SNORD99 as a marker for the diagnosis of endometrial cancer and its application

Abstract

The present invention relates to the field of molecular biology and tumor marker medical technology, and in particular to SNORD99 as a diagnostic marker for endometrial cancer and its application. An application of a molecular marker in the preparation of a product for diagnosing endometrial cancer, wherein the molecular marker is SNORD99, and its nucleotide sequence is shown in SEQID No.1. The marker is highly expressed in human clinical endometrial cancer tissues and is specifically highly expressed in human endometrial cancer cell lines HEC‑1B and ISHIKAWA. The present invention provides the application of SNORD99 in the preparation of a drug or pharmaceutical composition for treating endometrial cancer. As a marker for the diagnosis of endometrial cancer, SNORD99 provides a molecular target for the treatment of endometrial cancer and can be used in the preparation of anti-tumor drugs.

Description

Technical Field

[0001] The present invention relates to the field of tumor marker medical technology, and in particular to SNORD99 as a marker for diagnosing endometrial cancer and its application. Background Art

[0002] Endometrial cancer is one of the most common tumors of the female reproductive system. Its incidence rate is increasing year by year, ranking second among gynecological malignancies, and its case fatality rate ranks third among gynecological malignancies. Although endometrial cancer may have obvious symptoms in the early stages, the treatment effect of late-stage endometrial cancer is poor, the 5-year survival rate is low, and it is easy to relapse and metastasize. Clinically, if it can be diagnosed and treated early, and comprehensive treatment methods such as radical surgery or targeted molecular drug therapy are reasonably performed, the survival rate, quality of life and survival time of patients with endometrial cancer can be greatly improved. At present, the cause and pathogenesis of endometrial cancer have not been clearly defined, and there are no effective molecular markers for the diagnosis and treatment of endometrial cancer in clinical practice. Finding new molecular markers is of great significance for the mechanism research and clinical application of endometrial cancer.

[0003] SnoRNA is a type of small non-coding RNA widely distributed in the nucleolus of eukaryotic cells. It mainly exists in the intronic regions of protein-coding genes and non-protein-coding genes. It is 60-300 nt in length and can bind to ribonucleolar ribonucleoproteins to form snoRNPs complexes to participate in rRNA processing, RNA splicing and translation regulation, and oxidative stress response. SnoRNA has conserved structural elements and is divided into three major categories: box C / D snoRNA (SNORD), box H / ACAsnoRNA (SNORA) and MRP RNA. Among them, box C / D and box H / ACA are the main types of known snoRNAs, which guide the 2'-O-methylation and pseudouracilization modification of ribosomal RNA respectively by base pairing. Studies have shown that snoRNAs may cause functional defects by modifying ribosomal RNA, thereby causing normal cells to transform into tumor cells and participate in the occurrence and development of tumors. It has been reported that they are involved in regulating a variety of basic human pathological processes including brain and lung diseases, nervous system diseases and tumors. More and more evidence shows that snoRNAs are involved in regulating the occurrence of various tumors, promoting tumor cell proliferation, regulating cell cycle progression, and participating in regulating tumor metastasis, etc. In general, further research on the role of snoRNA in the occurrence and development of gynecological malignancies, especially endometrial cancer, will be of great help for the early diagnosis and prognosis of endometrial cancer. Summary of the invention

[0004] In view of the problems existing in the prior art, in order to find new diagnostic molecular markers and therapeutic targets for endometrial cancer, the purpose of the present invention is to provide the use of SNORD99 as a diagnostic marker for endometrial cancer and its therapeutic target. The marker is highly expressed in human clinical endometrial cancer tissues and specifically highly expressed in human endometrial cancer cell lines HEC-1B and ISHIKAWA. As a diagnostic marker for endometrial cancer, SNORD99 provides a molecular target for the treatment of endometrial cancer and can be used in the preparation of anti-tumor drugs.

[0005] In order to achieve the above object, the present invention adopts the following technical solutions.

[0006] A molecular marker is used in the preparation of a product for diagnosing endometrial cancer. The molecular marker is SNORD99, and its nucleotide sequence is shown in SEQ ID No.1.

