A SNP marker related to the full female trait of cucumber and application thereof
By developing the molecular marker CsSNP16 for all female traits in cucumber and its detection method, the problems of long purification cycle and difficulty in high-throughput detection of female cucumber lines have been solved, achieving efficient and accurate sex trait detection and simplifying the breeding process.
Patent Information
- Application Number
- CN202210384530.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-04-13
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2042-04-13
AI Technical Summary
The female genes in existing cucumber female lines require multiple generations of isolation and purification, which is a long process. Furthermore, the existing SNP markers are genetically distant from the cucumber female genes, making it difficult to meet the needs of high-throughput detection.
A molecular marker for all-female traits in cucumber, CsSNP16, and its detection method were developed. A fluorescence scanning genotyping method was used with CsSNP16 primer set to detect the allele at nucleotide 101 in the cucumber genome, achieving high-throughput and accurate sex typology detection.
This technology enables efficient and accurate detection of cucumber phenotypes, simplifies the cucumber breeding process, shortens the breeding cycle, and improves detection efficiency.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure HDA0003594349970000011
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to a SNP marker associated with the all-female trait of cucumber and its application. Background Technology
[0002] cucumber( Cucumis sativus Cucumbers (L.) are widely cultivated worldwide and are one of my country's important cucurbit crops. Over the past 40 years, with the development and improvement of breeding techniques, cucumber varieties have undergone several generations of updates; a large number of high-yielding, disease-resistant, and year-round-adapted excellent new cucumber varieties have been developed. Because female cucumber lines have significant value in breeding high-yielding new cucumber varieties and in cucumber seed production, female line varieties have gradually gained market recognition in recent years. However, the female genes in existing cucumber female line materials in my country mostly originate from European processing-type resources with smooth surfaces and few spines. To obtain homozygous North China type female line materials from these sources, multiple generations of isolation and purification using self-crossing and backcrossing methods are required, which is inefficient and time-consuming. Therefore, developing molecular markers closely linked to cucumber female genes is an effective way to accelerate the innovation of cucumber female line materials. Currently, with the completion of cucumber genome sequencing, research on the localization of genes for various important traits in cucumber has been promoted, and there have been many reports on cucumber genotyping and the development of related molecular markers (Wang Hebing, Xiang Huafeng, Zhang Sheng, Xiong Yan, Zhang Hongcheng (2015). Research progress on female cucumber lines in China, Chinese Agricultural Science Bulletin, 31(10): 92-96). However, in addition to the relatively large genetic distance between these molecular markers and cucumber female genes, the types of markers used are also difficult to meet the needs of high-throughput identification. Third-generation molecular markers SNPs have received widespread attention due to their large number, wide distribution, and genetic stability. At present, there are many SNP marker detection methods. Among them, the detection method based on gel electrophoresis is difficult to achieve high-throughput detection because it relies on gel electrophoresis detection; while the fluorescence scanning genotyping method based on KASP technology (Competitive allele specific PCR), which has a high degree of automation, is the most promising SNP detection method because it has relatively low requirements for instruments and equipment. Summary of the Invention
[0003] The technical problem to be solved by this invention is how to detect the sex type of cucumber.
[0004] To solve the above-mentioned technical problems, the present invention first provides the application of a molecular marker for the all-female trait of cucumber (named CsSNP16) or a substance for detecting the all-female trait of cucumber in the detection or auxiliary detection of cucumber sex type; the all-female trait of cucumber is a nucleotide corresponding to the 101st position of sequence 4 in the sequence listing of cucumber genome, and the all-female trait of cucumber is T or C.
