EST-SSR molecular markers for identification of white Agrocybe chaxing cultivar ZJCXG001 and its application
By developing EST-SSR molecular markers based on the sequencing data of the Chrysin Mushroom transcriptome, combined with capillary electrophoresis technology, the problem of rapid identification of the white Chrysin Mushroom variety ZJCXG001 was solved, efficient and accurate variety distinction and protection were achieved, and the development of the Chrysin Mushroom industry was promoted.
Patent Information
- Application Number
- CN202210634120.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-06-07
- Publication Date
- 2025-08-19
- Estimated Expiration
- 2042-06-07
AI Technical Summary
The existing technology is difficult to quickly and accurately identify the white tea mushroom variety ZJCXG001, which leads to its low yield and long production cycle in the industrial development, and the traditional cultivation methods and strain aging are serious, hindering the development of the tea mushroom industry.
The EST-SSR molecular marker developed based on the sequencing data of the Chrysin Mushroom transcriptome was used to quickly identify the white Chrysin Mushroom variety ZJCXG001 through the combination of EST-SSR molecular marker composed of two pairs of primers, AbA001 and AbA079, and combined with capillary electrophoresis technology.
The accurate identification of the white tea mushroom variety ZJCXG001 can be achieved, which can effectively distinguish from the parent white tea No. 6 and other black and brown varieties, save costs, improve efficiency, protect the intellectual property rights of the varieties, and ensure the authenticity of the varieties in the production process of the tea mushroom.
Smart Images

Figure CN114875166B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of edible fungus molecular biology, and particularly relates to an EST-SSR molecular marker for identifying a white agaricus variety ZJCXG001 and an application thereof. Background Art
[0002] Agrocybe chaxin Cyclocybe chaxingu Belongs to the Basidiomycota, Agaricomycetes, Pseudo-Omphalaceae, Cyclops Cyclocybe . Also known as oil tea mushroom and tea mushroom, the commercial name is tea tree mushroom. The tea mushroom has a fat cap and crisp stem, a strong tea oil aroma, and a delicious taste. It is not only rich in nutrients and high in protein, but also contains 8 essential amino acids for the human body; it also has the effects of clearing heat, calming the liver, diuresis, and strengthening the spleen. Among the folk, some people use it to treat stomach cold, low back pain, kidney deficiency, frequent urination, edema and other diseases. It is known as the "Chinese Magic Mushroom". According to statistics, in 2020, the annual output of tea mushroom in my country was about 922,300 tons, ranking 8th among the main edible fungi varieties. It is one of the main cultivated edible fungi in my country and has important economic value. At present, the main production areas of dried tea mushrooms in China are Fujian and Jiangxi; Zhejiang, Hubei, Yunnan, Beijing and other provinces and cities are important production areas of fresh products. The cultivated varieties are mainly black tea No. 3, black tea No. 5, and Gutian No. 2, most of which are yellowish brown to black brown. With the continuous development of the Agrocybe edulis industry and the increasing demand of consumers for varieties, the white variety of Agrocybe edulis is becoming more and more popular among consumers. It has been cultivated in small quantities in Guangchang, Jiangxi and other areas.
[0003] Currently, the dominant white variety of Agrocybe chaxin in my country is Baicha No. 6. Due to its long production cycle, frequent crops, and low yield, industrial cultivation has yet to be implemented, severely hindering the development of the industry. Furthermore, traditional cultivation methods and the aging and degradation of strains are placing increasing demands on the quality of cultivated Agrocybe chaxin strains. The need exists for simpler, faster, and more accurate strain identification techniques to ensure that each batch is of the highest quality and most accurate strain. To establish a new edible fungus variety registration system and truly protect the intellectual property rights of Chinese varieties, mature variety identification techniques must be established to lay the foundation for new variety registration. Our research unit has conducted extensive preliminary work, using Baicha No. 6 as a parent and, through monospore hybridization, breeding a white Agrocybe chaxin strain, "Zhongjun Baicha No. 1" (ZJCXG001), suitable for industrial cultivation.
