A DNA selection marker related to dwarfing of rice stem base and its application

Abstract

The present invention discloses a DNA selection marker related to dwarfing of the base of rice stalks, wherein the DNA selection marker is a marker developed based on the InDel site of the dwarfing control gene dJH3017 of the base of rice stalks and completely linked to the dwarf phenotype, wherein the InDel site is located on the second chromosome of rice 16361797-16361807. The present invention also discloses a kit, which comprises a primer combination of the DNA selection marker related to dwarfing of the base of rice stalks. The present invention also discloses an application of the DNA selection marker related to dwarfing of the base of rice stalks in (1) detection or identification of dwarfing traits of the base of rice stalks; and / or (2) auxiliary rice breeding. The present invention develops a related DNA selection marker and application based on the InDel site of the dwarfing control gene of the base of rice, which has important utilization value in rice dwarf breeding, lodging resistance breeding and high-yield breeding.

Description

Technical Field

[0001] The invention relates to the field of molecular genetic breeding, and in particular to a DNA selection marker related to dwarfing of the base of rice stems and an application thereof. Background Art

[0002] The rice dwarf gene can reduce the height of rice plants, making them less likely to fall over and increasing yields. It is a favorable mutation trait of rice. The application of the rice green revolution gene SD1, which began in the mid-20th century, significantly reduced the height of rice plants, partially solving the contradiction between high rice yield and lodging. At present, in my country's hybrid rice, the dwarfing source of rice almost all depends on SD1, and with the promotion of more and more indica-japonica hybrid rice. In addition, it was found in rice practice that even if hybrid rice contains homozygous SD1 genes, the plant height of some hybrid rice combinations is too high, and the heavy weight of the panicle leads to rice lodging and yield reduction, making the contradiction of excessive plant height of some combinations more prominent. In recent years, Chinese scientists have cloned a semi-dominant dwarf gene SBI (Shornted Basal Internodes) that controls rice plant height, which partially enriched the dwarfing sources of rice. The discovery and use of more dwarfing sources of rice can provide Chinese breeders with a variety of options to avoid the homogeneity of germplasm. Therefore, in order to further expand the utilization of dwarf sources of rice, exploring new dwarf gene resources and developing new DNA selection markers based on them remains an important direction in rice molecular genetic breeding research. Summary of the invention

[0003] The technical problem to be solved by the present invention is to provide a molecular marker developed based on the InDel site of a new rice stem dwarfing control gene dJH3017 and completely linked to the dwarf phenotype and its application, so as to facilitate and accelerate the introduction of the dwarf control gene dJH3017 into more excellent rice varieties and realize the effective utilization of the gene.

[0004] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0005] On the one hand, the present invention provides a DNA selection marker associated with dwarfing of rice stem base, the DNA selection marker is a marker developed based on the InDel site of rice stem base dwarfing control gene dJH3017 and is completely linked to the dwarf phenotype, and the InDel site is located at 16361797-16361807 of rice chromosome 2.

[0006] As a further improvement of the present invention, the DNA selection marker is an InDel marker, a KASP marker, a PARMS marker, a CAPS marker or a dCAPS marker.

[0007] Furthermore, the size of the InDel-marked PCR product is 50 bp-10 kb, preferably 50 bp-1000 bp, and more preferably 100-200 bp.

[0008] Furthermore, the primer combination of the DNA selection marker is:

[0009] ID3017F:TCTTCCAGGGACTACGTGAA;

[0010] ID3017R:CTTTGGGATTCCACGAATA.

[0011] On the other hand, the present invention also provides a kit comprising the above-mentioned primer combination of the DNA selection marker associated with dwarfing of the base of rice stems.

[0012] In another aspect, the present invention further provides an application of the above-mentioned DNA selection marker related to dwarfing of rice stem base, wherein the application is:

[0013] (1) Application in the detection or identification of dwarfing traits at the base of rice stems;

[0014] and / or (2) application in assisting rice breeding.

