Use of succinic acid as a biomarker for cancer diagnosis and treatment

By developing anti-succinic acid monoclonal antibodies and SUCNR1 inhibitors, succinic acid in serum is neutralized, and the SUCNR1 signaling pathway is inhibited. This solves the problem of tumor cells activating macrophages to polarize into TAMs through succinic acid, thus achieving effective cancer diagnosis and treatment.

CN114929274BActive Publication Date: 2026-02-13NATIONAL HEALTH RESEARCH INSTITUTE
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202080073102.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2019-10-17
Filing Date
2020-10-16
Publication Date
2026-02-13
Estimated Expiration
2040-10-16

AI Technical Summary

Technical Problem

Tumor cells activate the SUCNR1 signaling pathway through succinate, polarizing macrophages into tumor-associated macrophages (TAMs), which promotes cancer metastasis. Current technologies lack effective diagnostic and treatment methods.

Method used

Develop anti-succinic acid monoclonal antibodies and SUCNR1 inhibitors to neutralize succinic acid in serum, inhibit the SUCNR1 signaling pathway, prevent macrophages from polarizing into TAMs, and combine this with the detection of serum succinic acid concentration as a cancer biomarker.

Benefits of technology

It effectively inhibits cancer metastasis, improves the survival rate of cancer patients, provides a new method for cancer diagnosis by detecting the concentration of succinic acid in serum, and treats cancer using succinic acid antagonists.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114929274B_ABST
    Figure CN114929274B_ABST
Patent Text Reader

Abstract

The present disclosure demonstrates that cancer cells secrete succinate into the extracellular environment, which in turn increases the migration ability of macrophages and mediates cancer-associated macrophage polarization. In mouse models, succinate not only induces cancer cell epithelial-mesenchymal transition, enhances cancer cell migration ability, but also promotes cancer metastasis. The present disclosure also indicates that the concentration of succinate in the serum of lung cancer patients is higher than that of healthy subjects, which means that cancer cells release a large amount of succinate into the circulatory system during the development and progression of cancer. As shown in the present disclosure, serum succinate has high discriminative power and can be used as a new class of circulating metabolic carcinogen for predicting non-small cell lung cancer. In addition, in LLC tumor models, the increase in succinate concentration is accompanied by an increase in TAMs in subcutaneous tumors and more severe cancer metastasis, so the serum succinate may be an effective therapeutic biomarker for treating NSCLC. Therefore, the present disclosure also provides an anti-succinate antibody that can be used as a cancer therapeutic agent.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Application No. 62 / 916,376 (filing date October 17, 2019), the entire contents of which are incorporated herein by reference. TECHNICAL FIELD

[0003] The present application relates to the use of succinate as a novel biomarker for the diagnosis or treatment of cancer. More particularly, the present application relates to a method of treating cancer using an antagonist of succinate, such as an anti-succinate monoclonal antibody or a SUCNR1 inhibitor; and a method of diagnosing cancer by detecting the concentration of succinate in serum. BACKGROUND

[0004] The immune system has evolved to distinguish between normal and malignant cells, and an activated immune system initiates immune responses to eliminate damaged and malignant cells to protect the host, according to the classical concept of immunosurveillance, the immune system should be able to prevent the generation and development of tumors in healthy humans. Indeed, there is growing evidence that the existence of cancer immunosurveillance not only protects the host from the invasion of primary cancer, but also shapes the immunogenicity of tumors (de Visser et al., 2006; Dunn et al., 2004). However, once a tumor begins to form, tumor cells activate tolerogenic signaling pathways, which in turn damage the self-regulation of the immune system, resulting in the ability of tumors to be immune tolerant and not subject to immune attack. In addition, immune cells, endothelial cells and fibroblasts are recruited to the tumor microenvironment and activated into tumor-associated cells, thereby promoting tumor growth and metastasis.

[0005] In the tumor microenvironment, cancer cells not only release soluble molecules to initiate signaling of oncogenes for their growth, survival and metastasis, but also affect surrounding cells including immune cells to enhance tumor development. However, host cells recognize tumor cells as foreign and immune surveillance is mounted against them, thus the dynamic interaction between tumor and immune cells is critical for regulating tumor initiation and progression. Macrophages, the major cell population in the tumor microenvironment, play an important role in immune self-regulation and defense. In addition, they are activated and polarized by signals in the microenvironment, resulting in different phenotypes, such as classical activated macrophages (Ml) and alternatively activated macrophages (M2). Many evidences show that macrophages in the tumor microenvironment are activated by tumor-secreted cytokines to become M2-polarized tumor-associated macrophages (TAMs), which promote tumor progression and suppress anti-tumor immune responses. Cancer cells produce signals to control the functional phenotypes of various non-cancer cells in their surroundings to facilitate tumor development. Understanding the mechanisms by which tumor cells recruit cells to their microenvironment and change the phenotypes of surrounding cells will help to provide more effective therapeutic strategies.

[0006] The metabolic composition of cells is considered an important indicator of physiological or pathological states, such as health or cancerization. In addition, endogenous metabolites are involved in regulating many cell biology-defined processes, such as immune self-regulation and tumor development. In other words, the human body needs specific metabolites to maintain normal physiological processes; conversely, certain metabolites induce harmful reactions under stress. For example, the kynurenine metabolite released by tumor cells promotes cancer cell progression, however, host cells release defensive metabolites, such as fibroblasts, to produce and release a new kynurenine metabolite, 5-methoxytryptophan, to the extracellular environment to inhibit the overexpression of COX-2 and tumor initiation, both in vivo and in vitro. Notably, the production of such metabolites is inhibited in cancer-related fibroblasts, indicating that tumor cells can eliminate their anti-tumor response by affecting the phenotype of host cells. Therefore, cancer cells can likely produce and release endogenous factors to suppress anti-tumor immune responses and promote tumor progression.

[0007] Therefore, the present application provides a method for diagnosing cancer by detecting the expression level of succinate in serum as a new cancer biomarker. In addition, the present application also provides a method for treating cancer using a succinate antagonist, such as an anti-succinate monoclonal antibody or a SUCNR1 inhibitor. SUMMARY

[0008] Based on the above purpose, the present application discloses that tumor-secreted succinate can activate the signaling pathway of succinate receptor (SUCNR1), polarize macrophages into tumor-associated macrophages (TAM) to facilitate tumor metastasis, thereby increasing the expression level of succinate in cancer patients.

[0009] Therefore, the present application provides a method for diagnosing cancer by detecting the expression level of succinate in serum as a new cancer biomarker. In addition, the present application also provides a method for treating cancer using a succinate antagonist, such as an anti-succinate monoclonal antibody or a SUCNR1 inhibitor.

[0010] In some embodiments, the anti-succinate monoclonal antibody is a humanized anti-succinate antibody.

[0011] In a preferred embodiment, the humanized anti-succinate antibody comprises heavy chain variable domains VH1-VH5, each comprising an amino acid sequence as set forth in SEQ ID NO: 9-13; and light chain variable domains VL1-VL8, each comprising an amino acid sequence as set forth in SEQ ID NO: 14-21.

[0012] In some embodiments of the present application, the monoclonal antibody can neutralize succinate in serum.

[0013] In another embodiment, the monoclonal antibody can inhibit cancer metastasis and inhibit the conversion of macrophages into tumor-associated macrophages.

[0014] In another embodiment, the monoclonal antibody can inhibit the SUCNR1 signaling pathway and inhibit the expression of ARG1.

[0015] In some embodiments, the monoclonal antibody has a heavy chain with an amino acid sequence as set forth in SEQ ID NO: 2, and a light chain with an amino acid sequence as set forth in SEQ ID NO: 4.

[0016] In some embodiments, the monoclonal antibody has a heavy chain with an amino acid sequence as set forth in SEQ ID NO: 6, and a light chain with an amino acid sequence as set forth in SEQ ID NO: 8.

[0017] In some embodiments, the humanized anti-succinate antibody comprises heavy chain variable domains VH1-VH5 comprising the amino acid sequences set forth in SEQ ID NO: 9, 10, 11, 12, 13, respectively; and light chain variable domains VL1-VL8 comprising the amino acid sequences set forth in SEQ ID NO: 14, 15, 16, 17, 18, 19, 20, 21, respectively.

[0018] In other embodiments, the humanized anti-succinate antibody comprises heavy chain variable domains VH1-VH5 comprising the amino acid sequences encoded by the DNA sequences set forth in SEQ ID NO: 22, 23, 24, 25, 26, respectively; and light chain variable domains VL1-VL8 comprising the amino acid sequences encoded by the DNA sequences set forth in SEQ ID NO: 27, 28, 29, 30, 31, 32, 33, 34, respectively.

[0019] In another aspect, the present application relates to a method of treating cancer, comprising administering a succinate antagonist to a patient in need thereof.

[0020] In some embodiments, the cancer is non-small cell lung cancer, lung cancer, prostate cancer, breast cancer, or colorectal cancer.

[0021] In some embodiments, the succinate antagonist is an anti-succinate monoclonal antibody.

[0022] In other embodiments, the succinate antagonist is a SUCNR1 inhibitor. In some embodiments, the SUCNR1 inhibitor is a SUCNR1 siRNA.

[0023] In another aspect of the present application, a method of diagnosing cancer is provided, comprising detecting the concentration of succinate in the serum of a subject.

[0024] In some embodiments, the cancer is non-small cell lung cancer, lung cancer, prostate cancer, breast cancer, or colorectal cancer. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figures 1A-1F It is shown that a soluble factor in the conditioned medium of cancer cells induces macrophages to express TAM markers. Figure 1A ARG1 protein expression of peritoneal macrophages cultured in control medium, LCC-CM, or A459-CM is shown; Figure 1B Arg1 mRNA expression of peritoneal macrophages cultured in control medium, LCC-CM, or A459-CM is shown; Figure 1CARG1 expression levels in macrophages treated with control conditioned medium or PC3-CM; Figure 1D Arg1 mRNA expression levels in macrophages cultured for 24 hours in control conditioned medium, conditioned medium collected from MCF-7 (MCF7-CM) or conditioned medium collected from HT29 (HT29-CM); Figure 1E Arg1 mRNA expression levels in peritoneal macrophages cultured for 24 hours in SCM or PCM; Fizz1 , Mgl1 Figure 1F VCAM1 + CD11c + CD11b low – the proportion of macrophages.

[0026] Figures 2A-2E Succinate detected in small molecule fractions from lung cancer conditioned medium. Figure 2A Principal component analysis (PCA) plot from liquid chromatography mass spectrometry (LC-MS) results of control conditioned medium versus LLC-SCM; Figure 2B S-plot generated from orthogonal partial least squares discriminant analysis (OPLS-DA) results; Figure 2C , 2D Representative mass spectrometry data (retention time 1.8 min, m / z 50-400) of LLC-CM, A549-SCM, control conditioned medium DMEM or pure succinate. Figure 2E Sub-spectra of pure succinate and LLC-SCM MS1 at m / z 117.0 analyzed by liquid chromatography tandem mass spectrometer (LC-MSMS, MS2).

[0027] Figures 3A-3B Succinate concentrations in different cancer cell conditioned media and in primary subcutaneous tumors. Figure 3A Succinate concentrations in control conditioned medium, LLC-CM, A549-CM, PC3-CM, MCF-7-CM, HT-29-CM or peritoneal macrophage-CM. Figure 3B Succinate concentrations in primary subcutaneous tumors excised from C57BL / 6J mice injected subcutaneously with LLC cells.

[0028] Figures 4A-4D Succinate promotes macrophage polarization into TAMs.​Figure 4A Macrophages treated with different concentrations of succinate showing the expression level of ARG1; Figure 4B Macrophages treated with different concentrations of succinate showing the expression level of ARG1; Arg1 , Fizz1 , Mgl1 , Mgl2 mRNA expression level; Figure 4C Macrophages treated with succinate (1 mM) for 3 days showing the expression level of VCAM1 + CD11c + CD11b low The proportion of TAMs; Figure 4D The percentage of TAMs in primary subcutaneous tumors from mice injected with LLC and intraperitoneally injected with succinate (20 and 100 mg / kg).

[0029] Figures 5A-5D Clinical correlation of serum succinate and tumor SUCNR1 in non-small cell lung cancer (NSCLC). Figure 5A SUCNR1 mRNA expression in lung tissue without tumor and lung cancer tissue; Figure 5B Succinate concentration in serum of mice before and 16 days after inoculation with LLC; Figure 5C Succinate concentration in serum of healthy subjects and NSCLC patients; Figure 5D Succinate in serum of NSCLC patients analyzed by AUROC curve.

[0030] Figures 6A-6C Antibodies against succinate neutralize succinate and their specificity. Figure 6A Specificity of antibodies against succinate; Figure 6B Succinate expression in LLC-CM or A549-CM cultured with different concentrations of antibodies against succinate; Figure 6C Cell migration assay of LLC cells treated with control IgG or antibodies against succinate (Succ Ab) for 24 hours.

[0031] Figures 7A-7F Monoclonal antibodies effectively inhibit TAM polarization and cancer metastasis and improve the survival rate of mice with tumors. Figure 7A ARG1 expression in PMø treated with LLC-CM for 24 hours and control IgG or antibodies against succinate; Figure 7B VCAM1 expression in PMø treated with antibodies against succinate or control IgG for 3 days in the presence of succinate (1 mM). + CD11c+ CD11b low the proportion of TAMs; Figure 7C shows the result of migration detection of macrophages treated with succinic acid (1 mM) after 24 hours with or without control IgG, anti-succinic acid antibody treatment; Figures 7D-7F shows the TAM polarization degree, number of nodules, and survival time of C57BL / 6J mice with LLC tumors after 6G10F6 monoclonal antibody (1, 5 mg / kg) or control IgG antibody (5 mg / kg) treatment.

[0032] Figure 8 shows the DNA and amino acid sequences of antibody 6G10F6.

[0033] Figure 9 shows the DNA and amino acid sequences of antibody 6G10G5.

[0034] Figure 10 shows the cloning strategy of humanized monoclonal antibody 6G10F6.

[0035] Figure 11 shows the homology modeling of mouse monoclonal antibody Fv fragment.

[0036] Figures 12A-12C shows the binding confirmation of 6G10F6 chimeric antibody. Figure 12A shows the SDS gel electrophoresis (SDS-PAGE) analysis results of 6G10F6 chimeric antibody, where lane M1 is a protein marker (TaKaRa, Cat. No. 3452), lane 1 is a reducing condition, and lane 2 is a non-reducing condition; and the western blot analysis results of 6G10F6 chimeric antibody, where lane 2 is a protein marker (GenScript, Cat. No. M00521), lane P is human IgG1 (Kappa, Sigma, Cat. No. I5154) as a positive control, lane 1 is a reducing condition, and lane 2 is a non-reducing condition; Figures 12B-12C shows the affinity detection results of the chimeric antibody.

[0037] Figure 13 shows the ranking of humanized antibody affinity using Biacore.

[0038] Figures 14A-14B shows the preparation of selected back-mutated antibodies. Figure 14A shows the results of selected antibodies under non-reducing and reducing conditions; Figure 14B shows the purity and yield of purified IgG.

[0039] Figures 15A-15B Affinity detection results of the chimeric antibody and three humanized antibodies are shown. Figure 15A Results using the 1:1 interaction model of Biacore are shown; Figure 15B Results showing its antigen binding affinity to the parental chimeric antibody.

[0040] Figures 16A-16B Results showing the thermal stability evaluation of selected antibodies against the antigen, all antibodies were treated at -80℃, 4℃, 25℃, 40℃ for one to two months. Figure 16A Results showing the thermal stability of four purified antibodies; Figure 16B Results showing the thermal stability of nine untreated IgG samples.

