New influenza nanoparticle vaccine, and preparation thereof and use thereof

Abstract

Provided are an influenza vaccine as a nasal spray, and a preparation method therefor and the use thereof. In the vaccine, a fusion protein contains an influenza virus strain HA protein or a fragment thereof, an influenza virus protein epitope and ferritin; and an adjuvant is a CpG1009 adjuvant for enhancing humoral immunity and cellular immunity. The vaccine composed of the fusion protein and the new CpG adjuvant can induce a strong protective effect against challenge.

Description

Novel influenza nanoparticle vaccines and their preparation and application Technical Field

[0001] This invention belongs to the field of biotechnology, and more specifically, relates to novel fusion protein antigens, compositions comprising fusion protein antigens, related adjuvants, and their use in the preparation of influenza vaccine compositions, particularly nasal vaccine compositions. Background Technology

[0002] Influenza virus (IV) is a highly contagious respiratory pathogen and one of the leading infectious diseases causing morbidity and mortality worldwide, posing a serious threat to global public health. Preventing and controlling seasonal influenza outbreaks and pandemics is crucial, and vaccination is one of the most effective preventative measures. However, current influenza vaccines have some limitations, such as inducing strain-specific immunity, poor efficacy against mismatched strains, and inability to combat new pandemic strains.

[0003] Most current influenza vaccines are administered via intramuscular injection, which, while promoting strong humoral and cellular immunity, struggles to effectively induce mucosal immunity. Influenza virus infection begins with the binding of hemagglutinin (HA) to sialic acid receptors on the surface of respiratory epithelial cells, and secretory immunoglobulin A (sIgA)-mediated mucosal immunity forms the first line of defense against the influenza virus. Intranasal immunization is a promising route of vaccination for the prevention of infectious respiratory diseases such as influenza. It induces systemic and mucosal immune responses, and sIgA and IgG can prevent influenza infection upon viral entry. Influenza mucosal immunity offers cross-protection against heterologous and heterotyped viruses, and needle-free intranasal influenza vaccines offer advantages such as ease of administration, high recipient acceptance, and avoidance of biohazardous sharps waste.

[0004] The development of intranasal influenza vaccines has been slow. Currently, the only available human intranasal influenza vaccine is the cold-adapted live attenuated influenza virus (LAIV) vaccine, but it has safety concerns, especially in high-risk groups such as infants and the elderly, where there is a potential risk of reversion to virulence. Furthermore, the LAIV vaccine did not provide ideal protection for children during the 2009 H1N1 pandemic. Therefore, there is an urgent need to develop a new generation of safe, effective, and virus-independent intranasal influenza vaccines that can induce broader cross-protection.

[0005] In recent years, nanoparticle vaccine platforms have been applied to the development of nasal-feed vaccines, but most nanoparticle vaccines suffer from problems such as low antigen loading capacity, complex and lengthy preparation processes, and complex structures. Advances in nanotechnology have made synergistic epitope vaccination and mucosal immune responses possible.

[0006] Therefore, developing a safe and effective intranasal multi-epitope influenza vaccine is of great research significance and application potential.

[0007] Summary of the Invention

[0008] To address the aforementioned problems, this invention discloses a recombinant trivalent influenza nanoparticle vaccine using a novel CpG adjuvant, its preparation, and its application. By using the disclosed fusion protein as an antigen and CpG1009 as an adjuvant, a recombinant influenza nanoparticle vaccine with high safety and efficacy is provided. The fusion protein provided by this invention preferably simultaneously comprises an influenza virus surface glycoprotein or a fragment thereof, B-cell and T-cell antigenic epitopes, and a nanoparticle core. For example, the surface glycoprotein is hemagglutinin (HA) or a fragment thereof; the antigenic epitopes are derived from other structural proteins of the influenza virus besides HA, preferably selected from one or more of matrix protein 2 (M2), matrix protein 1 (M1), and ceramidinase (NA); the nanoparticle core is derived from a class of iron-storing proteins widely found in organisms, consisting of a regular icosahedral structure with an inner diameter of approximately 8-10 nm and an outer diameter of approximately 12-14 nm, composed of 24 subunits.

[0009] In one aspect, the present invention provides a fusion protein comprising: (1) an influenza virus HA protein or a fragment thereof; and (2) an antigenic epitope, wherein the antigenic epitope is derived from an influenza virus protein. The influenza virus HA protein may be derived from an H1N1 strain, an H3N2 strain, or a BV strain. Preferably, the influenza virus protein is selected from M2, M1, and NA proteins. In some embodiments, the lymphocyte B or T cell epitope is derived from an antigenic epitope of M2, M1, and NA, for example, it may be derived from one or more fragments of the M2, M1, and NA proteins, respectively. Specifically, the lymphocyte B or T cell epitope may be as shown in SEQ ID NO:4, 5, and 6.

[0010] In some embodiments, the HA protein or fragment thereof is selected from: (a) an HA protein or fragment thereof derived from the H1N1 strain, comprising the amino acid sequence shown in SEQ ID NO:1 or an amino acid sequence having at least 95% identity with it (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity); (b) an HA protein or fragment thereof derived from the H3N2 strain, comprising the amino acid sequence shown in SEQ ID NO:2 or an amino acid sequence having at least 95% identity with it (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity); and (c) an HA protein or fragment thereof derived from the BV strain, comprising the amino acid sequence shown in SEQ ID NO:3 or an amino acid sequence having at least 95% identity with it (e.g., at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity).

[0011] In some embodiments, the fusion protein comprises a HA protein or a fragment thereof derived from the H1N1 strain, and epitopes derived from any one or more of M2, M1, and NA. In some embodiments, the fusion protein comprises a HA protein or a fragment thereof derived from the H3N2 strain, and epitopes derived from any one or more of M2, M1, and NA. In some embodiments, the fusion protein comprises a HA protein or a fragment thereof derived from the BV strain, and epitopes derived from any one or more of M2, M1, and NA.

[0012] In some embodiments, the fusion protein comprises an HA protein or a fragment thereof derived from an H1N1 strain and an antigenic epitope derived from M2; wherein the HA protein or fragment thereof derived from the H1N1 strain comprises the amino acid sequence shown in SEQ ID NO:1, and the antigenic epitope derived from M2 comprises the amino acid sequence shown in SEQ ID NO:4.

[0013] In some embodiments, the fusion protein comprises an HA protein or a fragment thereof derived from the H3N2 strain and an antigenic epitope derived from M1; wherein the HA protein or fragment thereof derived from the H3N2 strain comprises the amino acid sequence shown in SEQ ID NO:2, and the antigenic epitope derived from M1 comprises the amino acid sequence shown in SEQ ID NO:5.

[0014] In some embodiments, the fusion protein comprises an HA protein or a fragment thereof derived from a BV strain and an antigenic epitope derived from NA; wherein the HA protein or fragment thereof derived from the BV strain comprises the amino acid sequence shown in SEQ ID NO:3, and the antigenic epitope derived from NA comprises the amino acid sequence shown in SEQ ID NO:6.

[0015] In some embodiments, the fusion protein further comprises ferritin, preferably located at the C-terminus of the fusion protein; preferably, the fusion protein is in the form of nanoparticles; optionally, the fusion protein further comprises a signal peptide at the N-terminus. In some embodiments, the ferritin is full-length ferritin or truncated ferritin (e.g., N-terminally truncated M residues, as shown in SEQ ID NO:7).

[0016] In some embodiments, the ferritin is selected from bacterial ferritin, plant-derived ferritin, algal ferritin, fungal-derived ferritin, insect-derived ferritin, or mammalian-derived ferritin, preferably mammalian-derived or bacterial-derived ferritin. In some embodiments, the bacterial-derived ferritin is Helicobacter pylori ferritin. In some embodiments, the Helicobacter pylori ferritin has an amino acid sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the amino acid sequence shown in SEQ ID NO:7.

[0017] In some embodiments, the HA protein or fragment thereof, the antigenic epitope, is directly linked to ferritin or linked via a linker sequence selected from SGS, SGG, EAAAK, GGGGS, GGPPG, AAY, and RVRR linkers. Preferably, the linker sequence is SGG, GGGGS, or EAAAK.

[0018] In some embodiments, the fusion protein comprises: (a) the amino acid sequence or a fragment thereof shown in SEQ ID NO:1, 2 or 3; (b) the amino acid sequence shown in SEQ ID NO:4, 5 or 6; and (c) the amino acid sequence or a fragment thereof shown in SEQ ID NO:7.

[0019] In some embodiments, the fusion protein comprises: (a) the amino acid sequence shown in SEQ ID NO: 8, 9 or 10; (b) the amino acid sequence shown in SEQ ID NO: 12, 13 or 14; or (c) an amino acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% identity with (a) or (b).

[0020] In one aspect, the present invention provides an antigen composition comprising a first fusion protein, a second fusion protein, and a third fusion protein, wherein the first fusion protein comprises an HA protein or a fragment thereof derived from an H1N1 strain and an antigenic epitope derived from M2, the second fusion protein comprises an HA protein or a fragment thereof derived from an H3N2 strain and an antigenic epitope derived from M1, and the third fusion protein comprises an HA protein or a fragment thereof derived from a BV strain and an antigenic epitope derived from NA.

[0021] In some embodiments, the HA protein or fragment thereof derived from the H1N1 strain comprises the amino acid sequence shown in SEQ ID NO:1; the antigenic epitope derived from M2 comprises the amino acid sequence shown in SEQ ID NO:4; the HA protein or fragment thereof derived from the H3N2 strain comprises the amino acid sequence shown in SEQ ID NO:2; the antigenic epitope derived from M1 comprises the amino acid sequence shown in SEQ ID NO:5; the HA protein or fragment thereof derived from the BV strain comprises the amino acid sequence shown in SEQ ID NO:3; and the antigenic epitope derived from NA comprises the amino acid sequence shown in SEQ ID NO:6. Preferably, the first, second, and third fusion proteins are all fused with ferritin at their C-termini and are presented in the form of nanoparticles. Optionally, the first, second, and third fusion proteins are all fused with a signal peptide at their N-termini.

[0022] In some embodiments, the first, second, and third fusion proteins respectively comprise amino acid sequences as shown in SEQ ID NO:8, 9, or 10, or amino acid sequences having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity.

[0023] In one aspect, the present invention provides a vaccine composition comprising the antigen composition disclosed herein, as well as a pharmaceutically acceptable carrier and / or adjuvant.

[0024] In some embodiments, the adjuvant comprises a CpG ODN adjuvant. In some embodiments, the CpG ODN adjuvant is a CpG ODN 1009 adjuvant, for example, the CpG1009 adjuvant has the nucleic acid sequence shown in SEQ ID NO:11.

[0025] In some embodiments, the antigen composition contains 5 to 20 μg of total HA, preferably 7.5 to 15 μg of total HA, per unit dose of the vaccine composition; and the CpG1009 adjuvant contains 5 to 25 μg, preferably 20 to 25 μg.

[0026] In one aspect, the present invention provides a nucleic acid molecule that encodes any of the fusion proteins disclosed herein.

[0027] In one aspect, the present invention provides a vector comprising the nucleic acid molecules disclosed herein, such as a baculovirus vector.

[0028] In one aspect, the present invention provides a host cell comprising the nucleic acid molecules or vectors disclosed herein, optionally said host cell being an Escherichia coli cell or an insect cell.