[0005] In the above application, the substance for detecting the molecular marker of the full female trait of cucumber can be a CsSNP16 primer set consisting of single-stranded DNAs with names F1, F2 and R respectively;
[0006] The F1 is (b1) or (b2):
[0007] (b1) the single-stranded DNA shown in positions 22-48 of SEQ ID NO: 1 of the sequence listing;
[0008] (b2) the single-stranded DNA obtained by substitution and / or deletion and / or addition of one or more nucleotides to positions 22-48 of SEQ ID NO: 1;
[0009] The F2 is (b3) or (b4):
[0010] (b3) the single-stranded DNA shown in positions 22-48 of SEQ ID NO: 2 of the sequence listing;
[0011] (b4) the single-stranded DNA obtained by substitution and / or deletion and / or addition of one or more nucleotides to positions 22-48 of SEQ ID NO: 2;
[0012] The R is the single-stranded DNA shown in SEQ ID NO: 3 of the sequence listing.
[0013] In the above application, (b2) can be the single-stranded DNA shown in SEQ ID NO: 1 of the sequence listing; and (b4) can be the single-stranded DNA shown in SEQ ID NO: 2 of the sequence listing.
[0014] The application also provides a method for detecting the genotype of cucumber, which is a TT genotype, a TC genotype and a CC genotype, and the method comprises: detecting the nucleotide corresponding to position 101 of SEQ ID NO: 4 in the sequence listing in the genome of the cucumber to be tested, and if both alleles at the target site of the cucumber to be tested are g1) below, the cucumber to be tested is a TT genotype cucumber; if both alleles at the target site of the cucumber to be tested are g2) below, the cucumber to be tested is a CC genotype cucumber; and if one allele at the target site of the cucumber to be tested is g1) below and the other allele is g2) below, the cucumber to be tested is a TC genotype cucumber;
[0015] g1) the nucleotide corresponding to position 101 of SEQ ID NO: 4 in the sequence listing is T;
[0016] g2) the nucleotide corresponding to position 101 of SEQ ID NO: 4 in the sequence listing is C.
[0017] In the above method, the CsSNP16 primer set is used to detect the nucleotide corresponding to position 101 of SEQ ID NO: 4 in the sequence listing in the genome of the cucumber to be tested.
[0018] The method can specifically include: performing a reaction by using the CsSNP16 primer set to obtain a reaction product, detecting a fluorescence signal of the reaction system, and determining that a to-be-tested cucumber with only a VIC fluorescence signal is a TT genotype cucumber (i.e., the cucumber is a homozygous type of the whole female trait molecular marker T), a to-be-tested cucumber with only a FAM fluorescence signal is a CC genotype cucumber (i.e., the cucumber is a homozygous type of the whole female trait molecular marker C), and a to-be-tested cucumber with both VIC and FAM fluorescence signals is a TC genotype cucumber (i.e., the cucumber is a heterozygous type of the whole female trait molecular marker T and C).
[0019] The reaction system for performing the reaction by using the CsSNP16 primer set can be: 50 ng of cucumber genomic DNA, 0.07 μL of primer mixture (in the primer mixture, the concentrations of the F1, the F2 and the R are all 50 pmol·L -1 ), 2.5 μL of 2×KASP Mix (Low Rox) of the LGC company, and water, supplemented to 8 μL.
[0020] The reaction condition for performing the reaction by using the CsSNP16 primer set can be: 10 min of pre-denaturation at 95℃, 1 cycle; 20 s of denaturation at 95℃, 60 s of annealing at 55-62℃ (preferably 55℃), and 32-40 cycles (preferably 40 cycles) are set.
[0021] The to-be-tested cucumber can be a homozygous cucumber or a heterozygous cucumber.
[0022] The application further provides a method for detecting the sex type of a cucumber plant, which comprises: detecting the genotype of a to-be-tested cucumber according to the method for detecting the genotype of a cucumber, and determining that a to-be-tested cucumber plant of a TT genotype opens female flowers or candidate female flowers, a to-be-tested cucumber plant of a CC genotype opens male flowers and female flowers or candidate male flowers and female flowers, and a to-be-tested cucumber plant of a TC genotype opens female flowers or candidate female flowers.
[0023] In the method, the to-be-tested cucumber can be a homozygous cucumber. Specifically, the to-be-tested cucumber can be a TT genotype cucumber or a CC genotype cucumber.
[0024] The application further provides a cucumber breeding method, which comprises: detecting the genotype of a cucumber according to the method for detecting the genotype of a cucumber, and selecting a cucumber of a TT genotype as a parent for breeding.