[0041] Figures 17A-17E It is pointed out that the macrophage polarization induced by succinate requires the involvement of SUCNR1. Figure 17A Results showing the VCAM1 expression in macrophages treated with succinate for 1 hour, compared with control IgG or anti-SUCNR1 antibody. + CD11c + CD11b low Fold change of the proportion of -TAM; Figure 17B With 17C Results showing the VCAM1 expression in macrophages transfected with scrambled control siRNA, mouse SUCNR1 siRNA-278, 559 or 758 for 48 hours. Sucnr1 mRNA expression and SUCNR1 protein expression; Figure 17D Results showing the VCAM1 expression in macrophages transfected with scrambled control siRNA, mouse SUCNR1 siRNA-278, 559 or 758 for 16 hours. Arg1 , Fizz1 , Mgl1 , Mgl2 mRNA expression; Figure 17E Results showing the VCAM1 expression in macrophages treated with succinate after different siRNA treatments. + CD11c + CD11b low Proportion of -TAM.

[0042] Figures 18A-18E It is shown that the succinate released by the tumor activates SUCNR1 to facilitate the migration of peritoneal macrophages. Figure 18A Results showing the cell migration detection of macrophages cultured in control medium (DMEM) or A549 conditioned medium (A549-CM); Figure 18BFigure 1 shows the cell migration assay results of macrophages cultured in control medium (DMEM) or A549-CM with or without control IgG or anti-SUCNRl antibody; Figure 18C Figure 2 shows the cell migration assay results of macrophages treated with different concentrations of succinate. Figure 18D Figure 3 shows the cell migration assay results of macrophages treated with succinate (1 mM) with or without control IgG or anti-SUCNRl antibody. Figure 18E Figure 4 shows the cell migration assay results of macrophages treated with different concentrations of succinate and PDGF in the bottom chamber.

[0043] Figures 19A-19F Figure 5 shows that succinate promotes the migration and invasion of tumor cells. Figure 19A Figure 6 shows the cell migration and invasion assay results of LLC cells treated with different concentrations of succinate. Figure 19B 19C Figure 7 shows the cell migration and invasion assay results of A549, HT-29, MCF-7, PC3 cells treated with different concentrations of succinate. Figure 19D Figure 8 shows the expression levels of E-cadherin, N-cadherin and vimentin in A549 cells treated with succinate (0.5, 1, 2.5 mM) or blank control for 24 hours. Figure 19E Figure 9 shows the expression levels of E-cadherin, N-cadherin and vimentin in A549 cells treated with succinate (1 mM) or blank control for a specified period of time. Figure 19F Figure 10 shows the cell migration assay results of A549 cells treated with succinate with or without metformin (2 mM).

[0044] Figures 20A-20C Figure 11 shows that succinate promotes tumor metastasis. Figure 20A Figure 12 shows the lungs excised from C57BL / 6J mice with tumors and the metastatic nodules therein. Figure 20B 20C Figure 13 shows the metastatic nodules in the liver, spleen and adrenal glands excised from C57BL / 6J mice with tumors.

[0045] Figures 21A-21E Figure 14 shows that polarized macrophages induced by succinate enhance the migration of cancer cells. Figure 21A 21B ​​​Figure 1 shows the results of cell migration assays of LLC cells cultured alone and co-cultured with succinate-induced polarized macrophages, and the IL-6 expression levels thereof; Figure 21C , 21D Figure 2 shows the results of cell migration assays of LLC cells cultured alone and co-cultured with succinate-induced polarized macrophages, and the IL-6 expression levels thereof, with the addition of anti-IL-6 neutralizing antibody or control IgG (2.5 μg / ml); Figure 21E Figure 3 shows the IL-6 expression levels of LLC cells co-cultured with macrophages transfected with interfering control siRNA (sc) or SUCNR1 siRNA-758.

[0046] Figures 22A-22C Figure 4 shows the effects of succinate on the intracellular calcium concentration, ERK1 / 2 activation, and prostaglandin E2 (PGE2) production. Figure 22A Figure 5 shows the expression levels of ERK1 / 2 and phosphorylated ERK1 / 2 in A549 / shNC and A549 / shSUCNR1 cells treated with succinate (1 mM) for a specified period of time; Figure 22B , 22C Figure 6 shows the intracellular calcium content in LLC / shNC, LLC / shSUCNR1, A549 / shNC, and A549 / shSUCNR1 cells treated with succinate (1 mM) for 2 hours, and the PGE2 content in their conditioned media.

[0047] Figures 23A-23B Figure 7 shows that succinate promotes the migration and invasion abilities of tumor cells through the SUCNR1 signaling pathway. Figure 23A Figure 8 shows the results of cell migration assays of LLC, A549, PC3, and HT-29 cells treated with succinate (1 mM) with or without control IgG or anti-SUCNR1 antibody; Figure 23B Figure 9 shows the results of invasion ability assays of LLC and HT-29 cells treated with succinate (1 mM) with or without control IgG or anti-SUCNR1 antibody.

[0048] Figures 24A-24F Figure 10 shows that tumor-secreted succinate promotes tumor metastasis through the SUCNR1 signaling pathway. Figure 24A Figure 11 shows the expression levels of SUCNR1 in A549 cell lines stably expressing shSUCNR1 or shNC (A549 / shSUCNR1, A549 / shNC); Figure 24BA549 cells stably transfected with control shRNA or SUCNR1 shRNA (A549 / shNC, A549 / shSUCNR1) were shown to have their cell migration and invasion abilities detected after 24 hours of succinate (1 mM) stimulation; Figure 24C LLC cell lines stably expressing shSUCNR1 (LLC / shSUCNR1) were shown to have their mRNA expression levels detected; Sucnr1 Figure 24D LLC cells and LLC / shSUCNR1 cells were shown to have their cell migration abilities detected after 24 hours of succinate (1 mM) stimulation; Figure 24E Mice injected with A549 / shNC cells or A549 / shSUCNR1 cells were shown to have their lung metastatic nodules detected after 8 weeks of twice-weekly intraperitoneal injection of succinate (100 mg / kg); Figure 24F Mice injected with LLC cells or LLC / shSUCNR1 cells were shown to have their lung metastatic nodules detected after 8 weeks of twice-weekly intraperitoneal injection of succinate (100 mg / kg).

[0049] Figures 25A-25E The effects of succinate on HIF-1a and kinase phosphorylation in A549 and LLC cells were shown. Figure 25A A549 cells and LLC cells were shown to have their HIF-1a, Akt, phosphorylated Akt, AMPK, phosphorylated AMPK, p38 MAPK, and phosphorylated p38 MAPK expression levels detected after a certain period of succinate (1 mM) treatment; Figure 25B LLC cells were shown to have their HIF-1α mRNA expression levels detected after a certain period of succinate (1 mM) treatment; Figure 25C LLC cells were shown to have their HIF-1α mRNA expression levels detected after 12 hours of treatment with different concentrations of LY294002 or SB202190; Figure 25D LLC cells pretreated with LY294002 or SB202190 were shown to have their HIF-1α mRNA expression levels detected after 12 hours of succinate (1 mM) treatment; Figure 25E A549 / shNC and A549 / shSUCNR1 cells were shown to have their HIF-1α mRNA expression levels detected after 12 hours of succinate (1 mM) or dimethyl-ester succinate (DMS, 20 mM) treatment.

[0050] Figures 26A-26F The PI3K-dependent HIF-1a upregulation was shown to be essential for succinate-induced cancer metastasis and EMT.​Figure 26A Cell migration assay results of LLC cells and A549 cells treated with succinate for 24 hours with or without HIF-1a inhibitor, 2-MeOE2, Bay 87-2243 at various concentrations; Figure 26B , 26C Cell migration assay results of A549 cells treated with succinate (1 mM) for 24 hours with or without a-KG (1 mM) or DMOG (200 µM); Figure 26D mRNA expression levels in A549 / shNC or A549 / HIF-1a cells, and cell migration assay results of A549 / shNC or A549 / HIF-1a cells treated with or without succinate (1 mM); HIF-1α mRNA expression levels in A549 / shNC or A549 / HIF-1a cells, and cell migration assay results of A549 / shNC or A549 / HIF-1a cells treated with or without succinate (1 mM); Figure 26E , 26F Expression levels of E-cadherin and vimentin in A549 cells pretreated with LY294002 or Bay 87-2243 and then treated with blank control or succinate (1 mM) for 24 hours.

[0051] Figures 27A-27B Role of HIF-1a in tumor metastasis induced by succinate in vivo. Figure 27A Detection of lung metastatic nodules in mice injected with A549 / shNC or A549 / HIF-1a cells and treated with intraperitoneal injection of succinate (100 mg / kg) twice a week for 8 weeks. Figure 27B Expression levels of E-cadherin and vimentin in total proteins purified from A549 / shNC or A549 / HIF-1a primary subcutaneous tumors. DETAILED DESCRIPTION

[0052] Other features and advantages of the present application will be further illustrated in the following examples, which are only illustrative and not intended to limit the scope of the present application.

[0053] Example 1, Succinate secreted by cancer cells can induce macrophage polarization

[0054] Soluble factors in cancer-conditioned medium can induce TAM markers in macrophages

[0055] ARG1 protein and Arg1 mRNA expression in macrophages were measured by Western blotting and quantitative real time polymerase chain reaction (qPCR), respectively. Conditioned medium (PC3-CM) collected from human prostate cancer PC3 cells was incubated with peritoneal macrophages in RPMI1640 medium containing 10% (v / v) FBS for 24, 48 and 72 hours, respectively. Cell lysates of macrophages treated with control medium or PC3-CM were subjected to immunoblotting with ARG1 or β-actin antibody. The results of three independent experiments showed that ARG1 protein and mRNA expression in macrophages incubated with conditioned medium of lung cancer cell lines (mouse LLC cells and human A549 cells) were increased compared to control medium Figure 1A and 1B , and similar effects were observed in human prostate cancer cells (PC3) to increase ARG1 protein expression in macrophages Figure 1C . On the other hand, peritoneal macrophages were incubated with control medium, conditioned medium collected from MCF-7 (MCF7-CM) or conditioned medium collected from HT29 (HT29-CM) for 24 hours, and qPCR was performed to detect Arg1 mRNA expression in macrophages, which showed that human breast cancer cells (MCF-7) and colon cancer cells (HT-29) could increase Arg1 Arg1 and other TAM markers, such as Arg1 , Fizz1 , Mgl1 mRNA expression Figure 1D .

[0056] To identify the active molecules, LLC-CM and A549-CM were separated into SCM with small molecules (<3 kDa) and PCM with protein-peptide fragments (>3 kDa), and qPCR was performed to analyze Arg1 Arg1 , Fizz1 , Mgl1mRNA expression levels; additionally, peritoneal macrophages were cultured in control medium, LLC-CM, LLC-SCM, or LLC-PCM for three days. The conditioned media (LLC-CM, A549-CM) for LLC and A549 cells were differentiated according to molecular size (<3 kDa and >3 kDa), and their effects on macrophage expression were assessed. Arg1 The effect of expression levels. The results showed that small molecule fragments (<3 kDa) could positively regulate not only Arg1 , Fizz1 , Mgl1 The performance metrics can also be increased by VCAM1. + CD11c + CD11b low - The proportion of TAM. However, protein-peptide fragments (>3 kDa, PCM) do not have the same effect. Figure 1E , 1F (VCAM1 was measured by flow cytometry) + CD11c + CD11b low - The proportion of macrophages was normalized to the number of cells treated with the control group medium. All data are expressed as the mean ± SEM value from three independent experiments. ** is the percentage of macrophages. P <0.005; *** is P <0.0005).

[0057] Next, soluble molecules in LLC-SCM and A549-SCM were identified using liquid chromatography-mass spectrometry (LC-MS). Principal component analysis (PCA) showed that LLC-SCM differed significantly in its component distribution from the control culture medium. Figure 2A ), indicating that there is a difference in the metabolite composition between the two groups. In order to identify the metabolites secreted by cancer cells, the S-plot generated by the orthogonal partial least squares discriminant analysis (OPLS-DA) model was used for analysis. According to the results of the S-plot, it can be seen that the metabolites secreted by the 11 LLC cells have significant fold changes and large p(corr)[1] and CoeffCS values ​​(greater than 0.001) Figure 2BThe three metabolites secreted by LLC cells were identified as succinate, lactate, and citrate by searching the in-house metabolite database and verification of the pure compounds. The chemical identity of the other eight metabolites was not known. In addition, a significant difference between tumor cell-SCM and control medium was observed by mass spectrometry (retention time 1.8 min, m / z 50-400) in LLC-SCM( Figure 2C ) and A549-SCM( Figure 2D ). A major peak at m / z 117.0 was observed in LLC-SCM( Figure 2E ) and A549-SCM( ) but not in control medium, and the sub-ion spectrum of the peak at m / z 117.0 was identical to that of pure succinate.

[0058]

[0059]

[0060] To further confirm the presence of succinate in the conditioned medium of cancer cells, the conditioned medium was analyzed using a succinate colorimetric assay kit. The results showed that comparable succinate concentrations were detected in LLC-CM (0.57 mM), A549-CM (0.43 mM), PC3-CM (0.41 mM), MCF-7-CM (0.28 mM), and HT-29-CM (0.25 mM), whereas only a small amount of succinate was detected in the conditioned medium of macrophages and fresh control medium (both 0.07 mM). These results showed that succinate is the major metabolite in the conditioned medium of cancer cells and can promote macrophage polarization. In addition, C57BL / 6J mice were injected subcutaneously with LLC cells, and tumor formation was induced in the mice after 21 days. The tumors were then excised and analyzed. The results showed that the succinate concentration in the subcutaneous tumors was 0.65 ± 0.039 mM (n = 11, data shown as mean ± SEM, ***p < 0.0005) (Fig. 4A), indicating that cancer cells can release succinate into the extracellular environment, which can be a positive regulator of TAM markers and cause TAM polarization. P <0.0005)( Figure 3B ).

[0061] Succinate secreted by cancer cells induces macrophage polarization

[0062] Mouse peritoneal macrophages were treated with succinate, and the expression levels of TAM markers were detected. The results showed that succinate can increase the expression level of ARG1 protein in mouse peritoneal macrophages in a concentration-dependent mannerFigure 4A In addition, further analysis of the transcription of TAM-specific genes in peritoneal macrophages showed that succinate could enhance the expression of TAM-related genes, including... Arg1 , Fizz1 , Mgl1 , Mgl2 And it exhibits concentration dependence ( Figure 4B In addition, succinic acid can also positively regulate TAM surface markers, including CD11c and VCAM1 (VCAM1). + CD11c + CD11b low ) ( Figure 4C This indicates that succinic acid can polarize macrophages to VCAM1. + CD11c + CD11b low -TAM. Next, using a mouse tumor model derived from LLC cells, the effect of succinate on TAM polarization in vivo was evaluated. LLC cells were subcutaneously injected into C57BL / J6 mice, followed by intraperitoneal injections of succinate (20, 100 mg / kg) or a blank control (excipient) twice weekly for 3 weeks. Primary subcutaneous tumors were collected on day 21, and flow cytometry was used to analyze tumors collected from different groups (n=11 in the saline group; n=8 in the 20 mg / kg succinate group; n=10 in the 100 mg / kg succinate group) to assess the proportion of TAM (data are the mean of three experiments ± SEM, where * indicates P<0.05, ** indicates P<0.005, *** indicates P<0.0005). The results showed that the primary subcutaneous tumors collected from mice treated with succinate contained VCAM1. + CD11c + CD11b low The number of -TAM was significantly higher in mice given saline solution than in mice given saline solution. Figure 4D Overall, the results above indicate that succinic acid can promote the functional polarization of TAM.