[0004] The rapidly growing amount of expressed sequence tags (EST) data in recent years has become an important source for simple sequence repeat (SSR) primer design. The resulting EST-SSR molecular markers are a new type of microsatellite marker developed based on expressed sequence tags. Compared to genomic SSRs, EST-SSRs, as a new type of molecular marker, rely on the conservation of EST-SSR flanking sequences and the stability of SSR evolution, ensuring the high interspecies compatibility of EST-SSR primers. EST-SSRs have the advantage of high interspecies transferability. The interspecies compatibility of EST-SSR primers can significantly increase the usefulness of these markers and expand the number of available markers. Traditional genomic-derived SSRs, however, have poor interspecies compatibility.
[0005] Existing reports on Agrocybe chaxing strain research primarily focus on strain genetic diversity and propagation methods, but there are no reports on the development of EST-SSR molecular markers based on Agrocybe chaxing. Therefore, given the current state of the Agrocybe chaxing industry, developing an accurate and effective Agrocybe chaxing strain identification system using modern molecular biology techniques is extremely important. Summary of the Invention
[0006] The first object of the present invention is to provide an EST-SSR molecular marker composition for identifying the white agrocybe cultivar ZJCXG001, and the second object of the present invention is to provide the application of the EST-SSR molecular marker composition in identifying the white agrocybe cultivar ZJCXG001.
[0007] The first object of the present invention is achieved in that the EST-SSR molecular markers used to identify the white agaricus variety ZJCXG001 are composed of the following two pairs of EST-SSR molecular markers: AbA001 and AbA079;
[0008] The primer sequences of the EST-SSR molecular markers are:
[0009] AbA001-F: ACCAACGACAGACAACACCA;
[0010] AbA001-R: CGAACCAGTCGTACCCTCAT;
[0011] AbA079-F: CTGGTACTGCGCAGCAAATA;
[0012] AbA079-R:TCGTTGGTGGATCTTCTTCC.
[0013] The second object of the present invention is achieved by applying the EST-SSR molecular marker in identifying the white Agrocybe aegerita variety ZJCXG001 according to the following steps:
[0014] S1. Mycelial culture: Transfer the Agrocybe chaxinga strain to be tested onto PDA solid culture medium, culture at 23-25°C for 7-9 days, and then collect the mycelials;
[0015] S2. Extraction of total genomic DNA: extracting genomic DNA from the mycelium, and detecting the concentration and quality of the total genomic DNA by ultraviolet spectrophotometry;
[0016] S3, EST-SSR molecular marker amplification: using the EST-SSR molecular marker composition to perform PCR amplification of the EST-SSR marker on the DNA extracted in step 2;
[0017] S4. Comparative analysis: The amplified products obtained in S3 were subjected to capillary electrophoresis to analyze the number and molecular weight size numbers of the allelic fragments amplified by the EST-SSR primers. The relative molecular weight of the allelic sites amplified by each EST-SSR primer can be determined by the molecular weight internal standard GS-500LIZ in capillary electrophoresis, and the numbering combination of different EST-SSR allelic fragments can be obtained. The strain that meets the EST-SSR allelic fragment numbering combination is the white tea firewood Agrocybe ZJCXG001 strain.
[0018] The beneficial effects of the present invention are:
[0019] 1. This present invention, based on transcriptome sequencing data from Agrocybe chaxingensis, provides two pairs of EST-SSR molecular markers specific for the white Agrocybe chaxingensis strain ZJCXG001. These markers are specific for the white Agrocybe chaxingensis strain ZJCXG001 among 10 tested strains (including BC6H, GC2H, HC3H, HC5H, LQM-NCYS, LQM23-SMYS, LQM25-SMYS, LQM7, LQM9, and ZJCXG001). The primer combination provided by this invention can quickly and easily distinguish the white Agrocybe chaxingensis strain ZJCXG001 from its parent, Baicha No. 6 (BC6H), and eight other dark-brown varieties. This approach offers advantages such as cost savings, improved efficiency, ease of use, and accurate results. It is suitable for the rapid identification of the white Agrocybe chaxingensis strain ZJCXG001 and has promising application prospects.