[0029] In one aspect, the present invention provides a method for preparing the fusion protein disclosed herein, comprising the steps of: culturing host cells transfected with the vector disclosed herein under suitable conditions; and separating the fusion protein from the supernatant of the host cells.

[0030] In one aspect, the present invention provides a method for preparing an influenza virus vaccine, comprising the step of mixing the antigen composition of the present invention with an adjuvant, wherein the adjuvant is optionally CpG1009 adjuvant.

[0031] In one aspect, the present invention relates to the use of the fusion proteins or antigen compositions disclosed herein in the preparation of vaccine compositions for preventing influenza virus infection in subjects, preferably, the vaccine compositions being administered nasally to the subjects. In some embodiments, the subjects are humans or non-human animals, preferably humans. In some embodiments, the influenza virus infection is selected from H1N1 virus infection, H3N2 virus infection, and BV virus infection.

[0032] In one aspect, the present invention relates to a method for preventing influenza virus infection in a subject, comprising administering to the subject a fusion protein disclosed herein or a vaccine composition disclosed herein. Optionally, the vaccine composition comprises a CpG1009 adjuvant. The administration may be intranasal.

[0033] In one aspect, the present invention relates to the use of the fusion protein disclosed herein in the preparation of a medicament for inducing humoral and / or cellular immunity against influenza virus.

[0034] In one aspect, the present invention relates to the use of the fusion protein disclosed herein in the production of antibodies against influenza viruses. In some embodiments, the antibodies include polyclonal antibodies, monoclonal antibodies, or recombinant antibodies.

[0035] The present invention also relates to the following embodiments:

[0036] In some aspects, the present invention provides an influenza vaccine, characterized in that:

[0037] The vaccine consists of a trivalent recombinant influenza ferritin nanoparticle antigen and CpG1009 adjuvant, and is administered via nasal spray.

[0038] The trivalent recombinant influenza ferritin nanoparticle antigen comprises fusion proteins formed by ferritin and HA proteins of H1N1, H3N2, and BV influenza strains, respectively.

[0039] In some respects, the present invention provides a novel influenza vaccine antigen design scheme, characterized in that: the antigen design scheme is any combination of M2, M1, and NA influenza broad-spectrum immunoepitopes on the HA protein of H1N1, H3N2, and BV influenza strains. Attached Figure Description

[0040] Figure 1 shows a schematic diagram of the composition of three nanoparticles fused with ferritin. The HA protein of H1N1, H3N2, and BV strains, together with broad-spectrum epitopes of M2, M1, and NA, and ferritin (Ftn), form three fusion proteins. The yellow lines represent peptide linkers, and the black dashed boxes indicate the optional presence of broad-spectrum epitopes.

[0041] Figure 2 shows the SDS-PAGE detection results of HA ferritin nanoparticle antigens of H1N1, H3N2, and BV strains. Mark is a reference for molecular weight.

[0042] Figure 3 shows the expression of H1N1 antigen-specific IgG in Balb / c mice 28 days after secondary immunization. A two-tailed t-test was used to assess the significance of differences in IgG expression among the groups: ns: P ≥ 0.05; *: P < 0.05; **: P < 0.01; ***: P < 0.001.

[0043] Figure 4 shows the expression of H3N2 antigen-specific IgG in Balb / c mice 28 days after the second immunization. A two-tailed t-test was used to assess the statistical significance of IgG expression differences among groups: ns: P ≥ 0.05; *: P < 0.05; **: P < 0.01; ***: P < 0.001.

[0044] Figure 5 shows the expression of BV antigen-specific IgG in Balb / c mice 28 days after the second immunization. A two-tailed t-test was used to assess the statistical significance of IgG expression differences among groups: ns: P ≥ 0.05; *: P < 0.05; **: P < 0.01; ***: P < 0.001.

[0045] Figure 6 shows the expression of H1N1 hemagglutination inhibition antibody in Balb / c mice 28 days after secondary immunization.

[0046] Figure 7 shows the expression of H3N2 hemagglutination inhibition antibody in Balb / c mice 28 days after secondary immunization.

[0047] Figure 8 shows the expression of BV hemagglutination inhibition antibody in Balb / c mice 28 days after secondary immunization.

[0048] Figure 9 shows the percentage change in body weight of Balb / c mice after challenge with the H1N1 influenza strain when immunized with a trivalent influenza nanoparticle vaccine antigen ratio of H1:H3:BV of 2:2:2.

[0049] Figure 10 shows the percentage change in body weight of Balb / c mice after challenge with the H1N1 influenza strain when immunized with a trivalent influenza nanoparticle vaccine antigen ratio of H1:H3:BV of 2:1:3.

[0050] Figure 11 shows the expression of hemagglutination inhibition antibodies in Balb / c mice 28 days after a single immunization with the nasal spray trivalent influenza nanoparticle vaccine.

[0051] Figure 12 shows the expression of antigen-specific IgG in Balb / c mice 28 days after a single immunization with a nasal spray trivalent influenza nanoparticle vaccine.

[0052] Figure 13 shows the percentage change in body weight of Balb / c mice after challenge with H1N1 influenza virus 35 days after a single immunization with a nasal spray trivalent influenza nanoparticle vaccine with CpG1009 adjuvant.

[0053] Figure 14 shows the percentage change in body weight of Balb / c mice after challenge with H1N1 influenza virus 35 days after a single immunization with a nasal spray trivalent influenza nanoparticle vaccine with CpG1009 adjuvant.

[0054] Figure 15 shows the survival curves of Balb / c mice challenged with H1N1 influenza virus 35 days after a single immunization with nasal spray trivalent influenza nanoparticle vaccines with and without CpG adjuvant.

[0055] Invention Details

[0056] In this invention, unless otherwise stated, all scientific and technical terms used herein have the same meaning as commonly understood by those skilled in the art. All patents, patent applications, and other publications cited herein are incorporated herein by reference in their entirety. Furthermore, the terms and laboratory procedures related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and immunology used herein are widely used terms and routine procedures in their respective fields. If any definition presented herein conflicts with a definition presented in a patent, patent application, or other publication incorporated herein by reference, the definition presented herein shall prevail.

[0057] Unless the context otherwise requires, singular terms shall include plural terms, and plural terms shall include singular terms. More specifically, as used in this specification and the appended claims, unless the context explicitly indicates otherwise, the singular forms “a,” “an,” and “the” include plural indicators. Thus, for example, reference to “a protein” includes multiple proteins; reference to “a cell” includes a mixture of cells, etc. In this application, unless otherwise stated, the use of “or” means “and / or.” Furthermore, the use of the term “comprising” and other forms such as “including” and “containing” is not restrictive. Moreover, the scope provided in the specification and the appended claims includes all values ​​between endpoints.

[0058] As used herein, the term "vector" refers to a nucleic acid medium in which polynucleotides can be inserted. When a vector allows the expression of a protein encoded by the polynucleotides inserted therein, the vector is called an expression vector. A vector can express a carried genetic material element in a host cell by transformation, transduction, or transfection. Vectors are well known to those skilled in the art and include, but are not limited to, plasmids, bacteriophages, kinases, artificial chromosomes such as yeast artificial chromosomes (YAC), bacterial artificial chromosomes (BAC), or P1-derived artificial chromosomes (PAC); bacteriophages such as λ phage or M13 phage; and animal viruses. Animal viruses that can be used as vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, and multivacuolar papillomaviruses (such as SV40). A vector may contain multiple elements for controlling expression, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. In addition, a vector may contain an origin of replication.

[0059] The "percentage (%) amino acid sequence identity" relative to a reference peptide sequence is defined as the percentage of identical amino acid residues in the candidate sequence to those in the reference peptide sequence after the sequences have been aligned (and vacancies have been introduced where necessary) to obtain the maximum percentage sequence identity, without considering any conserved substitutions as part of the sequence identity. Sequence alignment can be performed using various methods in the art to determine the percentage amino acid sequence identity, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN, or DNASTAR software. Those skilled in the art can determine suitable parameters for measuring the alignment, including any algorithm required to obtain the maximum alignment of the full length of the sequences being compared. When percentages of sequence identity are mentioned in this application, unless otherwise specifically stated, these percentages are calculated relative to the full length of a longer sequence. The calculation relative to the full length of a longer sequence applies to both nucleic acid sequences and peptide sequences.

[0060] As used herein, the term "operably linked" (or denoted by "-") refers to the juxtaposition (with or without spacers, adapters, or insert sequences) of two or more biological sequences of interest in a relationship that allows them to function in the intended manner. When used in relation to peptides, it refers to the linking of peptide sequences in a manner that allows the linked products to have the intended biological function. The operably linked sequence can be a direct linking of two parts or a linking via adapters such as peptide adapters.

[0061] The term "vector," as used herein, refers to a nucleic acid molecule capable of replicating another nucleic acid linked to it. This term includes vectors that function as self-replicating nucleic acid structures as well as vectors that bind to the genome of a host cell that has already been introduced therein. Some vectors are capable of directing the expression of nucleic acids operatively linked to them.

[0062] As used herein, the term "fusion protein" refers to a polypeptide having two (or more) parts operatively linked together, each part being a polypeptide with different properties. The parts may be directly linked by a single peptide bond or by a peptide linker containing one or more amino acid residues. In some embodiments, the fusion protein is a fusion protein of influenza virus HA protein or a fragment thereof, an antigenic epitope, and ferritin, wherein the antigenic epitope is an epitope derived from influenza virus protein, preferably selected from influenza virus M2, M1, or NA proteins.

[0063] As used herein, the term "humoral immunity" refers to the immune mechanism that achieves protection through the production of antibodies by plasma cells (i.e., effector B cells). When receptor molecules on the surface of B cells come into contact with antigens, they are activated, producing plasma cells and memory B cells. Plasma cells then produce specific antibodies that can bind to the antigens. Methods for detecting humoral immunity include, but are not limited to, serum immunoglobulin (Ig) assays and secretory IgA (SIgA) assays. SIgA is mainly distributed in exocrine secretions such as saliva, tears, gastrointestinal fluids, breast milk, and respiratory secretions, and is a major antibody in human mucosal immunity.

[0064] As used in this article, the term "cellular immunity" refers to the action of immune cells in clearing foreign substances, including natural killer (NK) cells and antibody-dependent cell-mediated cytotoxic cells (ADCCs) such as macrophages. Cellular immunity includes both killer (K) cells and T cell-mediated cellular immunity. Among these, T cell-mediated cellular immunity is specific cellular immunity, mainly involving CD4+. + T cell response and CD8 + T-cell response. Cellular immunity can be detected by measuring the cytokines or cytotoxic substances produced.

[0065] As used herein, the terms “subject” and “patient” are used interchangeably and refer to any living organism, including humans and animals.

[0066] As used herein, the term "immunogenicity" refers to the ability of an antigen to stimulate the body to form specific antibodies or sensitized lymphocytes. For influenza vaccines, the main evaluation indicators are the virus strain-specific hemagglutination inhibition (HAI) antibody titer and serum antibody seroconversion rate. Those skilled in the art are familiar with the methods for determining hemagglutination inhibition (HAI) antibody titers and serum antibody seroconversion rates.

[0067] As used in this article, the term "valence" in relation to vaccines refers to the number or types of serotypes of the same pathogen that the vaccine targets. For example, a vaccine containing antigens of three influenza viruses—H1N1, H3N2, and Victoria—is a trivalent influenza vaccine.

