Val Val Met Asp Gln Glu 1 5 10 15 Pro Ala Gly Asn Arg Thr Val Asn Arg Glu Asp Ser Asp Glu Gln Asp 20 25 30 Pro Gin Glu Val Thr Tyr Ala Gin Leu Asn His Cys Val Phe Thr Gin 35 40 45 Arg Lys lie Thr Arg Pro Ser Gin Arg Pro Lys Thr 50 55 60 <210> 342 <211> 6 <212> PRT <213> Homo sapiens <400> 342 Val Thr Tyr Ala Gin Leu 1 5

Claims

1. An anti-KIR3DL3 antibody or an antigen-binding fragment thereof, wherein the antibody or antigen-binding fragment comprises... a) The VH region, comprising the VH CDR1 amino acid sequence of SEQ ID NO: 31, the VHCDR2 amino acid sequence of SEQ ID NO: 33, and the VH CDR3 amino acid sequence of SEQ ID NO: 35; and b) The VL region, which comprises the VL CDR1 amino acid sequence of SEQ ID NO: 43, the VLCDR2 amino acid sequence of SEQ ID NO: 45, and the VL CDR3 amino acid sequence of SEQ ID NO:

47.

2. The anti-KIR3DL3 antibody or its antigen-binding fragment according to claim 1, comprising a VH region having an amino acid sequence having 80% or more identity with SEQ ID NO:29; and a VL region having an amino acid sequence having 80% or more identity with SEQ ID NO:

41.

3. The anti-KIR3DL3 antibody according to claim 1, wherein, The anti-KIR3DL3 antibody is a monoclonal antibody.

4. The anti-KIR3DL3 antibody according to claim 1, wherein, The anti-KIR3DL3 antibody is a chimeric antibody or a humanized antibody.

5. A fusion polypeptide comprising the anti-KIR3DL3 antibody or its antigen-binding fragment as described in claim 1.

6. A composition comprising the anti-KIR3DL3 antibody according to claim 1 or an antigen-binding fragment thereof.

7. The composition according to claim 6 further comprises a pharmaceutically acceptable carrier.

8. The composition according to claim 6 further comprises a pharmaceutically acceptable excipient.

9. A nucleic acid encoding the anti-KIR3DL3 antibody or its antigen-binding fragment according to claim 1.

10. A nucleic acid comprising a nucleic acid encoding a fusion polypeptide, wherein, The fusion polypeptide is the fusion polypeptide according to claim 5.

11. Use of the anti-KIR3DL3 antibody of claim 1 or its antigen-binding fragment in the production of a medicament for treating a subject with a disease, wherein the disease is cancer, and wherein the cancer is selected from lung cancer and leukemia.

12. The use according to claim 11, wherein (a) The subject had HHLA2-induced suppression of KIR3DL3 immune cell function; (b) The immune cell function of the subjects was suppressed by KIR3DL3; (c) The subject exhibited KIR3DL3-induced immunosuppression; (d) Cancer is cancer that expresses KIR3DL3; (e) Cancer is cancer that expresses HHLA2 or (f) Any combination or all of the following: (a), (b), (c), (d) and (e).

13. The use according to claim 11, wherein, The leukemias mentioned are selected from chronic lymphocytic leukemia (CLL), acute leukemia, chronic myeloid leukemia (CML), B-cell prolymphocytic leukemia, hairy cell leukemia, and pre-leukemia.

14. The use according to claim 11, wherein, The cancer in question is metastatic cancer.

15. The use according to claim 11 further includes administering one or more additional cancer therapies selected from chemotherapy, radiotherapy, immunotherapy, surgery, and combinations thereof to the subject.

Images