[0025] The cucumber breeding method can further comprise: selecting a cucumber of a TT genotype or a TC genotype as an intermediate material, and realizing cucumber breeding through multi-generation selection and breeding.
[0026] The whole female trait molecular marker of the cucumber also belongs to the protection scope of the application.
[0027] The application also provides a substance for any of the following uses Y1) - Y4), which comprises the CsSNP16 primer set:
[0028] Y1) detecting a molecular marker of a cucumber gynoecious trait;
[0029] Y2) preparing a product for detecting a molecular marker of a cucumber gynoecious trait;
[0030] Y3) detecting or assisting in detecting a cucumber sex type;
[0031] Y4) preparing a product for detecting or assisting in detecting a cucumber sex type.
[0032] The substance can also comprise other reagents required for detecting the molecular marker of the cucumber gynoecious trait, such as the 2xKASP Mix (Low Rox) of the LGC company.
[0033] The substance can be a kit. The substance can only be the CsSNP16 primer set, and can also be a complete set of reagents consisting of the CsSNP16 primer set and other reagents required for detecting the molecular marker of the cucumber gynoecious trait.
[0034] The application also provides any of the following uses:
[0035] H1) use of the molecular marker of the cucumber gynoecious trait in cucumber breeding;
[0036] H2) use of a substance for detecting the molecular marker of the cucumber gynoecious trait in cucumber breeding;
[0037] H3) use of a substance for detecting the molecular marker of the cucumber gynoecious trait in preparing a product for detecting or assisting in detecting a cucumber sex type;
[0038] H4) use of a method for detecting the cucumber genotype in detecting or assisting in detecting a cucumber sex type.
[0039] In the application, the cucumber can be any one or more of the cucumbers in Table 1 and Table 2, but is not limited to the cucumbers in Table 1 and Table 2.
[0040] In the application, the cucumber sex type refers to the sex of the cucumber flower. If all the flowers of a cucumber plant are female flowers, the plant is a female plant, and the phenotype is recorded as female; if the flowers of a cucumber plant are both female flowers and male flowers, the plant is a hermaphrodite plant, and the phenotype is recorded as non-female; if all the flowers of a cucumber plant are male flowers, the plant is a male plant, and the phenotype is also recorded as non-female.
[0041] The application obtains a SNP marker CsSNP16 closely linked to the cucumber gynoecy gene by combining whole genome sequencing and bioinformatics analysis, and phenotype identification of the material, the marker can be used to detect whether the cucumber plant is a female line plant, and can be further used for cucumber molecular marker assisted breeding. Meanwhile, the cucumber gynoecy trait SNP marker obtained by the application can be used for a high-throughput molecular detection platform, compared with the second generation molecular marker, the detection method is more simple, accurate and efficient. BRIEF DESCRIPTION OF DRAWINGS
[0042] Figure 1 Figure 1 is a genotyping diagram of the CsSNP16 marker in some cucumber inbred lines. Note: the red data points (lower right corner) represent a set of materials with the allele T, and the blue data points (upper left corner) represent a set of materials with the allele C. DETAILED DESCRIPTION
[0043] The application will be further described in detail below in conjunction with the specific embodiments, and the examples given are only for illustrating the application, but not for limiting the scope of the application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not constitute any limitation on the application.
[0044] In the following examples, the experimental methods are conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. In the following examples, the materials, reagents, instruments, etc. used, unless otherwise specified, can be obtained commercially. In the following examples, the quantitative tests were set up with three repeated experiments, and the results were averaged. In the following examples, unless otherwise specified, the 1st nucleotide of each nucleotide sequence in the sequence listing is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last nucleotide is the 3' terminal nucleotide of the corresponding DNA / RNA.