[0068] Nanoparticle vaccines and ferritin

[0069] Nanoparticle vaccines are a general term for novel vaccines that use nanoparticles (NPs) as carriers or adjuvants. They represent a key area of ​​current vaccine development and include liposome nanoparticle (LNP) vaccines, metallic nanoparticle (NP) vaccines, and protein nanoparticle (NP) vaccines. Nanoparticles are micro-particles with diameters ranging from 1 to 100 nm, either artificially manufactured or naturally formed. Nanoparticle vaccines offer advantages in antigen presentation, antigen assembly, and lymph node accumulation.

[0070] Several types of protein nanoparticles made from naturally derived proteins have been used for antigen delivery. Ferritin (Ftn) is a class of soluble proteins widely distributed in organisms, playing a crucial role in iron metabolism. Ferritin is a hollow protein shell (12-14 nm outer diameter, 8-10 nm internal diameter) with highly conserved secondary and tertiary structures composed of 24 subunits. Ferritin is found in almost all organisms, including bacteria, fungi, plants, and animals. Ferritin in vertebrates and mammals consists of two subunits (H and L), while ferritin molecules isolated from plants and bacteria contain only H-type chains. Ferritin can self-assemble in vitro into 24-mers with a diameter of approximately 12-14 nm. The self-assembled nanoparticle materials exhibit good biocompatibility and uniform and stable particle size. Nanoscale macromolecules possess very strong antigenicity. Using ferritin as a carrier for antigenic epitopes, through its self-assembly, antigens can be displayed on the surface of ferritin nanoparticles, enhancing their immune activity. In addition, ferritin can be modified by chemical methods or genetic engineering. For example, viral peptides can be fused to the N-terminus of the ferritin subunit, and the resulting protein has a ferritin nanostructure.

[0071] In some embodiments, ferritin from Helicobacter pylori (H. pylori) is used to prepare nanoparticles for the influenza vaccine composition. H. pylori ferritin is a natural and safe self-assembling nanocarrier and mucosal adjuvant; however, its nasal mucosal self-adjuvant activity after intranasal administration has not been sufficiently studied. The inventors have found that it exhibits superior immunomodulatory activity when used to display and deliver the fusion antigen of the present invention and is suitable for intranasal administration.

[0072] Influenza virus and antigens

[0073] Influenza virus (IV) belongs to the Orthomyxoviridae family. It is a single-stranded, negative-sense, segmented RNA virus that can cause seasonal or pandemic influenza in humans and other animals. Based on its nucleoprotein and matrix protein, it is classified into four types: A, B, C, and D (or A, B, C, D). Types A, B, and C influenza viruses (IAV, IBV, ICV) can spread among humans. Compared to influenza C virus, influenza A virus can cross-spread between different species, causing large-scale outbreaks and epidemics; influenza B virus mainly infects humans, causing localized epidemics. Hemagglutinin (HA) and neuraminidase (NA), distributed on the viral envelope, play crucial roles in viral infection and replication. Based on the genetic and antigenic characteristics of HA and NA, influenza A viruses can be divided into 18 H subtypes (H1-H18) and 11 N subtypes (N1-N11), while influenza B viruses are divided into two antigenic lineages: the Victoria lineage (V lineage, BV) and the Yamagata lineage (Y lineage, BY). For example, influenza A virus subtypes include, for instance, H1N1 and H3N2.

[0074] The genetic material of influenza A and B viruses consists of eight segments, while that of influenza C viruses consists of seven segments. Segments 1, 2, and 3 encode RNA polymerases, including PA, PB1 (polymerase basic 1), and PB2, responsible for transcription and replication of the viral RNA. Segment 4 encodes HA, responsible for viral invasion. Segment 5 encodes nucleoproteins (NPs), responsible for assembly with the RNA. Segment 6 encodes NA, responsible for viral release. Segment 7 encodes matrix protein 1 (M1) and matrix protein 2 (M2), responsible for forming the viral matrix protein layer. Segment 8 encodes non-structural proteins (including NS1 and NS2), whose functions are related to RNA exit from the nucleus and antagonizing the host's antiviral response. Influenza C virus lacks segment 6; its segment 4 encodes the hemagglutinin esterase fusion protein (HEF), which performs both viral invasion and release functions.

[0075] Because influenza virus replication lacks the involvement of RNA proofreading enzymes, RNA polymerase makes errors approximately every 10,000 nucleotides replicated, resulting in a higher mutation rate compared to other viruses. Furthermore, the segmented nature of the influenza virus genome allows for gene reassortment when different types and subtypes of the virus simultaneously infect a single cell, leading to significant mutations in the viral genome. In addition, to address antigenic drift and shifts in influenza viruses, seasonal influenza vaccines need to be updated annually to match circulating strains. Therefore, developing a broad-spectrum universal influenza vaccine, particularly a safe and effective intranasal universal influenza vaccine, to achieve cross-protection against different influenza viruses is essential.

[0076] To develop a universal influenza vaccine, this invention utilizes hemagglutinin HA (highly abundant) and epitope regions of highly conserved antigens such as M2, M1, and NA from the influenza virus as immunogens to induce a cross-protective T-cell immune response in response to influenza virus mutations. Matrix protein 2 (M2) is a protein specific to influenza A virus. The extracellular functional domain (M2 ectodomain, M2e) of influenza A virus M2 comprises 24 amino acids. M2e is almost completely conserved across all influenza A virus subtypes and can serve as an antigen for a broad-spectrum influenza A vaccine; that is, developing a universal vaccine using M2e can prevent infection from all subtypes of influenza A virus. Neuraminidase (NA) is another major glycoprotein on the surface of the influenza virus. By cleaving viral sialic acid receptors on the host cell membrane, it promotes the release of viral particles and prevents the accumulation of progeny viruses on the cell surface, playing a crucial role in viral transmission. NA proteins can induce the body to produce NA-specific antibodies, which are cleared through antibody-dependent cell-mediated cytotoxicity (ADCC) and complement-dependent cytotoxicity (CDC), playing an important role in inhibiting viral transmission and controlling influenza infection. NA has a lower antigenic drift frequency than HA, providing a broader range of protection and making it an ideal antigen for universal influenza vaccines. The partial amino acid sequence of the M1 antigen is highly conserved among influenza A viruses and mainly induces cellular immunity in the host, particularly cytotoxic T lymphocyte (CTL) responses. The extracellular functional region M2e of influenza A virus M2 mainly induces humoral immunity. HA proteins are homotrimeric transmembrane glycoproteins on the viral envelope surface. Each monomer consists of two disulfide-linked glycosylated polypeptides, HA1 and HA2, which constitute two structurally distinct domains: a globular head domain composed of part of HA1, and a stem domain composed of part of HA1 and all of HA2. The head domain contains numerous dominant epitopes and has strong immunogenicity, but varies greatly among different influenza virus strains, while the stem domain is highly conserved among influenza virus strains.

[0077] In some embodiments, an antigen for use in an influenza vaccine composition is prepared using one or more of the following proteins: M1 protein, M2 protein, HA protein, and NA protein, and fragments or portions thereof (e.g., M2e, HA2). Preferably, the antigen is prepared using a combination of two, more preferably three, and even more preferably four of the aforementioned proteins and their fragments or portions. The proteins may be derived from various influenza A virus subtypes such as H1N1 and H3N2, and influenza B viruses such as BV and BY.

[0078] Recombinant influenza fusion protein antigen

[0079] This invention provides one or more fusion proteins that can be used as influenza virus antigens in the preparation of vaccine compositions. In some embodiments, the fusion protein comprises two or more portions of a highly conserved protein derived from the influenza virus that are operatively linked. Preferably, the fusion protein is further fused to or operatively linked to ferritin, which can act as a nanocarrier to display antigenic epitopes on the surface of ferritin nanoparticles.

[0080] In some embodiments, the fusion protein comprises: (1) a portion or all of the influenza virus HA protein, and (2) an epitope derived from the influenza virus M2, M1, and NA proteins. For example, the epitope may be derived from the M2, M1, or NA proteins. The (1) and (2) portions may be directly linked or operatively linked via a adapter. The fusion protein may comprise multiple identical or different epitope portions. Optionally, the fusion protein further comprises a signal peptide sequence or other tag sequence at its N-terminus that facilitates expression or purification. Preferably, the fusion protein is further fused to ferritin at its C-terminus. Such fusion proteins containing ferritin are also referred to herein as HA ferritin nanoparticle antigens.

[0081] The influenza virus protein can be a human, avian, or swine influenza virus protein. It can be a human, avian, or swine influenza virus protein and its mutated amino acid sequence obtained through artificial synthesis or genetic engineering techniques. Without affecting the immunogenicity of the protein, the present invention also includes the corresponding influenza virus protein mutated by at least one amino acid. The epitope can be derived from highly conserved proteins of different influenza virus strains, such as influenza A and influenza B viruses, such as M2, M1, or NA proteins. In some embodiments, the HA protein portion of the influenza virus is derived from influenza viruses selected from H1N1, H3N2, and BV. More specifically, the HA proteins of H1N1, H3N2, and BV strains are shown in SEQ ID NO:15, 16, and 17, respectively; therefore, the HA protein portion of the fusion protein may comprise or consist of fragments of SEQ ID NO:15, 16, and 17.

[0082] In some embodiments, the fusion protein comprises (1) a portion of the HA protein derived from influenza virus H1N1, and (2) an epitope derived from the influenza virus M2 protein. In some embodiments, the influenza virus HA protein is the H1N1 strain HA protein (denoted as H1N1-HA) having an amino acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with the amino acid sequence shown in SEQ ID NO:1. In some embodiments, the epitope has an amino acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with the amino acid sequence shown in SEQ ID NO:4. The fusion protein may have, for example, the sequence shown in SEQ ID NO:12.

[0083] In some embodiments, the fusion protein comprises (1) a portion of the influenza virus HA protein derived from influenza virus H3N2, and (2) an epitope derived from the influenza virus M1 protein. In some embodiments, the influenza virus HA protein is the H3N2 strain HA protein (denoted as H3N2-HA) having an amino acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with the amino acid sequence shown in SEQ ID NO:2. In some embodiments, the epitope has an amino acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with the amino acid sequence shown in SEQ ID NO:5. The fusion protein may have, for example, the sequence shown in SEQ ID NO:13.

[0084] In some embodiments, the fusion protein comprises (1) a portion of the influenza virus HA protein derived from influenza virus BV, and (2) an epitope derived from the influenza virus NA protein. In some embodiments, the influenza virus HA protein is the BV strain HA protein (denoted as BV-HA) having an amino acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with the amino acid sequence shown in SEQ ID NO:3. In some embodiments, the epitope has an amino acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with the amino acid sequence shown in SEQ ID NO:6. The fusion protein may have, for example, the sequence shown in SEQ ID NO:14.

[0085] As described above, the fusion protein may further include (3) ferritin, preferably located at the C-terminus of the fusion protein. The ferritin may be full-length ferritin or truncated ferritin, such as monomeric subunits of full-length ferritin or truncated ferritin. In some embodiments, the ferritin may include bacterial ferritin, plant-derived ferritin, algal ferritin, fungal-derived ferritin, insect-derived ferritin, or mammalian-derived ferritin, preferably mammalian-derived ferritin or bacterial-derived ferritin. Preferably, the mammalian-derived ferritin includes human ferritin, murine ferritin, or equine spleen ferritin. Preferably, the bacterial-derived ferritin includes Helicobacter pylori ferritin or Escherichia coli ferritin. In some embodiments, the ferritin is Helicobacter pylori ferritin, having an amino acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with the amino acid sequence shown in SEQ ID NO:7.