[0015] Furthermore, the application in assisting rice breeding is to identify whether to introduce the mutant gene of the dJH3017 gene into other rice varieties, wherein the mutant gene is missing 11 positions at 16361797-16361807 of the second chromosome of rice; and the rice breeding is:

[0016] (1) Breeding of dwarf rice;

[0017] and / or (2) rice breeding for lodging resistance;

[0018] and / or (3) high-yield rice breeding.

[0019] Furthermore, the other rice varieties are rice varieties that have the SD1 gene but whose plant height is still too high.

[0020] The present invention develops a related DNA selection marker based on the InDel site of the rice stem base dwarfing control gene, and detects it, and confirms whether the mutant gene of the stem base dwarfing control gene dJH3017 exists and whether it is a homozygous mutation according to the polymorphism of the detection result. The marker can accurately identify whether the mutated dJH3017 is transferred into a rice variety (such as Basmati), and the above functional markers that are completely linked to the dwarf phenotype have important utilization value in rice dwarf breeding, lodging resistance breeding and high-yield breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] The above is only an overview of the technical solution of the present invention. In order to more clearly understand the technical means of the present invention, the present invention is further described in detail below in conjunction with the accompanying drawings and specific implementation methods.

[0022] Figure 1 This is the sequencing comparison of the wild type and the dwarf mutant Jingjiai on the dJH3017 gene;

[0023] Figure 2 This is a diagram showing the results of detection and identification using marker ID 3017. DETAILED DESCRIPTION

[0024] The following examples further illustrate the content of the present invention, but should not be construed as limiting the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the method, steps or conditions of the present invention all belong to the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

[0025] The present invention is based on the research results of the applicant at the same time. The applicant cloned a new gene LOC_Os02g27620 (gene sequence shown in dJH3017-Seq ID No: 1) that controls the dwarfing of the base of rice stems, which encodes inositol polyphosphate 5-phosphatase. In the process of cloning the gene, it was found that the rice stem base dwarfing gene dJH3017 had an 11 bp deletion at this site (5269-5279 of Seq ID No: 1) after mutation at the second chromosome of rice at 16361797-16361807. Therefore, the development and application of DNA selection markers were carried out based on this site.

[0026] Example 1 Cloning of rice stalk base dwarfing control gene and determination of mutation site

[0027] 1. Obtaining a rice culm base dwarfing mutant

[0028] Jingjiai is a dwarf mutant obtained by irradiating Jinghui 3017 with cobalt 60. Jinghui 3017 is a disease-resistant and high-compatibility rice restorer line. It contains SD1, but its plant height is still very high, about 1.5 meters when planted in Hangzhou. The plant height of the hybrid combination it is matched with is also too high. The dwarf mutant obtained by irradiating Jinghui 3017 with cobalt 60 has a plant height of about 1.0m.

[0029] 2. Gene Positioning

[0030] Preliminary positioning revealed that the dwarf gene of Jingji's dwarf gene is linked to RM71, RM324, RM5521 and RM475 located on the second chromosome.

[0031] Further positioning revealed that the dwarf gene was located between RM324 and D223A, and was linked to RM324 and D223A.

[0032] 3. Gene Sequencing and Cloning

[0033] Combining gene resequencing and DNA next generation sequencing verification Figure 1 , cloned the gene LOC_Os02g27620 (dJH3017) that controls the dwarf phenotype of rice (rice stem base dwarfing control gene), which encodes inositol polyphosphate 5-phosphatase.

[0034] like Figure 1 As shown, the sequencing comparison results of the wild type and the dwarf mutant Jingjiai on the dJH3017 gene showed that the mutant gene was missing 11 bases at positions 5269-5279 of Seq ID No: 1.

[0035] dJH3017 is allelic to d12, d32 and d50, but the mutation site of dJH3017 is closer to the back of the gene, and the dwarfing symptoms are moderate, making it more suitable for breeding.

[0036] Example 2 Development of DNA selection markers based on mutation sites

[0037] The present invention designs Indel primers around the 11 bp deletion on the second chromosome 16361797-16361807, the PCR product size is 50 bp-10 kb, the optimized product size is 50 bp-1000 bp, and the more optimal product size is 100-200 bp.