[0063] Example 2: Using serum succinic acid as a biomarker for cancer diagnosis

[0064] Increased expression of succinate receptors in human lung cancer

[0065] To provide information on the clinical relevance of SUCNR1, qPCR was used to detect the expression levels of receptor mRNA in 213 human hepatocellular carcinoma (HCC) tissues and 78 tumor-free liver tissues (Table 2). The results showed that the mean receptor mRNA expression level in HCC tissues was significantly higher than that in tumor-free liver tissues. Figure 5A The increased expression of SUCNR1 in tumors indicates that succinic acid contributes to the tumor-promoting ability of tumors.

[0066] Table 2. Patient demographics used to analyze SUCNR1

[0067]

[0068] Serum succinate is a potential biomarker for lung cancer.

[0069] C57BL / 6J mice were injected with LLC cells, and the serum succinate concentration was analyzed before and after LLC cell inoculation. Succinate was detectable before LLC cell injection (mean 0.17 ± 0.037 mM, n = 7), and increased 16 days after LLC cell inoculation (mean 0.36 ± 0.059 mM, observed in mice with 177.6 mm HBeAg deficiency). 3 The tumor, n=7)( Figure 5B This result indicates that serum succinic acid levels are elevated in mice with tumors. Furthermore, the clinical significance of serum succinic acid concentration was confirmed in 21 healthy subjects and 97 non-small cell lung cancer patients (Table 3). The mean serum succinic acid concentration in lung cancer patients (0.53 ± 0.038 mM) was significantly higher than that in healthy subjects. Figure 5C The elevated serum succinate concentration in non-small cell carcinoma patients indicates that it may be associated with tumor progression and could potentially serve as a marker of cancer progression. Furthermore, the area under the receiver operating characteristic (AUROC) curve was used to confirm the discriminative power of this patient group. Figure 5D The area under the curve (AUC) for succinic acid was 0.70 (95% confidence interval: 0.594–0.813). p = 0.0036), and the cutoff level for succinic acid with the best diagnostic efficiency obtained from the AUROC curve was 0.34 mM (with a sensitivity of 53.61% and a specificity of 85.71%). Therefore, the AUROC analysis shows that serum succinic acid has a higher predictive value for patients with non-small cell lung cancer. In summary, these results indicate that serum succinic acid can serve as a predictive biomarker for patients with non-small cell lung cancer.

[0070] Table 3. Patient demographics used to analyze serum succinate levels

[0071]

[0072] Results expressed in terms of patient numbers

[0073] IQR, interquartile range

[0074] Example 3, Development of Anti-Succinate Monoclonal Antibody and Therapeutic Effect

[0075] Development of Anti-Succinate Monoclonal Antibody as a Therapeutic Antibody Against Cancer

[0076] Since cancer cells secrete succinate into the tumor microenvironment to promote TAM polarization and cancer cell metastasis, and the concentration of succinate in the serum of lung cancer patients is significantly increased, in order to further detect the possibility of inhibiting tumor occurrence by neutralizing succinate in the serum using anti-succinate antibodies, a carrier peptide conjugated to succinate was prepared as an antigen to produce multiple antibodies against succinate, and the effect on LLC cell migration was detected. New Zealand rabbits were immunized with succinate-bovine serum albumin conjugate, and at the third immunization, the immune serum was pre-adsorbed on the protein in vivo and purified by protein A column (GenScript). Indirect ELISA test (GenScript) was performed using succinate-KLH (lysine-arginine-citrulline) conjugate to analyze the specificity of the antibody. Figure 6A In addition, in order to confirm the ability of anti-succinate antibodies to neutralize succinate in cancer-conditioned medium, the concentration of succinate in cancer-conditioned medium treated with anti-succinate antibodies or control antibodies, respectively, was also measured. LLC-CM or A549-CM was incubated with different concentrations of anti-succinate antibodies at 37°C overnight, and then succinate colorimetric assay kit was used to measure the concentration of succinate in LLC-CM or A549-CM. The results showed that anti-succinate antibodies can significantly reduce the concentration of succinate in cancer-conditioned medium, while control antibodies have no such effect. Figure 6B In addition, LLC cells were seeded in the upper chamber of a transwell plate and treated with control IgG or anti-succinate antibody (Succ Ab) for 24 hours, and PDGF-BB was used as a chemoattractant. The results showed that anti-succinate antibodies can inhibit the migration of LLC cells, while control antibodies have no such effect. Figure 6C

[0077] ​Therefore, further therapeutic monoclonal succinate antibodies were prepared. A total of 20 mouse monoclonal antibodies were produced and selected for ELISA testing. Among the 20 monoclonal antibodies, the top five with the highest binding affinity were selected for subsequent evaluation of anticancer ability. The results showed that the five monoclonal antibodies derived from the five cell lines could effectively inhibit the cell migration of A549 cells, and in particular, the monoclonal antibody produced by the 6G10 cell line had the best anti-cell migration activity. To determine the reason why tumor-secreted succinate induced macrophages to express ARG1, the effect of 6G10 monoclonal antibody on ARG1 expression was further detected. PMo treated with LLC-CM was co-cultured with control IgG or anti-succinate antibody for 24 hours, and then the cell lysate was subjected to ARG1 or β-actin antibody immunoblotting, which showed that F5 monoclonal antibody could inhibit the up-regulation of ARG1 caused by LLC-CM, while control IgG had no such effect Figure 7A ); in addition, PMo was pretreated with anti-succinate antibody or control IgG for 1 hour, then stimulated with succinate (1 mM) for 3 days, and the VCAM1 + CD11c + CD11b low proportion of TAM was normalized by the number of cells in the control medium; macrophages treated with succinate (1 mM) were subjected to transwell detection after being treated with control IgG or anti-succinate antibody for 24 hours, and the results showed that F6 monoclonal antibody not only inhibited the up-regulation of TAM surface markers, including CD11c and VCAM1 (VCAM1 + CD11c + CD11b low ( Figure 7B ), but also inhibited the migration of macrophages induced by succinate, while control IgG had no such effect Figure 7C ). Therefore, the 6G10 monoclonal antibody was selected as the first candidate antibody to evaluate its therapeutic effect on a homologous mouse tumor model of LLC. LLC cells were first injected subcutaneously into C57BL / 6J mice, so that the mice had an average of about 50 mm 3 of subcutaneous tumors (8 days after LLC tumor inoculation), and then the mice were given intraperitoneal injections of 6G10F6 monoclonal antibody (1, 5 mg / kg) or control antibody IgG (5 mg / kg) twice a week for a total of 5 weeks. The subcutaneous tumors were surgically removed at the 3rd week after LLC injection to evaluate TAM polarization, and the lungs, liver, spleen and adrenal glands of the mice were collected 2 weeks after tumor removal to evaluate tumor metastasis. The results showed that 6G10F6 monoclonal antibody not only effectively inhibited the TAM population in subcutaneous tumors Figure 7D), and also inhibited the reproducibility of lung tumors Figure 7E ), and also significantly prolonged the survival of mice with LLC tumors Figure 7F ). These results indicate that the 6G10F6 monoclonal antibody can be used as a therapeutic anti-cancer monoclonal antibody.

[0078] Sequencing of the monoclonal antibodies of the fusion tumors 6G10F6 and 6G10G5

[0079] To determine the sequence of the anti-succinate antibodies produced by the 6G10 cell line, the antibodies of the two fusion tumors 6G10F6 and 6G10G5 were sequenced. Total RNA was isolated from the fusion tumor cells according to the instructions of the TRIzol R reagent, and the total RNA was reverse transcribed into cDNA using isotype-specific anti-sense primers or universal primers according to the instructions of the PrimeScript TM 1st Strand cDNA Synthesis Kit, and the antibody fragments of the VHand VLwere amplified using the standard operating procedure of the rapid amplification of cDNA ends (RACE) of GenScript. The amplified antibody fragments were then transferred to a standard cloning vector, and colonies PCR was used to screen colonies with the correct size of the inserted fragments. Each fragment was sequenced in at least five colonies with the correct size. After comparing the sequences of the different colonies, the sequences common to the colonies were as shown in SEQ ID NO: 1 for the DNA sequence encoding the heavy chain of the 6G10F6 antibody, and as shown in SEQ ID NO: 2 for the amino acid sequence thereof; as shown in SEQ ID NO: 3 for the DNA sequence encoding the light chain of the 6G10F6 antibody, and as shown in SEQ ID NO: 4 for the amino acid sequence thereof; as shown in SEQ ID NO: 5 for the DNA sequence encoding the heavy chain of the 6G10G5 antibody, and as shown in SEQ ID NO: 6 for the amino acid sequence thereof; and as shown in SEQ ID NO: 7 for the DNA sequence encoding the light chain of the 6G10F6 antibody, and as shown in SEQ ID NO: 8 for the amino acid sequence thereof. Figure 8 and Figure 9 and as shown in SEQ ID NO: 4 for the amino acid sequence thereof; as shown in SEQ ID NO: 5 for the DNA sequence encoding the heavy chain of the 6G10G5 antibody, and as shown in SEQ ID NO: 6 for the amino acid sequence thereof; and as shown in SEQ ID NO: 7 for the DNA sequence encoding the light chain of the 6G10F6 antibody, and as shown in SEQ ID NO: 8 for the amino acid sequence thereof.

[0080] Antibody humanization of the mouse 6G10F6 monoclonal antibody and design of back-mutations

[0081] After functional evaluation of the 6G10F6 monoclonal antibody, it was found to have the functions of neutralizing succinic acid, inhibiting TAM polarization, and cancer metastasis. Therefore, the mouse 6G10F6 monoclonal antibody will be further humanized by using the complementarity-determining region (CDR) grafting and back mutation methods without sacrificing the binding affinity of the parent (chimeric) antibody. In order to reduce immunogenicity, the constant region of the mouse 6G10F6 monoclonal antibody will be replaced by the constant region of human IgG4 (heavy chain) and lambda chain (light chain) to generate a chimeric mouse-human 6G10F6 antibody for the development of humanized antibodies. Figure 10 For humanization, the CDR-grafted humanized antibody was designed, and then replaced with the presumed back mutation sites on the grafted antibody. In short, the CDR of the chimeric 6G10F6 antibody was grafted into a human acceptor (immunoglobulin µ heavy chain VH and immunoglobulin lambda chain variable region VL; Figure 10 ) to generate a humanized light chain and a humanized heavy chain for each chimeric antibody. The residues in the CDRs that are important for binding activity, the framework region, and the VH-VL interface were selected for substitution of the counterparts on the parent antibody.

[0082] The structure of the chimeric mouse-human 6G10F6 antibody was simulated by a computer-aided homology modeling program to identify the positions of the back mutations. In short, a BLAST search of the mouse 6G10F6 antibody sequence was performed on the PDB antibody database to determine the best template for the Fv fragment, especially for constructing the domain interface template. A structure template with 66% identity, 2BJM (crystal structure of SPE7: anthrone complex), was selected. The amino acid sequence alignment of the mouse monoclonal antibody and the 2BJM template is shown in Figure 11As shown, based on the homology model of 2BJM, all the backbone residues in the core were selected in order to mutate these residues back to the mouse monoclonal antibody, the internal hydrophobic interactions were preserved and the potential immunogenicity caused by back mutations was reduced. The humanized variable regions in the heavy chain were named VH1, VH2, VH3, VH4, VH5, which respectively comprise the amino acid sequences as recited in SEQ ID NOs: 9, 10, 11, 12, 13; while the humanized variable regions in the light chain were named VL1, VL2, VL3, VL4, VL5, VL6, VL7, VL8, which respectively comprise the amino acid sequences as recited in SEQ ID NOs: 14, 15, 16, 17, 18, 19, 20, 21; on the other hand, the humanized variable regions VH1, VH2, VH3, VH4, VH5 in the heavy chain respectively comprise the DNA sequences as recited in SEQ ID NOs: 22, 23, 24, 25, 26; while the humanized variable regions VL1, VL2, VL3, VL4, VL5, VL6, VL7, VL8 in the light chain respectively comprise the DNA sequences as recited in SEQ ID NOs: 27, 28, 29, 30, 31, 32, 33, 34.

[0083] Determination of binding affinity of chimeric 6G10F6 antibody and humanized antibodies

[0084] In order to construct and produce chimeric 6G10F6 antibody and humanized antibodies, DNA sequences encoding humanized IgG heavy and light chains were synthesized and inserted into pCDNA3.4 vector to construct full-length IgG expression plasmids (as shown in Figure 11 Forty humanized antibodies were expressed in HEK293 cells, and after centrifugal separation of the cells, the expression amount of the supernatant was detected by ELISA, and the binding and affinity ranking were confirmed by surface plasmon resonance (SPR) using Biacore 8K. Chimeric 6G10F6 antibody was purified Figure 12A ), and the affinity of succinic acid antibody to Ag was determined by surface plasmon resonance biosensor, in which the primary antibodies were goat anti-human IgG-HRP (GgeScript, Cat. No. A00166) and goat anti-human λ-HRP (SouthernBiotech, Cat. No. 2070-05). The affinity and kinetics of chimeric antibody to BSA-succinic acid are listed in Figure 12B , and the sensor-grams are shown in Figure 12CIn the study, the affinity of expressed antibodies to parental antibodies was ranked. The affinity of BSA-succinic acid for the supernatant of HEK293 cells expressing various humanized antibodies was shown in the [data missing]. Figure 13 In the middle, communities that cannot be combined with the marker are shown as gray markers.

[0085] Based on affinity ranking, the top three humanized antibodies (VH3+VL3, VH4+VL2, VH4+VL3) were expressed and purified according to GenScript standard operating procedures. Evaluation by SDS-PAGE showed that the purity of the humanized IgG was approximately 85%. Figure 14A The purified IgG yield is listed in Figure 14B Further, the top three purified antibodies by purity were selected and their affinity was tested at different concentrations. The binding data for each antibody were fitted to a 1:1 interaction model using Biacore 8K software; all data fit the model well (see [link to Biacore 8K software]). Figure 15A ).like Figure 15B As shown, all three humanized antibodies retained antigen-binding affinity comparable to that of the parental chimeric antibodies.

[0086] Thermostability determination of purified humanized IgG

[0087] In addition, ELISA was used to assess the stability of four purified antibodies (including chimeric and humanized antibodies VH3+VL3, VH4+VL2, and VH4+VL3) and the supernatant of nine HEK293 cells expressing each humanized antibody. The ELISA results showed that the three humanized antibodies could still bind stably to the antigen after being treated at different temperatures for two months (Figure 16).

[0088] In summary, mouse monoclonal antibodies (mAbs) can be successfully humanized. Five heavy chains and eight humanized light chains have been successfully designed and synthesized, and they have been inserted into the pCDNA3.4 expression vector for expression.

[0089] Example 4: Succinic acid can induce cancer cell migration and enhance cancer metastasis through a specific membrane receptor, SUCNR1.

[0090] The SUCNR1 signaling pathway is involved in succinic acid-mediated TAM polarization.