[0086] In the fusion protein, the portions or fragments can be directly linked or operably linked via adapters. The adapters can be flexible or non-flexible adapters conventionally used in the art, or adapters for epitope linkage. In some embodiments, the adapter is a peptide adapter having any of the following sequences: SGG, SGS, EAAAK, GGGGS, AAY, GGPPG, KK, and RVRR adapters. In some embodiments, the adapter sequence is SGG, GGGGS, or EAAAK.

[0087] In one embodiment, the fusion protein comprises H1N1-HA or a fragment thereof operably linked from the N-terminus to the C-terminus, an epitope derived from the M2 protein, and ferritin denoted as HA(H1N1)-M2e-Ftn, and having an amino acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with the amino acid sequence shown in SEQ ID NO:8.

[0088] In one embodiment, the fusion protein comprises H3N2-HA or a fragment thereof operably linked from the N-terminus to the C-terminus, an epitope derived from the M1 protein, and ferritin, denoted as HA(H3N2)-M1-Ftn, and having an amino acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with the amino acid sequence shown in SEQ ID NO:9.

[0089] In one embodiment, the fusion protein comprises BV-HA or a fragment thereof operably linked from the N-terminus to the C-terminus, an epitope derived from an NA protein, and ferritin, denoted as HA(BV)-NA-Ftn, and having an amino acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with the amino acid sequence shown in SEQ ID NO:10.

[0090] Compositions containing fusion proteins

[0091] The present invention also provides a composition (e.g., a vaccine composition or an antigen composition) comprising any one or a combination of the fusion proteins described above. Preferably, the composition comprises multiple fusion proteins to achieve cross-protection against different influenza viruses.

[0092] In some embodiments, the composition comprises three fusion proteins, wherein the first fusion protein comprises an HA protein moiety derived from H1N1 and an epitope derived from M2 protein, the second fusion protein comprises an HA protein moiety derived from H3N2 and an epitope derived from M1 protein, and the third fusion protein comprises an HA protein moiety derived from BV and an epitope derived from NA protein. The three fusion proteins may be mixed in the composition in different proportions.

[0093] In some embodiments, the first fusion protein is in the form of HA(H1N1)-M2e-Ftn, the second fusion protein is in the form of HA(H3N2)-M1-Ftn, and the third fusion protein is in the form of HA(BV)-NA-Ftn. In some embodiments, the composition comprises the first, second, and third fusion proteins in equal or similar proportions. In other embodiments, the proportion of one fusion protein may be the sum of the proportions of the other two fusion proteins. In some embodiments, the composition contains a higher proportion of the third fusion protein than the first fusion protein, and a higher proportion of the first fusion protein than the second fusion protein. Unless otherwise stated herein, the proportions of the first, second, and third fusion proteins or nanoparticle antigens refer to the weight ratio of the HA antigen components contained therein. For example, a 2:1:3 ratio of the first, second, and third fusion proteins means that the weight ratio of the HA antigen components contained in the first, second, and third fusion proteins is 2:1:3, for example, the first, second, and third fusion proteins contain 10 μg, 5 μg, and 15 μg of biologically active hemagglutinin HA antigen, respectively.

[0094] In some embodiments, the composition comprises a first, second, and third fusion protein in a ratio of approximately (2±1):(2±1):(2±1), meaning the ratio of each fusion protein can vary by 50% above or below a base of 2:2:2. For example, the ratio between the first, second, and third fusion proteins can be adjusted to a range of approximately (2±1):1:3 to (2±1):3:1, or approximately 1:(2±1):3 to 3:(2±1):1, or approximately 1:3:(2±1): to 3:1:(2±1).

[0095] In some specific embodiments, the antigen composition comprises antigenic components of fusion proteins H1N1-HA-M2e-Ftn, H3N2-HA-M1-Ftn, and BV-HA-NA-Ftn, wherein H1N1-HA-M2e-Ftn, H3N2-HA-M1-Ftn, and BV-HA-NA-Ftn (which can also be represented as H1:H3:BV) are combined in a ratio of approximately 2:2:2. In some specific embodiments, the antigen composition comprises antigenic components of fusion proteins H1N1-HA-M2e-Ftn, H3N2-HA-M1-Ftn, and BV-HA-NA-Ftn, wherein H1N1-HA-M2e-Ftn, H3N2-HA-M1-Ftn, and BV-HA-NA-Ftn are combined in a ratio of approximately 2:1:3.

[0096] Methods for measuring the content of the HA antigen component in the fusion protein are known to those skilled in the art, such as measurement by single radioimmunodiffusion (SRD) (JMWood et al.: J. Biol. Stand. 5 (1977) 237-247; JMWood et al., J. Biol. Stand. 9 (1981) 317-330). Alternatively, the content of the HA antigen component can also be determined by methods such as reverse HPLC, enzyme-multiplied immunoassay technique (EMIT), SDS-PAGE, and surface plasmon resonance (SRP).

[0097] Preparation of vaccine composition

[0098] In some aspects, the present invention provides a vaccine composition comprising the fusion protein disclosed herein and a pharmaceutically acceptable carrier. Preferably, the pharmaceutically acceptable carrier is an adjuvant.

[0099] The vaccine compositions of the present invention can be prepared by mixing the fusion proteins disclosed herein with various adjuvants known in the art in a certain proportion. These adjuvants include, but are not limited to, TLR (Toll-like receptor) agonists, NOD agonists, CLR (C-type lectin receptor) agonists, RLR agonists, aluminum adjuvants (e.g., aluminum hydroxide, aluminum phosphate), squalene-containing oil-in-water emulsions (e.g., MF59), AS adjuvant systems (e.g., AS01, AS03, AS04), saponin adjuvants, α-galactosylceramide-derived adjuvants, and polysaccharide adjuvants.

[0100] In some embodiments, the adjuvant comprises an agonist adjuvant, such as a TLR agonist adjuvant like CpG ODN. CpG ODN, as an agonist of Toll-like receptor 9 (TLR9), can stimulate TLR9-expressing cells and activate downstream innate immune response pathways. On the one hand, it induces type I and type III interferon expression in plasmacytoid dendritic cells; on the other hand, it activates B cells, promoting the secretion of inflammatory factors, thereby enhancing humoral and cellular immune responses. It can be taken up by endosomes, causing increased interferon secretion, and effectively activates antigen-specific T cells by promoting antigen cross-presentation. In some specific preferred embodiments, the CpG ODN is CpG1009, which has the nucleotide sequence of SEQ ID NO:11. More specifically, the nucleotides in the nucleotide sequence are fully thiolated.

[0101] In one aspect, the present invention provides CpG ODN (especially CpG1009) for the preparation of influenza virus vaccine compositions, particularly for the preparation of nasal vaccine compositions. The inventors have discovered that CpG ODN (especially CpG1009) can significantly enhance the immunogenicity of antigens. Vaccine compositions derived by combining CpG1009 adjuvant with the fusion protein described herein exhibit a strong ability to induce specific humoral and cellular immunity.

[0102] Suitablely, the vaccine composition of the present invention can be prepared in a vaccine dose volume of 0.1 mL to 1 mL, preferably 0.2 mL, 0.25 mL, or 0.5 mL. The dose volume can be slightly adjusted according to the HA concentration in the original bulk sample and according to the delivery route of administering a smaller dose via intranasal or intradermal route. For example, the vaccine composition of the present invention contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 μg HA per influenza virus strain, or no more than 15 μg HA per strain. The small amount of HA can be as low as practically feasible, provided that it allows for the formulation of vaccines that meet Chinese or international (e.g., EU or FDA) efficacy standards. For example, a low amount of HA can be 1 to 7.5 μg HA per influenza virus strain, suitably 1.25 to 7.5 μg HA per influenza virus strain, such as 2.5, 5, or 7.5 μg HA per influenza virus strain.

[0103] Administration of vaccine composition

[0104] The vaccine compositions of the present invention can be administered via any suitable route of delivery, such as intradermal, mucosal (e.g., intranasal), oral, intramuscular, or subcutaneous. Other routes of delivery are well known in the art.

[0105] Preferably, the vaccine composition of the present invention is administered nasally. Intranasal administration of recombinant protein vaccines is highly safe, and because the nasal mucosa lacks secretory enzymes and has low acidity, the required antigen dose for an effective vaccine is relatively low, making it an attractive route of administration. Following intranasal immunization, a strong immune response can be induced in the reproductive and respiratory tracts due to the activation of the common mucosal immune system.

[0106] The vaccine composition of the present invention can be applied topically to the nasopharyngeal region without being inhaled into the lungs. Preferably, an intranasal delivery device is used to deliver the vaccine composition to the nasopharyngeal region without entering or substantially avoiding the lungs. Suitable devices for intranasal administration of the vaccine composition of the present invention are spray or drop devices. Suitable commercially available nasal spray devices include Accuspray. TM(Becton Dickinson). Nasal spray devices suitable for intranasal administration are those whose performance is independent of the pressure applied by the user. These devices are called pressure threshold devices. The liquid is released from the nozzle only when a threshold pressure is applied. These devices make it easier to achieve a spray with a regular droplet size.

[0107] Methods for establishing strong and durable immunity typically involve repeated immunization, i.e., strengthening the immune response by administering one or more further doses. The vaccine composition of the present invention can be used in multi-dose administration regimens, such as two- or three-dose administration regimens. The doses administered in different doses of said multi-dose administration regimen can be the same or different. The interval between two or three administrations can be two weeks to six months, for example, three weeks to three months. Regular, long-term booster doses can also be provided, for example, every 2 to 10 years.

[0108] The vaccine compositions of the present invention are particularly suitable for nasal administration. Generally, purified protein antigens eliminate safety concerns for individuals with egg allergies, minimize side effects, and can be produced rapidly and cost-effectively. However, soluble protein vaccines exhibit poor immunogenicity when administered intranasally due to the demanding and tolerable mucosal environment. Choosing appropriate formulations and adjuvants is crucial for successful intranasal vaccines. The inventors have unexpectedly discovered that the vaccine compositions of the present invention, especially when combined with CpG1009, can also efficiently induce a strong immune response when administered intranasally. The fusion protein or fusion protein nanoparticles of the present invention achieve a synergistic effect when combined with the CpG1009 adjuvant.

[0109] Polynucleotides, vectors and host cells

[0110] In some aspects, the present invention also provides polynucleotides encoding the fusion proteins disclosed herein. These polynucleotides can be used to express the fusion proteins. The polynucleotides encoding the fusion proteins are isolated and sequenced using conventional procedures known in the art. The polynucleotides can also be obtained by synthetic methods. Preferably, the polynucleotides are codon-optimized for expression in eukaryotic host cells, such as insect and mammalian cells.

[0111] Using known recombination techniques, polynucleotides encoding fusion proteins can be inserted into vectors for further cloning (DNA amplification) or expression. Vector components typically include, but are not limited to, one or more of the following: signal sequences, origin of replication, one or more marker genes, enhancer elements, promoters (e.g., SV40, CMV, EF-1α), and transcription termination sequences.

