A base editing system and method of use thereof

Abstract

Provided is a base editing fusion protein comprising a nucleic acid targeting domain, a cytosine deaminase domain, and an adenine deaminase domain. Also provided is a base editing system and a method for producing at least one genetically modified cell.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering. Specifically, this invention relates to a base editing system and its method of use. More specifically, this invention relates to a base editing system and method capable of generating de novo mutations, such as saturation mutations, in situ in organisms, said base editing system and method being based on a base editing fusion protein comprising a deaminase and a CRISPR effector protein. Background of the Invention

[0003] Heredity and variation are the foundation of biological evolution, and variation enables organisms to adapt to constantly changing environments. Therefore, in the past few decades, creating random or targeted mutants through physical (e.g., ultraviolet light) or chemical (e.g., tilling) methods has become a practical approach for screening novel agronomic traits. However, these methods are time-consuming and labor-intensive. Most directed evolution methods have been developed in bacteria or yeast, such as error-prone PCR (ep-PCR), DNA recombination technology, DNA synthesis, and PACE. For higher organisms, especially plants, the target genes for directed evolution are often transformed into bacteria or yeast for manipulation. Once these genes leave their original genomic environment, the selected functional variants may not fully reflect their characteristics in the original species. The rise of research on clustered regular short palindromic repeats and their associations (CRISPR / Cas) systems, which can generate double-strand breaks (DSBs) at endogenous target sites, provides a simple and efficient method for generating targeted mutations. However, most mutations generated by CRISPR / Cas are insertions and deletions (indels), which can lead to many frameshift mutations or premature termination of translation. Since many functional mutations are caused by a single base variation, this insertion and deletion characteristic results in a significant number of invalid mutations in the CRISPR / Cas9 system, especially when de novo mutation is needed to generate a gain-of-function endogenous gene.

[0004] Therefore, there is still a need in the field for new gene mutagenesis methods that can generate de novo mutations in situ, such as saturation mutations. Summary of the Invention

[0005] This application covers at least the following implementation schemes:

[0006] Project 1. A base-editing fusion protein comprising a nucleic acid targeting domain, a cytosine deamination domain, and an adenine deamination domain.

[0007] Project 2. Base editing fusion protein of Project 1, wherein the nucleic acid targeting domain comprises at least one CRISPR effector protein peptide.

[0008] Project 3. The base-editing fusion protein of Project 2, wherein the CRISPR effector protein is a Cas9 nuclease or a functional variant thereof, preferably, the CRISPR effector protein is a nuclease-inactivated Cas9, more preferably, the nuclease-inactivated Cas9 contains the amino acid sequence shown in SEQ ID NO:2, and most preferably, the nuclease-inactivated Cas9 contains the amino acid sequence shown in SEQ ID NO:3.

[0009] Project 4. A base-editing fusion protein of any one of Projects 1-3, wherein the cytosine deamination domain comprises at least one cytosine deaminase polypeptide.

[0010] Project 5. Base-editing fusion protein of Project 4, wherein the cytosine deaminase is selected from APOBEC1 deaminase, activation-induced cytidine deaminase (AID), APOBEC3G, CDA1, human APOBEC3A deaminase, or functional variants thereof.

[0011] Project 6. Base-editing fusion protein of Project 5, wherein the cytosine deaminase is human APOBEC3A deaminase or a functional variant thereof, for example, the human APOBEC3A deaminase comprising the amino acid sequence shown in SEQ ID NO:4.

[0012] Project 7. A base-editing fusion protein of any one of Projects 1-6, wherein the adenine deamination domain comprises at least one DNA-dependent adenine deamination peptide.

[0013] Project 8. The base-editing fusion protein of Project 7, wherein the DNA-dependent adenine deaminase is derived from wild-type Escherichia coli tRNA adenine deaminase TadA (ecTadA), for example, the DNA-dependent adenine deaminase comprises the amino acid sequence shown in SEQ ID NO:6.

[0014] Project 9. A base-editing fusion protein of Project 7 or 8, wherein the adenine deamination domain contains two DNA-dependent adenine deaminases.

[0015] Project 10. The base-editing fusion protein of Project 7, wherein the adenine deamination domain further comprises wild-type Escherichia coli tRNA adenine deaminase TadA (ecTadA) fused with the DNA-dependent adenine deaminase, preferably, the DNA-dependent adenine deaminase is fused to the C-terminus of wild-type Escherichia coli tRNA adenine deaminase TadA (ecTadA).

[0016] Item 11. The base-editing fusion protein of Item 7 or 8, wherein the adenine deamination domain comprises the amino acid sequence shown in SEQ ID NO: 7 or 8.

[0017] Item 12. A base-editing fusion protein of any one of Items 1-11, wherein the nucleic acid targeting domain, the cytosine deamination domain, and the adenine deamination domain are fused by a linker, for example, the linker comprising an amino acid sequence selected from SEQ ID NO: 9-11.

[0018] Item 13. A base-editing fusion protein of any one of Items 1-12, wherein the base-editing fusion protein comprises, from the N-terminus to the C-terminus, a cytosine deamination domain, an adenine deamination domain, and a nucleic acid targeting domain, or, wherein the base-editing fusion protein comprises, from the N-terminus to the C-terminus, an adenine deamination domain, a cytosine deamination domain, and a nucleic acid targeting domain, in the following order.

[0019] Item 14. A base-editing fusion protein of any one of Items 1-13, wherein the base-editing fusion protein further comprises a uracil DNA glycosylase inhibitor (UGI), for example, the uracil DNA glycosylase inhibitor (UGI) comprises the amino acid sequence shown in SEQ ID NO:12.

[0020] Item 15. A base-editing fusion protein of any one of Items 1-14, wherein the base-editing fusion protein further comprises one or more nuclear localization sequences (NLS).

[0021] Item 16. The base-editing fusion protein of Item 1, wherein the base-editing fusion protein comprises any of the amino acid sequences shown in SEQ ID NO:13-19.

[0022] Project 17. A base editing system for modifying target nucleic acid regions in the genome, comprising:

[0023] i) a base-editing fusion protein of any one of items 1-16 and / or an expression construct containing a nucleotide sequence encoding said base-editing fusion protein; and / or

[0024] ii) at least one guide RNA and / or at least one expression construct containing a nucleotide sequence encoding said at least one guide RNA,

[0025] The at least one guide RNA targets at least one target sequence within the target nucleic acid region.

[0026] Item 18. The base editing system of Item 17, wherein the guide RNA is sgRNA, for example, the sgRNA contains the scaffold sequence shown in SEQ ID NO:27 or SEQ ID NO:28.

[0027] Project 19. Base editing systems of Project 17 or 18, wherein the target sequence targeted by the guide RNA contains a PAM sequence at the 3' end, such as 5'-NGG-3' or 5'-NG-3'.

[0028] Project 20. A base editing system of any one of Projects 17-19, wherein the at least one guide RNA targets a target sequence located on a sense strand and / or antisense strand within a target nucleic acid region of a cell genome.

[0029] Project 21. A base editing system of any one of Projects 17-20, wherein the nucleotide sequence encoding the base editing fusion protein is codon-optimized for the organism whose genome is to be modified.

[0030] Item 22. The base editing system of Item 21, wherein the base editing fusion protein is encoded by any of the nucleotide sequences shown in SEQ ID NO:20-26.

[0031] Item 23. A method for producing at least one genetically modified cell, comprising introducing a base editing system of any one of items 17-22 into at least one said cell, thereby causing substitution of one or more nucleotides in a target nucleic acid region of said at least one cell.

[0032] The method of Item 24. Item 23 further includes the step of screening cells from the at least one cell for cells having one or more desired nucleotide substitutions.

[0033] Item 25. The method of Item 23 or 24, wherein the base editing system is introduced into cells by means selected from: calcium phosphate transfection, protoplast fusion, electroporation, liposome transfection, microinjection, viral infection (such as baculovirus, vaccinia virus, adenovirus, adeno-associated virus, lentivirus and other viruses), gene gun method, PEG-mediated protoplast transformation, Agrobacterium tumefaciens-mediated transformation.

[0034] Project 26. The method of any one of Projects 23-25, wherein the cells are derived from mammals such as humans, mice, rats, monkeys, dogs, pigs, sheep, cattle, and cats; poultry such as chickens, ducks, and geese; and plants, including monocots and dicots, preferably crop plants such as wheat, rice, corn, soybeans, sunflowers, sorghum, rapeseed, alfalfa, cotton, barley, millet, sugarcane, tomatoes, tobacco, cassava, and potatoes.

[0035] Item 27. A method for producing genetically modified plants, comprising introducing a base editing system of any one of items 17-22 into at least one of said plants, thereby causing substitution of one or more nucleotides in a target nucleic acid region in the genome of said at least one plant.

[0036] Item 28. The method of Item 27, the method further comprising screening from the at least one plant for plants having one or more desired nucleotide substitutions.

[0037] Item 29. The method of Item 27 or 28, wherein the base editing system is introduced into plants by means selected from the following methods: gene gun method, PEG-mediated protoplast transformation, Agrobacterium tumefaciens-mediated transformation, plant virus-mediated transformation, pollen tube pathway method, and ovary injection method.

[0038] The method of Project 30.28, wherein the import is performed without selection pressure.

[0039] Item 31. The method of any one of items 27-30, wherein the introduction comprises converting the base editing system into isolated plant cells or tissues, and then regenerating the converted plant cells or tissues into a complete plant, preferably, the regeneration is performed in the absence of selection pressure.

[0040] Item 32. The method of any one of Items 27-30, wherein the importation includes converting the base editing system to a leaf, shoot tip, pollen tube, young spike, or hypocotyl on an intact plant.

[0041] Item 33. The method of any one of Items 27-30, wherein the expression construct is an in vitro transcribed RNA molecule.

[0042] Item 34. The method of any one of Items 27-33, wherein the genetically modified plant does not contain exogenous polynucleotides integrated into its genome.