[0091] Succinic acid is a known ligand for SUCNR1; therefore, this study aimed to further investigate whether succinic acid could promote TAM polarization via SUCNR1. First, peritoneal macrophages were pretreated with control IgG and anti-SUCNR1 antibody for 1 hour, followed by stimulation with succinic acid (1 mM) for 3 days. VCAM1 levels were then quantified using flow cytometry. + CD11c +CD11b low While data are presented as fold relative to control medium-treated group, anti-SUCNR1 antibody-treated macrophages abrogated succinate-mediated VCAM1 + CD11c + CD11b low positive regulation of number Figure 17A In addition, peritoneal macrophages were transfected with scrambled control siRNA, mouse SUCNR1 siRNA-278, 559, or 758 for 48 h, and then divided into groups for 1 mM succinate (Succ) stimulation or no treatment for 16 h or 3 days. The mRNA expression levels of Sucnr1 mRNA expression and SUCNR1 protein expression using ARG1 or β-actin as a loading control (data represent mean ± SEM of three experiments, *p < 0.05; **p < 0.005; ***p < 0.0005). P <0.05;** P <0.005;*** P <0.005), and the results showed that inhibition of SUCNR1 expression by specific siRNAs (si-278, si-559, and si-758) but not control siRNA suppressed succinate-induced Figure 17B 、 17C Arg1 、 Fizz1 、 Mgl1 、 Mgl2 mRNA expression Figure 17D and three different SUCNR1 siRNAs abrogated succinate-mediated VCAM1 + CD11c + CD11b low positive regulation of number, but not scrambled control siRNA Figure 17E These results indicate that succinate promotes TAM polarization through the SUCNR1 signaling pathway.

[0092] Succinate-activated SUCNR1 promotes macrophage migration

[0093] ​To further examine whether cancer CM and succinate can induce macrophage migration, peritoneal macrophages were seeded in the upper chamber of transwell plates and incubated in control medium (DMEM) or A549 cell CM (A549-CM) for 24 h, respectively. In addition, peritoneal macrophages were seeded in the upper chamber of transwell plates and incubated in control medium (DMEM) or A549 cell CM (A549-CM) for 24 h in the presence or absence of control IgG or anti-SUCNRl antibody. Subsequently, cell migration was tested using PDGF-BB as a chemoattractant and the migrated cells were counted, and the results were expressed as fold over basal control, as shown in Figure 18A As shown in 18B , compared with control medium, A549-CM and A549-SCM promoted macrophage migration, but anti-SUCNRl antibody inhibited this effect, while control IgG had no effect. In addition, treatment of macrophages with different concentrations of succinate for 24 h showed that anti-SUCNRl antibody inhibited succinate-induced macrophage migration, while control IgG had no effect Figure 18C , indicating that the succinate / SUCNRl signaling pathway is essential for macrophage migration.

[0094] To determine whether tumor-secreted succinate is a soluble chemoattractant for macrophages, peritoneal macrophages were treated with succinate (1 mM) in the presence or absence of control IgG or anti-SUCNRl antibody for 24 h, and then cell migration was analyzed by transwell assay, in which PDGF and different concentrations of succinate were added to the lower chamber of the transwell plate. Compared with the control group, succinate significantly enhanced macrophage migration Figure 18D , and the degree of succinate-induced migration was similar to that of PDGF, indicating that tumor cells can secrete succinate to promote macrophage aggregation and migration, and subsequent TAM polarization.

[0095] Succinate induces cancer cell migration and epithelial-mesenchymal transition (EMT) and enhances cancer metastasis

[0096] Since succinate can promote macrophage migration, it will be further tested whether succinate can regulate cancer cell migration. LLC cells were seeded on regular membrane or Matrigel-coated membrane and treated with different concentrations of succinate for 24 hours, and then transwell migration test and invasion ability test were performed. The relative migration or invasion ability was calculated in 3 fields under a light microscope. Similarly, A549, HT-29, MCF-7, and PC3 cells were seeded in the upper chamber of the transwell plate and treated with different concentrations of succinate for 24 hours. In the migration test and invasion ability test, PDGF-BB was used as the chemotactic factor, and the number of migrated cells was calculated. The results were expressed as the fold of the control. The results showed that succinate can promote the cell migration and invasion ability of LLC lung cancer cells Figure 19A ), A549 lung cancer cells, HT-29 colon cancer cells, MCF-7 breast cancer cells, and PC3 prostate cancer cells Figure 19B 、 19C ) in a dose-dependent manner.

[0097] Succinate also affects EMT in cancer cells. In short, A549 cells were treated with blank control or succinate (0.5, 1, 2.5 mM) for 24 hours, and then the cells were treated with blank control or succinate (1 mM) for a specific period of time. After cell lysis, E-cadherin, N-cadherin, vimentin, or β-actin-specific antibodies were used for immunoblotting of cell lysates. On the other hand, A549 cells were treated with succinate for 24 hours with or without metformin (2 mM) to evaluate the effect of EMT inhibition, and the cell migration ability was determined using a transwell test. The results showed that succinate can inhibit E-cadherin and increase the expression of N-cadherin and vimentin, and the effect is time- and dose-dependent Figure 19D 、 19E ). Importantly, the EMT inhibitor metformin can eliminate the A549 cell migration induced by succinate Figure 19F ), indicating that the succinate secreted by cancer cells can promote the migration and invasion ability of cancer cells through EMT-related mechanisms in an autocrine or paracrine manner.

[0098] Next, the physiological relevance of tumor-secreted succinate in tumor metastasis was examined using a syngeneic LLC tumor model. LLC cells were injected subcutaneously into C57BL / 6J mice, which were then given blank control or succinate (20, 100 mg / kg) twice a week by intraperitoneal injection. After 3 weeks, the subcutaneous primary tumors were surgically removed, and the mice were further bred for 2 weeks before being sacrificed. The lungs, liver, spleen, and adrenal glands were collected to assess cancer metastasis. The results showed that the number of cancer metastatic nodules in the lungs of succinate-treated mice was higher than that of saline-treated mice, and showed a dose-dependent relationship ( Figure 20A ), and the number of cancer metastatic nodules in the lungs and spleens of succinate-treated mice was also higher ( Figure 20B ); in addition, the incidence of metastasis in the adrenal glands of succinate-treated mice was also higher, but did not reach a statistically significant difference ( p = 0.088) Figure 20C

[0099] Succinate-polarized macrophages enhance cancer cell migration

[0100] Since succinate can enhance cancer cell metastasis through changes in macrophage phenotype, the effect of succinate-polarized macrophages on cancer cell migration was examined. Succinate-treated macrophages were polarized for 3 days, and then co-cultured with LLC cancer cells in transwell culture plates, and transwell assay was used to analyze cancer cell migration. The results showed that, compared with LLC cells cultured alone, polarized macrophages enhanced LLC cell migration ( Figure 21A ); on the other hand, IL-6 concentration increased in co-cultured culture medium, but not in culture medium cultured alone ( Figure 21B ). Notably, the elimination of IL-6 in co-cultured medium by adding anti-IL-6 neutralizing antibody ( Figure 21D ) can eliminate the enhanced migration ability of LLC cells co-cultured with polarized macrophages ( Figure 21C ). These results show that IL-6 secretion mediated by polarized macrophages is crucial for LLC cell migration.

[0101] LLC cells were co-cultured with macrophages transiently transfected with SUCNR1 siRNA758 and treated with succinate for 3 days, and the cell migration ability of macrophages transfected with SUCNR1 siRNA758 was significantly lower than that of macrophages transfected with control siRNA only ( Figure 21E ), indicating that succinate-induced macrophage polarization contributes to promoting cancer cell migration. ​

[0102] Succinate can promote cancer metastasis through SUCNR1 signaling pathway

[0103] Succinate can bind to SUCNR1 to activate multiple signaling pathway targets, particularly mitogen-activated protein kinases (MAPK), and increase intracellular calcium ion and prostaglandin E2 (PGE2). To determine that succinate can activate SUCNR1 in cancer cells, typical targets activated by succinate in A549 cells were analyzed. A549 / shNC, A549 / shSUCNR1 cells were treated with succinate (1 mM) for a certain time, and the cell lysate obtained after cell lysis was subjected to immunoblotting with specific antibodies for ERK1 / 2, phosphorylated ERK1 / 2. It was shown that after succinate treatment, phosphorylated ERK1 / 2 in A549 cells transfected with control RNA rapidly increased at a time point of two minutes, but this phenomenon was inhibited in A549 cells transfected with SUCNR1 shRNA. Figure 22A Further, LLC / shNC, LLC / shSUCNR1, A549 / shNC, A549 / shSUCNR1 cells were treated with succinate (1 mM) for 2 hours, and the intracellular calcium concentration and PGE2 content in the conditioned medium were detected by calcium colorimetric assay kit and PGE2 ELISA kit, respectively. The results showed that the intracellular calcium ion concentration of A549 or LLC cells increased after 2 hours of succinate treatment Figure 22B , however, the intracellular calcium ion concentration in both cells transfected with SUCNR1 shRNA did not increase Figure 22B ; in addition, the PGE2 content released into the medium was increased in LLC cells transfected with control shRNA, but not in LLC cells transfected with SUCNR1 shRNA Figure 22C , which is consistent with the explanation that succinate can activate the targets of SUCNR1 signaling.

[0104] Further, the ability of succinate to induce cancer cell migration through SUCNR1 was detected. LLC, A549, PC3 and HT-29 cells were treated with succinate (1 mM) for 24 hours with or without control IgG or anti-SUCNR1 antibody, and then transwell assay was used to analyze the cell migration. The results showed that anti-SUCNR1 antibody can block the migration of LLC A549, PC3 and HT-29 cells induced by succinate, while control IgG has no such effectFigure 23A ) In addition, LLC and HT-29 cells were treated with succinate (1 mM) for 24 hours with or without control IgG or anti-SUCNRl antibody, and then subjected to matrigel invasion assay. The results showed that the invasion of LLC and HT-29 cells induced by succinate was inhibited by SUCNRl antibody, but not by IgG antibody Figure 23B ).

[0105] Next, the cell migration and invasion induced by succinate in A549 cells (#3 and #8, stably transfected with SUCNRl shRNA, in which the expression of SUCNRl was reduced, Figure 24A ) were analyzed. A549 cells transfected with control shRNA (A549 / shNC) or SUCNRl shRNA (A549 / shSUCNRl) were treated with succinate (1 mM) for 24 hours, and then subjected to transwell assay and matrigel invasion assay. The results showed that the cell migration and invasion induced by succinate were inhibited by the reduction of SUCNRl gene Figure 24B ), and the cell migration induced by succinate was also reduced in LLC cells stably transfected with shSUCNRl (LLC / shSUCNRl) compared with control LLC cells (LLC / shNC) Sucnr1 ). Figure 24C and 24D ).

[0106] To investigate the effect of SUCNRl on the enhanced metastasis by succinate in vivo, A549 / shNC or A549 / shSUCNRl cells were subcutaneously inoculated into nude mice, and then the mice were given intraperitoneal injection of succinate (100 mg / kg) twice a week for 8 weeks. The mice were euthanized on day 56, and the lung tissues were removed for examination of metastatic nodules. The results showed that the lung metastatic nodules in mice inoculated with A549 / shSUCNRl cells were significantly lower than those in mice inoculated with A549 / shNC cells Figure 24E ), and similar results were observed in mice inoculated with LLC / shSUCNRl cells, in which the lung metastatic nodules were significantly reduced Figure 24F . These results showed that succinate promoted cancer metastasis through SUCNRl.

[0107] Succinate induced cancer metastasis through PI3K / AKT and HIF-1α signaling pathways

[0108] MAPK, phosphatidylinositol 3-kinase (PI3K)-AKT-TOR, and AMP-activated protein kinase (AMPK)-mediated hypoxia-inducible factor-1α (HIF-1α) play important roles in macrophage activation and cancer progression. Therefore, this study further investigated whether these signaling factors are also related to the effects of succinate. A549 and LLC cells were treated with succinate (1 mM) for a specific period, followed by cell lysis to obtain cell lysates. Immunomodulation was performed using specific antibodies against HIF-1α, Akt, phosphorylated Akt, AMPK, phosphorylated AMPK, p38 MAPK, phosphorylated p38 MAPK, or β-actin. Additionally, qPCR was used to detect the levels of HIF-1α, Akt, phosphorylated Akt, AMPK, phosphorylated AMPK, p38 MAPK, phosphorylated p38 MAPK, or β-actin in LLC cells treated with succinate (1 mM) for a specific period. Hif-1α mRNA expression levels. Results showed that in LLC and A549 cells, succinate induced phosphorylation of p38 MAPK, AKT, and AMPK in a time-dependent manner, and increased HIF-1α protein expression. Figure 25A ) and mRNA expression level ( Figure 25B LLC cells were treated with different concentrations of the selective kinase inhibitors LY294002 or SB202190 for a total of 12 hours, and their activity was measured. Hif-1α mRNA expression levels; In another part, LLC cells were pretreated with LY294002 or SB202190 for 1 hour, followed by stimulation with succinic acid (1 mM) for 12 hours, and then their expression levels were measured. Hif-1α mRNA expression levels. Results showed that PI3K / AKT inhibitors could suppress the cell's own mRNA expression levels. Hif-1α Expression level, and succinic acid-induced Hif-1α The expression level, while p38 MAPK inhibitors have no such effect ( Figure 25C and 25D To understand the role of SUCNR1 in driving HIF-1α expression in cells, the expression level of HIF-1α in A549 / shSUCNR1 cells was further investigated. The expression level of HIF-1α in A549 / shNC and A549 / shSUCNR1 cells treated with succinate (1 mM) or dimethyl succinate (DMS, 20 mM) for 12 hours was detected by qPCR. The results showed that HIF-1α expression was higher in A549 / shNC cells treated with succinate. HIF-1α Positive regulation ( Figure 25EIn contrast, A549 / shNC cells treated with membrane-penetrating DMS showed an increase in HIF-1α expression. However, in A549 / shSUCNR1 cells, succinate-induced HIF-1α expression was suppressed, but DMS-induced HIF-1α expression was not suppressed. This indicates that succinate induces HIF-1α expression in a SUCNR1-related manner, while DMS induces HIF-1α expression without the need for SUCNR1 intervention.

[0109] Since the HIF-1α pathway is known to mediate cancer metastasis through inducing EMT, this study will further investigate whether succinate can promote lung cancer cell migration and EMT through an HIF-1α-dependent signaling pathway. LLC and A549 lung cancer cells were treated with different concentrations of HIF-1α-specific inhibitors, and their cell migration ability was then assessed using a transwell assay. The results showed that the pharmacologically effective HIF-1α inhibitors 2-MeOE2 and Bay 87-2243 inhibited succinate-induced cell migration in both LLC and A549 cells in a dose-dependent manner. Figure 26A Prolyl hydroxylase (PHD) controls the stability of the HIF-1α protein by hydroxylating two conserved proline residues and accelerating their degradation. To provide further evidence supporting the key role of HIF-1α in succinate-induced cancer cell migration, cells were treated with either the PHD activator α-ketoglutarate (α-KG) or the inhibitor dimethyloxalyl glycine (DMOG) to analyze cell migration. The results showed that α-KG inhibited succinate-induced cancer cell migration, while DMOG promoted it. Figure 26B , 26C In addition, qPCR was used to measure the levels of [unclear - possibly "influence" or "influence"] in A549 / shNC or A549 / HIF-1α cells. HIF-1α The expression levels were measured, and the cell migration ability of A549 / shNC or A549 / HIF-1α cells treated with or without succinate was detected by transwell assay. Results showed that HIF-1α gene attenuation (A549 / HIF-1α) inhibited succinate-induced cell migration in A549 cells, but this phenomenon was not observed in the control group (A549 / shNC). Figure 26D). In addition, A549 cells were pretreated with LY294002 or Bay 87-2243 for one hour, and then treated with blank control or succinate (1 mM) for 24 hours. After cell lysis, the cell lysate was subjected to immunoblotting with antibodies specific to E-cadherin, N-cadherin, vimentin, or β-actin. The results showed that blocking PI3K by LY294002 or blocking HIF-1α signaling pathway by Bay 87-2243 both inhibited the increase in vimentin and the decrease in E-cadherin induced by succinate Figure 26E 、 26F ).