[0112] In some embodiments, the present invention provides a vector (e.g., an expression vector) comprising a polynucleotide encoding a fusion protein provided herein, at least one promoter (e.g., SV40, CMV, EF-1α) operatively linked to said polynucleotide, and at least one selection marker. Examples of vectors include, but are not limited to, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (e.g., herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, papillomaviruses (e.g., SV40), λ phages, and M13 phages, liposomes, plasmids pcDNA3.3, pMD18-T, pOptivec, pCMV, pEGFP, pIRES, pQD-Hyg-GSeu, pALTER, pBAD, pcDNA, pCal, pL, pET, and pGEM. EX, pGEX, pCI, pEGFT, pSV2, pFUSE, pVITRO, pVIVO, pMAL, pMONO, pSELECT, pUNO, pDUO, Psg5L, pBABE, pWPXL, pBI, p15TV-L, pPro18, pTD, pRS10, pLexA, pACT2.2, pCMV-SCRIPT.RTM, pCDM8, pCDNA1.1 / amp, pcDNA3.1, pRc / RSV, PCR 2.1, pEF-1, pFB, pSG5, pXT1, pCDEF3, pSVSPORT, pEF-Bos, etc.

[0113] Vectors containing a multinucleotide sequence encoding a fusion protein can be introduced into host cells for cloning or gene expression. Suitable host cells for cloning or expressing DNA in the vectors described herein can be prokaryotes, yeast, or higher eukaryotic cells. Suitable prokaryotes for this purpose include eubacteria, such as Gram-negative or Gram-positive bacteria, like *Escherichia coli*. In some preferred embodiments, the fusion protein of the present invention is expressed in high yield using *Escherichia coli* DH10Bac-ΔCP-VN, deposited on November 15, 2021, at the China General Microbiological Culture Collection Center (CGMCC, No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing), accession number 23911.

[0114] Besides prokaryotes, eukaryotic microorganisms such as filamentous fungi or yeasts are suitable cloning or expression hosts for the provided vectors. Saccharomyces cerevisiae or common baker's yeast are among the most commonly used lower eukaryotic host microorganisms. Suitable host cells for expressing the fusion protein provided herein can also be derived from multicellular organisms. Examples of invertebrate cells include plant and insect cells. In some embodiments, the host cell is Chinese hamster ovary (CHO) cells. In some other embodiments, the host cell is other mammalian cell lines, such as human cell lines. In some other embodiments, the host cell is insect cells. In some preferred embodiments, the fusion protein of the present invention is expressed in high yield using sf9-RF insect cells deposited on December 27, 2021, at the China General Microbiological Culture Collection Center (CGMCC, No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing), accession number 45028. In some preferred embodiments, the fusion protein of the present invention is expressed in high yield using High Five-NV free insect cells deposited on June 21, 2021, at the China General Microbiological Culture Collection Center (CGMCC, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing) with accession number 22356.

[0115] The fusion protein of this invention can be obtained using an insect baculovirus expression vector system (BEVS). BEVS is an expression system that uses insect baculovirus as the exogenous gene vector and insects and insect cells as recipients. Insect cells and mammals exhibit similar patterns and capabilities in translation and post-translational protein modification, including glycosylation, phosphorylation, acylation, signal peptide excision, and peptide cleavage and degradation. The resulting recombinant protein exhibits similar antigenicity, immunogenicity, and functional bioactivity to the natural protein; it can accommodate large-molecule inserts; and it is easily mass-produced at low cost. Commonly used BEVS systems include, for example, the Bac-to-Bac system, the BaculoDirect system, the BacPAK6 and BaculoGOLD systems, and the FlashBAC system. All of the above BEVS systems can be used to express the fusion protein of this invention.

[0116] In some embodiments, expressing the fusion protein of the present invention via a Bac-to-Bac system mainly includes the following steps: cloning the target gene into a pFastBac vector; transforming the plasmid into a bacterial strain (e.g., DH10Bac strain) to prepare a recombinant baculovirus shuttle plasmid (Bacmid); transforming the recombinant Bacmid into insect cells to prepare a recombinant baculovirus; amplifying the baculovirus, infecting the insect cells, and expressing the recombinant protein. Examples of pFastBac vectors include, but are not limited to, pFastBac1, pFastBac Dual, pFastBac HT A, pFastBac HT B, and pFastBac HT C vectors. In some embodiments, the pFastBac vector is the pFastBac1 vector. Examples of insect cells include, but are not limited to, Sf9, Sf21, and High Five (HF) cells. In some embodiments, the insect cells are Sf9 cells. In some embodiments, the insect cells are Sf9 and HF cells, wherein Sf9 is used to amplify the baculovirus, and subsequently, the obtained baculovirus is used to infect HF cells to express the recombinant protein.

[0117] The host cells were transformed using the above expression or cloning vectors to produce fusion proteins and cultured in appropriately modified conventional nutrient media to induce promoters, select transformants, or amplify genes encoding the desired sequences.

[0118] When a recombinant expression vector encoding a target protein is introduced into a host cell, the target protein is produced by culturing the host cell for a period of time to allow expression within the host cell or by secreting the target protein into the culture medium in which the host cell is cultured. The target protein can be recovered from the culture medium using standard protein purification methods.

[0119] Influenza virus infection, or related illnesses or symptoms

[0120] In one aspect, the present invention also provides the use of the composition in the preparation of a medicament for the prevention or treatment of influenza virus infection. The medicament may be a vaccine.

[0121] Influenza A, B, and C viruses can cause acute respiratory infections, namely influenza (flu). Influenza patients and asymptomatic carriers are the main sources of infection for seasonal influenza. The influenza virus is primarily transmitted through respiratory droplets produced by sneezing and coughing, and can also be transmitted through direct or indirect contact with mucous membranes such as the mouth, nose, and eyes. In certain places, such as crowded and poorly ventilated rooms, it can also be transmitted through aerosols. Influenza virus infection can cause symptoms including acute fever, muscle pain, headache, sore throat, cough, and runny nose. Different strains of influenza A and B viruses lead to the regular seasonal outbreaks of influenza.

[0122] The viruses that cause seasonal influenza epidemics are mainly the H1N1 and H3N2 subtypes of influenza A virus and the Victoria lineage of influenza B virus. Influenza C virus can infect humans, dogs, and pigs, causing only sporadic cases of upper respiratory tract infection. Because influenza viruses are prone to mutation, the circulating influenza strain may change every year, making it difficult for antibodies formed through previous natural infection or immunization to effectively neutralize the virus, thus making the general population susceptible. Children are at higher risk of contracting influenza because their immune systems are not yet fully developed.

[0123] Vaccination is the best way to prevent this disease, significantly reducing the risk of contracting influenza and developing serious complications. Globally available influenza vaccines are categorized into inactivated influenza vaccines, live attenuated influenza vaccines, and recombinant influenza vaccines. Based on their components, they are divided into trivalent and quadrivalent influenza vaccines. Trivalent vaccines contain one lineage of influenza virus strains: A(H3N2), A(H1N1)pdm09, and B (Victoria). Quadrivalent vaccines contain one lineage of influenza virus strains: A(H3N2), A(H1N1)pdm09, and B (Victoria) and B (Yamagata). Based on manufacturing processes, they can be classified as chicken embryo-based, cell culture-based, and recombinant influenza vaccines. Specific vaccine types include standard-dose split influenza vaccines and subunit inactivated vaccines based on chicken embryo culture, cell culture-based inactivated influenza vaccines, recombinant influenza vaccines, live attenuated influenza vaccines, high-dose inactivated influenza vaccines based on chicken embryo culture, and adjuvanted inactivated influenza vaccines. For influenza vaccines other than live attenuated vaccines, their antigen content is usually expressed as the content of hemagglutinin (HA) in each antigen component, for example, containing 15.0 μg of each antigen component HA.

[0124] In another aspect, the present invention provides a method for preventing and / or treating influenza, comprising administering the vaccine composition described herein to a subject in need, such as a subject at risk of influenza infection. The subject may be poultry, mammals, and particularly humans. Human subjects may be of various ages, such as the elderly or young children.

[0125] The present invention has the following beneficial effects:

[0126] 1. This invention fuses the broad-spectrum immunogenic epitopes of influenza virus proteins with HA protein and ferritin, thereby enhancing the broad-spectrum immune activation effect of the antigen.

[0127] 2. This invention provides a method for preparing trivalent influenza nanoparticle vaccines and their applications. The adjuvant system used in conjunction with the vaccine has also been innovated, using CpG1009 as an adjuvant to simultaneously enhance humoral and cellular immunity to the antigen.

[0128] 3. The vaccine composition of the present invention involves conserved immunotopes of viral HA proteins and influenza virus antigen proteins of different subtypes, and can induce antibodies against multiple subtypes of influenza viruses.

[0129] The technical solution of the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are merely illustrative and explanatory of the present invention, and should not be construed as limiting the scope of protection of the present invention. All technologies implemented based on the above content of the present invention are covered within the scope of protection intended by the present invention. Example

[0130] Unless otherwise stated, the raw materials and reagents used in the following examples are commercially available products or can be prepared by known methods.

[0131] Example 1: Preparation of H1N1, H3N2 and BV recombinant HA ferritin nanoparticles

[0132] 1. Construction of HA ferritin nanoparticle gene plasmids for H1N1, H3N2 and BV strains

[0133] Gene fragments H1N1-HA, H3N2-HA, BV-HA, Ftn, and M2, M1, and NA protein epitopes were synthesized by GenScript Biotech Ltd. The recombinant HA ferritin nanoparticle antigen gene fragment (composed of multiple fragment sequences, detailed in Table 1) was amplified by multiple rounds of PCR (primers synthesized by Qingke Biotechnology Co., Ltd.). The pFastBac1-syn21-HBM empty vector (provided by GenScript Biotech Ltd.) was double-digested with EcoRI and KpnI to recover the large fragment. Then, the target fragment was ligated to the vector fragment using multi-fragment homologous recombination technology to construct a recombinant plasmid. Subsequently, the recombinant plasmid was transformed into *E. coli* DH5α competent cells. After screening with ampicillin-resistant LB solid medium, the transformed bacteria were expanded and cultured overnight at 37°C with shaking. The plasmid was then extracted using an endotoxin-free plasmid mini-prep kit (Tiangen Biotech (Beijing) Co., Ltd.). After sequence confirmation, it was used for the next step of fusion protein expression.

[0134] The prepared fusion proteins were in the form of HA(H1N1)-M2e-Ftn, HA(H3N2)-M1-Ftn, and HA(BV)-NA-Ftn, respectively.

[0135] Table 1: Three recombinant influenza ferritin nanoparticle fusion proteins, their components, amino acid sequences of related proteins, and CpG1009 nucleic acid sequence.

[0136] 2. Expression of fusion proteins

[0137] 1) Plasmids containing the fusion protein genes H1N1-HA-M2e-Ftn, H3N2-HA-M1-Ftn, and BV-HA-NA-Ftn, respectively, were transformed into DH10Bac competent cells. The bacterial culture was resuspended and spread on a medium containing Kan+, tetracycline, gentamicin, IPTG, and X-gal. The medium was then placed in a 37°C incubator and cultured continuously for 48 hours to observe its growth. After blue-white screening, white spots were picked and cultured by shaking. Recombinant Bacmid was then extracted using a baculovirus shuttle plasmid Bacmid mini-extraction kit (Beyotime) and sequenced for verification. The target gene was successfully transformed.