[0043] Project 35. The method of any one of Projects 27-34, wherein the modified target nucleic acid region is associated with plant traits such as agronomic traits.

[0044] The method of any one of Projects 27-35, Item 36, further includes the step of screening plants for desired traits such as agronomic traits.

[0045] Item 37. The method of any one of items 27-36 further includes obtaining offspring of the genetically modified plant.

[0046] Item 38. A plant breeding method comprising crossing a genetically modified first plant, obtained by any one of the methods of Items 27-37, containing one or more nucleotide substitutions in a target nucleic acid region, with a second plant not containing said one or more nucleotide substitutions, thereby introducing said one or more nucleotide substitutions into the second plant, preferably, the genetically modified first plant having a desired trait such as an agronomic trait.

[0047] Project 39. A method for performing in situ saturation mutagenesis on an endogenous target nucleic acid region in a cell or organism to obtain a mutation of interest within the target nucleic acid region, comprising:

[0048] i) Provide a population of the cells or organisms;

[0049] ii) Introducing the base editing system of any one of items 17-22 into a population of said cells or organisms, resulting in one or more mutations in the endogenous target nucleic acid region of said cells or organisms;

[0050] iii) Screening the population of said cells or organisms for cells or organisms containing mutations of interest; and optionally iv) Identifying said mutations of interest.

[0051] The method of Project 40.39, wherein the base editing system comprises multiple guide RNAs and / or multiple expression constructs containing nucleotide sequences encoding the multiple guide RNAs, preferably, the multiple guide RNAs targeting different target sequences within a target nucleic acid region.

[0052] Item 41. The method of Item 39 or 40, wherein the plurality of guide RNAs comprises 2 to 250 or more types, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 300 or more guide RNAs.

[0053] Item 42. The method of any one of items 39-41, wherein at least some of the target sequences and / or complementary sequences of the plurality of guide RNAs partially overlap and / or are adjacent to each other.

[0054] Project 43. The method of any one of Projects 39-42, wherein the target nucleic acid region is approximately 20 bp to approximately 10,000 bp or longer, for example, approximately 20 bp, approximately 40 bp, approximately 60 bp, approximately 80 bp, approximately 100 bp, approximately 120 bp, approximately 140 bp, approximately 160 bp, approximately 180 bp, approximately 200 bp, approximately 300 bp, approximately 400 bp, approximately 500 bp, approximately 1000 bp, approximately 1500 bp, approximately 2000 bp, approximately 3000 bp, approximately 4000 bp, approximately 5000 bp, approximately 6000 bp or longer. Long; or, wherein the target nucleic acid sequence encodes an amino acid sequence of length from about 5 to about 2000 amino acids, for example, it may encode an amino acid sequence of length of about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 60, about 70, about 80, about 90, about 100, about 125, about 150, about 200, about 250, about 500, about 750, about 1000, about 1500, about 2000 or more amino acids.

[0055] Item 44. The method of any one of items 39-43, wherein the target sequences targeted by the plurality of guide RNAs substantially cover the target nucleic acid region.

[0056] Item 45. The method of any one of items 39-44, wherein at least a portion of the plurality of guide RNAs targets the sense strand of the target nucleic acid region.

[0057] Item 46. The method of any one of items 39-45, wherein at least a portion of the plurality of guide RNAs targets the antisense strand of the target nucleic acid region.

[0058] Item 47. The method of any one of Items 39-46, wherein the plurality of guide RNAs and / or the plurality of expression constructs containing nucleotide sequences encoding the plurality of guide RNAs are each independently introduced into the population of cells or organisms; or the plurality of guide RNAs and / or the plurality of expression constructs containing nucleotide sequences encoding the plurality of guide RNAs are introduced into the population of cells or organisms in combination with each other.

[0059] Item 48. The method of any one of Items 39-47, wherein the mutation is a nucleotide substitution, such as C to T substitution, A to G substitution, G to A substitution, or T to C substitution.

[0060] Item 49. The method of any one of Items 39-48, wherein the target nucleic acid region is located in the coding region of a protein, for example, the target nucleic acid region encodes a function-related motif or domain of the protein.

[0061] The method of Item 50. Item 49, wherein the mutation in the target nucleic acid region results in the substitution of amino acids in the amino acid sequence of the protein, preferably, the mutation results in a change in the function of the protein.

[0062] Item 51. The method of any one of Items 39-50, wherein the target nucleic acid region is associated with a trait of the cell or organism, for example, a mutation in the target nucleic acid region leads to a change in the trait of the cell or organism.

[0063] Item 52. The method of any one of Items 39-51, in step iii), screening for cells or organisms with mutations of interest by screening for cells or organisms with alterations of interest, for example, said alterations of interest are selected from increased growth rate, increased yield, increased nutrient content, increased cold resistance, increased drought resistance, increased insect resistance, increased disease resistance, and increased herbicide resistance.

[0064] Project 53. The method of any one of Projects 39-52, wherein the cells are derived from mammals such as humans, mice, rats, monkeys, dogs, pigs, sheep, cattle, and cats; poultry such as chickens, ducks, and geese; and plants, including monocots and dicots, preferably crop plants, including but not limited to wheat, rice, corn, soybeans, sunflowers, sorghum, rapeseed, alfalfa, cotton, barley, millet, sugarcane, tomatoes, tobacco, cassava, and potatoes.

[0065] Preferably, the cell is a plant cell, more preferably a crop plant cell, and even more preferably a rice cell.

[0066] Project 54. The method of any one of Projects 39-52, wherein the organism is selected from mammals such as humans, mice, rats, monkeys, dogs, pigs, sheep, cattle, and cats; poultry such as chickens, ducks, and geese; and plants, including monocots and dicots, preferably crop plants, including but not limited to wheat, rice, corn, soybeans, sunflowers, sorghum, rapeseed, alfalfa, cotton, barley, millet, sugarcane, tomatoes, tobacco, cassava, and potatoes.

[0067] Preferably, the organism is a plant, more preferably a crop plant, and even more preferably rice.

[0068] Item 55. A method for treating a disease in a subject of need, comprising delivering to the subject an effective amount of any one of items 17-22 of a base editing system to modify a gene associated with the disease.

[0069] Item 56. Use of the base editing system of any one of items 17-22 in the preparation of a pharmaceutical composition for treating a disease in a subject of need, wherein the base editing system is used to modify a gene associated with said disease.

[0070] Item 57. A pharmaceutical composition for treating a disease in a subject of need, comprising a base editing system of any one of items 17-22, and optionally a pharmaceutically acceptable vector, wherein the base editing system is used to modify a gene associated with said disease.

[0071] Item 58. The method of Item 55, the use of Item 56, or the pharmaceutical composition of Item 57, wherein the object is a mammal, such as a human.

[0072] Item 59. The method of Item 55, the use of Item 56, or the pharmaceutical composition of Item 57, wherein the disease is selected from tumors, inflammation, Parkinson's disease, cardiovascular disease, Alzheimer's disease, autism, drug addiction, age-related macular degeneration, schizophrenia, and hereditary diseases.

