Biomarkers, systems, methods, and kits for assessing efficacy of ibc therapies
By using circ-TMTC3 and circ-FAM117B as biomarkers and combining them with a multivariate Cox regression coefficient-weighted IBCcirSig scoring model, the instability of PD-L1 protein in predicting tumor IBC therapy was resolved, achieving more specific and stable efficacy assessment, and significantly improving the accuracy of efficacy assessment, especially in malignant tumors such as melanoma.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SUZHOU JIZHI MEDICAL CORP
- Filing Date
- 2022-04-02
- Publication Date
- 2026-04-17
AI Technical Summary
In the existing technology, the predictive ability of PD-L1 protein as a biomarker for immune checkpoint blockade therapy (IBC) is not universal and stable, resulting in poor specificity and low stability in the evaluation of the efficacy of tumor IBC treatment.
Using circ-TMTC3 and circ-FAM117B as biomarkers, the expression levels of these circRNAs in patient tumor tissues were measured, and the IBCcirSig scoring model was constructed by combining multivariate Cox regression coefficient weighting to evaluate the efficacy of tumor IBC therapy.
It improves the specificity and stability of efficacy assessment for tumor IBC therapy, enhances the accuracy of predicting patient response, and significantly improves the accuracy and stability of efficacy assessment, particularly in malignant tumors such as melanoma.
Smart Images

Figure CN114875144B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedicine, and in particular to biomarkers, systems, methods, and kits for evaluating the efficacy of tumor IBC therapy. Background Technology
[0002] Melanoma is the most common histological subtype, accounting for approximately 75% of skin cancer-related deaths worldwide, affecting 15-25 people per 100,000. The median survival for metastatic melanoma is 6-12 months. Immune checkpoint blockade (IBC) targets programmed cell death receptor 1 (PD-1) and cytotoxic T-lymphocyte antigen 4.
[0003] (CTLA-4) represents a revolutionary breakthrough in oncology. Unfortunately, only a small percentage of patients experience lasting clinical benefit from immunotherapy. There is an urgent need to identify biomarkers predicting IBC to guide precision cancer immunotherapy. circRNAs are a class of single-stranded non-coding RNAs characterized by a covalently closed circular structure, produced by backsplicing of precursor mRNA from a downstream 5' splice site to an upstream 3' splice site. circRNAs participate in various biological and cellular functions, such as tumorigenesis and epithelial-mesenchymal transition (EMT), by binding to miRNAs or proteins. Notably, recent studies have shown that circRNAs are involved in regulating various anti-tumor immune responses and immune cells. For example, hsa_circ_0020397 can bind to and inhibit miR-138 expression, thereby promoting the expression of miR-138's target protein PD-L1, leading to immune escape in colorectal cancer. circRNAs can also interact with proteins. For example, circFoxo3 can induce p53 degradation by binding to MDM2, thereby remodulating the immune response. Tumor cells may produce aberrant circRNAs and transport them to immune cells via exosomes and extracellular vesicles, suggesting a potential role for circRNAs in intercellular communication. Furthermore, there is evidence of a correlation between circRNAs and immune cell infiltration in some cancers. These studies indicate that circRNAs play an important role in the tumor microenvironment and may further predict responses to immunotherapy. Despite the increasing role of circRNAs in the immune system, an expression profile of circRNAs in cancer immunotherapy is still lacking. To date, various biomarkers associated with IBC response in melanoma have been identified, such as PD-L1 and CD8, tumor mutational burden (TMB) and neoantigens, the interferon (IFN)-γ signaling pathway, gene expression markers, and the tumor immune microenvironment.
[0004] The inventors have identified at least the following problems with existing technologies: While PD-L1 protein expression on tumor cells or immune cells is a commonly used biomarker for predicting immune checkpoint blockade therapy, its predictive ability for IBC response is not universal. Furthermore, PD-L1 expression is dynamic, altering with prior treatment and exposure to tumor-infiltrating immune cells, exhibiting spatial and temporal heterogeneity. These factors may limit its ability to differentiate patient response to immunotherapy, resulting in poor specificity and low stability in the assessment of IBC treatment efficacy. Summary of the Invention
[0005] The purpose of this invention is to provide a more specific and stable circRNA-based biomarker for evaluating the therapeutic effect of tumor IBC.
[0006] Another object of the present invention is to provide a kit for evaluating the therapeutic effect of tumor IBC.
[0007] Another object of the present invention is to provide a system and method for evaluating the treatment effect of tumor IBC.
[0008] To address the aforementioned technical problems, the first aspect of this invention provides a set of biomarkers for evaluating the efficacy of tumor IBC therapy, said biomarkers including circ-TMTC3 and / or circ-FAM117B.
[0009] In some preferred embodiments, the evaluation is a pre-evaluation.
[0010] In some preferred embodiments, the biomarkers include circ-TMTC3 and circ-FAM117B; wherein the nucleic acid sequence of circ-TMTC3 is at least partially identical to SEQ ID NO:1; and the nucleic acid sequence of circ-FAM117B is at least partially identical to SEQ ID NO:2.
[0011] In some preferred embodiments, the tumor is melanoma.
[0012] A second aspect of the present invention provides a kit for evaluating the efficacy of tumor IBC therapy, the kit comprising:
[0013] Primer pair set and probe, wherein the primer pair set includes a first primer pair and a second primer pair;
[0014] The first primer pair comprises a forward primer as shown in SEQ ID NO:3 and a reverse primer as shown in SEQ ID NO:4;
[0015] The second primer pair comprises a forward primer as shown in SEQ ID NO:5 and a reverse primer as shown in SEQ ID NO:6.
[0016] In some preferred embodiments, the probe includes:
[0017] The first probe specifically targets circ-TMTC3, and its sequence is shown in SEQ ID NO:7; and
[0018] The second probe specifically targets circ-FAM117B, and the sequence of the second probe is shown in SEQ ID NO:8.
[0019] A third aspect of the invention provides the use of circ-TMTC3 and circ-FAM117B detection reagents for preparing kits to evaluate the efficacy of tumor IBC therapy.
[0020] In another preferred embodiment, the detection reagent is a nucleic acid detection reagent (such as a PCR detection reagent specifically for detecting circ-TMTC3 or a PCR detection reagent specifically for detecting circ-FAM117B) or an immunological detection reagent (such as an antibody specifically for detecting circ-TMTC3 or an antibody specifically for detecting circ-FAM117B).
[0021] In another preferred embodiment, the PCR detection reagent specifically for detecting circ-TMTC3 includes:
[0022] It includes a forward primer with the sequence shown in SEQ ID NO:3 and a reverse primer with the sequence shown in SEQ ID NO:4; preferably, it also includes a probe with the sequence shown in SEQ ID NO:7.
[0023] In another preferred embodiment, the PCR detection reagent specifically for detecting circ-FAM117B includes:
[0024] It includes a forward primer with the sequence shown in SEQ ID NO:5 and a reverse primer with the sequence shown in SEQ ID NO:6; preferably, it also includes a probe with the sequence shown in SEQ ID NO:8.
[0025] A fourth aspect of the present invention provides a system for evaluating the efficacy of tumor IBC therapy, the system comprising:
[0026] A biomarker detection unit, configured to determine the expression level of a biomarker in a patient's tumor tissue; and
[0027] A data processing unit is configured to compare the expression levels and thresholds of biomarkers in the patient's tumor tissue to evaluate the efficacy of tumor IBC therapy for the patient.
[0028] The biomarkers include circ-TMTC3 and / or circ-FAM117B.