[0138] 2) Select insect Sf9 (our company) cells in the logarithmic growth phase (cell viability >90%) and seed them into 6-well plates and culture them in 908 medium (Yishengke, catalog number ZJ04F0963) at 1.6 × 10⁶ cells per well. 5 Cells were transfected and then placed in a 6-well plate at 27°C for 5–6 hours. Then, 5 μL of each plasmid was taken, followed by another 5 μL of... Add the Insect Transfection Reagent (Mirus) to 250 μL of fresh culture medium, mix, and let stand at room temperature for 20 min. Then add 260 μL of the mixture to the adherent Sf9 cells and incubate at 27°C for 5–6 days. Harvest the supernatant to obtain the P1 generation virus.

[0139] Select Sf9 cells in the logarithmic growth phase (cell viability > 90%) and seed them into T25 flasks, then culture them in 908 medium (0.8 × 10⁻⁶). 5 Cells / mL (culture volume 5mL), were incubated statically at 27℃ for 5-8 hours, then 1mL of P1 generation virus was added, and the mixture was incubated statically at 27℃ for 5-6 days. The supernatant was then harvested to obtain P2 generation virus.

[0140] Select Sf9 cells in the logarithmic growth phase (cell viability > 90%) and dilute the viable cell concentration to 2–3 × 10⁶ cells / year using 908 medium. 6 After the cells were counted at 1 / mL, they were seeded into 125mL cell shake flasks (culture volume 100mL) and passaged. 1mL of P2 generation virus was added, and the cells were incubated at 27℃ and 120rpm for 4-5 days. The supernatant was harvested to obtain P3 generation virus.

[0141] 3) Select HF-NF cells (Thermo Fisher, catalog number B85502) in the logarithmic growth phase, with a cell density of 2.0–2.5 × 10⁻⁶. 6 Cells were seeded at 0.1 MOI into IB907 medium (Yishengke, catalog number ZJ04F0963), and P3 generation virus was seeded at 0.1 MOI for fusion protein expression (cultured at 27℃, 120 rpm for 48 h). Samples were taken for virus detection (HF-NF cells seeded with P3 generation virus were sequenced and analyzed for the target gene, and no base insertions, deletions, or mutations were found. The DNA sequence of the target gene in the cells was confirmed to be completely correct after comparison with the full-length DNA sequence of the target gene).

[0142] 3. Protein sample purification and preparation process

[0143] 3.1 Clarification Process

[0144] 1) Remove solids by low-speed centrifugation and harvest cell supernatant: Fill the centrifuge bottle with the obtained cell culture medium to 85% of its maximum capacity, then balance the volume. Set the centrifuge parameters to 3000 rpm, 20 min, and 4℃. Harvest the cell supernatant, take a sample to determine the expression level and purity, and weigh the solids.

[0145] 2) High-speed centrifugation to remove trace impurities and harvest cell supernatant: The refrigerated cell supernatant was loaded into 85% of the maximum capacity of the centrifuge tube, then balanced. The centrifuge parameters were set as follows: centrifugation speed of 8000 rpm, centrifugation time of 30 min, and centrifugation temperature of 4℃. The cell supernatant was harvested, and samples were taken to test the content, turbidity, purity and endotoxin, and the recovery rate was calculated. The pH and conductivity values ​​were also measured.

[0146] 3.2 Crude Purification Process

[0147] 1) Diamond Layer 400 (Bogelon (Zhejiang) Biotechnology Co., Ltd.) packing material was used for composite mode purification, and the flow-through mode was adopted, which can effectively remove some impurities in the product.

[0148] First, sterilize the packed chromatography column with 1M NaOH and 30% isopropanol solution. Then, regenerate the column with 25mM PB, 2M NaCl, pH 7.20±0.05 solution. Equilibrate the column with 25mM PB, 100mM NaCl, pH 7.20±0.05 solution before loading the sample. After loading, use 25mM PB, 100mM NaCl, pH 7.20±0.05 solution as the eluent and collect the flow-through peak. The UV absorbance of the flow-through peak ranges from 20 to 80 mAU. Regenerate the column again with 25mM PB, 2M NaCl, pH 7.20±0.05 solution. Sterilize the column again with 1M NaOH and 30% isopropanol solution, and then preserve the column with 20% ethanol. This collected flow-through sample is the sample for the next chromatography step.

[0149] 3.3 Refining Process

[0150] 1) Anion exchange chromatography was performed using Nmacro 50Q packing material (Hangzhou Nanomicrobial Chemical Co., Ltd.) with a binding elution mode to effectively remove HCP, HCD and some product analog impurities.

[0151] 2) Disinfect the packed chromatography column with 0.5M NaOH, then regenerate the column with 25mM PB, 2M NaCl, pH 7.20±0.05. Equilibrate the column with 25mM PB, 100mM NaCl, pH 8.50±0.05 solution. Measure the sample conductivity before loading. If the conductivity is ≥13mS / cm, adjust the sample conductivity to 12±0.5mS / cm using 25mM PB, pH 8.50±0.05 solution before loading the sample. After loading, wash three column volumes with 25mM PB, 100mM NaCl, pH 8.50±0.05 solution. Elute with 25mM PB, 0.24M NaCl, pH 7.20±0.05 solution. The column was then regenerated with 25 mM PB, 2 M NaCl, and pH 7.20 ± 0.05, and then sterilized again with 0.5 M NaOH. The column was then stored in 20% ethanol. The collected eluted sample was used as the sample for the next chromatography step.

[0152] 3.4 Preparation of stock solution

[0153] The hollow fiber membrane column (Hangzhou Kebote Filter Material Co., Ltd.) is made of PES material, with a pore size of 300kD and a membrane area of ​​56cm². 2Concentration and buffer replacement were performed. First, the membrane column was flushed with water for injection, then sterilized with 0.5M NaOH, and then flushed again with water for injection until pH neutral. After the water flux test, the membrane column was equilibrated with a solution of 25mM PB, 150mM NaCl, and pH 7.20±0.05. Then, the concentration was reduced to one-quarter using a hollow fiber membrane column. Replacement buffer (25mM PB, 130mM NaCl, pH 7.20±0.05) was added to the original volume, and the cycle was repeated three times until the conductivity at the filter end was 17.0 mS / cm, and the concentrated protein was approximately 1 mg / mL. Finally, the column was rinsed with a solution of 25mM PB, 150mM NaCl, and pH 7.20±0.05, adding one column volume to the concentrate, until the concentration was between 0.5 and 0.7 mg / mL. After concentration, the system was rinsed with water for injection, disinfected with 0.5M NaOH, and then the membrane column was rinsed with water for injection. After integrity and water flux tests were completed, the membrane column was stored with 0.01M NaOH.

[0154] 3.5 QC Inspection

[0155] Sample size and purity were determined using SDS-PAGE and SEC-HPLC. HCD residues, HCP residues, and endotoxins were detected to ensure compliance with quality requirements. As shown in Figure 2, the sizes of the three fusion proteins were consistent with the antigen design.

[0156] Example 2: Study on the immunogenicity and protection against viral challenge of the vaccine

[0157] 1. Vaccine preparation

[0158] 1.1 CpG1009 adjuvant dilution

[0159] CpG1009 adjuvant (Nanjing Jisheng Aoma Biomedical Co., Ltd.) was diluted with sterile water to a stock solution of 5 mg / mL for subsequent vaccine preparation.

[0160] The sequence of the CpG1009 adjuvant (SEQ ID NO:11): TCGACGTTCGTCGTTCGTCGTCGT, specifically T*C*G*A*C*G*T*T*C*G*T*C*G*T*T*C*G*T*C*G*T*C*G*T*C*G*T*C*G*T (Note: * indicates thiomodification of the phosphate backbone).

[0161] 1.2 Preparation of CpG1009 adjuvant vaccine

[0162] Under aseptic conditions at room temperature, the purified fusion proteins H1N1-HA-M2e-Ftn, H3N2-HA-M1-Ftn, and BV-HA-NA-Ftn were mixed according to a ratio of 2:2:2 or 2:1:3 for the bioactive hemagglutinin HA content. The mixture was then diluted with antigen diluent (25 mM PB, 150 mM NaCl, 0.005% Tween-80, 100 mM arginine hydrochloride, 5% trehalose, pH 7.2), and an appropriate amount of CpG1009 stock solution was added. Two nasal spray vaccine compositions containing CpG adjuvant were prepared, with HA antigen content of 150 or 300 μg / mL and CpG adjuvant content of 400 μg / mL, labeled HA-np(2:2:2)+CpG1009 and HA-np(2:1:3)+CpG1009, respectively.

[0163] 1.3 Adjuvant-free vaccine formulation

[0164] The purified fusion protein antigens H1N1-HA-M2e-Ftn, H3N2-HA-M1-Ftn, and BV-HA-NA-Ftn were mixed under aseptic conditions at room temperature according to an antigen ratio of 2:2:2 or 2:1:3, and then diluted with antigen diluent (25 mM PB, 150 mM NaCl, 0.005% Tween-80, 100 mM arginine hydrochloride, 5% trehalose, pH 7.2). Two nasal spray vaccine compositions without CpG adjuvant were prepared, wherein the HA antigen content was 150 or 300 μg / mL, and they were labeled HA-np(2:2:2) and HA-np(2:1:3), respectively.

[0165] 1.4 Vaccine two-immunization and challenge experimental protocol

[0166] Female Balb / c mice were randomly divided into 9 groups of 6 mice each. The grouping and corresponding experimental protocols are shown in Table 2 below.

[0167] Animal group immunization and challenge: Groups 4-7, the trivalent antigen composition (H1:H3:BV = 2:2:2 and 2:1:3) was administered to Balb / c mice twice via intranasal immunization with either CpG1009 adjuvant or without adjuvant. The total HA immunization dose of the trivalent antigen composition was 15 μg total HA / dose, and the CpG1009 adjuvant was 20 μg / dose.

[0168] A positive control group was set up: Group 2, Dalian Yalifeng trivalent influenza vaccine, immunization dose of 15μg total HA / dose, immunization twice; Group 3, Hualan Biological quadrivalent influenza vaccine, immunization dose of 20μg total HA / dose, immunization twice;

[0169] Negative control groups were set up: H1N1 model group, CpG1009 adjuvant control group, and blank control group.

[0170] All animals were immunized once on day 0 and once on day 28. Serum samples were collected from the animals 28 days after the second immunization for hemagglutination inhibition antibody detection and antigen-specific IgG detection to assess the immunogenicity of the vaccine, as shown in Figures 3 to 8.

[0171] The H1N1 challenge group underwent a challenge experiment 31 days after the second immunization to evaluate the protective effect of the vaccine against challenge in mice. Intranasal challenge was performed using the H1N1 influenza strain (A / Victoria / 2570 / 2019(H1N1)) at a dose 10 times the LD50, with a challenge volume of 50 μL. Body weight changes in mice were monitored for 7 consecutive days post-challenge, as shown in Figures 9 and 10.

[0172] Table 2 Protocol for Two Immunization and Challenge Tests

[0173] 1.5 Single Immunization and Challenge Experimental Protocol

[0174] Female Balb / c mice were randomly divided into 9 groups of 6 mice each. The grouping and corresponding experimental protocols are shown in Table 3 below.