[0073] Item 60. A kit comprising a base-editing fusion protein of any one of Items 1-16 and / or an expression construct containing a nucleotide sequence encoding said base-editing fusion protein, or comprising a base-editing system of any one of Items 17-22. sequence list <110> Institute of Genetics and Developmental Biology, Chinese Academy of Sciences <120> A base editing system and its usage <130> I2019TC3552CB <160> 31 <170> PatentIn version 3.5 <210> 1 <211> 1368 <212> PRT <213> Streptococcus pyogenes <400> 1 Met Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser Val 1 5 10 15 Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe 20 25 30 Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Asn Leu Ile 35 40 45 Gly Ala Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu 50 55 60 Lys Arg Thr Ala Arg Arg Tyr Thr Arg Arg Lys Asn Arg With Cys 65 70 75 80 Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Asp Ser 85 90 95 Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys 100 105 110 His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr 115 120 125 His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Leu Val Asp 130 135 140 Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His 145 150 155 160 Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro 165 170 175 Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr 180 185 190 Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala 195 200 205 Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn 210 215 220 Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn 225 230 235 240 Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe 245 250 255 Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp 260 265 270 Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp 275 280 285 Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp 290 295 300 Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser 305 310 315 320 Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys 325 330 335 Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe 340 345 350 Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser 355 360 365 Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp 370 375 380 Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg 385 390 395 400 Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu 405 410 415 Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe 420 425 430 Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile 435 440 445 Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp 450 455 460 Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu 465 470 475 480 Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr 485 490 495 Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser 500 505 510 Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Thr Lys Val Lys 515,520,525 Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln 530 535 540 Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr 545 550 555 560 Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Ile Glu Cys Phe Asp 565,570,575 Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly 580,585,590 Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp 595,600,605 Asn Glu Glu Asn Glu Asp With Glu Asp With Val With Thr With Thr 610 615 620 Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala 625 630 635 640 His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr 645,650,655 Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp 660 665 670 Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe 675 680 685 Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe 690 695 700 Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu 705 710 715 720 His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly 725 730 735 Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly 740 745 750 Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln 755 760 765 Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile 770 775 780 Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro 785 790 795 800 Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu 805 810 815 Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg 820 825 830 Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu Lys 835 840 845 Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg 850 855 860 Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys 865 870 875 880 Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys 885 890 895 Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp 900 905 910 Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr 915 920 925 Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp 930 935 940 Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser 945 950 955 960 Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg 965 970 975 Glu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val 980 985 990 Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe 995 1000 1005 Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala 1010 1015 1020 Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe 1025 1030 1035 Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala 1040 1045 1050 Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu 1055 1060 1065 Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val 1070 1075 1080 Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys Thr 1085 1090 1095 Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys 1100 1105 1110 Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro 1115 1120 1125 Light Light Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser Val 1130 1135 1140 Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu Lys 1145 1150 1155 Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser Ser 1160 1165 1170 Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr Lys 1175 1180 1185 Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser Leu 1190 1195 1200 Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala Gly 1205 1210 1215 Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val 1220 1225 1230 Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser 1235 1240 1245 Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys 1250 1255 1260 His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys 1265 1270 1275 Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala 1280 1285 1290 Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn 1295 1300 1305 Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala 1310 1315 1320 Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser 1325 1330 1335 Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr 1340 1345 1350 Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp 1355 1360 1365 <210> 2 <211> 1368 <212> PRT <213> Artificial Sequence <220> <223> nCas9 (D10A) <400> 2 Met Asp Lys Lys Tyr Ser Ile Gly Leu Ala Ile Gly Thr Asn Ser Val 1 5 10 15 Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe 20 25 30 Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Asn Leu Ile 35 40 45 Gly Ala Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu 50 55 60 Lys Arg Thr Ala Arg Arg Tyr Thr Arg Arg Lys Asn Arg With Cys 65 70 75 80 Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Asp Ser 85 90 95 Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys 100 105 110 His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr 115 120 125 His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Leu Val Asp 130 135 140 Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His 145 150 155 160 Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro 165 170 175 Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr 180 185 190 Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala 195 200 205 Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn 210 215 220 Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn 225 230 235 240 Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe 245 250 255 Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp 260 265 270 Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp 275 280 285 Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp 290 295 300 Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser 305 310 315 320 Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys 325 330 335 Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe 340 345 350 Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser 355 360 365 Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp 370 375 380 Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg 385 390 395 400 Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu 405 410 415 Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe 420 425 430 Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile 435 440 445 Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp 450 455 460 Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu 465 470 475 480 Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr 485 490 495 Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser 500 505 510 Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys 515 520 525 Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln 530 535 540 Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr 545 550 555 560 Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp 565 570 575 Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly 580 585 590 Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp 595 600 605 Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr 610 615 620 Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala 625 630 635 640 His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr 645 650 655 Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp 660 665 670 Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe 675 680 685 Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe 690 695 700 Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu 705 710 715 720 His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly 725 730 735 Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly 740 745 750 Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln 755 760 765 Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile 770 775 780 Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro 785 790 795 800 Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu 805 810 815 Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg 820 825 830 Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu Lys 835 840 845 Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg 850 855 860 Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys 865 870 875 880 Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys 885 890 895 Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp 900 905 910 Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr 915 920 925 Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp 930 935 940 Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser 945 950 955 960 Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg 965 970 975 Glu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val 980 985 990 Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe 995 1000 1005 Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala 1010 1015 1020 Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe 1025 1030 1035 Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala 1040 1045 1050 Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu 1055 1060 1065 Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val 1070 1075 1080 Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys Thr 1085 1090 1095 Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys 1100 1105 1110 Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro 1115 1120 1125 Light Light Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser Val 1130 1135 1140 Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu Lys 1145 1150 1155 Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser Ser 1160 1165 1170 Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr Lys 1175 1180 1185 Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser Leu 1190 1195 1200 Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala Gly 1205 1210 1215 Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val 1220 1225 1230 Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser 1235 1240 1245 Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys 1250 1255 1260 His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys 1265 1270 1275 Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala 1280 1285 1290 Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn 1295 1300 1305 Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala 1310 1315 1320 Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser 1325 1330 1335 Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr 1340 1345 1350 Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp 1355 1360 1365 <210> 3 <211> 1368 <212> PRT <213> Artificial Sequence <220> <223> nCas9-NG(D10A) <400> 3 Met Asp Lys Lys Tyr Ser Ile Gly Leu Ala Ile Gly Thr Asn Ser Val 1 5 10 15 Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe 20 25 30 Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Asn Leu Ile 35 40 45 Gly Ala Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu 50 55 60 Lys Arg Thr Ala Arg Arg Tyr Thr Arg Arg Lys Asn Arg With Cys 65 70 75 80 Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Asp Ser 85 90 95 Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys 100 105 110 His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr 115 120 125 His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Leu Val Asp 130 135 140 Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His 145 150 155 160 Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro 165 170 175 Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr 180 185 190 Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala 195 200 205 Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn 210 215 220 Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn 225 230 235 240 Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe 245 250 255 Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp 260 265 270 Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp 275 280 285 Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp 290 295 300 Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser 305 310 315 320 Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys 325 330 335 Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe 340 345 350 Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser 355 360 365 Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp 370 375 380 Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg 385 390 395 400 Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu 405 410 415 Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe 420 425 430 Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile 435 440 445 Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp 450 455 460 Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu 465 470 475 480 Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr 485 490 495 Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser 500 505 510 Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys 515 520 525 Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln 530 535 540 Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr 545 550 555 560 Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp 565 570 575 Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly 580 585 590 Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp 595 600 605 Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr 610 615 620 Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala 625 630 635 640 His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr 645 650 655 Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp 660 665 670 Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe 675 680 685 Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe 690 695 700 Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu 705 710 715 720 His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly 725 730 735 Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly 740 745 750 Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln 755 760 765 Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile 770 775 780 Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro 785 790 795 800 Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu 805 810 815 Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg 820 825 830 Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu Lys 835 840 845 Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg 850 855 860 Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys 865 870 875 880 Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys 885 890 895 Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp 900 905 910 Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr 915 920 925 Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp 930 935 940 Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser 945 950 955 960 Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg 965 970 975 Glu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val 980 985 990 Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe 995 1000 1005 Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala 1010 1015 1020 Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe 1025 1030 1035 Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala 1040 1045 1050 Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu 1055 1060 1065 Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val 1070 1075 1080 Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys Thr 1085 1090 1095 Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Arg Pro Lys 1100 1105 1110 Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro 1115 1120 1125 Light Light Tyr Gly Gly Phe Val Ser Pro Thr Val Ala Tyr Ser Val 1130 1135 1140 Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu Lys 1145 1150 1155 Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser Ser 1160 1165 1170 Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr Lys 1175 1180 1185 Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser Leu 1190 1195 1200 Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala Arg 1205 1210 1215 Phe Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val 1220 1225 1230 Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser 1235 1240 1245 Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys 1250 1255 1260 His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys 1265 1270 1275 Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala 1280 1285 1290 Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn 1295 1300 1305 Ile Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Arg Ala 1310 1315 1320 Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Val Tyr Arg Ser 1325 1330 1335 Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr 1340 1345 1350 Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp 1355 1360 1365 <210> 4 <211> 199 <212> PRT <213> Homo sapiens <400> 4 Met Glu Ala Ser Pro Ala Ser Gly Pro Arg His Leu Met Asp Pro His 1 5 10 15 Ile Phe Thr Ser Asn Phe Asn Asn Gly Ile Gly Arg His Lys Thr Tyr 20 25 30 Leu Cys Tyr Glu Val Glu Arg Leu Asp Asn Gly Thr Ser Val Lys Met 35 40 45 Asp Gln His Arg Gly Phe Leu His Asn Gln Ala Lys Asn Leu Leu Cys 50 55 60 Gly Phe Tyr Gly Arg His Ala Glu Leu Arg Phe Leu Asp Leu Val Pro 65 70 75 80 Ser Leu Gln Leu Asp Pro Ala Gln Ile Tyr Arg Val Thr Trp Phe Ile 85 90 95 Ser Trp Ser Pro Cys Phe Ser Trp Gly Cys Ala Gly Glu Val Arg Ala 100 105 110 Phe Leu Gln Glu Asn Thr His Val Arg Leu Arg Ile Phe Ala Ala Arg 115 120 125 Ile Tyr Asp Tyr Asp Pro Leu Tyr Lys Glu Ala Leu Gln Met Leu Arg 130 135 140 Asp Ala Gly Ala Gln Val Ser Ile Met Thr Tyr Asp Glu Phe Lys His 145 150 155 160 Cys Trp Asp Thr Phe Val Asp His Gln Gly Cys Pro Phe Gln Pro Trp 165 170 175 Asp Gly Leu Asp Glu His Ser Gln Ala Leu Ser Gly Arg Leu Arg Ala 180 185 190 Ile Leu Gln Asn Gln Gly Asn 195 <210> 5 <211> 167 <212> PRT <213> Escherichia coli <400> 5 Met Ser Glu Val Glu Phe Ser His Glu Tyr Trp Met Arg His Ala Leu 1 5 10 15 Thr Leu Ala Lys Arg Ala Trp Asp Glu Arg Glu Val Pro Val Gly Ala 20 25 30 Val Leu Val His Asn Asn Arg Val Ile Gly Glu Gly Trp Asn Arg Pro 35 40 45 Ile Gly Arg His Asp Pro Thr Ala His Ala Glu Ile Met Ala Leu Arg 50 55 60 Gln Gly Gly Leu Val Met Gln Asn Tyr Arg Leu Ile Asp Ala Thr Leu 65 70 75 80 Tyr Val Thr Leu Glu Pro Cys Val Met Cys Ala Gly Ala Met Ile His 85 90 95 Ser Arg Ile Gly Arg Val Val Phe Gly Ala Arg Asp Ala Lys Thr Gly 100 105 110 Ala Ala Gly Ser Leu Met Asp Val Leu His His Pro Gly Met Asn His 115 120 125 Arg Val Glu Ile Thr Glu Gly Ile Leu Ala Asp Glu Cys Ala Ala Leu 130 135 140 Leu Ser Asp Phe Phe Arg Met Arg Arg Gln Glu Ile Lys Ala Gln Lys 145 150 155 160 Lys Ala Gln Ser Ser Thr Asp 165 <210> 6 <211> 167 <212> PRT <213> Artificial Sequence <220> <223> DNA-dependent adenine deaminase ecTadA7.10 <400> 6 Met Ser Glu Val Glu Phe Ser His Glu Tyr Trp Met Arg His Ala Leu 1 5 10 15 Thr Leu Ala Lys Arg Ala Arg Asp Glu Arg Glu Val Pro Val Gly Ala 20 25 30 Val Leu Val Leu Asn Asn Arg Val Ile Gly Glu Gly Trp Asn Arg Ala 35 40 45 Ile Gly Leu His Asp Pro Thr Ala His Ala Glu Ile Met Ala Leu Arg 50 55 60 Gln Gly Gly Leu Val Met Gln Asn Tyr Arg Leu Ile Asp Ala Thr Leu 65 70 75 80 Tyr Val Thr Phe Glu Pro Cys Val Met Cys Ala Gly Ala Met Ile His 85 90 95 Ser Arg Ile Gly Arg Val Val Phe Gly Val Arg Asn Ala Lys Thr Gly 100 105 110 Ala Ala Gly Ser Leu Met Asp Val Leu His Tyr Pro Gly Met Asn His 115 120 125 Arg Val Glu Ile Thr Glu Gly Ile Leu Ala Asp Glu Cys Ala Ala Leu 130 135 140 Leu Cys Tyr Phe Phe Arg Met Pro Arg Gln Val Phe Asn Ala Gln Lys 