[0029] In some preferred embodiments, the biomarker includes circ-TMTC3 or circ-FAM117B.
[0030] In some preferred embodiments, the system includes:
[0031] A biomarker detection unit, wherein the biomarker detection unit is configured to measure the expression level E1 of circ-TMTC3 in the patient's tumor tissue;
[0032] A data processing unit configured to compare E1 with a threshold E1' to determine the efficacy of the tumor IBC therapy for the patient;
[0033] When E1 is less than E1', the tumor IBC therapy is deemed to be sensitive (effective) to the patient; otherwise, the tumor IBC therapy is deemed to be tolerable (ineffective) to the patient.
[0034] In some preferred embodiments, the system includes:
[0035] A biomarker detection unit is configured to measure the expression level E2 of circ-FAM117B in a patient's tumor tissue.
[0036] A data processing unit configured to compare E2 with a threshold E2' to determine the efficacy of the tumor IBC therapy for the patient;
[0037] When E2 is less than E2', the tumor IBC therapy is deemed to be sensitive (effective) to the patient; otherwise, the tumor IBC therapy is deemed to be tolerant (ineffective) to the patient.
[0038] In some preferred embodiments, the biomarkers include circ-TMTC3 and circ-FAM117B.
[0039] In some preferred embodiments, the system includes:
[0040] A biomarker detection unit, configured to measure the expression levels E1 of circ-TMTC3 and E2 of circ-FAM117B in patient tumor tissue; and
[0041] A data processing unit is configured to compare E1 with a threshold E1' and compare E2 with a threshold E2' to determine the efficacy of the tumor IBC therapy for the patient.
[0042] When E1 is less than E1' and E2 is less than E2', the tumor IBC therapy is deemed effective for the patient; otherwise, the tumor IBC therapy is deemed ineffective for the patient.
[0043] In some preferred embodiments, the system includes:
[0044] A biomarker detection unit is configured to measure the expression levels E1 of circ-TMTC3 and E2 of circ-FAM117B in the patient's tumor tissue.
[0045] Data processing unit, the data processing unit being configured to:
[0046] Calculate the IBCcirSig score R based on E1 and E2.
[0047] Calculate the IBCcirSig score R' based on thresholds E1' and E2';
[0048] The efficacy of tumor IBC therapy in the patients was assessed by comparing the sizes of R and R'.
[0049] The IBCcirSig score was obtained by weighting the multivariate Cox regression coefficients using circ-TMTC3 and circ-FAM117B.
[0050] In some preferred embodiments, the value of the IBCcirSig score is calculated using formula I;
[0051] IBCcirSig = 1.001 × circ-TMTC3 expression level + 1.048 × circ-FAM117B expression level (Formula I).
[0052] In some preferred embodiments, the method for determining the expression level in the biomarker detection unit is selected from any one of RNA sequencing, hybridization, and nucleic acid amplification.
[0053] In some preferred embodiments, the method for determining the expression level in the biomarker detection unit is selected from: HPLC / UV-Vis spectroscopy, enzymatic analysis, mass spectrometry, NMR, immunoassay, ELISA, or any combination thereof.
[0054] In some preferred embodiments, the biomarker detection unit includes a PCR amplification device.
[0055] In some preferred embodiments, the biomarker detection unit uses the kit described in the second aspect of the present invention for detection.
[0056] In some preferred embodiments, the method for determining the expression level in the biomarker detection unit is qRT-PCR, and the threshold E1' is 0.4 to 0.6.
[0057] A fifth aspect of the present invention provides a method for evaluating the efficacy of tumor IBC therapy, the method comprising the steps of:
[0058] Determine the expression levels of biomarkers in the patient's tumor tissue;
[0059] The efficacy of tumor IBC therapy in the patients was evaluated by comparing the expression levels of biomarkers and the threshold E1' in the patients' tumor tissues.
[0060] The biomarkers include circ-TMTC3 and / or circ-FAM117B.
[0061] In some preferred embodiments, the biomarker includes circ-TMTC3 or circ-FAM117B.
[0062] In some preferred embodiments, the method includes the steps of:
[0063] The expression level of circ-TMTC3 (E1) in the patient's tumor tissue was measured.
[0064] The efficacy of the tumor IBC therapy for the patient was determined by comparing E1 with the threshold E1'.
[0065] When E1 is less than E1', the tumor IBC therapy is deemed to be sensitive (effective) to the patient; otherwise, the tumor IBC therapy is deemed to be tolerable (ineffective) to the patient.
[0066] In some preferred embodiments, the method includes the steps of:
[0067] The expression level of circ-FAM117B in the patient's tumor tissue was measured (E2).
[0068] The efficacy of the tumor IBC therapy for the patient was determined by comparing E2 with the threshold E2'.
[0069] When E2 is less than E2', the tumor IBC therapy is deemed to be sensitive (effective) to the patient; otherwise, the tumor IBC therapy is deemed to be tolerant (ineffective) to the patient.
[0070] In some preferred embodiments, the biomarkers include circ-TMTC3 and circ-FAM117B.
[0071] In some preferred embodiments, the method includes the steps of:
[0072] The expression levels of circ-TMTC3 (E1) and circ-FAM117B (E2) in the patient's tumor tissue were measured.
[0073] By comparing E1 with the threshold E1', and
[0074] The efficacy of the tumor IBC therapy for the patient was determined by comparing E2 with the threshold E2'.
[0075] When E1 is less than E1' and E2 is less than E2', the tumor IBC therapy is deemed to be sensitive (effective) to the patient; otherwise, the tumor IBC therapy is deemed to be tolerable (ineffective) to the patient.
[0076] In some preferred embodiments, the method includes the steps of:
[0077] The expression levels of circ-TMTC3 (E1) and circ-FAM117B (E2) in the patient's tumor tissue were measured.
[0078] By comparing the values of E1 and the threshold E1', and
[0079] The efficacy of the tumor IBC therapy for the patient was determined by comparing the values of E2 and the threshold E2'.
[0080] When E1 is less than E1' and E2 is less than E2', the tumor IBC therapy is deemed to be sensitive (effective) to the patient; otherwise, the tumor IBC therapy is deemed to be tolerable (ineffective) to the patient.
[0081] In some preferred embodiments, the method includes the steps of:
[0082] The expression levels of circ-TMTC3 (E1) and circ-FAM117B (E2) in the patient's tumor tissue were measured.
[0083] Calculate the IBCcirSig score R based on E1 and E2;
[0084] Calculate the IBCcirSig score R' based on thresholds E1' and E2';
[0085] The efficacy of tumor IBC therapy in the patients was assessed by comparing the sizes of R and R'.
[0086] The IBCcirSig score was obtained by weighting the multivariate Cox regression coefficients using circ-TMTC3 and circ-FAM117B.
[0087] In some preferred embodiments, the value of the IBCcirSig score is calculated using formula I;
[0088] IBCcirSig = 1.001 × circ-TMTC3 expression level + 1.048 × circ-FAM117B expression level (Formula I).
[0089] In some preferred embodiments, the method for determining the expression level is selected from any one of RNA sequencing, hybridization, and nucleic acid amplification.
[0090] In some preferred embodiments, the method for determining the expression level is selected from any one of RNA sequencing, hybridization, and nucleic acid amplification.
[0091] In some preferred embodiments, the expression level is determined by HPLC / UV-Vis spectroscopy, enzymatic analysis, mass spectrometry, NMR, immunoassay, ELISA, or any combination thereof.