[0045] Example 1: Obtaining of the SNP marker related to the cucumber gynoecy trait
[0046] In this example, 5 cucumber female line materials and 5 non-female line materials (Table 1) were selected for whole genome resequencing. The genotype data of the materials were analyzed by bioinformatics, and combined with the phenotype data of the above 10 materials, the nucleotide differences between the female line materials and the non-female line materials were located, and it was found that the SNP site 24245869 T / C on the 6th chromosome had significant correlation with the phenotype data, the SNP site was recorded as the cucumber gynoecy gene molecular marker, abbreviated as CsSNP16.
[0047] Table 1: 10 sequencing cucumber materials and phenotypes
[0048]
[0049] Note: The materials with upper left superscript 1, 2 are described in the article "Chen Feixue, et al. Analysis of molecular markers linked to high temperature tolerance QTL in cucumber. Journal of Nankai University (Natural Science Edition), 2008, 41(4): 49-54"; the materials with upper left superscript 3, 8 are described in the article "Huang Huanhuan, et al. Analysis of polymorphism of molecular markers between mapping parents of cucumber. North China Journal of Agricultural Sciences, 2007, 22(2): 47-49"; the materials with upper left superscript 4, 5 are described in the article "Xu Qing, et al. Construction and analysis of molecular genetic linkage map of distant population of cucumber. North China Journal of Agricultural Sciences, 2008, 23(1): 45-49"; the materials with upper left superscript 6, 7 are described in the article "Zhang Guihua, et al. Study on molecular markers linked to resistance to scab in cucumber. Chinese Journal of Agricultural Sciences, 2006, 39(11): 2250-2254"; the materials with upper left superscript 9, 10 are described in the article "Zhang Guihua, et al. AFLP markers linked to genes related to resistance to powdery mildew in cucumber. Acta Horticulturae Sinica, 2004, 31(2): 189-192".
[0050] In Table 1, the phenotype "female" means that the plant line flowers only female flowers, and "non-female" means that the plant line flowers not only female flowers but also male flowers.
[0051] The primer for detecting CsSNP16 was designed and synthesized, and the details are as follows:
[0052] Forward primer F1: 5'-GAAGGTCGGAGTCAACGGATTCCTTAGCATTATTCTTGGAACATTTTT -3' (sequence 1 in the sequence listing), the bold part is a VIC linker for binding with VIC;
[0053] Forward primer F2: 5'-GAAGGTGACCAAGTTCATGCTCCTTAGCATTATTCTTGGAACATTTTC -3' (sequence 2 in the sequence listing), the bold part is a FAM linker for binding with FAM;
[0054] Reverse primer R: 5'-TTTTCTCAGTTCTGATTAACGGTGT-3' (sequence 3 in the sequence listing).
[0055] The sequence of the PCR product obtained by using forward primers F1 / F2 and reverse primer R for PCR amplification with cucumber genomic DNA as the template is: 5'-CCTTAGCATTATTCTTGGAACATTTTRTAAACCTATCTACACCGTTAATCAGAACTGAGAAAA-3' (the underlined sequence in sequence 4 in the sequence listing), R represents T or C.
[0056] 8 μL PCR fluorescence quantitative instrument detection reaction system includes: cucumber genome DNA 50 ng, primer mix 0.07 μL (in the primer mix, the concentration of forward primer F1 and F2, reverse primer R is 50 pmol·L -1 ), LGC company 2×KASPMix (Low Rox) 2.5 μL, water to 8 μL.
[0057] According to the operation manual of the fluorescence quantitative PCR instrument AB-Q6, the sample table is edited, the running program is executed, and the data is saved. The reaction condition is: 95℃ pre-denaturation 10 min, 1 cycle; 95℃ denaturation 20 s, 55℃ annealing 60 s, 40 cycles.
[0058] After amplification, the fluorescence signal is detected, the test plant with VIC fluorescence signal is TT genotype (i.e. CsSNP16 site is T), the test plant with FAM fluorescence signal is CC genotype (i.e. CsSNP16 site is C), and the test plant with VIC and FAM fluorescence signal is TC genotype (i.e. CsSNP16 site is T and C).