[0020] 2. The precise identification method of the white Agrocybe chaxini strain ZJCXG001 provided by the present invention can prevent the selected high-quality white Agrocybe chaxini strain from being mixed with other similar varieties during production, operation and market circulation, thereby effectively protecting its intellectual property rights. It is of great significance for the authenticity identification of varieties during the Agrocybe chaxini production process. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 The relative molecular weight peaks of alleles detected by primer AbA001 in the selected white Agrocybe chaxing strain ZJCXG001 and nine Agrocybe chaxing strains BC6H, GC2H, HC3H, HC5H, LQM-NCYS, LQM23-SMYS, LQM25-SMYS, LQM7, and LQM9, respectively;
[0022] Figure 2 The relative molecular weight peaks of alleles detected by primer AbA079 in the selected white Agrocybe chaxini strain ZJCXG001 and nine Agrocybe chaxini strains BC6H, GC2H, HC3H, HC5H, LQM-NCYS, LQM23-SMYS, LQM25-SMYS, LQM7, and LQM9, respectively;
[0023] Figure 3 This is the UPGMA cluster tree of genetic distance of 10 Agrocybe chaxing strains constructed based on EST-SSR molecular markers. DETAILED DESCRIPTION
[0024] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments, but the present invention is not limited in any way. Any changes or improvements made based on the teachings of the present invention fall within the scope of protection of the present invention.
[0025] The present invention provides an EST-SSR molecular marker for identifying Agrocybe chaxingu varieties, which is composed of a pair of EST-SSR molecular markers AbA001 and AbA0792;
[0026] The primer sequence information of the EST-SSR molecular marker is shown in Table 1.
[0027] Table 1 Information of two pairs of EST-SSR marker primers
[0028]
[0029] The EST-SSR molecular marker combination used to identify Agrocybe chaxingu varieties consists of the following two pairs of EST-SSR molecular markers: AbA001 and AbA079;
[0030] The primer sequences of the EST-SSR molecular markers are:
[0031] AbA001-F: ACCAACGACAGACAACACCA;
[0032] AbA001-R: CGAACCAGTCGTACCCTCAT;
[0033] AbA079-F: CTGGTACTGCGCAGCAAATA;
[0034] AbA079-R:TCGTTGGTGGATCTTCTTCC.
[0035] The number of allelic fragments and molecular weight information of the two pairs of SSR primers are as follows:
[0036] Table 2 Information of allelic fragments amplified by EST-SSR marker primers
[0037]
[0038] The present invention also provides the use of the EST-SSR molecular marker in identifying Agrocybe chaxingu varieties. The specific method for identifying Agrocybe chaxingu varieties is implemented by the following steps:
[0039] S1. Mycelial culture: Transfer the Agrocybe chaxinga strain to be tested onto PDA solid culture medium, culture at 23-25°C for 7-9 days, and then collect the mycelials;
[0040] S2. Extraction of total genomic DNA: extracting genomic DNA from the mycelium, and detecting the concentration and quality of the total genomic DNA by ultraviolet spectrophotometry;
[0041] S3, EST-SSR molecular marker amplification: using the EST-SSR molecular marker composition to perform PCR amplification of the EST-SSR marker on the DNA extracted in step 2;
[0042] S4. Comparative analysis: The amplified products obtained in S3 were subjected to capillary electrophoresis to analyze the number and molecular weight size numbers of the allelic fragments amplified by the EST-SSR primers. The relative molecular weight of the allelic sites amplified by each EST-SSR primer can be determined by the molecular weight internal standard GS-500LIZ in capillary electrophoresis, and the numbering combination of different EST-SSR allelic fragments can be obtained. The strain that meets the EST-SSR allelic fragment numbering combination is the white tea firewood Agrocybe ZJCXG001 strain.