[0092] In some preferred embodiments, the method for determining the expression level in the biomarker detection unit is qRT-PCR, and the threshold E1' is 0.4 to 0.6.
[0093] Compared with the prior art, the present invention has at least the following advantages:
[0094] (1) The biomarkers provided by this invention are developed based on circRNA, which have tissue-specific expression, evolutionary conservation and are more stable than linear mRNA. Therefore, they are more specific and more stable for evaluating the treatment effect of tumor IBC.
[0095] (2) The method for evaluating the treatment effect of tumor IBC provided in some embodiments of the present invention uses two circRNAs, circ-TMTC3 and circ-FAM117B, to construct a model, which has better stability and higher accuracy in predicting the treatment effect of tumor IBC in patients.
[0096] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description
[0097] One or more embodiments are illustrated by way of example with reference to the accompanying drawings, and these illustrative descriptions do not constitute a limitation on the embodiments.
[0098] Figure 1 This refers to the number of circRNAs identified by each tool in independent melanoma patient cohorts 1 and 2 according to embodiments of the present invention;
[0099] Figure 2 This refers to the number of circRNAs per sample in queues 1 and 2 according to embodiments of the present invention;
[0100] Figure 3 This is a volcano plot (pre-treatment PRE; A) and (during treatment EDT; B) of upregulated (red) and downregulated (blue) circRNA in non-benefited and benefited melanoma samples according to embodiments of the present invention (P-value < 0.05, |log2(fold change)| ≥ 0.5; see Methods);
[0101] Figure 4 The Venn diagram of upregulated circRNA overlap found in PRE(A) and EDT(B) samples according to embodiments of the present invention (81 common circRNAs, 80 common circRNAs in MiOncoCirc, 74 host genes);
[0102] Figure 5 This is the IBC-related circular circRNA-miRNA-mRNA axis (above, see Method) according to embodiments of the present invention, and the network of all circRNA-miRNA-mRNA interaction pairs (below). "+" indicates that the expression of circRNAs is positively correlated with that of mRNA;
[0103] Figure 6 According to the embodiments of the present invention, the mRNAs in the IBC-related circRNA-miRNA-mRNA axis are enriched by the gene and genome encyclopedia (KEGG) and GO biological processes (p value < 0.05).
[0104] Figure 7 This is a partial likelihood bias plot of LASSO Cox regression used for selecting candidate circRNAs according to an embodiment of the present invention;
[0105] Figure 8 This is a LASSO coefficient distribution diagram of candidate circRNAs according to an embodiment of the present invention (the vertical dashed line represents the optimal value under the minimum criterion);
[0106] Figure 9This is a forest plot of the hazard ratios (HRs) of a multivariate Cox model of four circRNAs under disease-free progressive survival (PFS) according to an embodiment of the present invention;
[0107] Figure 10 This is a schematic diagram of the correlation between circ-TMTC3 and PFS in IBCcircSig, as shown in an embodiment of the present invention using Kaplan-Meier survival curves;
[0108] Figure 11 This is a schematic diagram of the correlation between circ-FAM117B and PFS in IBCcircSig, as shown in an embodiment of the present invention using Kaplan-Meier survival curves.
[0109] Figure 12 These are circ-TMTC3 expression maps of the PD group, CR / PR group, and SD group according to embodiments of the present invention;
[0110] Figure 13 This is an expression map of circ-FAM117B in the PD group, CR / PR group and SD group according to an embodiment of the present invention;
[0111] Figure 14 This is a Kaplan-Meier survival curve of PFS for high- and low-risk patients stratified by the optimal cutoff value IBCcircSig score according to an embodiment of the present invention;
[0112] Figure 15 This is an ROC curve of the IBCcircSig score at 12 months and 24 months of PFS according to an embodiment of the present invention;
[0113] Figure 16 This is a box plot of the IBCcircSig scores of the CR / PR group, SD group and PD group according to an embodiment of the present invention;
[0114] Figure 17 This is a forest plot of HR (CR / PR, complete remission / partial remission; SD, stable disease; PD, progressive disease; ROC (receiver operating characteristic curve); HR, hazard ratio) of a multivariate Cox model of IBCcircSig score and clinicopathological variables according to an embodiment of the present invention.
[0115] Figure 18 This is a Kaplan-Meier survival curve of PFS for high- and low-risk patients stratified by circ-TMTC3 using the optimal threshold method in an embodiment of the present invention;
[0116] Figure 19The Kaplan-Meier survival curves of PFS for high- and low-risk patients stratified by circ-FAM117B using the optimal threshold method in the embodiments of the present invention are shown.
[0117] Figure 20 This describes the expression of circ-TMTC3 in IBCcircSig in the CR, PR, SD, and PD groups according to embodiments of the present invention.
[0118] Figure 21 This describes the expression of circ-FAM117B in IBCcircSig in the CR, PR, SD, and PD groups according to embodiments of the present invention.
[0119] Figure 22 These are Kaplan-Meier survival curves for PFS in patients with high and low IBCcircSig scores according to embodiments of the present invention.
[0120] Figure 23 This is the time-dependent ROC curve of IBCcircSig score at 12 and 24 months of PFS according to an embodiment of the present invention.
[0121] Figure 24 This is a box plot of the IBCcircSig score distribution among the CR, PR, SD and PD groups according to an embodiment of the present invention;
[0122] Figure 25 This is a multivariate Cox model HR forest plot (PFS: progression-free survival; CR, complete remission; PR, local response; SD, stable disease; PD, progressive disease; ROC (receiver operating characteristic curve); HR, hazard ratio; AUC, area under the curve) of IBCcircSig score and clinicopathological variables according to embodiments of the present invention.
[0123] Figure 26 This is a schematic diagram illustrating the expression of circ-TMTC3 verified by qRT-PCR and Sanger sequencing according to an embodiment of the present invention;
[0124] Figure 27 This is a schematic diagram illustrating the generation principle of circ-TMTC3 in patient samples before anti-pd-1 treatment using qRT-PCR according to an embodiment of the present invention.
[0125] Figure 28 This is a schematic diagram illustrating the expression of circ-FAM117B verified by qRT-PCR and Sanger sequencing according to an embodiment of the present invention.
[0126] Figure 29This is a schematic diagram illustrating the generation principle of circ-FAM117B in patient samples before anti-pd-1 treatment using qRT-PCR, as described in an embodiment of the present invention. Detailed Implementation
[0127] The predictive ability of commonly used biomarkers in existing technologies for IBC response is extremely unstable. Through detailed and meticulous experiments, the inventors have developed a biomarker based on circRNA that can assess the therapeutic effect of IBC therapy in cancer patients. This biomarker is more stable, exhibits tissue-specific expression and evolutionary conservation, significantly improving the accuracy of IBC response prediction. Some embodiments of this invention provide a set of biomarkers for evaluating the efficacy of IBC therapy in cancer patients, including circ-TMTC3 and / or circ-FAM117B.
[0128] In some preferred embodiments, the assessment is a preliminary assessment. For example, predicting the efficacy of IBC therapy in melanoma patients.
[0129] In some preferred embodiments, the biomarkers include circ-TMTC3 and circ-FAM117B; wherein the nucleic acid sequence of circ-TMTC3 is at least partially identical to SEQ ID NO:1; and the nucleic acid sequence of circ-FAM117B is at least partially identical to SEQ ID NO:2.