[0007] Furthermore, the SNORD99 is a small nucleolar RNA formed after the splicing of introns 3-5 of SNHG12. The location of SNORD99 RNA is: chr1: 28578743-28578822, NR_003077.1, the sequence has 80 bases, and includes 1 exon.

[0008] Furthermore, the product is selected from a preparation, a chip or a kit.

[0009] Furthermore, the product can diagnose the occurrence of endometrial cancer by detecting the expression level of SNORD99 in the sample.

[0010] Furthermore, the product includes a primer pair for amplifying a nucleic acid sequence that specifically recognizes SNORD99, wherein the primer pair includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID No.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID No.3.

[0011] A pharmaceutical composition, characterized in that it comprises the SNHG12 gene and / or an inhibitor of its expression to produce SNORD99.

[0012] Furthermore, the inhibitor includes siRNA targeting SNHG12 gene and antisense oligonucleotide targeting small nucleolar RNA SNORD99, which are used to inhibit the level of SNORD99.

[0013] Preferably, the inhibitor is ASO, and its nucleotide sequence is shown in SEQ ID No. 4. Meanwhile, the ASO nucleotide sequence of the NC control group is provided by Shanghai Ribo Biotech Co., Ltd.

[0014] The molecular marker and the pharmaceutical composition are used in preparing a drug for treating endometrial cancer.

[0015] Compared with the prior art, the beneficial effects of the present invention are as follows.

[0016] The present invention discovered for the first time the biomarker SNORD99 associated with the occurrence and development of endometrial cancer, and achieved early diagnosis of endometrial cancer by detecting changes in SNORD99 in subjects.

[0017] The present invention provides a molecular target for treating endometrial cancer, and has sensitivity and specificity in treating the disease by targeting the molecular marker. The present invention provides a certain theoretical basis for the study of the mechanism of endometrial cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the expression of SNORD99 in endometrial cancer tissues and normal tissues in the TCGA database.

[0019] Figure 2 QPCR was used to detect the expression of SNORD99 in endometrial cancer cells.

[0020] Figure 3 The figure shows the expression of SNORD99 after the endometrial cancer cell line ISHIKAWA was transfected with SNORD99 plasmid.

[0021] Figure 4 This is the result of the scratch test on the ISHIKAWA cell line, a human endometrial cancer cell line.

[0022] Figures 5-1 to 5-2 These are the results of apoptosis experiments on human endometrial cancer cell lines HEC-1B and ISHIKAWA cells.

[0023] Figure 6 These are the results of proliferation experiments on human endometrial cancer cell lines HEC-1B and ISHIKAWA cells. DETAILED DESCRIPTION

[0024] The present invention will be further described in detail below in conjunction with the accompanying drawings and examples. The following examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0025] The present invention discovered for the first time that SNORD99 is related to the occurrence and development of endometrial cancer, and verified that SNORD99 is highly expressed in endometrial cancer. SNORD99 can be used as an independent predictor of endometrial cancer, and can also be used in combination with other molecular markers.

[0026] Example 1 Identification of SNORD99 and its detection in human endometrial cancer tissues and cells.

[0027] Experimental method: Four endometrial cancer cell lines, HEC-1B, HEC-1A, KLE, and ISHIKAWA, were resuspended and inoculated in six-well plates. When the cell growth reached 80%, total RNA was extracted from endometrial cancer cells using TRIzol reagent (Japan, Shiga, Takara). First, an appropriate amount of chloroform was added to TRIzol. After centrifugation, the upper aqueous phase was added to a new centrifuge tube, and the same volume of isopropanol was added to precipitate RNA. After centrifugation again, the supernatant was discarded, and the RNA precipitate was washed with 75% ethanol. The precipitate was then dried and dissolved in water treated with diethyl pyrocarbonate (DEPC). The absorbance (OD) at 260 nm was then measured using a UV spectrophotometer (Unico, Shanghai, China) to calculate the RNA concentration. Then, 2 μg of RNA was reverse transcribed into complementary DNA (cDNA) using avian myeloblastosis virus transcriptase and primers of SNORD99 (Japan, Shiga, Takara). Next, the SybrPrimeX EX-TAQ Patent II Kit (Shig, Takara, Japan) was used. Finally, the 2-ΔΔCt method was used to compare the threshold (Ct) of the target gene and U6 rRNA to determine the relative expression level of the target gene. Figure 2 As shown, SNORD99 is specifically and highly expressed in the HEC-1B cell line.