[0038] After a large number of molecular marker primer designs, the present invention screened a group of primer combinations ID3017, which can easily amplify the InDel site. After PAGE electrophoresis or capillary electrophoresis, the polymorphic difference of the InDel site can be easily detected. The PCR product size differs by 10 bp. The primer combination is:

[0039] ID3017F:TCTTCCAGGGACTACGTGAA;

[0040] ID3017R:CTTTGGGATTCCACGAATA.

[0041] The above embodiment provides an InDel marker based on the functional InDel site Chr2: 16361797-16361807, but due to the cloning of the gene and the discovery of the mutation site, a variety of DNA selection markers can be developed based on this, including but not limited to the InDel marker itself, which can be a KASP marker, a PARMS marker, a CAPS marker, a dCAPS marker, etc.

[0042] In addition, corresponding to the above molecular markers, a kit can be developed, which includes a primer combination of the above DNA selection marker related to dwarfing of rice stem base.

[0043] Example 3 Application of DNA selection markers

[0044] The mutant gene is used to improve Basmati (Basmati, Basmati rice, Indian fragrant rice) so that the plant height is reduced.

[0045] Using the hybridization of dwarf and Basmati, the Basmati / dwarf F3 segregating population was taken as an example, and the marker ID3017 obtained in Example 2 was used for detection and identification.

[0046] Materials and methods

[0047] 2X PCR MIX (VAZYME) 10 μL, Primer ID3017F (10 μM) 1 μL, Primer ID3017R (10 μM) 1 μL, DNA template 50 ng, H 2 O to 20 μL. Program: 95℃, 20s; 55℃, 30s; 72℃, 30s. Cycles 30-35 times, 6% PAGE gel, silver staining detection.

[0048] Test results such as Figure 2 As shown, the wild type - Basmati (tall): 144 bp (L11), the mutant dwarf - Jingjidwarf (dwarf) 134 bp (L12). L1-L10: dwarf F3; L13-L25: dwarf F3; L26-L32: tall F3. Among them, L1-L32 refers to the upper number 1-32.

[0049] As can be seen from the test result diagram, the mutated dJH3017 has been transformed into the rice variety Basmati, and the homozygous mutation can be directly identified in F3.