[0130] The tumor described in this invention refers to a new growth formed by the proliferation of local tissue cells under the influence of various tumorigenic factors. It typically includes both benign and malignant tumors, but preferably, the tumor is a malignant tumor. Malignant tumors, as referred to herein, are those that rapidly proliferate locally, destroy adjacent tissues, and metastasize to other sites, causing serious harm to the body. These can include: skin cancer, stomach cancer, lung cancer, liver cancer, esophageal cancer, colorectal cancer, leukemia, malignant lymphoma, cervical cancer, nasopharyngeal carcinoma, and breast cancer, etc. As a preferred example, the malignant tumor is melanoma (malignant).
[0131] The inventors experimentally verified that both circ-TMTC3 and circ-FAM117B, two circRNAs, can serve as biomarkers for evaluating the efficacy of tumor IBC therapy. By measuring the expression levels of one or both circRNAs in patient tissues, the efficacy of IBC therapy for individual patients can be well predicted. In some embodiments of the present invention, a method for evaluating the efficacy of tumor IBC therapy is provided, the method comprising the steps of:
[0132] Determine the expression levels of biomarkers in the patient's tumor tissue;
[0133] The efficacy of tumor IBC therapy in the patients was assessed by comparing the expression levels and thresholds of biomarkers in the patients' tumor tissues.
[0134] The biomarkers include circ-TMTC3 and / or circ-FAM117B.
[0135] The two biomarkers provided in this invention can be used alone or in combination to evaluate the efficacy of tumor IBC therapy. In some preferred embodiments of this invention, the biomarkers include circ-TMTC3 or circ-FAM117B.
[0136] When a single circRNA is selected as a biomarker, the method for evaluating the efficacy of tumor IBC therapy can specifically be one of the following two approaches:
[0137] Method 1
[0138] The method includes the following steps:
[0139] The expression level of circ-TMTC3 (E1) in the patient's tumor tissue was measured.
[0140] The efficacy of the tumor IBC therapy for the patient was determined by comparing E1 and the y threshold E1'.
[0141] If E1' is less than E1, the tumor IBC therapy is deemed effective for the patient; otherwise, the tumor IBC therapy is deemed ineffective for the patient.
[0142] Method Two
[0143] In some preferred embodiments, the method includes the steps of:
[0144] The expression level of circ-FAM117B in the patient's tumor tissue was measured (E2).
[0145] The efficacy of the tumor IBC therapy for the patient was determined by comparing E2 with the threshold E2'.
[0146] When E2 is less than E2', the tumor IBC therapy is deemed to be sensitive (effective) to the patient; otherwise, the tumor IBC therapy is deemed to be tolerant (ineffective) to the patient.
[0147] Further research by the inventors revealed that the accuracy of the predictions was better when a combination of circ-TMTC3 and circ-FAM117B was selected as the biomarker. Therefore, in some preferred embodiments of the present invention, the biomarkers include circ-TMTC3 and circ-FAM117B.
[0148] When the combination of circ-TMTC3 and circ-FAM117B is selected as a biomarker, the method for evaluating the efficacy of tumor IBC therapy may specifically be as follows:
[0149] Method 3
[0150] The method includes the following steps:
[0151] The expression levels of circ-TMTC3 (E1) and circ-FAM117B (E2) in the patient's tumor tissue were measured.
[0152] By comparing E1 with the threshold E1', and
[0153] The efficacy of the tumor IBC therapy for the patient was determined by comparing E2 with the threshold E2'.
[0154] When E1 is less than E1' and E2 is less than E2', the tumor IBC therapy is deemed effective for the patient; otherwise, the tumor IBC therapy is deemed ineffective for the patient.
[0155] Furthermore, the inventors constructed a linear mixed-effects model for accurately evaluating the efficacy of IBC therapy for melanoma by integrating machine learning algorithms. The weights of each variable were obtained through multivariate Cox regression coefficient weighting, and then linearly combined. The optimized model can correct for inter-individual differences, ensuring more reliable differentially expressed circRNAs. In some more preferred embodiments of the invention, the method includes the following steps:
[0156] The expression levels of circ-TMTC3 (E1) and circ-FAM117B (E2) in the patient's tumor tissue were measured.
[0157] Calculate the IBCcirSig score R based on E1 and E2;
[0158] The IBCcirSig score R' was calculated based on the threshold E1' and the expression level of circ-FAM117B E2'.
[0159] The efficacy of tumor IBC therapy in the patients was assessed by comparing the sizes of R and R'.
[0160] The IBCcirSig score was obtained by weighting the multivariate Cox regression coefficients using circ-TMTC3 and circ-FAM117B.
[0161] In some preferred embodiments, the value of the IBCcirSig score is calculated using formula I;
[0162] IBCcirSig = 1.001 × circ-TMTC3 expression level + 1.048 × circ-FAM117B expression level (Formula I).
[0163] The method for determining the expression level of biomarkers in this invention can be selected from any one of RNA sequencing, hybridization (e.g., tissue in situ hybridization (ISH)), and nucleic acid amplification.
[0164] In some preferred embodiments, the expression level is determined by HPLC / UV-Vis spectroscopy, enzymatic analysis, mass spectrometry, NMR, immunoassay, ELISA, or any combination thereof.
[0165] The inventors have also developed a kit for measuring the expression levels of the biomarkers circ-TMTC3 and circ-FAM117B based on nucleic acid amplification. This kit exhibits high sensitivity and accuracy, and strong anti-interference capabilities, allowing for convenient simultaneous measurement of both circ-TMTC3 and circ-FAM117B biomarkers. Some embodiments of the invention also provide a kit for evaluating the efficacy of tumor IBC therapy, the kit comprising:
[0166] A primer pair set, wherein the primer pair set includes a first primer pair and a second primer pair;
[0167] The first primer pair comprises a forward primer as shown in SEQ ID NO:3 and a reverse primer as shown in SEQ ID NO:4;
[0168] The second primer pair comprises a forward primer as shown in SEQ ID NO:5 and a reverse primer as shown in SEQ ID NO:6.
[0169] Some embodiments of the present invention also provide a system for evaluating the efficacy of tumor IBC therapy, the system comprising:
[0170] A biomarker detection unit, configured to determine the expression level of a biomarker in a patient's tumor tissue; and
[0171] A data processing unit is configured to compare the expression levels and thresholds of biomarkers in the patient's tumor tissue to evaluate the efficacy of tumor IBC therapy for the patient.
[0172] The biomarkers include circ-TMTC3 and / or circ-FAM117B.
[0173] In some preferred embodiments, the biomarker includes circ-TMTC3 or circ-FAM117B.
[0174] In some preferred embodiments, the system includes:
[0175] A biomarker detection unit, wherein the biomarker detection unit is configured to measure the expression level E1 of circ-TMTC3 in the patient's tumor tissue;
[0176] A data processing unit configured to compare E1 with a threshold E1' to determine the efficacy of the tumor IBC therapy for the patient;
[0177] When E1 is less than E1', the tumor IBC therapy is deemed to be sensitive (effective) to the patient; otherwise, the tumor IBC therapy is deemed to be tolerable (ineffective) to the patient.
[0178] In some preferred embodiments, the system includes:
[0179] A biomarker detection unit is configured to measure the expression level E2 of circ-FAM117B in a patient's tumor tissue.
[0180] A data processing unit configured to compare the value of E2 with a threshold E2' to determine the efficacy of the tumor IBC therapy for the patient;
[0181] When E2 is less than E2', the tumor IBC therapy is deemed to be sensitive (effective) to the patient; otherwise, the tumor IBC therapy is deemed to be tolerant (ineffective) to the patient.