[0028] The present invention first discovered that SNORD99 is related to the occurrence and development of endometrial cancer, and verified that SNORD99 is highly expressed in endometrial cancer. SNORD99 can be used as an independent predictor of endometrial cancer, and can also be used in combination with other molecular markers.

[0029] SNORD99 was identified and detected in human endometrial cancer cell lines. Figure 2 , showing that this snoRNA also exists in endometrial cancer cell lines and is specifically highly expressed in HEC-1B and ISHIKAWA cell lines.

[0030] The above results all suggest that SNORD99 (nucleotide sequence as shown in SEQ ID No.1, chr1:28578743-28578822|NR_003077|SNORD99) can be used as a diagnostic marker for the occurrence and metastasis of endometrial cancer. And the above-mentioned endometrial cancer diagnostic biomarker can be prepared into an endometrial cancer diagnostic product, and the product is selected from a preparation, a chip or a kit. The product includes a primer pair that specifically recognizes SNORD99, including an upstream primer and a downstream primer, and the nucleotide sequence of the upstream primer is shown in SEQ ID No.2; the nucleotide sequence of the downstream primer is shown in SEQ ID No.3.

[0031] As a preferred embodiment, the upstream primer sequence is as follows (SEQ ID No.2):

[0032] SNORD99 upstream primer: 5'ACTGGTCCAGGATGAAA 3'.

[0033] The downstream primer sequence is as follows (SEQ ID No.3):

[0034] SNORD99 downstream primer: 5'CCCATATCCGCATTTC 3'.

[0035] Example 2 The expression level of SNORD99 directly affects the proliferation, migration, invasion and apoptosis of endometrial cancer cells.

[0036] 1. Knockdown the expression of SNORD99 in HEC-1B cells by transient transfection of antisense oligonucleotides (ASO).

[0037] Antisense oligonucleotides (ASOs) were constructed by Shanghai Ruibo Biotechnology Co., Ltd., and Lipofectamine 3000 (Invitrogen, Carlsbad, USA) was used for transfection. The doses of all reagents were based on the manufacturer's instructions. Antisense oligonucleotides (ASOs) were used to silence SNORD99 expression in the endometrial cancer cell line HEC-1B, and NC was used to transfect the control HEC-1B cell line. Transfection was performed when the cell confluence reached 60-70%. The ASO-SNORD99 sequence is shown in the sequence table (SEQ ID No. 4), and the sequence of ASO-NC was provided by Shanghai Ruibo Biotechnology Co., Ltd.

[0038] 1. The expression level of SNORD99 was detected in HEC-1B cells transfected with different concentrations of ASO-SNORD99.

[0039] The HEC-1B endometrial cancer cell line cells were resuspended and inoculated in a six-well plate. When the cell growth reached 50-60%, they were transfected with AS0-NC and 25nM, 50nM, 75nM, and 100nM concentrations of ASO-SNORD99, respectively. When the cell growth reached 80%, total RNA was extracted from the endometrial cancer cells using TRIzol reagent (Japan, Shiga, Takara). The actual operation process was the same as the extraction and identification of SNORD99 in the endometrial cancer cell line. The results showed that after HEC-1B was transfected with ASO-SNORD99, the expression level of SNORD99 in HEC-1B was significantly reduced.

[0040] 2. Detection of tumor cell proliferation ability (CCK8 method).

[0041] HEC-1B cells were resuspended and seeded at 3000 cells per well in a 96-well plate. After the cells adhered, they were transfected with ASO-NC and ASO-SNORD99, respectively. At 0 h, 24 h, 48 h, and 72 h after cell transfection, 10 mg / mL of 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfonylphenyl)-2H-tetrazolyl monosodium salt) (Yeasen, Shanghai, China) was added to each well and then incubated in 5% carbon dioxide for 2 h. After shaking for 20 seconds, the absorbance at 450 nm was measured using a microplate spectrophotometer (BioTek Instruments, Winooski, VT, USA), and the growth rate was calculated and used to reflect cell viability.