[0050] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any form. Those skilled in the art may make some simple modifications, equivalent changes or modifications using the technical contents disclosed above, which all fall within the protection scope of the present invention. Sequence Listing <110> China National Rice Research Institute <120> A DNA selection marker related to dwarfing of rice stem base and its application <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 6919 <212> DNA <213> Oryza sativa (rice) <400> 1 cctacctgct tgtgttgtgc cggccacctc gtcctcgtct tcctctccga tctcccccca 60 atggcggatc ccggcgactc cgccgcgtcc ccctccccgt gggacgacct ccccgacgac 120 ttcttcctct ccgcctccat ctcctcccct tccccttcca cctccactcc ccctccccct 180 tcccccatcc cctccacctc cccgcgcccc accctccgct cctcctccct cccgcccgcc 240 tccaccccct ccccctcctc ctctgcctcc tcctcctctg gctccctcca ccacctccac 300 cccacccact ccctcccggc cttctccgcc gcggccgcgg cggcggcagc cgacgcctgg 360 cccccgccac cgggggcgca ccactccggc tccctccagg agttcgccgc ccccgcgtcc 420 tcctccgcga cccgcccgcc cccgcgcgcc gccgtgcgcg ccgaccgccc gccgccgctc 480 gacctgcgcc cgcgcccgcc cagggaatcc caggctggcg ccgcgctccg cgcgatcgcc 540 gtggacgggg ccaccggctc gcacctgtgg gccgtcggcg acgccggcgt cagggtgtgg 600 agcctcgccg acgccttccg cgcgcccgcg tctcggcaga ggtggggcga cgaggctgcc 660 gcgccgttcc gcgagtcgcg caggacgcag ccggcgctgt gcctcgtggc tgacccttgc 720 cgcggcgttg tgtggagcgg ccacgccaat ggctggatca tggggtggag cgccgatcca 780 ggaggactag aggccgggga gtgcattgcc tgggaagctc accgtggacc agtattcgca 840 ttgaccacct ctctatatgg taatctcct taactatgtt gtagcgtta aattttatca 900 tatatatgca gtaactatac aacaatacag ccgtttaatg caaatccaaa agttctgcaa 960 aaagaaagaa gaagattgt aatgtggc aaaacacc aattggtgga gttttctcc 1020 tcattaggga cccactttat cataccttac tgtacaaaaa tgaagtacgt agaaatcgta 1080 gctccaacta atcaatccat tgaaaactat tccaggagtc tgagctagtg gccatgtaga 1140 tgttgctgta aactctcctc tttgttctg cagtccacca tgagattcta ctccaaacta 1200 atgtttgtat ttgtgcttac catagttttc agtcttatat acttccgatt ttgtcttttt 1260 cacagtttat gccttttttc tggttttaat gtgatgcaac attatgtgtt acttagattc 1320 tttttactct caacctcta gatatgta cttcatataa atctatgttc tgcagggcat 1380 1440 ataattcttc aacatcatct agaatatagc aatcatgttt atggtgctca ttatcgtatc 1500 tagaataataa ttatttcatg gtgcccaacg ttcaagcagg taaataat atattctagc 1560 aatcaatgca caaggactta aattctttcc atttagtaaa acctaggtac taaggtatga 1620 agacagat atcatatctt tttgtccgca gttaatatgt ggacagcaat gcattgtcgt 1680 caaattacac tcatagaca cgaacctttc acttaaggag cctttacatt taaggtgcag 1740 actcactgct tgtgttttgg cagctttcct tcatagttgt tgtcttttaa atgcaaaaat 1800 gattatttt ctctttgcat gcatcatagg tgatttgtgg tctggctctg aagggggagt 1860 aatcaaagtt tggtatgaag aaagtaattga gaagtccctt tctttacaaa gagaagaaaa 1920 gcgtaagacc tccttttag ttgaaagatc attcattgac cttagagcca tggtcagtga 1980 tggaggggcc tgtcccttgc ctgccgtaga tgtaaaactt ctgttgtctg acaattctag 2040 atcaaagta tggagtgctg gttacctctc acttgcactc tggtacactt cgtgcatcca 2100 ttcatctgtt agtgttgcgt ttggctgaca ttagtccagc tgtttgtata tttctgttat 2160 attcttgtct attttgccat atagggattc ttgcaccaag gagcttctga aagtgattag 2220 cgtggatggc caagtcgata ctcgttttga tatcttatct tctcaggatc catttggcta 2280 tgaaacaaag caaaaccttt tctctgctcc aggaaagat aaagctcgca gtcctgttgg 2340 atttttccag agatcacgaa atgctttaat gggagcggct gatgcagtcc ggagagttgc 2400 tgctaaagca ggatttggag atgattctca aagaatagaa gcattagcaa tgtcaattga 2460 tgggatgatc tggacagggt