[0059] In table 1, 863-6, 863-7, HZL04-1, Hm60-1, U4 are all TT genotype, and all the flowers are female flowers; Q6, Q12, F-3, Q9, Q10 are all CC genotype, and the flowers on the same plant are both female flowers and male flowers.
[0060] Example 2, verification of SNP marker closely linked to cucumber gynoecy trait gene
[0061] The genotypes of 50 cucumber materials (table 2) were detected by using the SNP marker (CsSNP16) linked to the gynoecy trait gene obtained in example 1, and the sex of the flowers of each material was counted in the field to determine the accuracy of CsSNP16 for molecular marker assisted selection.
[0062] The genotypes of 50 germplasm materials were detected as in example 1.
[0063] The results are shown in table 2, and the results show that there are 22 TT genotype cucumbers, all of which are female flowers; there are 27 CC genotype cucumbers, all of which are female and male flowers; there is only one TC genotype cucumber, all of which are female flowers. It shows that CsSNP16 can be used to detect the sex type of cucumber plants.
[0064] Table 2, phenotype and genotype data of 50 cucumber materials
[0065]
[0066] Note: H033-8-2, Hm82-1, H9-13, H14, H2, H058-14, H064-1-2, R6, R12, Hm169, ML27, L3, L8, H1, Hm84, U6, S3, Hm62, D, Jinchunmici are described in the article "Zhang Guihua, et al. AFLP analysis of genetic diversity of cucumber germplasm resources. North China Journal of Agricultural Sciences, 2007, 22 (3) : 21-24";
[0067] L1, L2, L4, L5, L6, X-4, X-14, X-22, X-27, X-28, S31, D-6, D-17, D-40, CH102-2-1, H074-1, Jinchun 4, H058-10, Changchunmici, L16, L23, L24, L25, L26, L28, L32, L34, L36, L41, A6 are described in the article "Du Shengli, Zhang Guihua, et al. SCAR conversion of AFLP markers for cucumber powdery mildew resistance genes. Journal of Horticulture, 2005, 32 (6) : 1095-1097";
[0068] In Table 2, the phenotype "female" means that all flowers of the line are female flowers, and "non-female" means that the flowers of the line are female flowers and male flowers.
[0069] The above has been described in detail. For those skilled in the art, without departing from the purpose and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wide range of equivalent parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that further improvements can be made to the present application. In general, according to the principle of the present application, this application intends to include any change, use or improvement of the present application, including changes made by conventional techniques known in the art, which are outside the scope disclosed in the present application. Some basic features can be applied within the scope of the following attached claims. <110> Tianjin Derui Speciality Co., Ltd. <120> A SNP marker related to the full female trait of cucumber and application thereof <160> 4 <170> PatentIn version 3.5 <210> 1 <211> 48 <212> DNA <213> Artificial sequence <400> 1 gaaggtcggagtcaacggattccttagcattattcttggaacattttt 48 <210> 2 <211> 48 <212> DNA <213> Artificial sequence <400> 2 gaaggtgaccaagttcatgctccttagcattattcttggaacattttc 48 <210> 3 <211> 25 <212> DNA <213> Artificial sequence <400> 3 ttttctcagttctgattaacggtgt 25 <210> 4 <211> 301 <212> DNA <213> Cucumis sativus L. <400> 4 ggaattattcaaaacagttcgataaacatcattgggccattcatttccagttcaaaacaa 60 agcatacagataaaccttagcattattcttggaacattttrtaaacctatctacaccgtt 120 aatcagaactgagaaaatattacaaaatctcttgggactggcagaaaaggtaaacgatga 180 ttctacaaaatcaccctatgcctacgatagactgacggtccaattcattttatcttcgat 240 aagccccatttgtaatctggtaagtacagaatagagttgttgtgaaacaaccccaacacc 300 a 301
Claims