[0175] Animal grouping, immunization, and challenge: Groups 4-7 were immunized once with trivalent antigen (H1:H3:BV = 2:2:2) with or without CpG1009 adjuvant via intranasal immunization. The total HA dose of trivalent antigen was 7.5 and 15 μg of total HA per dose, and the CpG1009 adjuvant was 20 μg per dose.

[0176] A positive control group was set up: Group 2, Dalian Yalifeng trivalent influenza vaccine, immunization dose of 15μg total HA / dose, immunization once; Group 3, Hualan Biological quadrivalent influenza vaccine, immunization dose of 20μg total HA / dose, immunization once.

[0177] Negative control groups were set up: H1N1 model group, CpG1009 adjuvant control group, and blank control group.

[0178] All animals were immunized once on day 0. Hemagglutination inhibition antibody and antigen-specific IgG tests were performed 28 days post-immunization, as shown in Figures 11 and 12. The H1N1 challenge group underwent a challenge experiment 35 days post-immunization using the H1N1 influenza virus strain administered via nasal drops at a dose 5 times the LD50 and a volume of 50 μL. Mouse weight changes were monitored for 14 consecutive days post-challenge, as shown in Figures 13 and 14. Mice were considered dead if their weight decreased by more than 25% of their pre-challenge weight, and survival rates were calculated, as shown in Figure 15.

[0179] Table 3. Single Immunization and Challenge Test Protocol

[0180] 1.6 Blood Coagulation Inhibition Detection

[0181] The detection of hemagglutination inhibition antibodies in 1.4 and 1.5 above shall be performed as follows.

[0182] 1) Removal of nonspecific inhibin (which inhibits erythrocyte aggregation) from serum

[0183] Take 3 volumes of dissolved Vibrio cholerae receptor-destroying enzyme (RDE) and mix with 1 volume of serum (150 μL RDE + 50 μL serum), and incubate at 37°C for 18 h. Then incubate at 56°C for 30 min to inactivate any remaining RDE. Add 200 μL of physiological saline, mix well, and use 250 μL for H1N1 and BV antigen hemagglutination inhibition detection, and 150 μL for H3N2 antigen hemagglutination inhibition detection.

[0184] 2) Removal of nonspecific lectins from serum

[0185] Preparation of thick red blood cells: According to the test volume, take an appropriate amount of 1% red blood cell suspension (see Table 4 for the amount of 1% red blood cell suspension), centrifuge at 360×g for 10 min, remove the supernatant, and use a sterile pipette to remove the reflux solution adhering to the wall, leaving a thick layer of red blood cells for subsequent experiments. Thick red blood cells from turkey blood and guinea pig blood were prepared separately.

[0186] Table 4. Proportion of 1% Red Blood Cell Suspension

[0187] Add 1 volume of centrifuged concentrated red blood cells to 20 volumes of RDE-treated serum in a centrifuge tube (different types of samples should be mixed with the corresponding red blood cells, such as H1N1 and BV mixed with concentrated red blood cells from turkey blood; H3N2 mixed with concentrated red blood cells from guinea pig blood). Use a pipette to add the required volume of red blood cells to the serum, and repeat the pipetting process several times to ensure thorough mixing.

[0188] Incubate at 2–8°C for 1 hour, inverting the centrifuge tube every 15–20 minutes to resuspend and mix the deposited red blood cells (Note: the resuscitation time should be controlled within 5 minutes). Then centrifuge at 4°C and 410×g for 5 minutes; transfer the serum supernatant to a new centrifuge tube for later use (be careful not to aspirate the precipitated red blood cells).

[0189] Take out a 96-well microplate and determine the number of wells to add PBS buffer based on the amount of serum to be tested. Generally, start by adding 50 μL of PBS buffer to well A1, followed by 50 μL of RDE-treated serum for a 2-fold dilution. Transfer 50 μL of the 2-fold diluted serum to well A2 for duplicate wells. Add 50 μL of 1% erythrocyte suspension to each well (select according to the antigen required for detection: 1% turkey erythrocyte suspension for H1N1 and BV; 1% guinea pig erythrocyte suspension for H3N2). Place the 96-well microplate on a micro-shaker and shake for 15–30 seconds. Incubate at room temperature for 25–60 minutes and observe the results. If erythrocytes are deposited, it indicates that nonspecific agglutinins in the serum have been completely removed. If not, repeat the above steps.

[0190] 3) Blood coagulation titer test

[0191] Add 50 μL of PBS buffer to each well in columns 2-12 of a 96-well microhemagglutination plate. Add 100 μL of standard antigen to wells A1-G1 in column 1, and 100 μL of PBS to well H1 as a negative control for red blood cells. Aspirate 50 μL of standard antigen from each well in column 1 and perform serial dilutions (2-fold) from column 2 to column 12. Discard 50 μL from each well in the last column. If the antigen hemagglutination titer is high, it is recommended to continue increasing the dilution.

[0192] Add 50 μL of 1% red blood cell suspension to each well (select according to the antigen being tested: 1% turkey red blood cell suspension for H1N1 and BV; 1% guinea pig red blood cell suspension for H3N2). Place the 96-well microcoagulation plate on a micro-shaker and shake for 15–30 seconds to mix thoroughly. Incubate at room temperature, observe the results, and take photographs (for 96-well V-shaped microcoagulation plates, observe at a 45° angle; for negative controls, the negative control should show a teardrop-like downward flow; for 96-well U-shaped microcoagulation plates, observe the results from the front; for negative controls, the negative control should show a ring-like appearance).

[0193] Result interpretation: Complete agglutination is defined as agglutination of all red blood cells and recorded as "+"; agglutination of only some red blood cells is recorded as "+ / -"; no agglutination is recorded as "-". The hemagglutination titer is determined by the highest dilution that produces complete agglutination, and the reciprocal of this dilution is the hemagglutination titer of the antigen.

[0194] 4) Preparation of antigens with 4 hemagglutination units

[0195] One agglutination unit refers to the amount of antigen that can cause an equal amount of standardized erythrocyte agglutination. HAI titers are determined based on this. Generally, four hemagglutination units of antigen are used when performing erythrocyte agglutination inhibition tests.

[0196] When preparing antigen for 4 hemagglutination units, first calculate the total amount of antigen required for the 4 hemagglutination units needed for the erythrocyte agglutination inhibition assay. If each serum sample is diluted in 8 wells, and 25 μL of antigen is used per well, then 0.2 mL of 4 hemagglutination units of antigen is needed to measure one serum sample. Calculate the total amount of antigen required for the experiment based on the number of serum samples to be tested.

[0197] Next, calculate the antigen dilution. Divide the antigen's hemagglutination titer by 8 to obtain the antigen dilution required to prepare 4 hemagglutination units (4 hemagglutination units used in the erythrocyte agglutination inhibition assay means 4 hemagglutination units per 25 μL of antigen, which is equal to 8 hemagglutination units per 50 μL of antigen). For example, if the hemagglutination titer of an antigen is 64, dividing by 8 equals 8, then the antigen should be diluted at a ratio of 1:8 (1 mL antigen to 7 mL PBS buffer).

[0198] 5) Labeling of four hemagglutination unit antigens

[0199] To ensure consistent and accurate antigen dosage in the hemagglutination inhibition test, the newly prepared 4 hemagglutination units of antigen need to be re-titrated. The procedure is the same as for the hemagglutination titration test, and the titration results should be photographed and recorded.

[0200] If agglutination occurs in the first four wells but not in the fifth, it indicates that each 50 μL of antigen contains 8 hemagglutination units, and the antigen dilution is accurate, suitable for the erythrocyte agglutination inhibition test. If agglutination also occurs in the fifth well, it indicates that each 50 μL of antigen contains 16 hemagglutination units, and the antigen must be diluted equally. If agglutination occurs only in the first three wells, it indicates that each 50 μL of antigen contains only 4 hemagglutination units, and the antigen amount needs to be doubled. Furthermore, antigen containing 4 hemagglutination units must be prepared fresh for each use.

[0201] 6) Blood coagulation inhibition titer test

[0202] Take a 96-well microplate and add 25 μL of PBS buffer to wells 2-11 and 50 μL of PBS buffer to well 12 using a pipette.

[0203] Add 50 μL of the test serum to well 1, mix thoroughly, then transfer 25 μL to well 2, and so on, serially diluting up to well 11. Discard 25 μL from well 11. Dilute 4 hemagglutination units (A12-D12) 1:2 to 1:16; use erythrocyte controls (E12-H12). Add 25 μL of antigen (4 hemagglutination units) to each of wells A1-A11. Place the 96-well microplate on a micro-shaker and shake for 15-30 seconds to ensure thorough mixing. Let stand at room temperature for 30 minutes.

[0204] Add 50 μL of 1% turkey red blood cell suspension (suitable for H1N1, BV) or 50 μL of 1% guinea pig red blood cell suspension (suitable for H3N2) to each well from right to left. Place the 96-well microplate on a micro-shaker and shake for 15–30 s to mix thoroughly. After standing at room temperature for 25–60 min, observe the blood coagulation inhibition results.

[0205] Result determination:

[0206] (1) When the 96-well V-shaped microcoagulation plate is tilted at 45° and the negative control shows teardrops flowing downwards, take a picture from the back of the 96-well V-shaped microcoagulation plate. The hemagglutination inhibition titer of the serum is determined by the reciprocal of the highest dilution factor that completely inhibits erythrocyte aggregation.

[0207] (2) When the negative control of the 96-well U-shaped microcoagulation plate is in a ring shape, take a picture from the back of the 96-well U-shaped microcoagulation plate and determine the hemagglutination inhibition titer of the serum by the reciprocal of the highest dilution factor that completely inhibits red blood cell aggregation.

[0208] 1.7 Antigen-specific IgG ELISA detection

[0209] The antigen-specific IgG detection described in sections 1.4 and 1.5 above is performed as follows.

[0210] 1.7.1 Solution Preparation

[0211] Coating solution: Carbonate buffer (pH 9.6) (1L as an example): Weigh 1.59g sodium carbonate and 2.93g sodium bicarbonate, add ultrapure water to a final volume of 1L, filter through a 0.22μm membrane, and store at 4℃ for later use.

[0212] Washing solution: PBST (pH 7.4) (1L as an example): Weigh 8.0g sodium chloride, 0.2g potassium chloride, 3.58g disodium hydrogen phosphate dodecahydrate, and 0.27g potassium dihydrogen phosphate. Measure 0.5mL of Tween-20 and add ultrapure water to make up to 1L. Filter through a 0.22μm membrane and store at 4℃ for later use.

[0213] Blocking buffer and antibody diluent (100mL as an example): Weigh 5g of skim milk powder and dissolve it in 100mL of PBST to make the blocking buffer. Weigh 3g of skim milk powder and dissolve it in 100mL of PBST to make the antibody diluent.

[0214] Termination solution: 1M hydrochloric acid solution (120mL as an example): Measure 10mL of concentrated hydrochloric acid, add it to 110mL of water for injection, and mix well.

[0215] 1.7.2 Experimental Procedure

[0216] Coating: Dilute the HA subunit antigens of H1N1, H3N2, and BV to 1 μg / mL with coating buffer, add 100 μL / well to the microplate, cut the sealing film to an appropriate size, stretch it tightly to seal the wells of the microplate, and incubate overnight at 4°C; shake off the liquid in the microplate, wash 3 times with 200 μL / well of washing buffer, 5 min each time, and pat dry.