145 150 155 160 Lys Ala Gln Ser Ser Thr Asp 165 <210> 7 <211> 364 <212> PRT <213> Artificial Sequence <220> <223> Adenine deaminase domain ecTadA7.10-ecTadA7.10 <400> 7 Ser Glu Val Glu Phe Ser His Glu Tyr Trp Met Arg His Ala Leu Thr 1 5 10 15 Leu Ala Lys Arg Ala Arg Asp Glu Arg Glu Val Pro Val Gly Ala Val 20 25 30 Leu Val Leu Asn Asn Arg Val Ile Gly Glu Gly Trp Asn Arg Ala Ile 35 40 45 Gly Leu His Asp Pro Thr Ala His Ala Glu Ile Met Ala Leu Arg Gln 50 55 60 Gly Gly Leu Val Met Gln Asn Tyr Arg Leu Ile Asp Ala Thr Leu Tyr 65 70 75 80 Val Thr Phe Glu Pro Cys Val Met Cys Ala Gly Ala Met Ile His Ser 85 90 95 Arg Ile Gly Arg Val Val Phe Gly Val Arg Asn Ala Lys Thr Gly Ala 100 105 110 Ala Gly Ser Leu Met Asp Val Leu His Tyr Pro Gly Met Asn His Arg 115 120 125 Val Glu Ile Thr Glu Gly Ile Leu Ala Asp Glu Cys Ala Ala Leu Leu 130 135 140 Cys Tyr Phe Phe Arg Met Pro Arg Gln Val Phe Asn Ala Gln Lys Lys 145 150 155 160 Ala Gln Ser Ser Thr Asp Ser Gly Gly Ser Ser Gly Gly Ser Ser Gly 165 170 175 Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala Thr Pro Glu Ser Ser Gly 180 185 190 Gly Ser Ser Gly Gly Ser Ser Glu Val Glu Phe Ser His Glu Tyr Trp 195 200 205 Met Arg His Ala Leu Thr Leu Ala Lys Arg Ala Arg Asp Glu Arg Glu 210 215 220 Val Pro Val Gly Ala Val Leu Val Leu Asn Asn Arg Val Ile Gly Glu 225 230 235 240 Gly Trp Asn Arg Ala Ile Gly Leu His Asp Pro Thr Ala His Ala Glu 245 250 255 Ile Met Ala Leu Arg Gln Gly Gly Leu Val Met Gln Asn Tyr Arg Leu 260 265 270 Ile Asp Ala Thr Leu Tyr Val Thr Phe Glu Pro Cys Val Met Cys Ala 275 280 285 Gly Ala Met Ile His Ser Arg Ile Gly Arg Val Val Phe Gly Val Arg 290 295 300 Asn Ala Lys Thr Gly Ala Ala Gly Ser Leu Met Asp Val Leu His Tyr 305 310 315 320 Pro Gly Met Asn His Arg Val Glu Ile Thr Glu Gly Ile Leu Ala Asp 325 330 335 Glu Cys Ala Ala Leu Leu Cys Tyr Phe Phe Arg Met Pro Arg Gln Val 340 345 350 Phe Asn Ala Gln Lys Lys Ala Gln Ser Ser Thr Asp 355 360 <210> 8 <211> 364 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of the adenine deaminase domain ecTadA-ecTadA7.10 <400> 8 Ser Glu Val Glu Phe Ser His Glu Tyr Trp Met Arg His Ala Leu Thr 1 5 10 15 Leu Ala Lys Arg Ala Trp Asp Glu Arg Glu Val Pro Val Gly Ala Val 20 25 30 Leu Val His Asn Asn Arg Val Ile Gly Glu Gly Trp Asn Arg Pro Ile 35 40 45 Gly Arg His Asp Pro Thr Ala His Ala Glu Ile Met Ala Leu Arg Gln 50 55 60 Gly Gly Leu Val Met Gln Asn Tyr Arg Leu Ile Asp Ala Thr Leu Tyr 65 70 75 80 Val Thr Leu Glu Pro Cys Val Met Cys Ala Gly Ala Met Ile His Ser 85 90 95 Arg Ile Gly Arg Val Val Phe Gly Ala Arg Asp Ala Lys Thr Gly Ala 100 105 110 Ala Gly Ser Leu Met Asp Val Leu His His Pro Gly Met Asn His Arg 115 120 125 Val Glu Ile Thr Glu Gly Ile Leu Ala Asp Glu Cys Ala Ala Leu Leu 130 135 140 Ser Asp Phe Phe Arg Met Arg Arg Gln Glu Ile Lys Ala Gln Lys Lys 145 150 155 160 Ala Gln Ser Ser Thr Asp Ser Gly Gly Ser Ser Gly Gly Ser Ser Gly 165 170 175 Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala Thr Pro Glu Ser Ser Gly 180 185 190 Gly Ser Ser Gly Gly Ser Ser Glu Val Glu Phe Ser His Glu Tyr Trp 195 200 205 Met Arg His Ala Leu Thr Leu Ala Lys Arg Ala Arg Asp Glu Arg Glu 210 215 220 Val Pro Val Gly Ala Val Leu Val Leu Asn Asn Arg Val Ile Gly Glu 225 230 235 240 Gly Trp Asn Arg Ala Ile Gly Leu His Asp Pro Thr Ala His Ala Glu 245 250 255 Ile Met Ala Leu Arg Gln Gly Gly Leu Val Met Gln Asn Tyr Arg Leu 260 265 270 Ile Asp Ala Thr Leu Tyr Val Thr Phe Glu Pro Cys Val Met Cys Ala 275 280 285 Gly Ala Met Ile His Ser Arg Ile Gly Arg Val Val Phe Gly Val Arg 290 295 300 Asn Ala Lys Thr Gly Ala Ala Gly Ser Leu Met Asp Val Leu His Tyr 305 310 315 320 Pro Gly Met Asn His Arg Val Glu Ile Thr Glu Gly Ile Leu Ala Asp 325 330 335 Glu Cys Ala Ala Leu Leu Cys Tyr Phe Phe Arg Met Pro Arg Gln Val 340 345 350 Phe Asn Ala Gln Lys Lys Ala Gln Ser Ser Thr Asp 355 360 <210> 9 <211> 32 <212> PRT <213> Artificial Sequence <220> <223> 32aa linker <400> 9 Ser Gly Gly Ser Ser Gly Gly Ser Ser Gly Ser Glu Thr Pro Gly Thr 1 5 10 15 Ser Glu Ser Ala Thr Pro Glu Ser Ser Gly Gly Ser Ser Gly Gly Ser 20 25 30 <210> 10 <211> 48 <212> PRT <213> Artificial Sequence <220> <223> 48aa linker <400> 10 Ser Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala Thr Pro Glu Ser 1 5 10 15 Ser Gly Gly Ser Ser Gly Gly Ser Ser Ser Gly Ser Glu Thr Pro Gly Thr 20 25 30 Ser Glu Ser Ala Thr Pro Glu Ser Ser Gly Gly Ser Ser Gly Gly Ser 35 40 45 <210> 11 <211> 16 <212> PRT <213> Artificial Sequence <220> <223> XTEN connector <400> 11 Ser Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala Thr Pro Glu Ser 1 5 10 15 <210> 12 <211> 83 <212> PRT <213> Artificial Sequence <220> <223> Uracil DNA glycosylation inhibitor (UGI) amino acid sequence <400> 12 Thr Asn Leu Ser Asp Ile Ile Glu Lys Glu Thr Gly Lys Gln Leu Val 1 5 10 15 Ile Gln Glu Ser Ile Leu Met Leu Pro Glu Glu Val Glu Glu Val Ile 20 25 30 Gly Asn Lys Pro Glu Ser Asp Ile Leu Val His Thr Ala Tyr Asp Glu 35 40 45 Ser Thr Asp Glu Asn Val Met Leu Leu Thr Ser Asp Ala Pro Glu Tyr 50 55 60 Lys Pro Trp Ala Leu Val Ile Gln Asp Ser Asn Gly Glu Asn Lys Ile 65 70 75 80 Lys Met Leu <210> 13 <211> 2126 <212> PRT <213> Artificial Sequence <220> <223> STEME-1 <400> 13 Met Glu Ala Ser Pro Ala Ser Gly Pro Arg His Leu Met Asp Pro His 1 5 10 15 Ile Phe Thr Ser Asn Phe Asn Asn Gly Ile Gly Arg His Lys Thr Tyr 20 25 30 Leu Cys Tyr Glu Val Glu Arg Leu Asp Asn Gly Thr Ser Val Lys Met 35 40 45 Asp Gln His Arg Gly Phe Leu His Asn Gln Ala Lys Asn Leu Leu Cys 50 55 60 Gly Phe Tyr Gly Arg His Ala Glu Leu Arg Phe Leu Asp Leu Val Pro 65 70 75 80 Ser Leu Gln Leu Asp Pro Ala Gln Ile Tyr Arg Val Thr Trp Phe Ile 85 90 95 Ser Trp Ser Pro Cys Phe Ser Trp Gly Cys Ala Gly Glu Val Arg Ala 100 105 110 Phe Leu Gln Glu Asn Thr His Val Arg Leu Arg Ile Phe Ala Ala Arg 115 120 125 Ile Tyr Asp Tyr Asp Pro Leu Tyr Lys Glu Ala Leu Gln Met Leu Arg 130 135 140 Asp Ala Gly Ala Gln Val Ser Ile Met Thr Tyr Asp Glu Phe Lys His 145 150 155 160 Cys Trp Asp Thr Phe Val Asp His Gln Gly Cys Pro Phe Gln Pro Trp 165 170 175 Asp Gly Leu Asp Glu His Ser Gln Ala Leu Ser Gly Arg Leu Arg Ala 180 185 190 Ile Leu Gln Asn Gln Gly Asn Ser Gly Ser Glu Thr Pro Gly Thr Ser 195 200 205 Glu Ser Ala Thr Pro Glu Ser Ser Gly Gly Ser Ser Gly Gly Ser Ser 210 215 220 Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala Thr Pro Glu Ser Ser 225 230 235 240 Gly Gly Ser Ser Gly Gly Ser Ser Glu Val Glu Phe Ser His Glu Tyr 245 250 255 Trp Met Arg His Ala Leu Thr Leu Ala Lys Arg Ala Trp Asp Glu Arg 260 265 270 Glu Val Pro Val Gly Ala Val Leu Val His Asn Asn Arg Val Ile Gly 275 280 285 Glu Gly Trp Asn Arg Pro Ile Gly Arg His Asp Pro Thr Ala His Ala 290 295 300 Glu Ile Met Ala Leu Arg Gln Gly Gly Leu Val Met Gln Asn Tyr Arg 305 310 315 320 Leu Ile Asp Ala Thr Leu Tyr Val Thr Leu Glu Pro Cys Val Met Cys 325 330 335 Ala Gly Ala Met Ile His Ser Arg Ile Gly Arg Val Val Phe Gly Ala 340 345 350 Arg Asp Ala Lys Thr Gly Ala Ala Gly Ser Leu Met Asp Val Leu His 355 360 365 His Pro Gly Met Asn His Arg Val Glu Ile Thr Glu Gly Ile Leu Ala 370 375 380 Asp Glu Cys Ala Ala Leu Leu Ser Asp Phe Phe Arg Met Arg Arg Gln 385 390 395 400 Glu Ile Lys Ala Gln Lys Lys Ala Gln Ser Ser Thr Asp Ser Gly Gly 405 410 415 Ser Ser Gly Gly Ser Ser Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser 420 425 430 Ala Thr Pro Glu Ser Ser Gly Gly Ser Ser Gly Gly Ser Ser Glu Val 435 440 445 Glu Phe Ser His Glu Tyr Trp Met Arg His Ala Leu Thr Leu Ala Lys 450 455 460 Arg Ala Arg Asp Glu Arg Glu Val Pro Val Gly Ala Val Leu Val Leu 465 470 475 480 Asn Asn Arg Val Ile Gly Glu Gly Trp Asn Arg Ala Ile Gly Leu His 485 490 495 Asp Pro Thr Ala His Ala Glu Ile Met Ala Leu Arg Gln Gly Gly Leu 500 505 510 Val Met Gln Asn Tyr Arg Leu Ile Asp Ala Thr Leu Tyr Val Thr Phe 515 520 525 Glu Pro Cys Val Met Cys Ala Gly Ala Met Ile His Ser Arg Ile Gly 530 535 540 Arg Val Val Phe Gly Val Arg Asn Ala Lys Thr Gly Ala Ala Gly Ser 545 550 555 560 Leu Met Asp Val Leu His Tyr Pro Gly Met Asn His Arg Val Glu Ile 565 570 575 Thr Glu Gly Ile Leu Ala Asp Glu Cys Ala Ala Leu Leu Cys Tyr Phe 580 585 590 Phe Arg Met Pro Arg Gln Val Phe Asn Ala Gln Lys Lys Ala Gln Ser 595 600 605 Ser Thr Asp Ser Gly Gly Ser Ser Gly Gly Ser Ser Gly Ser Glu Thr 610 615 620 Pro Gly Thr Ser Glu Ser Ala Thr Pro Glu Ser Ser Gly Gly Ser Ser 625 630 635 640 Gly Gly Ser Asp Lys Lys Tyr Ser Ile Gly Leu Ala Ile Gly Thr Asn 645 650 655 Ser Val Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys 660 665 670 Lys Phe Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn 675 680 685 Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr 690 695 700 Arg Leu Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg 705 710 715 720 Ile Cys Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp 725 730 735 Asp Ser Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp 740 745 750 Lys Lys His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val 755 760 765 Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu 770 775 780 Val Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu 785 790 795 800 Ala His Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu 805 810 815 Asn Pro Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln 820 825 830 Thr Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val 835 840 845 Asp Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu 850 855 860 Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe 865 870 875 880 Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser 885 890 895 Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr 900 905 910 Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr 915 920 925 Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu 930 935 940 Ser Asp Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser 945 950 955 960 Ala Ser Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu 965 970 975 Leu Lys Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile 980 985 990 Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly 995 1000 1005 Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu 1010 1015 1020 Lys Met Asp Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu 1025 1030 1035 Asp Leu Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro 1040 1045 1050 His Gln Ile His Leu Gly Glu Leu His Ala Ile Leu Arg Arg Gln 1055 1060 1065 Glu Asp Phe Tyr Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu 1070 1075 1080 Lys Ile Leu Thr Phe Arg Ile Pro Tyr Tyr Val Gly Pro Leu Ala 1085 1090 1095 Arg Gly Asn Ser Arg Phe Ala Trp Met Thr Arg Lys Ser Glu Glu 1100 1105 1110 Thr Ile Thr Pro Trp Asn Phe Glu Glu Val Val Asp Lys Gly Ala 1115 1120 1125 Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn Phe Asp Lys Asn 1130 1135 1140 Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser Leu Leu Tyr Glu 1145 1150 1155 Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr Val Thr 1160 1165 1170 Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys Lys 1175 1180 1185 Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val 1190 