1. The use of a substance for detecting a cucumber gynoecy trait molecular marker in detecting the sex type of cucumber; the cucumber gynoecy trait molecular marker is as shown in sequence 4 in the sequence listing, and the cucumber gynoecy trait molecular marker has a T / C mutation at position 101 of sequence 4; when both alleles of the cucumber to be tested at position 101 of sequence 4 are T, the cucumber plant to be tested produces female flowers; when both alleles of the cucumber to be tested at position 101 of sequence 4 are C, the cucumber plant to be tested produces male and female flowers; when the two alleles of the cucumber to be tested at position 101 of sequence 4 are T and C, the cucumber plant to be tested produces female flowers. wherein The substance for detecting the cucumber gynoecy trait molecular marker is a CsSNP16 primer set, which is composed of single-stranded DNAs with names F1, F2 and R respectively; 2. Use according to claim 1, characterized in that: The F1 is a single-stranded DNA as shown in positions 22-48 of sequence 1 in the sequence listing; The F2 is a single-stranded DNA as shown in positions 22-48 of sequence 2 in the sequence listing; The R is a single-stranded DNA as shown in sequence 3 in the sequence listing. The substance for detecting the cucumber gynoecy trait molecular marker is a CsSNP16 primer set, which is composed of single-stranded DNAs with names F1, F2 and R respectively; 3. Use according to claim 1, characterized in that: The F1 is a single-stranded DNA as shown in sequence 1 in the sequence listing; The F2 is a single-stranded DNA as shown in sequence 2 in the sequence listing; The R is a single-stranded DNA as shown in sequence 3 in the sequence listing. Detecting the genotype of the cucumber to be tested, the genotype being TT genotype, TC genotype and CC genotype, the cucumber plant to be tested with TT genotype produces female flowers, the cucumber plant to be tested with CC genotype produces male and female flowers, and the cucumber plant to be tested with TC genotype produces female flowers; 4. A method of detecting sex type in cucumber comprising: The detection of the genotype of the cucumber to be tested includes: detecting the nucleotide corresponding to position 101 of sequence 4 in the sequence listing in the genome of the cucumber to be tested, and if both alleles of the cucumber to be tested at the target site are g1) below, the cucumber to be tested is of TT genotype; if both alleles of the cucumber to be tested at the target site are g2) below, the cucumber to be tested is of CC genotype; and if one allele of the cucumber to be tested at the target site is g1) and the other allele is g2), the cucumber to be tested is of TC genotype; g1) the nucleotide corresponding to position 101 of sequence 4 in the sequence listing is T; g2) the nucleotide corresponding to position 101 of sequence 4 in the sequence listing is C. The detection of the nucleotide corresponding to position 101 of sequence 4 in the sequence listing in the genome of the cucumber to be tested is performed using the CsSNP16 primer set in claim 2 or 3.
5. The method of claim 4, wherein: Detecting the genotype of the cucumber, the genotype being TT genotype, TC genotype and CC genotype, and selecting the cucumber with TT genotype as the parent for breeding; 6. A method of breeding cucumbers comprising: The detecting the genotype of the cucumber comprises: detecting the nucleotide corresponding to the 101th nucleotide of SEQ ID NO: 4 in the sequence table in the genome of the cucumber, and if both of the two alleles of the cucumber at the target site are g1) as described below, the cucumber is a TT genotype cucumber; if both of the two alleles of the cucumber at the target site are g2) as described below, the cucumber is a CC genotype cucumber; if one of the two alleles of the cucumber at the target site is g1) as described below and the other is g2) as described below, the cucumber is a TC genotype cucumber; g1) the nucleotide corresponding to the 101th nucleotide of SEQ ID NO: 4 in the sequence table is T; g2) the nucleotide corresponding to the 101th nucleotide of SEQ ID NO: 4 in the sequence table is C.
7. The method of claim 6, wherein: The detection of the nucleotide corresponding to the 101th nucleotide of SEQ ID NO: 4 in the sequence table in the genome of the cucumber to be tested is performed by using the primer set of CsSNP16 in claim 2 or 3.
Citation Information
Patent Citations
repetition mechanism with improved damper lift for pianos
CH10221A
Method for transforming cucumis melo female line through high-throughout molecular marker and special primer thereof
CN105256031A
Cucumber male sterility gene, molecular marker, screening method and application thereof
WO2018201754A1