[0217] Blocking: Add 200 μL of the prepared blocking solution to each well, seal the plate, and incubate at 37°C for 1 hour; remove the liquid from the microplate, wash three times with 200 μL of washing buffer for 5 minutes each time, and pat dry.

[0218] Primary antibody incubation: Dilute the serum to be tested to a 1:100 concentration with antibody dilution buffer. Add 100 μL / well to the microplate, seal the plate, and incubate at 37°C for 1 h. Discard the liquid from the microplate, wash 5 times with 200 μL / well of washing buffer for 5 min each time, and pat dry.

[0219] Secondary antibody incubation: Dilute the corresponding secondary antibody 1:5000 with antibody dilution buffer, add 100 μL / well to the microplate, seal the plate, and incubate at 37℃ for 1 h; remove the liquid from the microplate, wash 5 times with 200 μL / well of washing buffer, and pat dry.

[0220] Color development: Add 100 μL of TMB color development solution per well and develop at 37℃ for 10–20 min (judgment based on color change).

[0221] Termination: Add 50 μL of stop solution per well to terminate the reaction; read the OD value on a microplate reader. 450 nm (reference wavelength 620nm) value.

[0222] 1.8 Test Results

[0223] Following two immunizations with the nasal spray trivalent influenza nanoparticle vaccine, both the nanoparticle vaccine and the one with CpG1009 adjuvant induced strong humoral immunity in mice. As shown in Figures 3, 4, and 5, analysis of antigen-specific IgG levels in each experimental group revealed that, with the addition of CpG1009 adjuvant, the humoral immunity induced by nasal spray immunization with the trivalent influenza ferritin nanoparticle vaccine was significantly superior to that induced by intramuscular injection of the positive control vaccine, and the addition of CpG1009 was significantly superior to that without. When the antigen ratio was H1:H3:BV = 2:1:3, the trivalent influenza ferritin nanoparticle vaccine without CpG1009 showed at least comparable immunizing efficacy to the positive control vaccine. As shown in Figures 6, 7, and 8, analysis of hemagglutination inhibition antibodies in each experimental group revealed that, with the addition of CpG1009 adjuvant, the trivalent hemagglutination inhibition antibodies induced by nasal spray immunization with the trivalent influenza ferritin nanoparticle vaccine were significantly superior to those induced by intramuscular injection of the positive control vaccine. Nanoparticle vaccines with different antigen ratios can all effectively induce active immunity.

[0224] Mice challenged with the H1N1 strain after two immunizations showed that the influenza nanoparticle vaccine with CpG1009 adjuvant provided better protection than the positive control vaccine. As shown in Figures 9 and 10, the influenza nanoparticle vaccine with CpG1009 adjuvant at an immunization dose of 15 μg total HA / dose provided good protection to mice, with less weight loss compared to mice immunized with the positive control influenza vaccine.

[0225] Following a single immunization with the nasal spray trivalent influenza nanoparticle vaccine, the nanoparticle vaccine with CpG1009 adjuvant induced strong humoral immunity in mice. As shown in Figure 11, analysis of the H1N1 hemagglutination inhibition titer measured in each experimental group revealed that, with the addition of CpG1009 adjuvant, the humoral immunity induced by nasal spray immunization with the trivalent influenza ferritin nanoparticle vaccine was comparable to that induced by intramuscular injection of the positive control vaccine. As shown in Figure 12, analysis of the antigen-specific IgG measured in each experimental group showed that, with the addition of CpG1009 adjuvant, the humoral immunity induced by nasal spray immunization with the trivalent influenza ferritin nanoparticle vaccine was significantly superior to that induced by intramuscular injection of the positive control vaccine, and the addition of CpG1009 was significantly superior to the addition without CpG1009.

[0226] Mice challenged with the H1N1 strain after a single immunization showed that the influenza nanoparticle vaccine with CpG1009 adjuvant provided better protection than the positive control vaccine. As shown in Figures 13 and 14, the influenza nanoparticle vaccine with CpG1009 adjuvant at immunization doses of 7.5 and 15 μg total HA per dose provided good protection in mice, with less weight loss compared to mice immunized with the positive control influenza vaccine. As shown in Figure 15, mice were considered dead if their weight loss exceeded 25% after challenge. The protection rate was defined as the survival rate. At 14 days post-challenge, the influenza nanoparticle vaccine with CpG1009 adjuvant at an immunization dose of 15 μg total HA per dose provided 100% protection against challenge in mice, while the protection rate at an immunization dose of 7.5 μg total HA per dose was 66.7%. In contrast, the protection rate of the Hualan Biological quadrivalent inactivated influenza vaccine at an immunization dose of 20 μg total HA per dose was also 66.7%.

[0227] The above results indicate that the nasal spray trivalent influenza nanoparticle vaccine with CpG1009 adjuvant prepared in this invention can induce strong hemagglutination inhibition antibodies and antigen-specific IgG, producing a superior challenge protection effect compared to commercially available trivalent and quadrivalent inactivated influenza vaccines.

[0228] The embodiments of the present invention have been described above. However, the present invention is not limited to the above embodiments. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A fusion protein comprising: (1) Influenza virus HA protein or fragments thereof; and (2) Antigenic epitope, wherein the antigenic epitope is an antigenic epitope derived from influenza virus protein, wherein the influenza virus protein is selected from M2, M1 and NA proteins.

2. The fusion protein of claim 1, wherein the antigenic epitope is selected from the following: (a) An antigenic epitope derived from the M2 protein, comprising the amino acid sequence shown in SEQ ID NO:4; (b) An antigenic epitope derived from the M1 protein, comprising the amino acid sequence shown in SEQ ID NO:5; and (c) An antigenic epitope derived from the NA protein, comprising the amino acid sequence shown in SEQ ID NO:

6.

3. The fusion protein of claim 1 or 2, wherein the HA protein or a fragment thereof is selected from the following: (a) HA protein or fragment thereof derived from H1N1 strain, comprising an amino acid sequence as shown in SEQ ID NO:1 or an amino acid sequence having at least 95% identity with it. (b) HA protein or fragment thereof derived from the H3N2 strain, comprising an amino acid sequence as shown in SEQ ID NO:2 or an amino acid sequence having at least 95% identity with it; (c) HA protein or fragment thereof derived from BV strain, comprising an amino acid sequence as shown in SEQ ID NO:3 or an amino acid sequence having at least 95% identity with it.

4. The fusion protein of claim 1, comprising: HA protein or fragments thereof derived from the H1N1 strain, comprising the amino acid sequence shown in SEQ ID NO:1; and An antigenic epitope derived from the M2 protein, comprising an amino acid sequence as shown in SEQ ID NO:

4.

5. The fusion protein of claim 1, comprising: HA protein or fragments thereof derived from the H3N2 strain, comprising the amino acid sequence shown in SEQ ID NO:2; and An antigenic epitope derived from the M1 protein, comprising an amino acid sequence as shown in SEQ ID NO:

5.

6. The fusion protein of claim 1, comprising: HA protein or fragments thereof derived from BV strains, comprising the amino acid sequence shown in SEQ ID NO:3; and The antigenic epitope is derived from the NA protein and contains the amino acid sequence shown in SEQ ID NO:

6.

7. The fusion protein according to any one of claims 1-6, further comprising ferritin, preferably said ferritin being located at the C-terminus of the fusion protein. Preferably, the fusion protein is in the form of nanoparticles. Optionally, the fusion protein further includes a signal peptide at its N-terminus.

8. The fusion protein of any one of claims 1-7, wherein the ferritin is full-length ferritin or truncated ferritin.

9. The fusion protein according to any one of claims 1-8, wherein the ferritin is selected from bacterial ferritin, plant ferritin, algal ferritin, fungal ferritin, insect ferritin or mammalian ferritin, preferably mammalian ferritin or bacterial ferritin.

10. The fusion protein of claim 9, wherein the bacterial ferritin is Helicobacter pylori ferritin.

11. The fusion protein of claim 10, wherein the Helicobacter pylori ferritin comprises an amino acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with the amino acid sequence shown in SEQ ID NO:

7.

12. The fusion protein of any one of claims 1-11, wherein the HA protein or a fragment thereof is directly linked to the antigenic epitope, or, in the presence of ferritin, to the antigenic epitope, or linked via a linker sequence, wherein the linker sequence is selected from SGS, SGG, EAAAK, GGGGS, GGPPG, and RVRR linkers, preferably, the linker sequence is SGG, GGGGS, or EAAAK.

13. The fusion protein of any one of claims 1-12, wherein the fusion protein comprises: (a) The amino acid sequence shown in SEQ ID NO: 8, 9 or 10; (b) The amino acid sequence shown in SEQ ID NO: 12, 13 or 14; or (c) An amino acid sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to (a) or (b).

14. An antigen composition comprising a first fusion protein as defined in claim 4, a second fusion protein as defined in claim 5, and a third fusion protein as defined in claim 6. Preferably, the first, second, and third fusion proteins are all fused with ferritin at their C-termini and are in the form of nanoparticles.

15. The antigen composition of claim 14, wherein the first, second and third fusion proteins each comprise an amino acid sequence as shown in SEQ ID NO:8, 9 or 10, or each comprise an amino acid sequence as shown in SEQ ID NO:12, 13 or 14.

16. A vaccine composition comprising the antigen composition of claim 14 or 15, and a pharmaceutically acceptable carrier and / or adjuvant.

17. The vaccine composition of claim 16, wherein the adjuvant comprises CpG ODN adjuvant.

18. The vaccine composition of claim 17, wherein the CpG ODN adjuvant is CpG ODN 1009 adjuvant.

19. The vaccine composition of claim 18, wherein the CpG1009 adjuvant has the nucleic acid sequence shown in SEQ ID NO:

11.

20. A nucleic acid molecule encoding the fusion protein of any one of claims 1-13.

21. A vector comprising the nucleic acid molecule of claim 20, for example, the vector being a baculovirus vector.

22. A host cell comprising the nucleic acid molecule of claim 20 or the vector of claim 21, wherein the host cell is optionally an Escherichia coli cell or an insect cell.

23. A method for preparing the fusion protein according to any one of claims 1-13, comprising the following steps: Culture host cells transfected with the vector of claim 21 under suitable conditions; and The fusion protein was isolated from the supernatant of the host cells.

24. A method for preparing an influenza virus vaccine, comprising the step of mixing the antigen composition of claim 14 or 15 with an adjuvant, wherein the adjuvant is optionally CpG1009 adjuvant.

25. Use of the fusion protein of any one of claims 1-13 or the antigen composition of claim 14 or 15 in the preparation of a vaccine composition for preventing influenza virus infection in subjects. Preferably, the vaccine composition is administered to the subject via the nose.

26. The use of claim 25, wherein the subject is a human or non-human animal, preferably a human.

27. The use according to claim 26, wherein the influenza virus infection is selected from H1N1 virus infection, H3N2 virus infection and / or BV virus infection.

28. Use of the fusion protein of any one of claims 1-13 in the preparation of a medicament for inducing humoral and / or cellular immunity against influenza virus.

29. Use of the fusion protein according to any one of claims 1-13 in the production of antibodies against influenza virus.

30. The use according to claim 29, wherein the antibody comprises a polyclonal antibody, a monoclonal antibody, or a recombinant antibody.

Images