ctgcaaatgg atgtcttgct cgatgggatg gcaacggtaa 2520 ccgtttgcaa gagtttcagc atcatttgtg ttctgttcaa agcattttca gctttgggac 2580 aagaatatgg gccggttaca tggatggtag tattcagctg ttggacttgg aaggtaactt 2640 actaggaggc tggatcgcac atagcagtcc agttctgagt atggctgttg gaggttcata 2700 catctttaca atggctggtc atggcggagt ccgtggatgg aatttgtcat ctccagggcc 2760 tattgacaac attatgcgtt ctactttgat tgaggctgag ccattataca aacaatttga 2820 atacatgaaa gtgttggtgg gttcttggaa tgtcgggcaa gaaaaggcat cttatgagtc 2880 actaagagct tggctaaagt taccgacacc agaggttggg ttagtggtag ttggattgca 2940 ggaggtggac atgggtgctg gttttcttgc aatgtctgca gctaaagaaa cagtaagtca 3000 agtttaagtt ctagtttttt taattaaagt tatttgaaca catgtttttg ttatttactt 3060 gcacttagtc atctgctact attatacaga ccaaatccta gtaacactga acaagagtgt 3120 tgttagacat cttgctcttg ttgattttt ttgttgaata atcattatca ttatgtataa 3180 gatacctcgt tgtacaaatg tacaatgtta tcttgaccac aaaaaaatac gcttgtttga 3240 caggctgtac ctctttctc tatcagtatg attagagtta agcttattttt tgccacagtt 3300 ttattaaatg tctacaatac aacactgatt ggcacaggat ccatgtgcca tccttgcaat 3360 gagtggcagc aatggatga aactcaatga cacaatgatt taaccttgtc ttgcactctt 3420 gctaaagatc gttctgccgt tagacttccc aagaatatta ataaagtata acatgaaact 3480 ggcatggtt ttgctacttc taatcctgat acttttgtac gtccacttgc tttaggttgg 3540 gctagaggga agcccaaacg gagattggtg gttggatgca attgggcagc agttaaaggg 3600 ttactctttt gagcgtgttg gctcgaggca gatggctgga ttgcttatct gtgtatggta 3660 atctgttcag gacttatttt atcctgcagc ttcatctgcc ttttgtttgt gtataaatta 3720 ttcagtttct tctttttctc agggtcagaa cacatcttaa gcagttcatt ggtgatattg 3780 ataatgctgc ggtagcatgt ggattagggc gagcaatcgg caacaaggta cttctgttat 3840 cttattgccc cactctttct tggcgcaaga tgagcttgaa atgttgtta tgaggcattt 3900 gacttatcaa acatatcatg acaaatttg ttttgatcta agcatttcat gctttagcca 3960 tcatatttat tggagatgtg ttcatattct ggaacatttg agttaagggg gggaatacct 4020 ttgctggcca ctatatgcca aaactccctt tcatgtttaa gcacaatgct gattagttca 4080 ttctagagaa aggtagcaag gaggataaga tataccatat aggcatacag tatataataa 4140 aaaggaatat atgctatg atggaaatgt agtgtgacag caagtgctat ttgatttgtt 4200 ttctttcatg cattcacatg ttgaacattg tttgtttact tgtttaaaat gaacatcttg 4260 gaagttctga aagttcaagt tgttaacgat gcactaagca aaaagattat tcacatttgt 4320 ccccatattc atttggtagc agttgttgtg caaaaccaat aaatcattgt taccaagatg 4380 atatctggtg gtttgtgcat acaattaatg aatgagaggt gtgcaatact gatcagaaaa 4440 tgaaaaaaaa aagacaaatt ttaaaacaca ttatgggcct aaaatgtaac cacccactag 4500 ttctgttatt tttctggggg agtacagata ttacttcaaa aggactgtat tctgtcttat 4560 ctgctgcttt gttcatgtat gcctatatta gggagcagtg ggattgagga tgagaataca 4620 tgataggagt atttgctttg taaattgcca ttttgctgct catatggaag ctgtgagtcg 4680 acggaatgaa gattttgacc atgtctttag aacaatgacc tttgccaccc cttcgagtgg 4740 aataatgaca acatcaggtg tttgttcaac cttttcccat tatttttcag tattttccaa 4800 tgggcattca agtcaaatga cctgtaaatt tgttgtgata ttacaatcag caatgagcaa 4860 atcttataca ctgttacttg ttttggtggt cttgcagttt ctagttctac tggccagctt 4920 cttcgaggag caaatgtatg gtgtattaat gttggttcat tacattttct cggtggatag 4980 ggagtagatt ctcatcttga tatactaagt tgttcctatt ataatttaca gggatcaaga 5040 atgcctgagt tgtcagacac ggacatgatt gtctttcttg gtgacttcaa ttaccgcctt 5100 tatgatattt cctatgatga tgcaatgggc ttagtttccc ggagatgctt tgactggcta 5160 aaaaataatg accaactgcg agcagaaatg agatctggga gagtcttcca gggactacgt 5220 gaaggggatt tcaagtttcc ccctacatac aaatttgaga aacatacagc aggcttatca 5280 ggtatcttac tttgtttttt attcgtggaa tcccaaagta