[0110] The role of HIF-1α in metastasis induced by succinate in vivo was confirmed using a xenograft A549 / shHIF-1α tumor model. A549 / shNC or A549 / HIF-1α cells were subcutaneously inoculated into nude mice, and then the mice were given intraperitoneal injections of succinate (100 mg / kg) twice a week for 8 weeks. The results showed that the number of metastatic nodules in the lungs of mice inoculated with A549 / HIF-1α was significantly lower than that of mice inoculated with A549 / shNC Figure 27A ), On the other hand, immunoblotting of total proteins extracted from primary subcutaneous tumors of A549 / shNC or A549 / HIF-1α was performed using antibodies specific to E-cadherin, vimentin, or β-actin. The results showed that, compared with A549 / shNC primary subcutaneous tumors, the decrease in E-cadherin and the increase in vimentin induced by succinate in A549 / HIF-1α primary subcutaneous tumors were reversed Figure 27B ). In summary, these results showed that SUCNR1 activated by succinate can induce EMT mediated by HIF-1α through the PI3K / AKT signaling pathway, thereby promoting cancer metastasis. SEQUENCE LISTING <110> Taiwan Health Research Institute <120> Use of succinate as a biomarker for cancer diagnosis and treatment <150> US 62 / 916,376 <151> 2019-10-17 <160> 34 <170> PatentIn version 3.5 <210> 1 <211> 411 <212> DNA <213> Artificial sequence <220> <221> misc_feature <223> Heavy chain of 6G10F6 antibody <400> 1 atgagagtgc tgattctttt gtggctgttc acagcctttc ctggtatcct gtctgatgtg 60 cagcttcagg agtcgggacc tggcctggtg aaaccttctc agtctctgtc cctcacctgc 120 actgtcactg gctactcaat caccagtgat tatgcctgga actggttccg gcagtttcca 180 ggaaacaaac tggagtggat gggctacaca agctacagtg gtagcactag ctataaccca 240 tctctcaaaa gtcgaatctc tatcactcga aacacatcca agaaccagat cttcctgcag 300 ttgaattctg tgactcctga ggacacagcc acatattact gtgcaagaga ggttactacg 360 tttggatact ttgactactg gggccaaggc accactctca cagtctcctc a 411 <210> 2 <211> 137 <212> PRT <213> Artificial sequence <220> <221> UNSURE <223> Heavy chain of 6G10F6 antibody <400> 2 Met Arg Val Leu Ile Leu Leu Trp Leu Phe Thr Ala Phe Pro Gly Ile 1 5 10 15 Leu Ser Asp Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro 20 25 30 Ser Gln Ser Leu Ser Leu Thr Cys Thr Val Thr Gly Tyr Ser Ile Thr 35 40 45 Ser Asp Tyr Ala Trp Asn Trp Phe Arg Gln Phe Pro Gly Asn Lys Leu 50 55 60 Glu Trp Met Gly Tyr Thr Ser Tyr Ser Gly Ser Thr Ser Tyr Asn Pro 65 70 75 80 Ser Leu Lys Ser Arg Ile Ser Ile Thr Arg Asn Thr Ser Lys Asn Gln 85 90 95 Ile Phe Leu Gln Leu Asn Ser Val Thr Pro Glu Asp Thr Ala Thr Tyr 100 105 110 Tyr Cys Ala Arg Glu Val Thr Thr Phe Gly Tyr Phe Asp Tyr Trp Gly 115 120 125 Gln Gly Thr Thr Leu Thr Val Ser Ser 130 135 <210> 3 <211> 384 <212> DNA <213> Artificial sequence(人工序列) <220> ​ <223> Light chain of 6G10F6 antibody <400> 3 atggcctgga cttcacttat actctctctc ctggctctct gctcaggagc cagttcccag 60 gctgttgtga ctcaggaatc tgcactcacc acatcacctg gtggaacagt catactcact 120 tgtcgctcaa gtactggggc tgttacaact agtaactatg ccaactgggt ccaagaaaaa 180 ccagatcatt tattcactgg tctaataggt ggtaccagca accgagctcc aggtgttcct 240 gtcagattct caggctccct gattggagac aaggctgccc tcaccatcac aggggcacag 300 actgaggatg atgcaatgta tttctgtgct ctatggtaca gcacccatta tgttctcggc 360 ggtggaacca aggtcactgt ccta 384 <210> 4 <211> 128 <212> PRT <213> Artificial sequence <220> <221> UNSURE <223> Light chain of 6G10F6 antibody <400> 4 Met Ala Trp Thr Ser Leu Ile Leu Ser Leu Leu Ala Leu Cys Ser Gly 1 5 10 15 ​Ala Ser Ser Gln Ala Val Val Thr Gln Glu Ser Ala Leu Thr Thr Ser 20 25 30 Pro Gly Gly Thr Val Ile Leu Thr Cys Arg Ser Ser Thr Gly Ala Val 35 40 45 Thr Thr Ser Asn Tyr Ala Asn Trp Val Gln Glu Lys Pro Asp His Leu 50 55 60 Phe Thr Gly Leu Ile Gly Gly Thr Ser Asn Arg Ala Pro Gly Val Pro 65 70 75 80 Val Arg Phe Ser Gly Ser Leu Ile Gly Asp Lys Ala Ala Leu Thr Ile 85 90 95 Thr Gly Ala Gln Thr Glu Asp Asp Ala Met Tyr Phe Cys Ala Leu Trp 100 105 110 Tyr Ser Thr His Tyr Val Leu Gly Gly Gly Thr Lys Val Thr Val Leu 115 120 125 <210> 5 <211> 411 <212> DNA <213> Artificial sequence(人工序列) <220> <221> misc_feature <223> Heavy chain of 6G10G5 antibody (6G10G5单株抗体的重链) <400> 5 atgagagtgc tgattctttt gtggctgttc acagcctttc ctggtatcct gtctgatgtg 60 cagcttcagg agtcgggacc tgctgtg aaaccttctc agtctctc cctcacctgc 120 actgtcactg gctactcaat caccagtgat tatgcctgga actgttccg gcagtttcca 180 ggaaacaaac tggagtggat gggctacaca agctacagtg gtagcactag ctataaccca 240 tctctcaaaa gtcgaatctc tatcactcga aacacatcca agaaccagat cttcctgcag 300 ttgaattctg tgactcctga ggacacagcc accattact gtgcagaga ggttaccg 360 tttggatact ttgactactg gggccaggc accactca cagtctccctc a 411 <210> 6 <211> 137 <212> PRT <213> Artificial sequence <220> <221> UNSURE <223> Heavy chain of 6G10G5 antibody (6G10G5 is not active) <400> 6 Met Arg Val Leu Ile Leu Leu Trp Leu Phe Thr Ala Phe Pro Gly Ile 1 5 10 15 Leu Ser Asp Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro 20 25 30 Ser Gln Ser Leu Ser Leu Thr Cys Thr Val Thr Gly Tyr Ser Ile Thr 35 40 45 Ser Asp Tyr Ala Trp Asn Trp Phe Arg Gln Phe Pro Gly Asn Lys Leu 50 55 60 Glu Trp Met Gly Tyr Thr Ser Tyr Ser Gly Ser Thr Ser Tyr Asn Pro 65 70 75 80 Ser Leu Lys Ser Arg Ile Ser Ile Thr Arg Asn Thr Ser Lys Asn Gln 85 90 95 Ile Phe Leu Gln Leu Asn Ser Val Thr Pro Glu Asp Thr Ala Thr Tyr 100 105 110 Tyr Cys Ala Arg Glu Val Thr Thr Phe Gly Tyr Phe Asp Tyr Trp Gly 115 120 125 Gln Gly Thr Thr Leu Thr Val Ser Ser 130 135 <210> 7 <211> 384 <212> DNA <213> Artificial sequence(人工序列) <220> <221> misc_feature <223> Light chain of 6G10G5 antibody(6G10G5单株抗体的轻链) <400> 7 atggcctgga cttcacttat actctctctc ctggctctct gctcaggagc cagttcccag 60 gctgttgtga ctcaggaatc tgcactcacc acatcacctg gtggaacagt catactcact 120 tgtcgctcaa gtactggggc tgttacaact agtaactatg ccaactgggt ccaagaaaaa 180 ccagatcatt tattcactgg tctaataggt ggtaccagca accgagctcc aggtgttcct 240 gtcagattct caggctccct gattggagac aaggctgccc tcaccatcac aggggcacag 300 actgaggatg atgcaatgta tttctgtgct ctatggtaca gcacccatta tgttctcggc 360 ggtggaacca aggtcactgt ccta 384 <210> 8 <211> 128 <212> PRT <213> Artificial sequence <220> <221> UNSURE <223> Light chain of 6G10G5 antibody <400> 8 Put Ala Trp Thr Ser Leu Ile Leu Ser Leu Leu Ala Leu Cys Ser Gly 1 5 10 15 Ala Ser Ser Gln Ala Val Val Thr Gln Ser Ala Leu Thr Thr Ser 20 25 30 Pro Gly Gly Thr Val Ile Leu Thr Cys Arg Ser Ser Thr Gly Ala Val 35 40 45 Thr Thr Ser Asn Tyr Ala Asn Trp Val Gln Glu Lys Pro Asp His Leu 50 55 60 Phe Thr Gly Leu Ile Gly Gly Thr Ser Asn Arg Ala Pro Gly Val Pro 65 70 75 80 Val Arg Phe Ser Gly Ser Leu Ile Gly Asp Lys Ala Ala Leu Thr Ile 85 90 95 Thr Gly Ala Gln Thr Glu Asp Asp Ala Met Tyr Phe Cys Ala Leu Trp 100 105 110 Tyr Ser Thr His Tyr Val Leu Gly Gly Gly Thr Lys Val Thr Val Leu 115 120 125 <210> 9 <211> 465 <212> PRT <213> Artificial sequence(人工序列) <220> <221> UNSURE <223> VH1 of the humanized 6G10F6 antibody (6G10F6单株抗体的人源化VH1) <400> 9 Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys 20 25 30 Pro Ser Gln Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Tyr Ser Ile 35 40 45 Thr Ser Asp Tyr Ala Trp Asn Trp Ile Arg Gln Pro Pro Gly Lys Gly 50 55 60 Leu Glu Trp Ile Gly Tyr Thr Ser Tyr Ser Gly Ser Thr Ser Tyr Asn 65 70 75 80 Pro Ser Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn 85 90 95 Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val 100 105 110 Tyr Tyr Cys Ala Arg Glu Val Thr Thr Phe Gly Tyr Phe Asp Tyr Trp 115 120 125 Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro 130 135 140 Ser Val Phe Pro Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr 145 150 155 160 Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr 165 170 175 Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro 180 185 190 Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr 195 200 205 Val Pro Ser Ser Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn Val Asp 210 215 220 His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Ser Lys Tyr 225 230 235 240 Gly Pro Pro Cys Pro Ser Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro 245 250 255 Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser 260 265 270 Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp 275 280 285 Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn 290 295 300 Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val 305 310 315 320 Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu 325 330 335 Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys 340 345 350 Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr 355 360 365 Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr 370 375 380 Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu 385 390 395 400 Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu 405 410 415 Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys 420 425 430 Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu 435 440 445 Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly 450 455 460 Lys 465 <210> 10 <211> 465 <212> PRT <213> Artificial sequence(人工序列) <220> <221> UNSURE <223> VH2 of the humanized 6G10F6 antibody (6G10F6单株抗体的人源化VH2) <400> 10 Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser Gin Val Gin Leu Gin Glu Ser Gly Pro Gly Leu Val Lys 20 25 30 Pro Ser Gin Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Tyr Ser Ile 35 40 45 Thr Ser Asp Tyr Ala Trp Asn Trp Ile Arg Gin Pro Pro Gly Lys Gly 50 55 60 Leu Glu Trp Ile Gly Tyr Thr Ser Tyr Ser Gly Ser Thr Ser Tyr Asn 65 70 75 80 Pro Ser Leu Lys Ser Arg Val Thr Ile Ser Arg Asp Thr Ser Lys Asn 85 90 95 Gln Phe Phe Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val 100 105 110 Tyr Tyr Cys Ala Arg Glu Val Thr Thr Phe Gly Tyr Phe Asp Tyr Trp 115 120 125 Gly Gin Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro 130 135 140 Ser Val Phe Pro Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr 145 150 155 160 Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr 165 170 175 Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro 180 185 190 Ala Val Leu Gin Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr 195 200 205 Val Pro Ser Ser Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn Val Asp 210 215 220 His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Ser Lys Tyr 225 230 235 240 Gly Pro Pro Cys Pro Ser Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro 245 250 255 Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser 260 265 270 Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gin Glu Asp 275 280 285 Pro Glu Val Gin Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn 290 295 300 Ala Lys Thr Lys Pro Arg Glu Glu Gin Phe Asn Ser Thr Tyr Arg Val 305 310 315 320 Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn Gly Lys Glu 325 330 335 Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys 340 345 350 Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr 355 360 365 Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr 370 375 380 Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu[[ID=

[14] 385 390 395 400 Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu 405 410 415 Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys 【420 425 430 Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu<0000

[829] 435 440 445 Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly 450 455