[0042] 3. Determination of tumor cell apoptosis (flow cytometry).

[0043] Count 3×10 5 Cells were plated in 6-well plates. After the cells adhered to the wall, ASO-NC and ASO-SNORD99 were used for transfection, respectively. Serum-free medium was used for transfection, and the total amount of liquid in the six-well plate was 2 ml. After 48 hours of transfection, the culture medium of each well was collected, and the cells were digested with EDTA-free trypsin after washing with PBS. The trypsin digestion time should be appropriate to prevent false positives. After centrifugation at 1500r for 5 minutes, the cells were collected and washed twice with pre-cooled PBS. The cells were resuspended in 50μL 1× binding buffer, and 2.5μL Annexin V-FITC and 2.5μL PI staining solution (Becton, Dickinson and Company, USA) were added to stain for 20 minutes in the dark. Then, 200μL of 1× binding buffer was added at room temperature in the dark. The apoptosis rate of cells was detected by flow cytometry.

[0044] 4. Experimental results.

[0045] like Figures 5-1 to 5-2 As shown in Figure 2, silencing SNORD99 in the endometrial cancer cell line HEC-1B cells promoted cell apoptosis compared with the control cells. Figure 6 As shown, silencing of SNORD99 by oligonucleotides in the endometrial cancer cell line HEC-1B cells inhibited cell proliferation compared with control cells.

[0046] 2. Construction of stable cell lines.

[0047] The overexpression plasmid (pZdonor-CMV-SNORD99) and the control empty vector plasmid (pZdonor-CMV) were constructed by Beijing Hesheng Gene Biological Company, and Lipofectamine 3000 (Invitrogen, Carlsbad, USA) was used for transfection. The doses of all reagents were based on the manufacturer's instructions. The SNORD99 plasmid was used to upregulate SNORD99 expression in endometrial carcinoma ISHIKAWA, and the empty vector plasmid was used to transfect HEC-1B as a control. G418 was used to select stable clonal cell lines. The SNORD99 sequence is shown in the sequence diagram. When the cell confluence reaches 90%, the cells are passaged and 500 μg / ml G418 is added to the culture medium to screen for stably transfected cells. The cell density should be kept below 50% during screening. Screening should be carried out for at least 2 weeks.

[0048] 1. The expression level of SNORD99 was detected in ISHIKAWA cells transfected with SNORD99 plasmid and CON193 empty vector respectively.

[0049] ISHIKAWA cells transfected with SNORD99 plasmid and CON193 empty vector were resuspended and seeded in six-well plates. When the cell growth reached 80%, total RNA was extracted from ISHIKAWA cells using TRIzol reagent (Japan, Shiga, Takara). The actual operation process was the same as that of extracting and identifying SNORD99 from endometrial cancer cell lines. The results are shown in Figure 3 As shown, the results showed that the expression level of SNORD99 in ISHIKAWA cells transfected with SNORD99 plasmid was significantly increased compared with the control group.

[0050] 2. Detection of tumor cell proliferation ability (CCK8 method).

[0051] ISHIKAWA cells transfected with SNORD99 plasmid and CON193 empty vector were resuspended and seeded at 3000 cells per well in a 96-well plate. After the cells adhered to the wall, 10 mg / mL of 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfonylphenyl)-2H-tetrazolyl monosodium salt) (Yeasen, Shanghai, China) was added to each well at 0 h, 24 h, 48 h, and 72 h after cell transfection, and then incubated in 5% carbon dioxide for 2 h. After shaking for 20 seconds, the absorbance at 450 nm was measured using a microplate spectrophotometer (BioTek Instruments, Winooski, VT, USA), and the growth rate was calculated and used to reflect cell viability.

[0052] 3. Detection of tumor cell migration ability (cell scratch test).