catataaaga tcatcacctt 5340 tatttgtcat atagggtatg atagcagtga gaagaggcgc attcctgcct ggtgtgacag 5400 aatcctatat cgtgatagcc gagttagttc agggaatgag tgttccttgg attgtcctgt 5460 ggtttcttca atatcactgt aagttatttg ttgtgcatgt ttttttttaa cccgaaaaag 5520 cttaaaatat gtcaatacct tgttattatg ttttccaggt atgactcttg catggaagca 5580 acagatagtg atcacaaacc tataaaatct gtgttcaatt tggatattgc ttatgttgac 5640 aaacagacaa tgaggcagaa atatgtggag ctaatgagct caaataataa agtggtgcat 5700 ttgcttcagg aacttgaagc attccctgga gtaaataata atattctaa catcatcttg 5760 cagatcgga atccatctgt tgtgaaattg caaacagaa caggaatcat cgcttgtttt 5820 gagatcattg vakaagcacc aaatttgtcc agcacattt tctctgctt tcctgcatgg 5880 ctaaaggtga gtcaatgctt tgtctgactc cttttactgt atttttatta aaataatcta 5940 atactagcaa cgtacaaaa ctttgcacga ccgaatttct catgttttac atgggcacaa 6000 ctgcagagta gtagaaatat tagtctcttc agtatcaga gttatgacaa aagagagcat 6060 atggtttcag ttatactccc tccgttcag gttatagac gtttgactt tggtcaagt 6120 storm chaatttgat windows chatter gchattat windows 6180 ttagtttatt aaatcaataa ttgaatatat ttgataata aatttgctt gggttgaaaa 6240 tgttattatt gtttctaca aacttagtca aacttgaagt aatttgactt tgaccaagt 6300 caaaaacatc ttataacctg aaacggaggt agtagtagat tgacgcgttg gcattagtaa 6360 agcagactc cagaatttgt tattactgt ttgctgtt ttattctca ccattattaa 6420 ttcactgttg tgagcttaat gttttgaaaa ctgtgggcat atattcaata taggtctctc 6480 cagcagtcgg cataatatct ccgggacaga cggtagaggt cactttgcag cacagagacc 6540 tgcatagcca acaaaactat aatggaactt cattggatat tttgcctggt ggagctaccc 6600 aacaaaaggc agcaactgtt tttgcgaaaa taactggagt atattcaaca gttgcaaaat 6660 attacgaaat acatgtacaa caccagaact gcaggagcac attgccatcg agaggttata 6720 acttaggtga ccggtttttt taattttgag tttggtatca ggaatttagg aaatgtatgt 6780 tgtatcaaat gttctttttg agtgaagtca caaaatcaag gctttctact accctcaaca 6840 tgtgtatttt caagagagga aaattgtaaa cagtgtagca tacaacagcc caaattttct 6900 actgggtttc ggtgtggaa 6919 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 tcttccaggg actacgtgaa 20 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <400> 3 ctttgggatt ccacgaata 19

Claims

1. A kit, characterized in that: A primer combination comprising a DNA selection marker associated with dwarfing of the base of rice stems; The DNA selection marker is based on the rice stem base dwarfing control gene dJH3017 A marker developed from an InDel locus located at 16361797-16361807 on rice chromosome 2 and completely linked to the dwarf phenotype; The primer combination of the DNA selection marker is: ID3017F:TCTTCCAGGGACTACGTGAA; ID3017R: CTTTGGGATTCCACGAATA.

2. The use of the kit according to claim 1, characterized in that The application is to detect or identify the dwarfing trait at the base of rice stems, and to confirm the dwarfing control gene at the base of the stems according to the polymorphism of the detection or identification results. dJH3017 The mutant gene exists and is a homozygous mutation.

3. The use of the kit according to claim 1, characterized in that The application is an application in assisting rice breeding, wherein the assisting rice breeding is to use the primer combination in the kit according to claim 1 to detect the stem base dwarfing control gene dJH3017 The mutant gene exists and is a homozygous mutation, and the rice breeding is: (1) Breeding of dwarf rice varieties; and / or (2) rice breeding for lodging resistance; and / or (3) high-yield rice breeding.

Images