[0182] In some preferred embodiments, the biomarkers include circ-TMTC3 and circ-FAM117B.
[0183] In some preferred embodiments, the system includes:
[0184] A biomarker detection unit, configured to measure the expression levels E1 of circ-TMTC3 and E2 of circ-FAM117B in patient tumor tissue; and
[0185] A data processing unit is configured to set a threshold E1' and compare E2 with the threshold E2' to determine the efficacy of the tumor IBC therapy for the patient.
[0186] When E1 is less than E1' and E2 is less than E2', the tumor IBC therapy is deemed to be sensitive (effective) to the patient; otherwise, the tumor IBC therapy is deemed to be tolerable (ineffective) to the patient.
[0187] In some preferred embodiments, the system includes:
[0188] A biomarker detection unit is configured to measure the expression levels E1 of circ-TMTC3 and E2 of circ-FAM117B in the patient's tumor tissue.
[0189] Data processing unit, the data processing unit being configured to:
[0190] Calculate the IBCcirSig score R based on E1 and E2.
[0191] Calculate the IBCcirSig score R' based on thresholds E1' and E2';
[0192] The efficacy of tumor IBC therapy in the patients was assessed by comparing the sizes of R and R'.
[0193] The IBCcirSig score was obtained by weighting the multivariate Cox regression coefficients using circ-TMTC3 and circ-FAM117B.
[0194] In some preferred embodiments, the value of the IBCcirSig score is calculated using formula I;
[0195] IBCcirSig = 1.001 × circ-TMTC3 expression level + 1.048 × circ-FAM117B expression level (Formula I).
[0196] In some preferred embodiments, the method for determining the expression level in the biomarker detection unit is selected from any one of RNA sequencing, hybridization, and nucleic acid amplification.
[0197] In some preferred embodiments, the method for determining the expression level in the biomarker detection unit is selected from: HPLC / UV-Vis spectroscopy, enzymatic analysis, mass spectrometry, NMR, immunoassay, ELISA, or any combination thereof.
[0198] In some preferred embodiments, the biomarker detection unit includes a PCR amplification device.
[0199] In some preferred embodiments, the biomarker detection unit uses the kit described in the second aspect of the present invention for detection.
[0200] In some preferred embodiments, the biomarker detection unit includes a detection reagent, the detection reagent includes a primer pair set, the primer pair set including a first primer pair and a second primer pair;
[0201] The first primer pair comprises a forward primer as shown in SEQ ID NO:3 and a reverse primer as shown in SEQ ID NO:4;
[0202] The second primer pair comprises a forward primer as shown in SEQ ID NO:5 and a reverse primer as shown in SEQ ID NO:6.
[0203] In some preferred embodiments, the method for determining the expression level in the biomarker detection unit is qRT-PCR, and the threshold E1' is 0.4 to 0.6.
[0204] the term
[0205] Unless otherwise defined, the following terms may have the meanings assigned to them below. However, it should be understood that other meanings known or understood by those skilled in the art are also possible and are within the scope of this invention.
[0206] As used herein, unless the context clearly indicates otherwise, the singular forms “a,” “one,” and “the” include plural references. All technical and scientific terms used herein have the same meaning.
[0207] Unless specifically stated or obvious from the context, as used herein, the term "approximately" should be understood as falling within the normal tolerance range in the field, such as within 2 standard deviations of the mean. "Approximately" can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. Unless the context otherwise requires, all numerical values provided herein may be modified by the term "approximately".
[0208] As used herein, the term "amplification" refers to any known in vitro process used to obtain multiple copies ("amplifiers") of a target nucleic acid sequence or its complementary sequence or fragment thereof. In vitro amplification refers to the production of nucleic acids that may contain fewer copies of the amplified nucleic acid than the complete target region sequence or its complementary sequence. Known in vitro amplification methods include, for example, transcription-mediated amplification, replicase-mediated amplification, polymerase chain reaction (PCR) amplification, ligase chain reaction (LCR) amplification, and strand substitution amplification (SDA, including multi-strand substitution amplification methods (MSDA)). Replicase-mediated amplification uses self-replicating RNA molecules and replicases (e.g., Q-β-replicaase) (e.g., Kramer et al., U.S. Patent No. 4,786,600). PCR amplification is well-known, using DNA polymerase, primers, and thermal cycling to synthesize multiple copies of the two complementary strands of DNA or cDNA (e.g., Mullis et al., U.S. Patent Nos. 4,683,195, 4,683,202, and 4,800,159). LCR amplification uses at least four separate oligonucleotides to amplify the target and its complementary strand through multiple cycles of hybridization, ligation, and denaturation (e.g., EP Patent Application Publication No. 0320308). SDA is a method in which primers contain recognition sites for restriction endonucleases that allow the endonuclease to cleave one strand of a semi-modified DNA duplex containing a target sequence, followed by amplification in a series of primer extension and strand substitution steps (e.g., Walker et al., U.S. Patent No. 5,422,252). Two other known strand substitution amplification methods do not require endonuclease cleavage (Dattagupta et al., U.S. Patent No. 6,087,133 and U.S. Patent No. 6,124,120 (MSDA)). Those skilled in the art will understand that the oligonucleotide primer sequences of this invention can be readily used in any in vitro amplification method based on primer extension via polymerase. (See also Kwoh et al., 1990, Am. Biotechnol. Lab. 8:14-25 and Kwoh et al., 1989, Proc. Natl. Acad. Sci. USA) 86, 1173-1177; Liza Rdi et al., 1988, BioTechnology 6: 1197-1202; Malek et al., 1994, Methods Mol. Biol., 28: 253-260; and Sambrook et al., 2000, Molecular Cloning A Laboratory Manual, Third Edition, CSH Laboratories). As is well known in the art, oligonucleotides are engineered to bind complementary sequences under selected conditions.
[0209] As used in this article, the term "marker" or "biomarker" refers to a biological molecule or biomolecule whose expression level is correlated, for example, positively or negatively, with the therapeutic effect of IBC therapy on tumors (e.g., melanoma).
[0210] As used in this article, “expression” refers to the process of producing polypeptides from DNA. This process involves the transcription of a gene into mRNA and the translation of that mRNA into a polypeptide. Depending on the context, “expression” may refer to the production of RNA or protein, or both.
[0211] As used herein, "patient" or "subject" may refer to a human or a non-human animal, preferably a mammal. "Subject" refers to any animal, including horses, dogs, cats, pigs, goats, rabbits, hamsters, monkeys, guinea pigs, rats, mice, lizards, snakes, sheep, cattle, fish, and birds. Human subjects may be referred to as patients.
[0212] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the present invention is further described below in conjunction with specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight. Unless otherwise specified, the experimental materials and reagents used in the following embodiments are commercially available.
[0213] Unless otherwise specified, the technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains. It should be noted that the terms used herein are for the purpose of describing particular embodiments only and are not intended to limit the exemplary embodiments of this application.
[0214] Raw RNA-seq data and clinical information for Cohort 1 used in this study can be downloaded from the European Nucleotide Archive (ENA) (https: / / www.ebi.ac.uk / ena), accession number PRJEB23709. In short, melanoma patients were treated with monotherapy of anti-PD-1 (nivolumab or pembrolizumab) or in combination with anti-PD-1 and anti-CTLA-4 (ipilimumab). Patient response was determined using RECIST 1.1 criteria. "Pre-treatment" indicates sample collection before immunotherapy, and "during treatment" indicates sample collection 7–14 days after immunotherapy. This patient cohort included 88 samples with RNA-seq data, comprising 47 patients who received anti-PD-1 monotherapy (pre-treatment, n=38; during treatment, n=9) and 41 patients who received combination ipilimumab and anti-PD-1 immunotherapy (pre-treatment, n=32; during treatment, n=9). The raw RNA-seq data and clinical information for cohort 2 used in this study were downloaded from the genotype and phenotype database (dbGaP).