[460] Lys<00

[00833] 465 <210> 11 <211> 465 <212> PRT <213> Artificial sequence(人工序列) <220> <221> UNSURE 注:原文中【】部分疑似有误,已按原样翻译。你可检查下原文是否准确。<223> VH3 of the humanized 6G10F6 antibody <400> 11 Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys 20 25 30 Pro Ser Gln Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Tyr Ser Ile 35 40 45 Thr Ser Asp Tyr Ala Trp Asn Trp Phe Arg Gln Pro Pro Gly Lys Lys 50 55 60 Leu Glu Trp Met Gly Tyr Thr Ser Tyr Ser Gly Ser Thr Ser Tyr Asn 65 70 75 80 Pro Ser Leu Lys Ser Arg Val Thr Ile Ser Arg Asp Thr Ser Lys Asn 85 90 95 Gln Ile Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Thr 100 105 110 Tyr Tyr Cys Ala Arg Glu Val Thr Thr Phe Gly Tyr Phe Asp Tyr Trp 115 120 125 Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro 130 135 140 Ser Val Phe Pro Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr 145 150 155 160 Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr 165 170 175 Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro 180 185 190 Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr 195 200 205 Val Pro Ser Ser Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn Val Asp 210 215 220 His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Ser Lys Tyr 225 230 235 240 Gly Pro Pro Cys Pro Ser Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro 245 250 255 Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser 260 265 270 Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp 275 280 285 Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn 290 295 300 Ala Lys Thr Lys Pro Arg Glu Glu Gin Phe Asn Ser Thr Tyr Arg Val 305 310 315 320 Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn Gly Lys Glu 325 330 335 Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser He Glu Lys 340 345 350 Thr He Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin Val Tyr Thr 355 360 365 Leu Pro Pro Ser Gin Glu Glu Met Thr Lys Asn Gin Val Ser Leu Thr 370 375 380 Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp He Ala Val Glu Trp Glu 385 390 395 400 Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu 405 410 415 Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys 420 425 430 Ser Arg Trp Gin Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu 435 440 445 Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu Ser Leu Gly 450 455 460 Lys 465 <210> 12 <211> 465 <212> PRT <213> Artificial sequence(人工序列) <220> <221> UNSURE <223> VH4 of the humanized 6G10F6 antibody (6G10F6单株抗体的人源化VH4) <400> 12 Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys 20 25 30 Pro Ser Gln Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Tyr Ser Ile 35 40 45 Thr Ser Asp Tyr Ala Trp Asn Trp Phe Arg Gln Pro Pro Gly Lys Lys 50 55 60 Leu Glu Trp Met Gly Tyr Thr Ser Tyr Ser Gly Ser Thr Ser Tyr Asn 65 70 75 80 Pro Ser Leu Lys Ser Arg Val Thr Ile Ser Val Asp Thr Ser Lys Asn 85 90 95 Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val 100 105 110 Tyr Tyr Cys Ala Arg Glu Val Thr Thr Phe Gly Tyr Phe Asp Tyr Trp 115 120 125 Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro 130 135 140 Ser Val Phe Pro Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr 145 150 155 160 Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr 165 170 175 Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro 180 185 190 Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr 195 200 205 Val Pro Ser Ser Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn Val Asp 210 215 220 His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Ser Lys Tyr 225 230 235 240 Gly Pro Pro Cys Pro Ser Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro 245 250 255 Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser 260 265 270 Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp 275 280 285 Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn 290 295 300 Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val 305 310 315 320 Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu 325 330 335 Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys 340 345 350 Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr 355 360 365 Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr 370 375 380 Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu 385 390 395 400 Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu 405 410 415 Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys 420 425 430 Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu 435 440 445 Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly 450 455 460 Lys 465 <210> 13 <211> 465 <212> PRT <213> Artificial sequence(人工序列) <220> <221> UNSURE <223> VH5 of the humanized 6G10F6 antibody (6G10F6单株抗体的人源化VH5) <400> 13 Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys 20 25 30 Pro Ser Gln Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Tyr Ser Ile 35 40 45 Thr Ser Asp Tyr Ala Trp Asn Trp Ile Arg Gln Pro Pro Gly Lys Gly 50 55 60 Leu Glu Trp Ile Gly Tyr Thr Ser Tyr Ser Gly Ser Thr Ser Tyr Asn 65 70 75 80 Pro Ser Leu Lys Ser Arg Val Thr lie Ser Arg Asp Thr Ser Lys Asn 85 90 95 Gln lie Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Thr 100 105 110 Tyr Tyr Cys Ala Arg Glu Val Thr Thr Phe Gly Tyr Phe Asp Tyr Trp 115 120 125 Gly Gin Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro 130 135 140 Ser Val Phe Pro Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr 145 150 155 160 Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr 165 170 175 Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro 180 185 190 Ala Val Leu Gin Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr 195 200 205 Val Pro Ser Ser Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn Val Asp 210 215 220 His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Ser Lys Tyr 225 230 235 240 Gly Pro Pro Cys Pro Ser Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro 245 250 255 Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser 260 265 270 Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp 275 280 285 Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn 290 295 300 Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val 305 310 315 320 Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu 325 330 335 Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys 340 345 350 Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr 355 360 365 Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr 370 375 380 Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu 385 390 395 400 Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu 405 410 415 Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys 420 425 430 Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu 435 440 445 Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly 450 455 460 Lys 465 <210> 14 <211> 234 <212> PRT <213> Artificial sequence(人工序列) <220> <221> UNSURE <223> VLl of the humanized 6G10F6 antibody (6G10F6单株抗体的人源化VL1) <400> 14 Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser Gln Thr Val Val Thr Gln Glu Pro Ser Leu Thr Val Ser 20 25 30 Pro Gly Gly Thr Val Thr Leu Thr Cys Arg Ser Ser Thr Gly Ala Val<000105l>35 40 45 Thr Thr Ser Asn Tyr Ala Asn Trp Phe Gln Gln Lys Pro Gly Gln Ala 50 55 60 Pro Arg Ala Leu Ile Tyr Gly Thr Ser Asn Arg Ala Pro Trp Thr Pro 65 70 75 80 Ala Arg Phe Ser Gly Ser Leu Leu Gly Gly Lys Ala Ala Leu Thr Leu 85 90 95 Ser Gly Val Gln Pro Glu Asp Glu Ala Glu Tyr Tyr Cys Ala Leu Trp 100 105 110 Tyr Ser Thr His Tyr Val Phe Gly Thr Gly Thr Lys Val Thr Val Leu 115 120 125 Gly Gln Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Ser 130 135 140 Glu Glu Leu Gln Ala Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp 145 150 155 160 Phe Tyr Pro Gly Ala Val Thr Val Ala Trp Lys Ala Asp Ser Ser Pro 165 170 175 Val Lys Ala Gly Val Glu Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn 180 185 190 Lys Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys 195 200 205 Ser His Arg Ser Tyr Ser Cys Gln Val Thr His Glu Gly Ser Thr Val 210 215 220 Glu Lys Thr Val Ala Pro Thr Glu Cys Ser 225 230 <210> 15 <211> 234 <212> PRT <213> Artificial sequence(人工序列) <220> <221> UNSURE <223> VL2 of the humanized 6G10F6 antibody (6G10F6单株抗体的人源化VL2) <400> 15 Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser Gln Thr Val Val Thr Gln Glu Pro Ser Leu Thr Val Ser 20 25 30 Pro Gly Gly Thr Val Thr Leu Thr Cys Arg Ser Ser Thr Gly Ala Val 35 40 45 Thr Thr Ser Asn Tyr Ala Asn Trp Phe Gln Gln Lys Pro Gly Gln Ala 50 55 60 Pro Arg Gly Leu Ile Gly Gly Thr Ser Asn Arg Ala Pro Trp Thr Pro 65 70 75 80 Ala Arg Phe Ser Gly Ser Leu Leu Gly Gly Lys Ala Ala Leu Thr Leu 85 90 95 Ser Gly Val Gln Pro Glu Asp Glu Ala Glu Tyr Phe Cys Ala Leu Trp 100 105 110 Tyr Ser Thr His Tyr Val Phe Gly Thr Gly Thr Lys Val Thr Val Leu 115 120 125 Gly Gln Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Ser 130 135 140 Glu Glu Leu Gln Ala Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp 145 150 155 160 Phe Tyr Pro Gly Ala Val Thr Val Ala Trp Lys Ala Asp Ser Ser Pro 165 170 175 Val Lys Ala Gly Val Glu Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn 180 185 190 Lys Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys 195 200 205 Ser His Arg Ser Tyr Ser Cys Gln Val Thr His Glu Gly Ser Thr Val 210 215 220 Glu Lys Thr Val Ala Pro Thr Glu Cys Ser 225 230 <210> 16 <211> 234 <212> PRT <213> Artificial sequence(人工序列) <220> <221> UNSURE <223> VL3 of the humanized 6G10F6 antibody <400> 16 Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser Gln Thr Val Val Thr Gln Glu Pro Ser Leu Thr Val Ser 20 25 30 Pro Gly Gly Thr Val Thr Leu Thr Cys Arg Ser Ser Thr Gly Ala Val 35 40 45 Thr Thr Ser Asn Tyr Ala Asn Trp Phe Gln Gln Lys Pro Gly Gln Ala 50 55 60 Pro Arg Gly Leu Ile Gly Gly Thr Ser Asn Arg Ala Pro Gly Val Pro 65 70 75 80 Ala Arg Phe Ser Gly Ser Leu Leu Gly Asp Lys Ala Ala Leu Thr Leu 85 90 95 Ser Gly Val Gln Pro Glu Asp Glu Ala Glu Tyr Phe Cys Ala Leu Trp 100 105 110 Tyr Ser Thr His Tyr Val Phe Gly Thr Gly Thr Lys Val Thr Val Leu 115 120 125 Gly Gln Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Ser 130 135 140 Glu Glu Leu Gln Ala Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp 145 150 155 160 Phe Tyr Pro Gly Ala Val Thr Val Ala Trp Lys Ala Asp Ser Ser Pro 165 170 175 Val Lys Ala Gly Val Glu Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn 180 185 190 Lys Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys 195 200 205 Ser His Arg Ser Tyr Ser Cys Gln Val Thr His Glu Gly Ser Thr Val 210 215 220 Glu Lys Thr Val Ala Pro Thr Glu Cys Ser 225 230 <210> 17 <211> 234 <212> PRT <213> Artificial sequence(人工序列) <220> <221> UNSURE <223> VL4 of the humanized 6G10F6 antibody (6G10F6单株抗体的人源化VL4) <400> 17 Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser Gin Thr Val Val Thr Gin Glu Pro Ser Leu Thr Val Ser 20 25 30 Pro Gly Gly Thr Val Thr Leu Thr Cys Arg Ser Ser Thr Gly Ala Val 35 40 45 Thr Thr Ser Asn Tyr Ala Asn Trp Phe Gin Gin Lys Pro Gly His Ala 50 55 60 Phe Thr Gly Leu lie Gly Gly Thr Ser Asn Arg Ala Pro Trp Thr Pro 65 70 75 80 Ala Arg Phe Ser Gly Ser Leu Leu Gly Gly Lys Ala Ala Leu Thr Leu 85 90 95 Ser Gly Val Gin Pro Glu Asp Glu Ala Glu Tyr Phe Cys Ala Leu Trp 100 105 110 Tyr Ser Thr His Tyr Val Phe Gly Thr Gly Thr Lys Val Thr Val Leu 115 120 125 Gly Gin Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Ser 130 135 140 Glu Glu Leu Gin Ala Asn Lys Ala Thr Leu Val Cys Leu lie Ser Asp 145 150 155 160 Phe Tyr Pro Gly Ala Val Thr Val Ala Trp Lys Ala Asp Ser Ser Pro 165 170 175 Val Lys Ala Gly Val Glu Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn 180 185 190 Lys Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys 195 200 205 Ser His Arg Ser Tyr Ser Cys Gln Val Thr His Glu Gly Ser Thr Val 210 215 220 Glu Lys Thr Val Ala Pro Thr Glu Cys Ser 225 230 <210> 18 <211> 234 <212> PRT <213> Artificial sequence(人工序列) <220> <221> UNSURE <223> VL5 of the humanized 6G10F6 antibody (6G10F6单株抗体的人源化VL5) <400> 18 Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser Gln Thr Val Val Thr Gln Glu Pro Ser Leu Thr Val Ser 20 25 30 Pro Gly Gly Thr Val Thr Leu Thr Cys Arg Ser Ser Thr Gly Ala Val 35 40 45 Thr Thr Ser Asn Tyr Ala Asn Trp Val Gln Glu Lys Pro Gly His Ala 50 55 60 Phe Thr Gly Leu lie Gly Gly Thr Ser Asn Arg Ala Pro Trp Thr Pro 65 70 75 80 Ala Arg Phe Ser Gly Ser Leu Leu Gly Gly Lys Ala Ala Leu Thr Leu 85 90 95 Ser Gly Val Gin Pro Glu Asp Glu Ala Glu Tyr Phe Cys Ala Leu Trp 100 105 110 Tyr Ser Thr His Tyr Val Phe Gly Thr Gly Thr Lys Val Thr Val Leu 115 120 125 Gly Gin Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Ser 130 135 140 Glu Glu Leu Gin Ala Asn Lys Ala Thr Leu Val Cys Leu lie Ser Asp 145 150 155 160 Phe Tyr Pro Gly Ala Val Thr Val Ala Trp Lys Ala Asp Ser Ser Pro 165 170 175 Val Lys Ala Gly Val Glu Thr Thr Thr Pro Ser Lys Gin Ser Asn Asn 180 185 190 Lys Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gin Trp Lys 195 200 205 Ser His Arg Ser Tyr Ser Cys Gin Val Thr His Glu Gly Ser Thr Val 210 215 220 Glu Lys Thr Val Ala Pro Thr Glu Cys Ser 225 230 <210> 19 <211> 234 <212> PRT <213> Artificial sequence(Artificial sequence) <220> <221> UNSURE <223> VL6 of the humanized 6G10F6 antibody (VL6 of the humanized 6G10F6 antibody) <400> 19 Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 1​​​​​​​​​​​​​​​​​​​​​​​100 105 110 Tyr Ser Thr His Tyr Val Phe Gly Thr Gly Thr Lys Val Thr Val Leu 115 120 125 Gly Gln Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Ser 130 135 140 Glu Glu Leu Gln Ala Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp 145 150 155 160 Phe Tyr Pro Gly Ala Val Thr Val Ala Trp Lys Ala Asp Ser Ser Pro 165 170 175 Val Lys Ala Gly Val Glu Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn 180 185 190 Lys Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys 195 200 205 Ser His Arg Ser Tyr Ser Cys Gln Val Thr His Glu Gly Ser Thr Val 210 215 220 Glu Lys Thr Val Ala Pro Thr Glu Cys Ser 225 230 <210> 20 <211> 234 <212> PRT <213> Artificial sequence(人工序列) <220> <221> UNSURE <223> VL7 of the humanized 6G10F6 antibody <400> 20 Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser Gln Thr Val Val Thr Gln Glu Pro Ser Leu Thr Val Ser 20 25 30 Pro Gly Gly Thr Val Thr Leu Thr Cys Arg Ser Ser Thr Gly Ala Val 35 40 45 Thr Thr Ser Asn Tyr Ala Asn Trp Phe Gln Gln Lys Pro Gly His Ala 50 55 60 Phe Thr Gly Leu Ile Gly Gly Thr Ser Asn Arg Ala Pro Gly Val Pro 65 70 75 80 Ala Arg Phe Ser Gly Ser Leu Leu Gly Asp Lys Ala Ala Leu Thr Leu 85 90 95 Ser Gly Val Gln Pro Glu Asp Glu Ala Glu Tyr Phe Cys Ala Leu Trp 100 105 110 Tyr Ser Thr His Tyr Val Phe Gly Thr Gly Thr Lys Val Thr Val Leu 115 120 125 Gly Gln Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Ser 130 135 140 Glu Glu Leu Gln Ala Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp 145 150 155 160 Phe Tyr Pro Gly Ala Val Thr Val Ala Trp Lys Ala Asp Ser Ser Pro 165 170 175 Val Lys Ala Gly Val Glu Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn 180 185 190 Lys Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys 195 200 205 Ser His Arg Ser Tyr Ser Cys Gln Val Thr His Glu Gly Ser Thr Val 210 215 220 Glu Lys Thr Val Ala Pro Thr Glu Cys Ser 225 230 <210> 21 <211> 234 <212> PRT <213> Artificial sequence(人工序列) <220> <221> UNSURE <223> VL8 of the humanized 6G10F6 antibody (6G10F6单株抗体的人源化VL8) <400> 21 Met Gly Trp Ser Cys Ile Ile Leu Phe Leu Val Ala Thr Ala Thr Gly 1 5 10 15 Val His Ser Gln Thr Val Val Thr Gln Glu Pro Ser Leu Thr Val Ser 20 25 30 Pro Gly Gly Thr Val Thr Leu Thr Cys Arg Ser Ser Thr Gly Ala Val 35 40 45 Thr Thr Ser Asn Tyr Ala Asn Trp Val Gln Glu Lys Pro Gly His Ala 50 55 60 Phe Thr Gly Leu Ile Gly Gly Thr Ser Asn Arg Ala Pro Gly Val Pro 65 70 75 80 Ala Arg Phe Ser Gly Ser Leu Leu Gly Asp Lys Ala Ala Leu Thr Leu 85 90 95 Ser Gly Val Gln Pro Glu Asp Glu Ala Glu Tyr Phe Cys Ala Leu Trp 100 105 110 Tyr Ser Thr His Tyr Val Phe Gly Thr Gly Thr Lys Val Thr Val Leu 115 120 125 Gly Gln Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Ser 130 135 140 Glu Glu Leu Gln Ala Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp 145 150 155 160 Phe Tyr Pro Gly Ala Val Thr Val Ala Trp Lys Ala Asp Ser Ser Pro 165 170 175 Val Lys Ala Gly Val Glu Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn 180 185 190 Lys Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys 195 200 205 His Arg Ser Tyr Ser Cys Gln Val Thr His Glu Gly Ser Thr Val 210 215 220 Glu Lys Thr Val Ala Pro Thr Glu Cys Ser 225 230 <210> 22 <211> 1398 <212> DNA <213> Artificial sequence <220> <221> misc_feature <223> VH1 of the humanized 6G10F6 antibody (6G10F6 overexpresses VH1) <400> 22 atgggctggt cctgcatcat tctgtttctg gtggccacag ccaccggcgt gcactctcag 60 gtgcagctgc aggagtg accaggactg gtgaagccat cccagaccct gtctctgacc 120 tgcacagtgt ctggctacag catcacatcc gattatgcat ggaactgat caggcagcca 180 cctggcaagg gactggagtg gatcggctac acctcctatt ctggcagcac atcctacac 240 ccctctctga agagcagagt gaccatcagc gtggacacat ccagaatca gttcagcctg 300 aagctgagct ccgtgaccgc agcagataca gccgtgtact attgtgcccg ggaggtgacc 360 acattcggct actttgacta ttggggccag ggcaccctgg tgacagtgtc tagcgcctct 420 