[0043] The present invention also provides a kit for identifying the white Agrocybe chaxing variety ZJCXG001, wherein the kit only contains a specific primer combination of the EST-SSR molecular marker combination.
[0044] Example 1 Identification of Agrocybe leucogensis ZJCXG001 strain
[0045] 1. Test methods
[0046] 1. DNA extraction
[0047] Ten tested Agrocybe chaxing strains (BC6H, GC2H, HC3H, HC5H, LQM-NCYS, LQM23-SMYS, LQM25-SMYS, LQM7, LQM9, and ZJCXG001) were transferred to potato dextrose agar solid medium and cultured at 25°C for 7-9 days. Mycelia were collected and genomic DNA was extracted from Agrocybe chaxing samples using a magnetic bead plant genomic DNA extraction kit equipped with an automated workstation.
[0048] 2. PCR amplification
[0049] Two pairs of EST-SSR molecular markers were used to perform PCR amplification of EST-SSR markers on the extracted DNA;
[0050] The PCR amplification system was as follows: total volume 10ul, including: 2×Taq PCR Master Mix 5ul, 10umol / L SSR marker forward primer and reverse primer 0.5uL each, template DNA 1uL, ddH2O 3uL.
[0051] PCR reaction conditions: pre-denaturation at 95°C for 5 min; 10 cycles of denaturation at 95°C for 30 s, gradient annealing at 62-52°C for 30 s, and extension at 72°C for 30 s; 25 cycles of denaturation at 95°C for 30 s, annealing at 52°C for 30 s, and extension at 72°C for 30 s; and finally, extension at 72°C for 20 min. To ensure the accuracy of identification, the experiment was repeated three times.
[0052] 3. Detect the amplified product by capillary electrophoresis:
[0053] 1) Mix Hi-Di Formamide buffer and GeneScan 500LIZ Size Standard internal standard reagent at a ratio of 13:1 to prepare a mix;
[0054] 2) Aliquot the mix into a 384-well reaction plate and add 9 μl of mix to each well;
[0055] 3) Add 1 μl sample template to the 384-well plate and centrifuge at 4000 rpm.
[0056] 4) Heat the mixing plate at 95°C for 5 minutes using a metal bath heater to pre-denature the plate. Immediately place the plate at -20°C.
[0057] 5) After cooling, take out, centrifuge at 4000 rpm, thaw and mix;
[0058] 6) Perform capillary electrophoresis using a 3730 sequencer, loading 2 μl of sample and 6 μl of bromophenol blue, at 300 V for 12 minutes.
[0059] 2. Result Analysis
[0060] 1. Comparative analysis of fluorescence detection peak graphs of capillary electrophoresis
[0061] The electrophoresis detection peak diagrams of the other 9 Agrocybe chaxing strains were compared with the electrophoresis detection peak diagram of the white Agrocybe chaxing strain ZJCXG001 ( Figure 1-2 ), the peaks of each fluorescent marker of the white tea-firewood Agrocybe ZJCXG001 strain and the other nine species did not overlap and were clearly distinguishable. Figure 1 The results of primer AbA001 amplification showed that the sizes of the corresponding fragments of ZJCXG001 and 9 Agrocybe chaxingu strains BC6H, GC2H, HC3H, HC5H, LQM-NCYS, LQM23-SMYS, LQM25-SMYS, LQM7, and LQM9 were 157, (157, 161), 153, 153, (157, 161), 153, 155, 153, 157, and 153, respectively; Figure 2 The results of primer AbA079 amplification showed that the corresponding fragment sizes of the white Agrocybe chaxing strain ZJCXG001 and nine Agrocybe chaxing strains BC6H, GC2H, HC3H, HC5H, LQM-NCYS, LQM23-SMYS, LQM25-SMYS, LQM7, and LQM9 were 225, 228, 216, 216, 228, 222, 222, 222, 228, and 216, respectively;
[0062] Figure 1 and Figure 2 The results showed that the two pairs of EST-SSR molecular marker primers provided by the present invention can accurately distinguish the white Agrocybe aegerita ZJCXG001 strain from its parent white tea No. 6 (BC6H) and other 8 dark brown varieties.