1195 1200 Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp 1205 1210 1215 Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu 1220 1225 1230 Gly Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe 1235 1240 1245 Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu 1250 1255 1260 Thr Leu Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu 1265 1270 1275 Lys Thr Tyr Ala His Leu Phe Asp Asp Lys Val Met Lys Gln Leu 1280 1285 1290 Lys Arg Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu 1295 1300 1305 Ile Asn Gly Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp 1310 1315 1320 Phe Leu Lys Ser Asp Gly Phe Ala Asn Arg Asn Phe Met Gln Leu 1325 1330 1335 Ile His Asp Asp Ser Leu Thr Phe Lys Glu Asp Ile Gln Lys Ala 1340 1345 1350 Gln Val Ser Gly Gln Gly Asp Ser Leu His Glu His Ile Ala Asn 1355 1360 1365 Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly Ile Leu Gln Thr Val 1370 1375 1380 Lys Val Val Asp Glu Leu Val Lys Val Met Gly Arg His Lys Pro 1385 1390 1395 Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln Thr Thr Gln 1400 1405 1410 Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile Glu Glu 1415 1420 1425 Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro Val 1430 1435 1440 Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu 1445 1450 1455 Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn 1460 1465 1470 Arg Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe 1475 1480 1485 Leu Lys Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp 1490 1495 1500 Lys Asn Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val 1505 1510 1515 Lys Lys Met Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu 1520 1525 1530 Ile Thr Gln Arg Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly 1535 1540 1545 Gly Leu Ser Glu Leu Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu 1550 1555 1560 Val Glu Thr Arg Gln Ile Thr Lys His Val Ala Gln Ile Leu Asp 1565 1570 1575 Ser Arg Met Asn Thr Lys Tyr Asp Glu Asn Asp Lys Leu Ile Arg 1580 1585 1590 Glu Val Lys Val Ile Thr Leu Lys Ser Lys Leu Val Ser Asp Phe 1595 1600 1605 Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg Glu Ile Asn Asn Tyr 1610 1615 1620 His His Ala His Asp Ala Tyr Leu Asn Ala Val Val Gly Thr Ala 1625 1630 1635 Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe Val Tyr Gly 1640 1645 1650 Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys Ser Glu 1655 1660 1665 Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr Ser Asn 1670 1675 1680 Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala Asn Gly Glu 1685 1690 1695 Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr Gly Glu 1700 1705 1710 Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys Val 1715 1720 1725 Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln 1730 1735 1740 Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser 1745 1750 1755 Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr 1760 1765 1770 Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser Val Leu Val Val 1775 1780 1785 Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu Lys Ser Val Lys 1790 1795 1800 Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser Ser Phe Glu Lys 1805 1810 1815 Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr Lys Glu Val Lys 1820 1825 1830 Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser Leu Phe Glu Leu 1835 1840 1845 Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala Gly Glu Leu Gln 1850 1855 1860 Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val Asn Phe Leu 1865 1870 1875 Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser Pro Glu Asp 1880 1885 1890 Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys His Tyr Leu 1895 1900 1905 Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg Val Ile 1910 1915 1920 Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala Tyr Asn Lys 1925 1930 1935 His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile Ile His 1940 1945 1950 Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys Tyr 1955 1960 1965 Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu 1970 1975 1980 Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr 1985 1990 1995 Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro 2000 2005 2010 Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Glu Phe 2015 2020 2025 Ser Gly Gly Ser Thr Asn Leu Ser Asp Ile Ile Glu Lys Glu Thr 2030 2035 2040 Gly Lys Gln Leu Val Ile Gln Glu Ser Ile Leu Met Leu Pro Glu 2045 2050 2055 Glu Val Glu Glu Val Ile Gly Asn Lys Pro Glu Ser Asp Ile Leu 2060 2065 2070 Val His Thr Ala Tyr Asp Glu Ser Thr Asp Glu Asn Val Met Leu 2075 2080 2085 Leu Thr Ser Asp Ala Pro Glu Tyr Lys Pro Trp Ala Leu Val Ile 2090 2095 2100 Gln Asp Ser Asn Gly Glu Asn Lys Ile Lys Met Leu Ser Gly Gly 2105 2110 2115 Ser Pro Lys Lys Lys Arg Lys Val 2120 2125 <210> 14 <211> 2096 <212> PRT <213> Artificial Sequence <220> <223> STEME-2 <400> 14 Met Ser Glu Val Glu Phe Ser His Glu Tyr Trp Met Arg His Ala Leu 1 5 10 15 Thr Leu Ala Lys Arg Ala Trp Asp Glu Arg Glu Val Pro Val Gly Ala 20 25 30 Val Leu Val His Asn Asn Arg Val Ile Gly Glu Gly Trp Asn Arg Pro 35 40 45 Ile Gly Arg His Asp Pro Thr Ala His Ala Glu Ile Met Ala Leu Arg 50 55 60 Gln Gly Gly Leu Val Met Gln Asn Tyr Arg Leu Ile Asp Ala Thr Leu 65 70 75 80 Tyr Val Thr Leu Glu Pro Cys Val Met Cys Ala Gly Ala Met Ile His 85 90 95 Ser Arg Ile Gly Arg Val Val Phe Gly Ala Arg Asp Ala Lys Thr Gly 100 105 110 Ala Ala Gly Ser Leu Met Asp Val Leu His His Pro Gly Met Asn His 115 120 125 Arg Val Glu Ile Thr Glu Gly Ile Leu Ala Asp Glu Cys Ala Ala Leu 130 135 140 Leu Ser Asp Phe Phe Arg Met Arg Arg Gln Glu Ile Lys Ala Gln Lys 145 150 155 160 Lys Ala Gln Ser Ser Thr Asp Ser Gly Gly Ser Ser Gly Gly Ser Ser 165 170 175 Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala Thr Pro Glu Ser Ser 180 185 190 Gly Gly Ser Ser Gly Gly Ser Ser Glu Val Glu Phe Ser His Glu Tyr 195 200 205 Trp Met Arg His Ala Leu Thr Leu Ala Lys Arg Ala Arg Asp Glu Arg 210 215 220 Glu Val Pro Val Gly Ala Val Leu Val Leu Asn Asn Arg Val Ile Gly 225 230 235 240 Glu Gly Trp Asn Arg Ala Ile Gly Leu His Asp Pro Thr Ala His Ala 245 250 255 Glu Ile Met Ala Leu Arg Gln Gly Gly Leu Val Met Gln Asn Tyr Arg 260 265 270 Leu Ile Asp Ala Thr Leu Tyr Val Thr Phe Glu Pro Cys Val Met Cys 275 280 285 Ala Gly Ala Met Ile His Ser Arg Ile Gly Arg Val Val Phe Gly Val 290 295 300 Arg Asn Ala Lys Thr Gly Ala Ala Gly Ser Leu Met Asp Val Leu His 305 310 315 320 Tyr Pro Gly Met Asn His Arg Val Glu Ile Thr Glu Gly Ile Leu Ala 325 330 335 Asp Glu Cys Ala Ala Leu Leu Cys Tyr Phe Phe Arg Met Pro Arg Gln 340 345 350 Val Phe Asn Ala Gln Lys Lys Ala Gln Ser Ser Thr Asp Ser Gly Gly 355 360 365 Ser Ser Gly Gly Ser Ser Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser 370 375 380 Ala Thr Pro Glu Ser Ser Gly Gly Ser Ser Gly Gly Ser Glu Ala Ser 385 390 395 400 Pro Ala Ser Gly Pro Arg His Leu Met Asp Pro His Ile Phe Thr Ser 405 410 415 Asn Phe Asn Asn Gly Ile Gly Arg His Lys Thr Tyr Leu Cys Tyr Glu 420 425 430 Val Glu Arg Leu Asp Asn Gly Thr Ser Val Lys Met Asp Gln His Arg 435 440 445 Gly Phe Leu His Asn Gln Ala Lys Asn Leu Leu Cys Gly Phe Tyr Gly 450 455 460 Arg His Ala Glu Leu Arg Phe Leu Asp Leu Val Pro Ser Leu Gln Leu 465 470 475 480 Asp Pro Ala Gln Ile Tyr Arg Val Thr Trp Phe Ile Ser Trp Ser Pro 485 490 495 Cys Phe Ser Trp Gly Cys Ala Gly Glu Val Arg Ala Phe Leu Gln Glu 500 505 510 Asn Thr His Val Arg Leu Arg Ile Phe Ala Ala Arg Ile Tyr Asp Tyr 515 520 525 Asp Pro Leu Tyr Lys Glu Ala Leu Gln Met Leu Arg Asp Ala Gly Ala 530 535 540 Gln Val Ser Ile Met Thr Tyr Asp Glu Phe Lys His Cys Trp Asp Thr 545 550 555 560 Phe Val Asp His Gln Gly Cys Pro Phe Gln Pro Trp Asp Gly Leu Asp 565 570 575 Glu His Ser Gln Ala Leu Ser Gly Arg Leu Arg Ala Ile Leu Gln Asn 580 585 590 Gln Gly Asn Ser Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala Thr 595 600 605 Pro Glu Ser Leu Lys Asp Lys Lys Tyr Ser Ile Gly Leu Ala Ile Gly 610 615 620 Thr Asn Ser Val Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro 625 630 635 640 Ser Lys Lys Phe Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys 645 650 655 Lys Asn Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu 660 665 670 Ala Thr Arg Leu Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys 675 680 685 Asn Arg Ile Cys Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys 690 695 700 Val Asp Asp Ser Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu 705 710 715 720 Glu Asp Lys Lys His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp 725 730 735 Glu Val Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys 740 745 750 Lys Leu Val Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu 755 760 765 Ala Leu Ala His Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly 770 775 780 Asp Leu Asn Pro Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu 785 790 795 800 Val Gln Thr Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser 805 810 815 Gly Val Asp Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg 820 825 830 Arg Leu Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly 835 840 845 Leu Phe Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe 850 855 860 Lys Ser Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys 865 870 875 880 Asp Thr Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp 885 890 895 Gln Tyr Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile 900 905 910 Leu Leu Ser Asp Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro 915 920 925 Leu Ser Ala Ser Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu 930 935 940 Thr Leu Leu Lys Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys 945 950 955 960 Glu Ile Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp 965 970 975 Gly Gly Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu 980 985 990 Glu Lys Met Asp Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu 995 1000 1005 Asp Leu Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro 1010 1015 1020 His Gln Ile His Leu Gly Glu Leu His Ala Ile Leu Arg Arg Gln 1025 1030 1035 Glu Asp Phe Tyr Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu 1040 1045 1050 Lys Ile Leu Thr Phe Arg Ile Pro Tyr Tyr Val Gly Pro Leu Ala 1055 1060 1065 Arg Gly Asn Ser Arg Phe Ala Trp Met Thr Arg Lys Ser Glu Glu 1070 1075 1080 Thr Ile Thr Pro Trp Asn Phe Glu Glu Val Val Asp Lys Gly Ala 1085 1090 1095 Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn Phe Asp Lys Asn 1100 1105 1110 Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser Leu Leu Tyr Glu 1115 1120 1125 Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr Val Thr 1130 1135 1140 Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys Lys 1145 1150 1155 Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val 1160 1165 1170 Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp 1175 1180 1185 Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu 1190 1195 1200 Gly Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe 1205 1210 1215 Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu 1220 1225 1230 Thr Leu Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu 1235 1240 1245 Lys Thr Tyr Ala His Leu Phe Asp Asp Lys Val Met Lys Gln Leu 1250 1255 1260 Lys Arg Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu 1265 1270 1275 Ile Asn Gly Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp 1280 1285 1290 Phe Leu Lys Ser Asp Gly Phe Ala Asn Arg Asn Phe Met Gln Leu 1295 1300 1305 Ile His Asp Asp Ser Leu Thr Phe Lys Glu Asp Ile Gln Lys Ala 1310 1315 1320 Gln Val Ser Gly Gln Gly Asp Ser Leu His Glu His Ile Ala Asn 1325 1330 1335 Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly Ile Leu Gln Thr Val 1340 1345 1350 Lys Val Val Asp Glu Leu Val Lys Val Met Gly Arg His Lys Pro 1355 1360 1365 Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln Thr Thr Gln 1370 1375 1380 Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile Glu Glu 1385 1390 1395 Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro Val 1400 1405 1410 Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu 1415 1420 1425 Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn 1430 1435 1440 Arg Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe 1445 1450 1455 Leu Lys Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp 1460 1465 1470 Lys Asn Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val 1475 1480 1485 Lys Lys Met Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu 1490 1495 1500 Ile Thr Gln Arg Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly 1505 1510 1515 Gly Leu Ser Glu Leu Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu 1520 1525 1530 Val Glu Thr Arg Gln Ile Thr Lys His Val Ala Gln Ile Leu Asp 1535 1540 1545 Ser Arg Met Asn Thr Lys Tyr Asp Glu Asn Asp Lys Leu Ile Arg 1550 1555 1560 Glu Val Lys Val Ile Thr Leu Lys Ser Lys Leu Val Ser Asp Phe 1565 1570 1575 Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg Glu Ile Asn Asn Tyr 1580 1585 1590 His His Ala His Asp Ala Tyr Leu Asn Ala Val Val Gly Thr Ala 1595 1600 1605 Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe Val Tyr Gly 1610 1615 1620 Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys Ser Glu 1625 1630 1635 Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr Ser Asn 1640 1645 1650 Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala Asn Gly Glu 1655 1660 1665 Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr Gly Glu 1670 1675 1680 Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys Val 1685 1690 1695 Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln 1700 1705 1710 Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser 1715 1720 1725 Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr 1730 1735 1740 Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser Val Leu Val Val 1745 1750 1755 Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu Lys Ser Val Lys 1760 1765 1770 Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser Ser Phe Glu Lys 1775 1780 1785 Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr Lys Glu Val Lys 1790 1795 1800 Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser Leu Phe Glu Leu 1805 1810 1815 Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala Gly Glu Leu Gln 1820 1825 1830 Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val Asn Phe Leu 1835 1840 1845 Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser Pro Glu Asp 1850 1855 1860 Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys His Tyr Leu 1865 1870 1875 Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg Val Ile 1880 1885 1890 Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala Tyr Asn Lys 1895 1900 1905 His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile Ile His 1910 1915 1920 Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys Tyr 1925 1930 1935 Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu 1940 1945 1950 Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr 1955 1960 1965 Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro 1970 1975 1980 Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Glu Phe 1985 1990 1995 Ser Gly Gly Ser Thr Asn Leu Ser Asp Ile Ile Glu Lys Glu Thr 2000 2005 2010 Gly Lys Gln Leu Val Ile Gln Glu Ser Ile Leu Met Leu Pro Glu 2015 2020 2025 Glu Val Glu Glu Val Ile Gly Asn Lys Pro Glu Ser Asp Ile Leu 2030 2035 2040 Val His Thr Ala Tyr Asp Glu Ser Thr Asp Glu Asn Val Met Leu 2045 2050 2055 Leu Thr Ser Asp Ala Pro Glu Tyr Lys Pro Trp Ala Leu Val Ile 2060 2065 2070 Gln Asp Ser Asn Gly Glu Asn Lys Ile Lys Met Leu Ser Gly Gly 2075 2080 2085 Ser Pro Lys Lys Lys Arg Lys Val 2090 2095 <210> 15 <211> 2252 <212> PRT <213> Artificial Sequence <220> <223> STEME-3 <400> 15 Met Glu Ala Ser Pro Ala Ser Gly Pro Arg His Leu Met Asp Pro His 1 5 10 15 Ile Phe Thr Ser Asn Phe Asn Asn Gly Ile Gly Arg His Lys Thr Tyr 20 25 30 Leu Cys Tyr Glu Val Glu Arg Leu Asp Asn Gly Thr Ser Val Lys Met 35 40 45 Asp Gln His Arg Gly Phe Leu His Asn Gln Ala Lys Asn Leu Leu Cys 50 55 60 Gly Phe Tyr Gly Arg His Ala Glu Leu Arg Phe Leu Asp Leu Val Pro 65 70 75 80 Ser Leu Gln Leu Asp Pro Ala Gln Ile Tyr Arg Val Thr Trp Phe Ile 85 90 95 Ser Trp Ser Pro Cys Phe Ser Trp Gly Cys Ala Gly Glu Val Arg Ala 100 105 110 Phe Leu Gln Glu Asn Thr His Val Arg Leu Arg Ile Phe Ala Ala Arg 115 120 125 Ile Tyr Asp Tyr Asp Pro Leu Tyr Lys Glu Ala Leu Gln Met Leu Arg 130 135 140 Asp Ala Gly Ala Gln Val Ser Ile Met Thr Tyr Asp Glu Phe Lys His 145 150 155 160 Cys Trp Asp Thr Phe Val Asp His Gln Gly Cys Pro Phe Gln Pro Trp 165 170 175 Asp Gly Leu Asp Glu His Ser Gln Ala Leu Ser Gly Arg Leu Arg Ala 180 185 190 Ile Leu Gln Asn Gln Gly Asn Ser Gly Ser Glu Thr Pro Gly Thr Ser 195 200 205 Glu Ser Ala Thr Pro Glu Ser Ser Gly Gly Ser Ser Gly Gly Ser Ser 210 215 220 Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala Thr Pro Glu Ser Ser 225 230 235 240 Gly Gly Ser Ser Gly Gly Ser Ser Glu Val Glu Phe Ser His Glu Tyr 245 250 255 Trp Met Arg His Ala Leu Thr Leu Ala Lys Arg Ala Trp Asp Glu Arg 260 265 270 Glu Val Pro Val Gly Ala Val Leu Val His Asn Asn Arg Val Ile Gly 275 280 285 Glu Gly Trp Asn Arg Pro Ile Gly Arg His Asp Pro Thr Ala His Ala 290 295 300 Glu Ile Met Ala Leu Arg Gln Gly Gly Leu Val Met Gln Asn Tyr Arg 305 310 315 320 Leu Ile Asp Ala Thr Leu Tyr Val Thr Leu Glu Pro Cys Val Met Cys 325 330 335 Ala Gly Ala Met Ile His Ser Arg Ile Gly Arg Val Val Phe Gly Ala 340 345 350 Arg Asp Ala Lys Thr Gly Ala Ala Gly Ser Leu Met Asp Val Leu His 355 360 365 His Pro Gly Met Asn His Arg Val Glu Ile Thr Glu Gly Ile Leu Ala 370 375 380 Asp Glu Cys Ala Ala Leu Leu Ser Asp Phe Phe Arg Met Arg Arg Gln 385 390 395 400 Glu Ile Lys Ala Gln Lys Lys Ala Gln Ser Ser Thr Asp Ser Gly Gly 405 410 415 Ser Ser Gly Gly Ser Ser Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser 420 425 430 Ala Thr Pro Glu Ser Ser Gly Gly Ser Ser Gly Gly Ser Ser Glu Val 435 440 445 Glu Phe Ser His Glu Tyr Trp Met Arg His Ala Leu Thr Leu Ala Lys 450 455 460 Arg Ala Arg Asp Glu Arg Glu Val Pro Val Gly Ala Val Leu Val Leu 465 470 475 480 Asn Asn Arg Val Ile Gly Glu Gly Trp Asn Arg Ala Ile Gly Leu His 485 490 495 Asp Pro Thr Ala His Ala Glu Ile Met Ala Leu Arg Gln Gly Gly Leu 500 505 510 Val Met Gln Asn Tyr Arg Leu Ile Asp Ala Thr Leu Tyr Val Thr Phe 515 520 525 Glu Pro Cys Val Met Cys Ala Gly Ala Met Ile His Ser Arg Ile Gly 530 535 540 Arg Val Val Phe Gly Val Arg Asn Ala Lys Thr Gly Ala Ala Gly Ser 545 550 555 560 Leu Met Asp Val Leu His Tyr Pro Gly Met Asn His Arg Val Glu Ile 565 570 575 Thr Glu Gly Ile Leu Ala Asp Glu Cys Ala Ala Leu Leu Cys Tyr Phe 580 585 590 Phe Arg Met Pro Arg Gln Val Phe Asn Ala Gln Lys Lys Ala Gln Ser 595 600 605 Ser Thr Asp Ser Gly Gly Ser Ser Gly Gly Ser Ser Gly Ser Glu Thr 610 615 620 Pro Gly Thr Ser Glu Ser Ala Thr Pro Glu Ser Ser Gly Gly Ser Ser 625 630 635 640 Gly Gly Ser Asp Lys Lys Tyr Ser Ile Gly Leu Ala Ile Gly Thr Asn 645 650 655 Ser Val Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys 660 665 670 Lys Phe Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn 675 680 685 Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr 690 695 700 Arg Leu Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg 705 710 715 720 Ile Cys Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp 725 730 735 Asp Ser Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp 740 745 750 Lys Lys His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val 755 760 765 Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu 770 775 780 Val Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu 785 790 795 800 Ala His Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu 805 810 815 Asn Pro Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln 820 825 830 Thr Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val 835 840 845 Asp Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu 850 855 860 Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe 865 870 875 880 Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser 885 890 895 Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr 900 905 910 Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr 915 920 925 Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu 930 935 940 Ser Asp Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser 945 950 955 960 Ala Ser Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu 965 970 975 Leu Lys Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile 980 985 990 Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly 995 1000 1005 Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu 1010 1015 1020 Lys Met Asp Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu 1025 1030 1035 Asp Leu Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro 1040 1045 1050 His Gln Ile His Leu Gly Glu Leu His Ala Ile Leu Arg Arg Gln 1055 1060 1065 Glu Asp Phe Tyr Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu 1070 1075 1080 Lys Ile Leu Thr Phe Arg Ile Pro Tyr Tyr Val Gly Pro Leu Ala 1085 1090 1095 Arg Gly Asn Ser Arg Phe Ala Trp Met Thr Arg Lys Ser Glu Glu 1100 1105 1110 Thr Ile Thr Pro Trp Asn Phe Glu Glu Val Val Asp Lys Gly Ala 1115 1120 1125 Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn Phe Asp Lys Asn 1130 1135 1140 Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser Leu Leu Tyr Glu 1145 1150 1155 Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr Val Thr 1160 1165 1170 Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys Lys 1175 1180 1185 Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val 1190 1195 1200 Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp 1205 1210 1215 Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu 1220 1225 1230 Gly Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe 1235 1240 1245 Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu 1250 1255 1260 Thr Leu Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu 1265 1270 1275 Lys Thr Tyr Ala His Leu Phe Asp Asp Lys Val