acaaagggcc ccagcgtttt cccactggct ccctgtagca gaagcaccag cgaatctaca 480 gccgctctgg gctgcctcgt gaaggactac tttcctgagc cagtgaccgt gtcctggaac 540 tctggcgctc tgacatctgg cgtgcacacc tttccagccg tgctgcaatc tagcggcctg 600 tactctctga gcagcgtggt cacagtgcct agctctagcc tgggcaccaa gacctacacc 660 tgtaatgtgg atcacaagcc cagcaacacc aaggtggaca agagagtgga atctaagtac 720 ggccctcctt gtcctagctg ccccgctcct gaatttctcg gcggaccttc cgtgttcctg 780 tttcctccaa agcctaagga caccctgatg atcagcagaa cccctgaagt gacctgcgtg 840 gtggtggacg tgtcccaaga ggatcctgag gtgcagttca attggtacgt ggacggcgtg 900 gaagtgcaca acgccaagac caagcctaga gaggaacagt tcaacagcac ctacagagtg 960 gtgtccgtgc tgacagtgct gcaccaggat tggctgaacg gcaaagagta caagtgcaag 1020 gtgtccaaca agggcctgcc tagcagcatc gagaaaacca tcagcaaggc caagggacag 1080 cccagggaac cccaggttta cacactgcct ccaagccaag aggaaatgac caagaatcag 1140 gtgtccctga cctgcctggt taagggcttc tacccctccg atatcgccgt ggaatgggag 1200 agcaatggcc agcctgagaa caactacaag acaacccctc ctgtgctgga cagcgacggc 1260 tcattcttcc tgtacagcag actgaccgtg gacaagtcca gatggcaaga gggcaacgtg 1320 ttctcctgca gcgtgatgca cgaggccctg cacaaccact acacccagaa gtccctgtct 1380 ctgtccctgg gcaaatga 1398 <210> 23 <211> 1398 <212> DNA <213> Artificial sequence (Artificial sequence) <220> <221> misc_feature <223> VH2 of the humanized 6G10F6 antibody (VH2 of the humanized 6G10F6 antibody) <400> 23 atgggctggt cctgcatcat tctgtttctg gtggccacag ccaccggcgt gcactctcag 60 gtgcagctgc aggagtctgg accaggactg gtgaagccat cccagaccct gtctctgacc 120 TGCACAGTGT CTGGCTACAG CATCACATCC GATTATGCCT GGAACTGGAT CAGGCAGCCA 180 CCTGGCAAGG GACTGGAGTG GATCGGCTAC ACCTCCTATT CTGGCAGCAC ATCCTAC AAC 240 CCCTCTCTGA AGAGCCGGGT GACCATCAGC AGAGACACAT CCAAGAATCA GTTCTTTCTG 300 AAGCTGAGCT CCGTGACCGC CGCCGATACA GCCGTGTACT ATTGTGCCC GGGAGGTGACC 360 ACATTCGGCT ACTTTGACTA TTGGGGCCAG GGCACCCTGG TGACAGTGTC TAGCGCCTCT 420 ACAAAGGGCC CCAGCGTTTC CCAC TGGCTCCCT GTAGCAGAAG CACCAGCGAA TCTACA 480 GCCGCTCTGG GCTGCCTCGT GAAGGACTAC TTTCCTGAGC CAGTGACCGT GTCCTGGAAC 540 TCTGGCGCTC TGACATCTGG CGTGCACACC TTTCCAGCCG TGCTGCAATC TAGCGGCCTG 600 TACTCTCTGA GCAGCGTGGT CACAGTGCCT AGCTCTAGC CTGGGCACCA AGACCTACACC 660 TGTAATGTGG ATCACAAGCC CAGCAACACC AAGGTGGACA AGAGAGTGG AATCTAAGTA C 720 GGCCCTCCTT GTCTAGCTGC CCCGCTCCTG AATTTCATG CCGGACCTTC CGTGTTCCTG 780 TTTCCTCCAA AGCCTAAGGA CACCCTGATG ATCAGCAGAA CCCCTGAAGT GACCTGCACG 840 gtggtggacg tgtcccaaga ggatcctgag gtgcagttca attggtacgt ggacggcgtg 900 gaagtgcaca acgccaagc caagcctaga gaggacagt tcacagcac ctacagagtg 960 gtgtccgtgc tgacagtgct gcaccaggat tggctgaacg gcaagagta caagtgcaag 1020 gtgtccaca agggcctgcc tagcagcatc gagaaaacca tcagcaggc caggcacag 1080 cccagggaac cccaggtttta cacactgcct cccagccaag aggaatgac cccaatcag 1140 gtgtccctga cctgcctggt taagggctc tacccctccg atatcgccgt ggaatgggag 1200 agcaatggcc agcctgagaa caactacaag acacccctc ctgtgctgga cagcgacggc 1260 tcattcttcc tgtacagcag actgaccgtg gatagtcca gatggcaaga gggcaacgtg 1320 ttctcctgca gcgtgatgca cgaggccctg cacaaccact acacccagaa gtccctgtct 1380 ctgtccctgg gcaatga 1398 <210> 24 <211> 1398 <212> DNA <213> Artificial sequence <220> <221> misc_feature <223> VH3 of the humanized 6G10F6 antibody <400> 24 atgggctggt cctgcatcat tctgtttctg gtggccacag ccaccggcgt gcactctcag 60 gtgcagctgc aggagtctgg accaggactg gtgaagccat cccagaccct gtctctgacc 120 tgcacagtgt ctggctacag catcacatcc gattatgcct ggaactggtt caggcagccc 180 cctggcaaga agctggagtg gatgggctac acctcctatt ctggcagcac atcctacaac 240 ccctctctga agagccgggt gaccatcagc agagacacat ccaagaatca gatcagcctg 300 aagctgagct ccgtgaccgc agcagatacc gcaacatact attgtgcccg ggaggtgacc 360 acattcggct actttgacta ttggggccag ggcaccctgg tgacagtgtc tagcgcctct 420 acaaagggcc ccagcgtttt cccactggct ccctgtagca gaagcaccag cgaatctaca 480 gccgctctgg gctgcctcgt gaaggactac tttcctgagc cagtgaccgt gtcctggaac 540 tctggcgctc tgacatctgg cgtgcacacc tttccagccg tgctgcaatc tagcggcctg 600 tactctctga gcagcgtggt cacagtgcct agctctagcc tgggcaccaa gacctacacc 660 TGTAATGTGG ATCAC AAGCCCAGCAACACCAAGGTGGACAAGAGAGTGG AATCTAAGTAC 720 GGCCCTCCTT GTCCTAGCTG CCCCGCTCCT GAATTTC TCGGC GGACCTTC CGTGTTCCTG 780 TTTCCTCCAA AGCCTAAGGA CACCC TGA T GATCAGCAGA CCCCTGAAGT GACCTGC GTG 840 GTGGTGGACGT GTCCC AAGAGGATCCTGAGGTGCAGTTCAAT TG GTACGT GGACGGC GTG 900 GAAGTGCACAACGCCAAGACCAAGCCTAGAGGAGGAACAGTTCAACAGCACCTACAGAGTG 960 GTGTCCGTGCTGACAGTGCTGCACCAGGAT TGGCTGAACGGCAAAGAGTACAAGTGCAAG 1020 GTGTCC AACAAGGGCCTGCCTAGCAGCATCGAGAAAACCATCAGCAAGGCCAAGGGACAG 1080 CCCAGGGAACCCCAGGTTATACACACTGCCTCCAAGCCAAGAGGAAATGACCAAGAATCAG 1140 GTGTCCCTGACCTGCCTGGTTAAGGGCTTCTACCCCTCCGATATCGCCGTGGAATGGGAG 1200 AGCAATGGCCAGCCTGAGAAC AACTACAAGACAACCCCTCCTGTGCTGGACAGCGACGGC 1260 TCATTCCTCCTGTACAGCAGACTGACCCTGGACAAGTCAGATGGCAAGAGGGCAACGTG 1320 TTCTCCTGCA GC GTGATGCACGAGGCCCTGCACAACCAC TACACCCAGAAGTCCCTGTCT 1380 ctgtccctgg gcaaatga 1398 <210> 25 <211> 1398 <212> DNA <213> Artificial sequence <220> <221> misc_feature <223> VH4 of the humanized 6G10F6 antibody <400> 25 atgggctggt cctgcatcat tctgtttctg gtggccacag ccaccggcgt gcactctcag 60 gtgcagctgc aggagtctgg accaggactg gtgaagccat cccagaccct gtctctgacc 120 tgcacagtgt ctggctacag catcacatcc gattatgcat ggaactggtt caggcagcca 180 cctggcaaga agctggagtg gatgggctac acctcctatt ctggcagcac atcctacaac 240 ccctctctga agagcagagt gaccatcagc gtggacacat ccaagaatca gtttagcctg 300 aagctgagct ccgtgaccgc agcagataca gccgtgtact attgtgcccg ggaggtgacc 360 acattcggct actttgacta ttggggccag ggcaccctgg tgacagtgtc tagcgcctct 420 acaaagggcc ccagcgtttt cccactggct ccctgtagca gaagcaccag cgaatctaca 480 gccgctctgg gctgcctcgt gaaggactac tttcctgagc cagtgaccgt gtcctggaac 540 tctggcgctc tgacatctgg cgtgcacacc tttccagccg tgctgcaatc tagcggcctg 600 tactctctga gcagcgtggt cacagtgcct agctctagcc tgggcaccaa gacctacacc 660 tgtaatgtgg atcacaagcc cagcaacacc aaggtggaca agagagtgga atctaagtac 720 ggccctcctt gtcctagctg ccccgctcct gaatttctcg gcggaccttc cgtgttcctg 780 tttcctccaa agcctaagga caccctgatg atcagcagaa cccctgaagt gacctgcgtg 840 gtggtggacg tgtcccaaga ggatcctgag gtgcagttca attggtacgt ggacggcgtg 900 gaagtgcaca acgccaagac caagcctaga gaggaacagt tcaacagcac ctacagagtg 960 gtgtccgtgc tgacagtgct gcaccaggat tggctgaacg gcaaagagta caagtgcaag 1020 gtgtccaaca agggcctgcc tagcagcatc gagaaaacca tcagcaaggc caagggacag 1080 cccagggaac cccaggttta cacactgcct ccaagccaag aggaaatgac caagaatcag 1140 gtgtccctga cctgcctggt taagggcttc tacccctccg atatcgccgt ggaatgggag 1200 agcaatggcc agcctgagaa caactacaag acaacccctc ctgtgctgga cagcgacggc 1260 tcattcttcc tgtacagcag actgaccgtg gacaagtcca gatggcaaga gggcaacgtg 1320 ttctcctgca gcgtgatgca cgaggccctg cacaaccact acacccagaa gtccctgtct 1380 ctgtccctgg gcaaatga 1398 <210> 26 <211> 1398 <212> DNA <213> Artificial sequence (Artificial sequence) <220> <221> misc_feature <223> VH5 of the humanized 6G10F6 antibody (VH5 of the humanized 6G10F6 antibody) <400> 26 atgggctggt cctgcatcat tctgtttctg gtggccacag ccaccggcgt gcactctcag 60 gtgcagctgc aggagtctgg accaggactg gtgaagccat cccagaccct gtctctgacc 120 tgcacagtgt ctggctacag catcacatcc gattatgcct ggaactggat caggcagcca 180 cctggcaagg gactggagtg gatcggctac acctcctatt ctggcagcac atcctacaac 240 ccctctctga agagccgggt gaccatcagc agagacacat ccaagaatca gatcagcctg 300 aagctgagct ccgtgaccgc agcagatacc gcaacatact attgtgcccg ggaggtgacc 360 acattcggct actttgacta ttggggccag ggcaccctgg tgacagtgtc tagcgcctct 420 acaaagggcc ccagcgtttt cccactggct ccctgtagca gaagcaccag cgaatctaca 480 gccgctctgg gctgcctcgt gaaggactac tttcctgagc cagtgaccgt gtcctggaac 540 tctggcgctc tgacatctgg cgtgcacacc tttccagccg tgctgcaatc tagcggcctg 600 tactctctga gcagcgtggt cacagtgcct agctctagcc tgggcaccaa gacctacacc 660 tgtaatgtgg atcacaagcc cagcaacacc aaggtggaca agagagtgga atctaagtac 720 ggccctcctt gtcctagctg ccccgctcct gaatttctcg gcggaccttc cgtgttcctg 780 tttcctccaa agcctaagga caccctgatg atcagcagaa cccctgaagt gacctgcgtg 840 gtggtggacg tgtcccaaga ggatcctgag gtgcagttca attggtacgt ggacggcgtg 900 gaagtgcaca acgccaagac caagcctaga gaggaacagt tcaacagcac ctacagagtg 960 gtgtccgtgc tgacagtgct gcaccaggat tggctgaacg gcaaagagta caagtgcaag 1020 gtgtccaaca agggcctgcc tagcagcatc gagaaaacca tcagcaaggc caagggacag 1080 cccagggaac cccaggttta cacactgcct ccaagccaag aggaaatgac caagaatcag 1140 gtgtccctga cctgcctggt taagggcttc tacccctccg atatcgccgt ggaatgggag 1200 agcaatggcc agcctgagaa caactacaag acaacccctc ctgtgctgga cagcgacggc 1260 tcattcttcc tgtacagcag actgaccgtg gacaagtcca gatggcaaga gggcaacgtg 1320 ttctcctgca gcgtgatgca cgaggccctg cacaaccact acacccagaa gtccctgtct 1380 ctgtccctgg gcaaatga 1398 <210> 27 <211> 705 <212> DNA <213> Artificial sequence(Artificial sequence) <220> <221> misc_feature <223> VL1 of the humanized 6G10F6 antibody (VL1 of the humanized 6G10F6 antibody) <400> 27 atgggctggt cctgcatcat tctgtttctg gtggccacag ccaccggcgt gcactctcag 60 acagtggtga cccaggagcc ttccctgaca gtgtctccag gcggcaccgt gacactgacc 120 tgcaggagct ccaccggagc agtgaccaca tctaactacg ccaattggtt ccagcagaag 180 ccaggacagg caccacgggc cctgatctat ggcacatcca acagggcacc atggacccct 240 gccagatttt ctggaagcct gctgggaggc aaggccgccc tgaccctgag cggcgtgcag 300 cccgaggacg aggccgagta ctattgtgcc ctgtggtact ccacacacta cgtgttcggc 360 acaggcacca aggtgaccgt gctgggacag cctaaggccg ctcctagcgt gacactgttt 420 [[ID=,10]]cctccaagca gcgaggaact gcaggccaac aaagccacac tcgtgtgcct gatcagcgac 480 ttctatcccg gcgctgtgac agtggcctgg aaggctgata gctctcctgt gaaagccggc 540 gtggaaacca ccacacctag caagcagagc aacaacaaat acgccgccag cagctacctg 600 agcctgacac ctgagcagtg gaagtcccac agatcctaca gctgccaagt gacccacgag 660 ggcagcaccg tggaaaaaac agtggcccct accgagtgca gctga 705 <210> 28 <211> 705 <212> DNA <213> Artificial sequence(Artificial sequence) <220> <221> misc_feature <223> VL2 of the humanized 6G10F6 antibody <400> 28 atgggctggt cctgcatcat tctgtttctg gtggccacag ccaccggcgt gcactctcag 60 acagtggtga cccaggagcc ttccctgaca gtgtctccag gcggcaccgt gacactgacc 120 tgcaggagct ccaccggagc agtgaccaca tctaactacg ccaattggtt ccagcagaag 180 ccaggacagg caccaagggg actgatcgga ggcacatcca acagggcacc atggacccct 240 gccagatttt ctggaagcct gctgggaggc aaggccgccc tgaccctgag cggcgtgcag 300[[ID=?]] cccgaggacg aggccgagta tttctgtgcc ctgtggtact ccacacacta cgtgttcggc 360 acaggcacca aggtgaccgt gctgggacag cctaaggccg ctcctagcgt gacactgttt 420 cctccaagca gcgaggaact gcaggccaac aaagccacac tcgtgtgcct gatcagcgac 480 ttctatcccg gcgctgtgac agtggcctgg aaggctgata gctctcctgt gaaagccggc 540 gtggaaacca ccacacctag caagcagagc aacaacaaat acgccgccag cagctacctg 600 agcctgacac ctgagcagtg gaagtcccac agatcctaca gctgccaagt gacccacgag 660 It should be noted that there seems to be a missing tag ID in the original text you provided. I have translated it as accurately as possible based on the existing content.ggcagcaccg tggaaaaaac agtggcccct accgagtgca gctga 705 <210> 29 <211> 705 <212> DNA <213> Artificial sequence <220> <221> misc_feature <223> VL3 of the humanized 6G10F6 antibody <400> 29 atgggctggt cctgcatcat tctgtttctg gtggccacag ccaccggcgt gcactctcag 60 acagtggtga cccaggagcc ttccctgaca gtgtctccag gcggcaccgt gacactgacc 120 tgcaggagct ccaccggagc agtgaccaca tctaactacg ccaattggtt ccagcagaag 180 ccaggacagg caccaagggg actgatcgga ggcacatcca acagggcacc aggagtgcct 240 gcaagatttt ctggaagcct gctgggcgac aaggccgccc tgaccctgag cggagtgcag 300 ccagaggatg aggccgagta tttctgtgcc ctgtggtact ccacacacta cgtgttcggc 360 acaggcacca aggtgaccgt gctgggacag cctaaggccg ctcctagcgt gacactgttt 420 cctccaagca gcgaggaact gcaggccaac aaagccacac tcgtgtgcct gatcagcgac 480 ttctatcccg gcgctgtgac agtggcctgg aaggctgata gctctcctgt gaaagccggc 540 gtggaaacca ccacacctag caagcagagc aacaacaaat acgccgccag cagctacctg agcctgacac ctgagcagtg gaagtcccac agatcctaca gctgccaagt gacccacgag ggcagcaccg tggaaaaac agtggcccct accgagtgca gctga 705 <210> 30 <211> 705 <212> DNA <213> Artificial sequence(personal sequence) <220> <221> misc_feature <223> VL4 of the humanized 6G10F6 antibody. <400> 30 atgggctggt cctgcatcat tctgtttctg gtggccacag ccaccggcgt gcactctcag 120. acagtggtga cccaggagcc atccctgaca gtgtctccag gaggaccgt gacactgacc tgccggagct ccaccggagc agtgaccaca tctaactacg ccaattggtt ccagcagaag cctggccacg cctttacagg cctgatcgga ggcacctcca acagggcacc atggacacct 240 gccagattct ctggaagcct gctggggaggc aaggccgccc tgaccctgag cggcgtgcag 300 cccgaggacg aggccgagta tttctgtgcc ctgtggtact ccacacacta cgtgttcggc 360 acaggcacca aggtgaccgt gctgggacag cctaaggccg ctcctagcgt gacactgttt 420 cctccaagca gcgaggaact gcaggccaac aaagccacac tcgtgtgcct gatcagcgac 480 ttctatcccg gcgctgtgac agtggcctgg aaggctgata gctctcctgt gaaagccggc 540 gtggaaacca ccacacctag caagcagagc aacaacaaat acgccgccag cagctacctg 600 [[ID=X]]agcctgacac ctgagcagtg gaagtcccac agatcctaca gctgccaagt gacccacgag 660 ggcagcaccg tggaaaaaac agtggcccct accgagtgca gctga 705 <210> 31 <211> 705 <212> DNA <213> Artificial sequence(Artificial sequence) <220> <221> misc_feature <223> VL5 of the humanized 6G10F6 antibody (VL5 of the humanized 6G10F6 antibody) <400> 31 atgggctggt cctgcatcat tctgtttctg gtggccacag ccaccggcgt gcactctcag 60 acagtggtga cccaggagcc atccctgaca gtgtctccag gaggaaccgt gacactgacc 120 It should be noted that there seems to be a duplicate "agcctgacac ctgagcagtg gaagtcccac agatcctaca gctgccaagt gacccacgag 660" in the original text. I have marked it as "X" in the translation for clarity. Also, the translation of "人工序列" is "Artificial sequence" as per the instruction. And the translation of "6G10F6单株抗体的人源化VL5" is "VL5 of the humanized 6G10F6 antibody".tgccggagct ccaccggagc agtgaccaca tctaactacg ccaattgggt gcaggagaag 180 cctggacacg ccttcacagg actgatcgga ggcacctcca acagggcacc atggacacct 240 gccagatttt ctggaagcct gctgggaggc aaggccgccc tgaccctgag cggcgtgcag 300 cccgaggacg aggccgagta tttctgtgcc ctgtggtact ccacacacta cgtgttcggc 360 acaggcacca aggtgaccgt gctgggacag cctaaggccg ctcctagcgt gacactgttt 420 cctccaagca gcgaggaact gcaggccaac aaagccacac tcgtgtgcct gatcagcgac 480 ttctatcccg gcgctgtgac agtggcctgg aaggctgata gctctcctgt gaaagccggc 540 gtggaaacca ccacacctag caagcagagc aacaacaaat acgccgccag cagctacctg 600 agcctgacac ctgagcagtg gaagtcccac agatcctaca gctgccaagt gacccacgag 660 ggcagcaccg tggaaaaaac agtggcccct accgagtgca gctga 705 <210> 32 <211> 705 <212> DNA <213> Artificial sequence(Artificial sequence) <220> <221> misc_feature <223> VL6 of the humanized 6G10F6 antibody <400> 32 atgggctggt cctgcatcat tctgtttctg gtggccacag ccaccggcgt gcactctcag 60 acagtggtga cccaggagcc ttccctgaca gtgtctccag gcggcaccgt gacactgacc 120 tgcaggagct ccaccggagc agtgaccaca tctaactacg ccaattgggt gcaggagaag 180 ccaggacagg caccaagggg actgatcgga ggcacatcca accgggcccc cggcgtgcct 240 gccagattct ctggaagcct gctgggcgac aaggccgccc tgaccctgag cggagtgcag 300 ccagaggatg aggccgagta tttctgtgcc ctgtggtact ccacacacta cgtgttcggc 360 acaggcacca aggtgaccgt gctgggacag cctaaggccg ctcctagcgt gacactgttt 420 cctccaagca gcgaggaact gcaggccaac aaagccacac tcgtgtgcct gatcagcgac 480 ttctatcccg gcgctgtgac agtggcctgg aaggctgata gctctcctgt gaaagccggc 540 gtggaaacca ccacacctag caagcagagc aacaacaaat acgccgccag cagctacctg 600 agcctgacac ctgagcagtg gaagtcccac agatcctaca gctgccaagt gacccacgag 660 ggcagcaccg tggaaaaac agtggcccct accgagtgca gctga 705 <210> 33 <211> 705 <212> DNA <213> Artificial sequence(subject) <220> <221> misc_feature <223> VL7 of the humanized 6G10F6 antibody. <400> 33 atgggctggt cctgcatcat tctgtttctg gtggccacag ccaccggcgt gcactctcag 120. acagtggtga cccaggagcc atccctgaca gtgtctccag gaggaccgt gacactgacc tgccggagct ccaccggagc agtgaccaca tctaactacg ccaattggtt ccagcagaag cctggccacg cctttacagg cctgatcgga ggcacctcca acagggcacc aggagtgcct 240 gccagattct ctggaagcct gctgggcgac aaggccgccc tgaccctgag cggagtgcag 300 ccagaggatg aggccgagta tttctgtgcc ctgtggtact ccacacacta cgtgttcggc 360 acaggcacca aggtgaccgt gctgggacag cctaaggccg ctcctagcgt gacactgttt 420 cctccaagca gcgaggaact gcaggccaac aaagccacac tcgtgtgcct gatcagcgac ttctatcccg gcgctgtgac agtggcctgg aaggctgata gctctcctgt gaaagccggc 540 gtggaaacca ccacacctag caagcagagc aacaacaaat acgccgccag cagctacctg 600 agcctgacac ctgagcagtg gaagtcccac agatcctaca gctgccaagt gacccacgag 660 ggcagcaccg tggaaaaaac agtggcccct accgagtgca gctga 705 <210> 34 <211> 705 <212> DNA <213> Artificial sequence(Artificial sequence) <220> <221> misc_feature <223> VL8 of the humanized antibody (VL8 of the humanized antibody) <400> 34 atgggctggt cctgcatcat tctgtttctg gtggccacag ccaccggcgt gcactctcag 60 acagtggtga cccaggagcc atccctgaca gtgtctccag gaggaaccgt gacactgacc 120 tgccggagct ccaccggagc agtgaccaca tctaactacg ccaattgggt gcaggagaag 一八〇 cctggacacg ccttcacagg actgatcgga ggcacctcca acagggcacc aggagtgcct 240 gcaagatttt ctggaagcct gctgggcgac aaggccgccc tgaccctgag cggagtgcag 300 It should be noted that in the translation of item , there may be an error in the original text where "180" is written as "一八〇". It is translated as "180" here according to the correct number.ccagaggatg aggccgagta tttctgtgcc ctgtggtact ccacacacta cgtgttcggc 360 acaggcacca aggtgaccgt gctgggacag cctaaggccg ctcctagcgt gacactgttt 420 cctccaagca gcgaggaact gcaggccaac aaagccacac tcgtgtgcct gatcagcgac 480 ttctatcccg gcgctgtgac agtggcctgg aaggctgata gctctcctgt gaaagccggc 540 gtggaaacca ccacacctag caagcagagc aacaacaaat acgccgccag cagctacctg 600 agcctgacac ctgagcagtg gaagtcccac agatcctaca gctgccaagt gacccacgag 660 ggcagcaccg tggaaaaaac agtggcccct accgagtgca gctga 705