[0063] 2. Analysis of band combinations amplified by two pairs of SSR primers
[0064] The allelic fragments amplified by two pairs of EST-SSR primers in 10 tested Agrocybe chaxing strains were coded according to their molecular weight and numbered. The corresponding number combinations for BC6H, GC2H, HC3H, HC5H, LQM-NCYS, LQM23-SMYS, LQM25-SMYS, LQM7, and LQM9 were (3+4) / 4, 1 / 1, 1 / 1, (3+4) / 4, 1 / 2, 2 / 2, 1 / 2, 3 / 4, and 1 / 1. The strain matching number combination 3 / 3 was the white Agrocybe chaxingxing strain ZJCXG001.
[0065] 3. Cluster analysis
[0066] The genetic diversity of 10 Agrocybe chaxini strains was analyzed based on the polymorphic fragments amplified by two pairs of EST-SSRs. Based on Nei's genetic distance, the UPGMA clustering tree of the 10 Agrocybe chaxini strains was constructed ( Figure 3 ).from Figure 3 It can be seen that the two pairs of primers provided by the present invention distinguished the white Agrocybe chaxinga ZJCXG001 from the other nine tested Agrocybe chaxinga species on different cluster branches, and the white Agrocybe chaxinga ZJCXG001 species was a separate branch, which was completely distinguished from its parent Baicha No. 6 (BC6H) and the other eight dark brown varieties.
[0067] It can be seen that the EST-SSR primer combination of Agrocybe chaxing provided by the present invention can be used for the identification of the white Agrocybe chaxing strain ZJCXG001.
Claims
1. An EST-SSR primer combination for identifying the white Agrocybe chaxini strain ZJCXG001, characterized in that: The EST-SSR primer combination consists of the AbA001 primer pair and the AbA079 primer pair, which are: AbA001-F: ACCAACGACAGACAACACCA; AbA001-R: CGAACCAGTCGTACCCTCAT; AbA079-F: CTGGTACTGCGCAGCAAATA; AbA079-R:TCGTTGGTGGATCTTCTTCC.
2. A method for using the EST-SSR primer combination for identifying the white agaricus variety ZJCXG001 strain according to claim 1, characterized in that: To do this, follow these steps: S1. Mycelial culture: Transfer the Agrocybe chaxinga strain to be tested onto PDA solid culture medium and culture at 23-25°C for 7-9 days before collecting the mycelials. S2. Extraction of total genomic DNA: Extract the genomic DNA from the mycelium obtained in step S1, and detect the concentration and quality of the total genomic DNA by UV spectrophotometry; S3, PCR amplification: PCR amplification of the DNA extracted in step S2 is performed using the EST-SSR primer combination; S4. Comparative analysis: The amplified products obtained in step S3 are subjected to capillary electrophoresis to analyze the amplified allelic fragments and the number thereof by the AbA001 primer pair and the AbA079 primer pair. The molecular weight of each allelic fragment is determined by the internal molecular weight standard GS-500LIZ during capillary electrophoresis to obtain an allelic fragment combination. If the combination amplifies one allelic fragment each by the AbA001 primer pair and the AbA079 primer pair, and the molecular weights correspond to number 3 in Table 1, i.e., the combination corresponds to number combination 3 / 3, the Agrocybe aegerita strain to be tested is the white Agrocybe aegerita strain ZJCXG001. Table 1 is as follows: 。 3. A kit for identifying the white agrocybe cultivar ZJCXG001 strain, characterized in that: A specific primer combination containing only the EST-SSR primer combination according to claim 1.