[0215] (https: / / www.ncbi.nlm.nih.gov / gap / ), accession number phs000452.v3.p1. This cohort included patients with advanced melanoma treated with monotherapy against PD-1 (nivolumab or pembrolizumab), with or without prior anti-CTLA-4 therapy. Patient efficacy was assessed using RECIST 1.1 criteria, including 30 patients with progressive disease (PD), 9 with stable disease (SD), 1 with mixed response (MR), 19 with partial response (PR), and 10 with complete response (CR). A total of 69 pre-immunotherapy samples with available RNA-seq data were included in this patient cohort.
[0216] Example 1: Abnormal expression of circRNA in IBC-treated patients
[0217] In this embodiment, the inventors collected two independent whole RNA sequencing data cohorts, using either single-agent anti-PD-1 therapy or combination therapy with anti-CTLA-4 and anti-PD-1. Cohort 1 included 88 patients who received single-agent anti-PD-1 therapy (47 patients, including 38 pre-treatment patients and 9 treatment-intermediate patients) or combination therapy with anti-CTLA-4 and anti-PD-1 (41 patients, including 32 pre-treatment patients and 9 treatment-intermediate patients); Cohort 2 included 69 melanoma patients who received anti-PD-1 therapy (nirushumab or pembrolizumab).
[0218] To identify reliable circRNAs, the inventors combined four excellent circRNA detection tools, including cirri2, Find_circ, CircExplorer2, and CircRNA_finder, to quantify backsplicing reads (see...). Figure 1 , Figure 1The number of circRNAs identified by each tool is shown in independent melanoma patient cohorts 1(A) and 2(B). Different circRNA detection tools identified different numbers of circRNAs, thus retaining at least two backsplicing reads ≥2 and circRNAs identified by more than two tools. Specifically, the inventors identified 89,204 circRNAs from 88 samples in cohort 1 and 43,911 circRNAs from 69 samples in cohort 2. The number of detectable circRNAs per patient in cohort 1 ranged from 1,440 to 16,653, and the number of detectable circRNAs per patient in cohort 2 ranged from 39 to 11,652. To reduce potential inaccuracies, the inventors only considered circRNAs identified in more than 20% of the samples in each cohort. A total of 5,350 circRNAs were retained in cohort 1, with a retention range of 774 to 4,525 per patient (see [link to relevant documentation]). Figure 2 C), a total of 3654 circRNAs were retained in cohort 2, with a retention range of 20 to 3013 per patient (see C). Figure 2 D). 90.4% (3293 / 3644) of the circRNAs in cohort 2 were detectable in cohort 1 (Fisher test, p<2.2e-16). Of these detected circRNAs, 96.6% (5167 / 5350) of the circRNAs in cohort 1 and 97.3% (3544 / 3644) of the circRNAs in cohort 2 were present in the MiOncoCirc database, and their circRNAs were quantified from tumor samples, indicating that the circRNA profiles in these two cohorts are tumor-associated.
[0219] The nucleic acid sequence (coding sequence) of Circ-TMTC3 is SEQ ID NO:1
[0220]
[0221] The nucleic acid sequence (coding sequence) of Circ-FAM117B is SEQ ID NO:2
[0222] GCTCCTGTTCCAAAGAGTGCACTTATTCCTGTAATTCCCATCACCAAATCAACAGGCTCCCGGTTCCGGAATAGCGTGGAAGGATTGAATCAGGAGATTGAAATAATAATTAAAGAGACTGGGGAAAAGGAAGAGCAACTTATACCGCAAGATATTCCAGATGGCCATCGTGCTCCACCCCCCCTTGTACAGAGAAGTAGCAGCACGCGCAGCATTGACACAGAGACGCCTGGTGGGGCAGACAG GGGAAGCAACAACAGCAGCCGTTCCCAGTCCGTGTCCCCCAACATCGTTCCTCACCATTTCCAATGAAGGTAGCGAGGAGAGTCCTTGCTCAGCGGATGACCTGCTTGTTGATCCCAGAGATAAAGAGAATGGGAACAATTCTCCTTTGCCCAAATATGCAACCTCACCAAAACCTAACAACAGTTATATGTTCAAAAGGGAACCTCCTGAGGGCTGTGAAAGGGTCAAAGTCTTTGAGGAATGCTC
[0223] Example 2: Construction of a circRNA differential regulatory network
[0224] In this embodiment, the inventors used a linear mixed-effects model to identify differentially regulated circRNAs in patients who responded to or did not respond to immunotherapy, and then selected upregulated circRNAs commonly found in both non-beneficiary and beneficiary patients for analysis.
[0225] (1) Identifying the difference between immunotherapy response and non-response circRNA
[0226] To identify differentially expressed circRNAs in non-benefit and benefit samples before and during the early stages of treatment, the inventors applied a linear mixed-effects model (LME) to calculate differentially expressed circRNAs. This model considers nested random effects (per individual sample) and potential confounding factors, and is executed using the lme procedure in the nlme-R package. A p-value < 0.05 and |log2(fold change)| ≥ 0.5 were considered statistically significant. Specifically, the LME model was first used to identify differentially expressed circRNAs between the benefit group (n = 54) and the non-benefit group (n = 16) before treatment. The expression differences of these differentially expressed circRNAs during treatment were then investigated (benefit group, n = 13; non-benefit group, n = 5).
[0227] In pre-treatment samples, the inventors found 227 upregulated and 23 downregulated circRNAs in non-beneficiary patients compared to benefiting patients (P < 0.05 and |log2(fold change)| ≥ 0.5). In treatment samples, 1547 upregulated and 10 downregulated circRNAs were found after IBC treatment (see [link to study]). Figure 3 , Figure 3 A is a volcano plot showing the upregulation (red) and downregulation (blue) of circRNA in pre-treatment PRE non-benefit and benefit melanoma samples; Figure 3 B shows the volcano plot of EDT circRNA upregulation (red) and downregulation (blue) during treatment. In both the pre-treatment and treatment-internal non-responder groups, more circRNAs were upregulated and fewer were downregulated, suggesting a potential association between circRNA overexpression and immunotherapy resistance. To further explore the functional role of circRNAs in immunotherapy, the inventors selected upregulated circRNAs from 81 non-beneficiary and beneficiary patients at time points before and during treatment for subsequent analysis (see...). Figure 4 ).
[0228] (2) Identification of the circRNA-miRNA-mRNA relationship network
[0229] To predict circRNA-miRNA interactions, the inventors used the Miranda software (which identifies potential target sites for miRNAs in the genome sequence) to predict the target sites of circRNAs. It ranks candidate miRNAs for each circRNA based on alignment score and minimum free energy. The Miranda algorithm was used to predict high-confidence binding sites, and the top 30 miRNAs with the highest scores were selected for each 81-upregulated circRNA.
[0230] Then, miRNA-mRNA pairs were downloaded from the Tarbase database (which contains experimentally supported miRNA-mRNA interactions) and the TargetScan database, retaining shared miRNA-mRNA pairs from both databases. The inventors detected a total of 773 miRNAs and 2429 interactions along the circRNA-miRNA axis.