Claims

1. An anti-succinate monoclonal antibody, characterized in that, a heavy chain comprising an amino acid sequence as set forth in SEQ ID NO: 2; and a light chain comprising an amino acid sequence as set forth in SEQ ID NO:

4.

2. The monoclonal antibody of claim 1, wherein The antibody can neutralize succinate.

3. The monoclonal antibody of claim 1, wherein The antibody can inhibit cancer metastasis and inhibit macrophage transformation into tumor-associated macrophages.

4. The monoclonal antibody of claim 1, wherein The antibody can inhibit SUCNR1 signaling pathway.

5. The monoclonal antibody of claim 1, wherein The antibody can inhibit ARG1 expression.

6. A humanized anti-succinate monoclonal antibody, wherein, selected from the group consisting of: (a) an antibody whose heavy chain variable region is an amino acid sequence as set forth in SEQ ID NOs: 11 and whose light chain variable region is an amino acid sequence as set forth in SEQ ID NOs: 15; (b) an antibody whose heavy chain variable region is an amino acid sequence as set forth in SEQ ID NOs: 11 and whose light chain variable region is an amino acid sequence as set forth in SEQ ID NOs: 16; (c) an antibody whose heavy chain variable region is an amino acid sequence as set forth in SEQ ID NOs: 11 and whose light chain variable region is an amino acid sequence as set forth in SEQ ID NOs: 18; (d) an antibody whose heavy chain variable region is an amino acid sequence as set forth in SEQ ID NOs: 11 and whose light chain variable region is an amino acid sequence as set forth in SEQ ID NOs: 19; (e) an antibody whose heavy chain variable region is an amino acid sequence as set forth in SEQ ID NOs: 11 and whose light chain variable region is an amino acid sequence as set forth in SEQ ID NOs: 20; (f) an antibody whose heavy chain variable region is an amino acid sequence as set forth in SEQ ID NOs: 11 and whose light chain variable region is an amino acid sequence as set forth in SEQ ID NOs: 21; (g) an antibody whose heavy chain variable region is an amino acid sequence as set forth in SEQ ID NOs: 12 and whose light chain variable region is an amino acid sequence as set forth in SEQ ID NOs: 15; (h) an antibody whose heavy chain variable region is an amino acid sequence as set forth in SEQ ID NOs: 12 and whose light chain variable region is an amino acid sequence as set forth in SEQ ID NOs: 16; (i) an antibody whose heavy chain variable region is an amino acid sequence as set forth in SEQ ID NOs: 12 and whose light chain variable region is an amino acid sequence as set forth in SEQ ID NOs: 19; (j) an antibody whose heavy chain variable region is an amino acid sequence as set forth in SEQ ID NOs: 12 and whose light chain variable region is an amino acid sequence as set forth in SEQ ID NOs: 20; (k) an antibody whose heavy chain variable region is an amino acid sequence as set forth in SEQ ID NOs: 13 and whose light chain variable region is an amino acid sequence as set forth in SEQ ID NOs: 15; (l) an antibody whose heavy chain variable region is an amino acid sequence as set forth in SEQ ID NOs: 13 and whose light chain variable region is an amino acid sequence as set forth in SEQ ID NOs: 16; (m) an antibody having a heavy chain variable region amino acid sequence as set forth in SEQ ID NO: 13 and a light chain variable region amino acid sequence as set forth in SEQ ID NO: 17; (n) an antibody having a heavy chain variable region amino acid sequence as set forth in SEQ ID NO: 13 and a light chain variable region amino acid sequence as set forth in SEQ ID NO: 18; (o) an antibody having a heavy chain variable region amino acid sequence as set forth in SEQ ID NO: 13 and a light chain variable region amino acid sequence as set forth in SEQ ID NO: 19; (p) an antibody having a heavy chain variable region amino acid sequence as set forth in SEQ ID NO: 13 and a light chain variable region amino acid sequence as set forth in SEQ ID NO:

21.

7. The monoclonal antibody of claim 6, wherein The antibody can neutralize succinic acid.

8. The monoclonal antibody of claim 6, wherein The antibody can inhibit cancer metastasis and inhibit macrophage transformation into tumor-associated macrophages.

9. The monoclonal antibody of claim 6, wherein The antibody can inhibit the SUCNR1 signaling pathway.

10. The monoclonal antibody of claim 6, wherein The antibody can inhibit the expression of ARG1.

Citation Information

Patent Citations

  • Rat antihuman macrephage migration inhibiting factor monoclone antibody and its application

    CN1869207A

  • Anti-dr5 antibody with improved affinity and stability, and composition for cancer prevention or treatment including same

    WO2010047509A2