[0053] ISHIKAWA cells transfected with SNORD99 plasmid and CON193 empty vector were resuspended and inoculated in six-well plates. When cell growth reached 80%, a straight line of uniform width was drawn vertically in each well with a 200 μL pipette tip. Excess suspended cells were then rinsed with PBS (phosphate buffered saline) and the cells were incubated in 5% carbon dioxide. Then, photos were taken with an optical microscope at 0 hours, 24 hours, and 48 hours after the scratch, and measured using Image J software (National Institutes of Health, Bethesda, MD, USA). The calculation formula for wound healing rate is as follows: ((original wound area-wound area at different times) / original wound area × 100%).

[0054] 4. Determination of tumor cell apoptosis (flow cytometry).

[0055] ISHIKAWA cells transfected with SNORD99 plasmid and CON193 empty vector were counted and 3×10 5 Cells were plated in 6-well plates. After 48 hours, the culture medium of each well was collected. After washing with PBS, the cells were digested with EDTA-free trypsin. The trypsin digestion time should be appropriate to prevent false positives. After centrifugation at 1500r for 5 minutes, the cells were collected and washed twice with pre-cooled PBS. The cells were resuspended in 50μL 1× binding buffer, and 2.5μL Annexin V-FITC and 2.5μL PI staining solution (Becton, Dickinson and Company, USA) were added to stain for 20 minutes in the dark. Then, 200μL of 1× binding buffer was added at room temperature in the dark. The apoptosis rate of cells was detected by flow cytometry.

[0056] 5. Experimental results.

[0057] like Figure 3 As shown, the expression level of SNORD99 was significantly increased after the endometrial cancer cell line ISHIKAWA was transfected with SNORD99 plasmid, but the expression of its host gene was basically not affected.

[0058] like Figure 4 As shown, overexpression of SNORD99 in the human endometrial cancer cell line ISHIKAWA promoted cell migration compared with control cells.

[0059] like Figures 5-1 to 5-2 As shown, in the endometrial cancer cell line ISHIKAWA overexpressing SNORD99, cell apoptosis was reduced compared with control cells.

[0060] like Figure 6 As shown, in the endometrial cancer cell line ISHIKAWA overexpressing SNORD99, cell proliferation was promoted compared with control cells.

[0061] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. It should be pointed out that a person skilled in the art can make several improvements and modifications without departing from the technical principles of the present invention, and these improvements and modifications should also be regarded as within the scope of protection of the present invention. Sequence Listing <110> The Third Affiliated Hospital of Guangzhou Medical University (Guangzhou Severe Pregnant and Postpartum Women Treatment Center, Guangzhou Rouji Hospital) <120> SNORD99 as a marker for the diagnosis of endometrial cancer and its application <130> 4 <140> SIPOSequenceListing 1.0 <210> 1 <211> 80 <212> DNA <213> (Artificial sequence) <400> 1 ACTGGTCCAGGATGAAACCT AATTTGAGTG GACATCCATG GATGAGAAAAT GCGGATATGG 60 GACTGAGACC AGCTCCTAGG 80 <210> 2 <211> 17 <212> DNA <213> (Artificial sequence) <400> 2 ACTGGTCCAG GATGAAA 17 <210> 3 <211> 20 <212> DNA <213> (Artificial sequence) <400> 3 CCCATATCCG CATTTC 16 <210> 4 <211> 20 <212> DNA <213> (Artificial sequence) <400> 4 ATGCGGATAT GGGACTGAGA 20

Claims

1. Use of a product for detecting the expression level of a molecular marker in the preparation of a product for diagnosing endometrial cancer, characterized in that: The molecular marker is SNORD99, and its nucleotide sequence is shown in SEQ ID No.

1.

2. The use according to claim 1, characterized in that The SNORD99 is a small nucleolar RNA formed after the cleavage of introns 3 to 5 of SNHG12. The location of SNORD99 RNA is: chr1: 28578743-28578822, NR_003077.1, the sequence has 80 bases, and includes 1 exon.

3. The use according to claim 1, characterized in that The product for diagnosing endometrial cancer is selected from a chip or a kit.

4. The use according to claim 1, characterized in that The product for diagnosing endometrial cancer includes a primer pair for amplifying a specifically identified nucleic acid sequence, the primer pair includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID No.2; the nucleotide sequence of the downstream primer is shown in SEQ ID No.3.

Images