[0231] Finally, circRNA-miRNA-mRNA interactions were screened according to the following criteria:
[0232] 1) Retain 95 percentile miRNAs expressed in TCGA melanoma to filter out non-melanoma-associated miRNAs;
[0233] 2) Retain the top 30 miRNAs that interact with circRNAs based on their scores;
[0234] 3) Retain miRNAs that interact with both circRNA and mRNA;
[0235] 4) The circRNA-miRNA-mRNA interaction is preserved, and there is a significant positive correlation between circRNA and mRNA (Rs>0.2 and p<0.05).
[0236] Based on the above screening principles, the inventors identified 184,587 circular circRNA-miRNA-mRNA interactions based on the common miRNA target sites of circRNA and mRNA.
[0237] Furthermore, the inventors further screened high-confidence associations based on multiple steps, including expression correlation, and retained 8449 (81 circRNAs - 183 miRNAs - 2046 mRNAs) IBC response-related interactions. Figure 5 , Figure 5 The upper middle section shows the IBC-related circular circRNA-miRNA-mRNA axis; the lower section shows the network of all circRNA-miRNA-mRNA interaction pairs. Pathway analysis based on these 2046 mRNAs showed significant enrichment of tumor signaling pathways, such as the Hippo signaling pathway, p53 signaling pathway, mTOR signaling pathway, and AMPK signaling pathway (see [link to relevant documentation]). Figure 6These mRNAs are also enriched in several biological processes, including cell cycle checkpoints, cellular hypoxia responses, autophagy, and Wnt signaling pathway regulation. For example, targeting the Wnt signaling pathway may reverse immunotherapy resistance by altering antigen presentation. Analysis showed that circRNAs were abnormally upregulated in non-beneficiary patients, suggesting a potential role for circRNAs in resisting cancer immunotherapy by altering cancer signaling pathways.
[0238] Example 3: Constructing a circRNA model to predict the efficacy of immunotherapy
[0239] In this embodiment, the inventors used a machine learning-based algorithm to construct IBCcircSig. (i) Univariate survival analysis was performed on progression-free survival (PFS) and circRNA expression to identify prognostic-related circRNAs; (ii) Based on a LASSO Cox regression model, the optimal combination of circRNAs from (i) was selected. The inventors named the final biomarker “IBCcirSig”, and (iii) the IBCcircSig score for each sample was established based on a weighted average of expression values and multivariate Cox regression coefficients (1.001*circ-TMTC3 + 1.048*circ-FAM117B). The specific method is as follows:
[0240] (1) Constructing circRNA biomarkers in patient cohort 1 to predict the efficacy of immunotherapy
[0241] To identify prognostic-related circRNAs, the inventors performed univariate Cox regression analysis on the expression levels of 227 upregulated circRNAs and progression-free survival (PFS) in pre-treatment samples from cohort 1. The results showed that high expression of 25 circRNAs was significantly associated with poorer PFS (log-rank test, FDR < 0.05, Cox FDR < 0.05).
[0242] To determine the optimal combination of circRNAs as prognostic biomarkers, the inventors used a LASSO Cox regression model to analyze the expression profiles and clinical information of 25 circRNAs (results are shown in [link to results]). Figure 7 ), and selected 4 circRNAs with non-zero regression coefficients (see Figure 8 Multivariate Cox regression analysis using these four circRNAs as variables revealed that circ-TMTC3 and circ-FAM117B were significant predictors (see...). Figure 9 The expression of these two circRNAs was associated with poorer PFS. Figure 10 and Figure 11In patients with complete or partial remission (CR / PR) and stable disease (SD) on anti-PD-1 therapy, the expression of circ-TMTC3 and circ-FAM117B was significantly lower than in patients with progressive disease (e.g., Parkinson's disease PD). Figure 12 and Figure 13 ).
[0243] Further, by weighting the expression values of circRNAs in IBCcircSig using multivariate Cox regression coefficients, the inventors constructed an IBC-related circRNA biomarker (IBCcircSig) score (1.001*circ-TMTC3 + 1.048*circ-FAM117B). Further assessment of clinical relevance revealed that patients with higher IBCcircSig scores had worse progression-free survival (PFS) compared to those with lower IBCcircSig scores (log-rank test, p < 0.001). Figure 14 ).
[0244] The 12-month and 24-month progression rates in the high IBCcircSig score group were 100% and 100%, respectively, significantly higher than the 27% and 30% in the low IBCcircSig score group. Using 12-month and 24-month PFS as the standard, the areas under the ROC curves (AUC) for IBCcircSig score versus time were 0.76 and 0.75, respectively. Figure 15 ).
[0245] The inventors further investigated the relationship between IBC circSig score and patient response to IBC treatment, finding that the IBC circSig score of CR / PR patients was significantly lower than that of PD / SD patients (CR / PR vs PD / SD, p = 5.6 × 10⁻⁶). -5 ; Figure 16 ).
[0246] Furthermore, the inventors investigated whether the IBC circSig score could serve as an independent prognostic factor. Through multivariate Cox regression analysis, they corrected for the influence of other traditional clinical factors, including age, sex, IBC treatment modality, CD274 (PD-L1), and PDCD1. After correcting for confounding factors, the IBC circSig score (hazard ratio [HR] = 2.975, 95% confidence interval [CI] 1.723–5.138, p < 0.001) was an independent prognostic risk factor for PFS. Figure 17 ).
[0247] (2) Assessment of IBCcircSig score performance in independent patient cohort 2:
[0248] In independent patient cohort 2, the inventors further evaluated the performance of the IBC circSig score and found that circ-TMTC3 and circ-FAM117B were associated with poorer PFS, and tended to be enriched in patients with PD response to IBC treatment in cohort 2. Figure 18-21 ).
[0249] Further calculation of the IBCcircSig score for each sample showed that patients with high IBCcircSig scores had lower FPS compared to those with low IBCcircSig scores. Figure 22 For 12-month and 24-month PFS as standards, the areas under the ROC curves (AUC) of the IBCcircSig score over time were 0.69 and 0.65, respectively. Figure 23 The IBCcircSig score of CR / PR patients was significantly lower than that of PD or SD patients (CR / PR vs PD / SD, p = 0.0015). Figure 24 This is consistent with the observations in cohort 1. Further multivariate Cox analysis showed that the IBC circSig score (HR = 1.32, 95% CI 1.0721–1.630, p = 0.009) was an independent prognostic factor. Figure 25 ).
[0250] Example 4: Validating the circRNA model to predict the efficacy of immunotherapy
[0251] (1) PCR amplification of circular RNA after ribonuclease treatment
[0252] RNA was isolated from tumor samples of patients who received IBC treatment and linear circ-TMTC3 was isolated using specific primer pairs.
[0253] PCR amplification was performed using [F5'-AATACTTCTTACAGGCTACCCATGT-3' and R5'-AACCACAAAAGAGGCTGTTCC-3'] and circ-FAM117B[F5'-CTTTGCCCAAATATGCAACC-3' and R5'-CTTTGGAACAGGAGCGAGCA-3'].
[0254] SEQ ID NO:3
[0255] AATACTTCTTACAGGCTACCCATGT
[0256] SEQ ID NO:4
[0257] AACCACAAAAGAGGCTGTTCC
[0258] SEQ ID NO:5
[0259] CTTTGCCCAAATATGCAACC
[0260] SEQ ID NO:6
[0261] CTTTGGAACAGGAGCGAGCA
[0262] Two micrograms of RNA were incubated with ribonuclease R (VWR) at 37°C for 30 min to degrade linear RNA. The RNA was then incubated at 70°C for 10 min to inactivate RNase R, followed by reverse transcription RT-PCR detection. RNA was converted to cDNA for PCR. No reverse transcriptase (No RT) was used as a negative control, and circ-TMTC3 and circ-FAM117B were used as positive controls to locate the presence of circ-TMTC3 and circ-FAM117B, respectively. Sanger sequencing was performed after RNase R treatment. The primers used were 5'-AATACTTCTTACAGGCTACCCATGT-3' (circ-TMTC3) and 5'-CTTTGCCCAAATATGCAACC-3' (circ-FAM117B).
[0263] The inventors further collected pre-treatment tumor samples from 11 and 4 patients who responded to anti-PD1 treatment, respectively. The expression levels of circ-TMTC3 and circ-FAM117B in these samples were detected using qRT-PCR. The results are shown in Figures A and C, indicating that the expression levels of both circRNAs were significantly higher in non-responders than in responders. Figure 26 and 28 ).
[0264] Sanger sequencing further confirmed that the PCR product crossed the circular junction sites of circ-TMTC3 and circ-FAM117B (red dashed lines indicate the circular intersections). Figure 27 and 29 ).
[0265] Those skilled in the art will understand that the above embodiments are specific examples of implementing the present invention, and in practical applications, various changes in form and detail may be made without departing from the spirit and scope of the present invention. SEQUENCE LISTING <110> Jizhi (Suzhou) Medical Technology Co., Ltd. <120> Biomarkers, systems, methods, and kits for evaluating the efficacy of intravascular coagulation (IBC) therapy in cancer patients. <130> P220239-1CNCNB8 <160> 6 <170> PatentIn version 3.5 <210> 1 <211> 25 <212> DNA <213> Artificial sequence <400> 1 aatacttctt acaggctacc catgt 25 <210> 2 <211> twenty one <212> DNA <213> Artificial sequence <400> 2 aaccacaaaa gaggctgttc c 21 <210> 3 <211> 20 <212> DNA <213> Artificial sequence <400> 3 ctttgcccaa atatgcaacc 20 <210> 4 <211> 20 <212> DNA <213> Artificial sequence <400> 4 ctttggaaca ggagcgagca 20 <210> 5 <211> 1042 <212> DNA <213> Artificial sequence <400> 5 tttttgtcca gaagtgctta tagaaaagat ggctaatatt aacctaaaag aaataacctt 60 aatagtaggt gtggttactg cctgctattg gaacagcctc ttttgtggtt ttgtttttga 120 tgatgtttca gcaatactgg ataacaaaga cttgcatcca tctacacctt taaaaacttt 180 atttcaaaat gacttctggg gaacccctat gtctgaggag agaagccaca agtcttaccg 240 tcccttaaca gtattgacat ttcgcttaaa ttatttgtta agtgaactaa aaccaatgtc 300 atatcatctc ctgaatatga tttttcatgc tgtggttagt gtgatatttc tcaaagtatg 360 caaacttttt ctggacaaca agagtagtgt gattgcttct ttactttttg cagtgcaccc 420 aatacacaca gaagcagtaa caggagttgt tggaagagca gaacttttgt catctatctt 480 ttttctagca gcttttttgt catataccag atcaaaagga ccagacaatt ccataagcgc 540 tttgtttaat ggcattacca tttattcctg catcgaacct tttttttcca gttggatttg 600 ttgttgccga gcgagtatta tatgttccca gcatggggtt ctgtattttg gtagcccatg 660 gatggcagaa aatatcaaca aaaagcctga gacagaacaa actttgagtc agatccaaat 720 gaaaacaagg atgttactga gaataaagtc tcaaatgacc attgccactt cdatatcag 780 tgaactaaga tatagtcat cctacttaat gtatttaaaa agctatcctg gatttgtctg 840 tctatggtga tactcactca ttccttaaaa acattccaca gaaattggga ttgggagtct 900 gaatatacat tgttatgtc agccttgaag gtaaataaaa ataatgccaa actttggaat 960 aatgtgggtc atgctctgga aaatgaaaag aactttgaga gagctttgaa atacttctta 1020 caggctaccc atgttcagcc ag 1042 <210> 6 <211> 491 <212> DNA <213> Artificial sequence <400> 6 gctcctgttc caaagagtgc acttattcct gtaattccca tcaccaaatc aacaggctcc 60 cggttccgga atagcgtgga aggattgaat caggagattg aaataataat taaagagact 120 ggggaaaagg aagagcaact tataccgcaa gatattccag atggccatcg tgctccacccc 180 ccccttgtac agagaagtag cagcacgcgc agcattgaca cacagacgcc tggtggggca 240 gacaggggaa gcaacaacag cagccgttcc cagtccgtgt ccccaacatc gttcctcacc 300 atttccaatg aaggtagcga ggagagtcct tgctcagcgg atgacctgct tgttgatccc 360 agagataaag agaatgggaa caattctcct ttgcccaaat atgcaacctc accaaaacct aacaacagtt atatgttcaa aagggaacct cctgagggct gtgaaagggt caaagtcttt gaggaatgct c 491
Claims
1. A biomarker for evaluating the efficacy of tumor IBC therapy, characterized in that, The biomarker consists of circ-TMTC3 and circ-FAM117B, wherein the nucleic acid sequence of circ-TMTC3 is shown in SEQ ID NO:1; the nucleic acid sequence of circ-FAM117B is shown in SEQ ID NO:2; and the tumor is melanoma.
2. The use of reagents for detecting the expression levels of circ-TMTC3 and circ-FAM117B in the preparation of kits for evaluating the efficacy of tumor IBC therapy, wherein, The nucleic acid sequence of circ-TMTC3 is shown in SEQ ID NO:1; the nucleic acid sequence of circ-FAM117B is shown in SEQ ID NO:2, and the tumor is melanoma.
3. A system for evaluating the efficacy of tumor IBC therapy, characterized in that, The system includes: A biomarker detection unit, configured to determine the expression level of a biomarker in a patient's tumor tissue; and A data processing unit is configured to compare the expression levels and thresholds of biomarkers in the patient's tumor tissue to evaluate the efficacy of tumor IBC therapy for the patient. The biomarkers consist of circ-TMTC3 and circ-FAM117B. The nucleic acid sequence of circ-TMTC3 is shown in SEQ ID NO:1; the nucleic acid sequence of circ-FAM117B is shown in SEQ ID NO:2; and the tumor is melanoma.
4. The system according to claim 3, characterized in that, The biomarker detection unit is configured to measure the expression levels E1 of circ-TMTC3 and E2 of circ-FAM117B in the patient's tumor tissue. The data processing unit is configured to: Calculate the IBCcirSig score R based on E1 and E2. Calculate the IBCcirSig score R' based on thresholds E1' and E2'. The efficacy of tumor IBC therapy in the patients was assessed by comparing the sizes of R and R'. The IBCcirSig score is obtained by weighting the multivariate Cox regression coefficients using circ-TMTC3 and circ-FAM117B. The formula for weighting the multivariate Cox regression coefficients is 1.001∗circ-TMTC3 + 1.048∗circ-FAM117B.
Citation Information
Patent Citations
Process for amplifying, detecting, and / or-cloning nucleic acid sequences
US4683195A
Process for amplifying nucleic acid sequences
US4683202A
Autocatalytic replication of recombinant RNA
US4786600A
Process for amplifying, detecting, and / or cloning nucleic acid sequences
US4800159A
Simultaneous amplification of multiple targets
US5422252A