Met Lys Gln Leu 1280 1285 1290 Lys Arg Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu 1295 1300 1305 Ile Asn Gly Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp 1310 1315 1320 Phe Leu Lys Ser Asp Gly Phe Ala Asn Arg Asn Phe Met Gln Leu 1325 1330 1335 Ile His Asp Asp Ser Leu Thr Phe Lys Glu Asp Ile Gln Lys Ala 1340 1345 1350 Gln Val Ser Gly Gln Gly Asp Ser Leu His Glu His Ile Ala Asn 1355 1360 1365 Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly Ile Leu Gln Thr Val 1370 1375 1380 Lys Val Val Asp Glu Leu Val Lys Val Met Gly Arg His Lys Pro 1385 1390 1395 Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln Thr Thr Gln 1400 1405 1410 Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile Glu Glu 1415 1420 1425 Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro Val 1430 1435 1440 Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu 1445 1450 1455 Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn 1460 1465 1470 Arg Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe 1475 1480 1485 Leu Lys Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp 1490 1495 1500 Lys Asn Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val 1505 1510 1515 Lys Lys Met Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu 1520 1525 1530 Ile Thr Gln Arg Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly 1535 1540 1545 Gly Leu Ser Glu Leu Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu 1550 1555 1560 Val Glu Thr Arg Gln Ile Thr Lys His Val Ala Gln Ile Leu Asp 1565 1570 1575 Ser Arg Met Asn Thr Lys Tyr Asp Glu Asn Asp Lys Leu Ile Arg 1580 1585 1590 Glu Val Lys Val Ile Thr Leu Lys Ser Lys Leu Val Ser Asp Phe 1595 1600 1605 Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg Glu Ile Asn Asn Tyr 1610 1615 1620 His His Ala His Asp Ala Tyr Leu Asn Ala Val Val Gly Thr Ala 1625 1630 1635 Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe Val Tyr Gly 1640 1645 1650 Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys Ser Glu 1655 1660 1665 Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr Ser Asn 1670 1675 1680 Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala Asn Gly Glu 1685 1690 1695 Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr Gly Glu 1700 1705 1710 Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys Val 1715 1720 1725 Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln 1730 1735 1740 Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser 1745 1750 1755 Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr 1760 1765 1770 Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser Val Leu Val Val 1775 1780 1785 Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu Lys Ser Val Lys 1790 1795 1800 Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser Ser Phe Glu Lys 1805 1810 1815 Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr Lys Glu Val Lys 1820 1825 1830 Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser Leu Phe Glu Leu 1835 1840 1845 Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala Gly Glu Leu Gln 1850 1855 1860 Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val Asn Phe Leu 1865 1870 1875 Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser Pro Glu Asp 1880 1885 1890 Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys His Tyr Leu 1895 1900 1905 Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg Val Ile 1910 1915 1920 Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala Tyr Asn Lys 1925 1930 1935 His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile Ile His 1940 1945 1950 Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys Tyr 1955 1960 1965 Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu 1970 1975 1980 Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr 1985 1990 1995 Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro 2000 2005 2010 Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Glu Phe 2015 2020 2025 Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn 2030 2035 2040 Pro Gly Pro Thr Asn Leu Ser Asp Ile Ile Glu Lys Glu Thr Gly 2045 2050 2055 Lys Gln Leu Val Ile Gln Glu Ser Ile Leu Met Leu Pro Glu Glu 2060 2065 2070 Val Glu Glu Val Ile Gly Asn Lys Pro Glu Ser Asp Ile Leu Val 2075 2080 2085 His Thr Ala Tyr Asp Glu Ser Thr Asp Glu Asn Val Met Leu Leu 2090 2095 2100 Thr Ser Asp Ala Pro Glu Tyr Lys Pro Trp Ala Leu Val Ile Gln 2105 2110 2115 Asp Ser Asn Gly Glu Asn Lys Ile Lys Met Leu Ser Gly Gly Ser 2120 2125 2130 Pro Lys Lys Lys Arg Lys Val Glu Gly Arg Gly Ser Leu Leu Thr 2135 2140 2145 Cys Gly Asp Val Glu Glu Asn Pro Gly Pro Thr Asn Leu Ser Asp 2150 2155 2160 Ile Ile Glu Lys Glu Thr Gly Lys Gln Leu Val Ile Gln Glu Ser 2165 2170 2175 Ile Leu Met Leu Pro Glu Glu Val Glu Glu Val Ile Gly Asn Lys 2180 2185 2190 Pro Glu Ser Asp Ile Leu Val His Thr Ala Tyr Asp Glu Ser Thr 2195 2200 2205 Asp Glu Asn Val Met Leu Leu Thr Ser Asp Ala Pro Glu Tyr Lys 2210 2215 2220 Pro Trp Ala Leu Val Ile Gln Asp Ser Asn Gly Glu Asn Lys Ile 2225 2230 2235 Lys Met Leu Ser Gly Gly Ser Pro Lys Lys Lys Arg Lys Val 2240 2245 2250 <210> 16 <211> 2220 <212> PRT <213> Artificial Sequence <220> <223> STEME-4 <400> 16 Met Ser Glu Val Glu Phe Ser His Glu Tyr Trp Met Arg His Ala Leu 1 5 10 15 Thr Leu Ala Lys Arg Ala Trp Asp Glu Arg Glu Val Pro Val Gly Ala 20 25 30 Val Leu Val His Asn Asn Arg Val Ile Gly Glu Gly Trp Asn Arg Pro 35 40 45 Ile Gly Arg His Asp Pro Thr Ala His Ala Glu Ile Met Ala Leu Arg 50 55 60 Gln Gly Gly Leu Val Met Gln Asn Tyr Arg Leu Ile Asp Ala Thr Leu 65 70 75 80 Tyr Val Thr Leu Glu Pro Cys Val Met Cys Ala Gly Ala Met Ile His 85 90 95 Ser Arg Ile Gly Arg Val Val Phe Gly Ala Arg Asp Ala Lys Thr Gly 100 105 110 Ala Ala Gly Ser Leu Met Asp Val Leu His His Pro Gly Met Asn His 115 120 125 Arg Val Glu Ile Thr Glu Gly Ile Leu Ala Asp Glu Cys Ala Ala Leu 130 135 140 Leu Ser Asp Phe Phe Arg Met Arg Arg Gln Glu Ile Lys Ala Gln Lys 145 150 155 160 Lys Ala Gln Ser Ser Thr Asp Ser Gly Gly Ser Ser Gly Gly Ser Ser 165 170 175 Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala Thr Pro Glu Ser Ser 180 185 190 Gly Gly Ser Ser Gly Gly Ser Ser Glu Val Glu Phe Ser His Glu Tyr 195 200 205 Trp Met Arg His Ala Leu Thr Leu Ala Lys Arg Ala Arg Asp Glu Arg 210 215 220 Glu Val Pro Val Gly Ala Val Leu Val Leu Asn Asn Arg Val Ile Gly 225 230 235 240 Glu Gly Trp Asn Arg Ala Ile Gly Leu His Asp Pro Thr Ala His Ala 245 250 255 Glu Ile Met Ala Leu Arg Gln Gly Gly Leu Val Met Gln Asn Tyr Arg 260 265 270 Leu Ile Asp Ala Thr Leu Tyr Val Thr Phe Glu Pro Cys Val Met Cys 275 280 285 Ala Gly Ala Met Ile His Ser Arg Ile Gly Arg Val Val Phe Gly Val 290 295 300 Arg Asn Ala Lys Thr Gly Ala Ala Gly Ser Leu Met Asp Val Leu His 305 310 315 320 Tyr Pro Gly Met Asn His Arg Val Glu Ile Thr Glu Gly Ile Leu Ala 325 330 335 Asp Glu Cys Ala Ala Leu Leu Cys Tyr Phe Phe Arg Met Pro Arg Gln 340 345 350 Val Phe Asn Ala Gln Lys Lys Ala Gln Ser Ser Thr Asp Ser Gly Gly 355 360 365 Ser Ser Gly Gly Ser Ser Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser 370 375 380 Ala Thr Pro Glu Ser Ser Gly Gly Ser Ser Gly Gly Ser Glu Ala Ser 385 390 395 400 Pro Ala Ser Gly Pro Arg His Leu Met Asp Pro His Ile Phe Thr Ser 405 410 415 Asn Phe Asn Asn Gly Ile Gly Arg His Lys Thr Tyr Leu Cys Tyr Glu 420 425 430 Val Glu Arg Leu Asp Asn Gly Thr Ser Val Lys Met Asp Gln His Arg 435 440 445 Gly Phe Leu His Asn Gln Ala Lys Asn Leu Leu Cys Gly Phe Tyr Gly 450 455 460 Arg His Ala Glu Leu Arg Phe Leu Asp Leu Val Pro Ser Leu Gln Leu 465 470 475 480 Asp Pro Ala Gln Ile Tyr Arg Val Thr Trp Phe Ile Ser Trp Ser Pro 485 490 495 Cys Phe Ser Trp Gly Cys Ala Gly Glu Val Arg Ala Phe Leu Gln Glu 500 505 510 Asn Thr His Val Arg Leu Arg Ile Phe Ala Ala Arg Ile Tyr Asp Tyr 515 520 525 Asp Pro Leu Tyr Lys Glu Ala Leu Gln Met Leu Arg Asp Ala Gly Ala 530 535 540 Gln Val Ser Ile Met Thr Tyr Asp Glu Phe Lys His Cys Trp Asp Thr 545 550 555 560 Phe Val Asp His Gln Gly Cys Pro Phe Gln Pro Trp Asp Gly Leu Asp 565 570 575 Glu His Ser Gln Ala Leu Ser Gly Arg Leu Arg Ala Ile Leu Gln Asn 580 585 590 Gln Gly Asn Ser Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala Thr 595 600 605 Pro Glu Ser Asp Lys Lys Tyr Ser Ile Gly Leu Ala Ile Gly Thr Asn 610 615 620 Ser Val Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys 625 630 635 640 Lys Phe Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn 645 650 655 Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr 660 665 670 Arg Leu Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg 675 680 685 Ile Cys Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp 690 695 700 Asp Ser Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp 705 710 715 720 Lys Lys His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val 725 730 735 Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu 740 745 750 Val Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu 755 760 765 Ala His Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu 770 775 780 Asn Pro Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln 785 790 795 800 Thr Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val 805 810 815 Asp Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu 820 825 830 Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe 835 840 845 Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser 850 855 860 Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr 865 870 875 880 Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr 885 890 895 Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu 900 905 910 Ser Asp Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser 915 920 925 Ala Ser Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu 930 935 940 Leu Lys Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile 945 950 955 960 Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly 965 970 975 Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys 980 985 990 Met Asp Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu 995 1000 1005 Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln 1010 1015 1020 Ile His Leu Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp 1025 1030 1035 Phe Tyr Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile 1040 1045 1050 Leu Thr Phe Arg Ile Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly 1055 1060 1065 Asn Ser Arg Phe Ala Trp Met Thr Arg Lys Ser Glu Glu Thr Ile 1070 1075 1080 Thr Pro Trp Asn Phe Glu Glu Val Val Asp Lys Gly Ala Ser Ala 1085 1090 1095 Gln Ser Phe Ile Glu Arg Met Thr Asn Phe Asp Lys Asn Leu Pro 1100 1105 1110 Asn Glu Lys Val Leu Pro Lys His Ser Leu Leu Tyr Glu Tyr Phe 1115 1120 1125 Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr Val Thr Glu Gly 1130 1135 1140 Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys Lys Ala Ile 1145 1150 1155 Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val Lys Gln 1160 1165 1170 Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp Ser Val 1175 1180 1185 Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly Thr 1190 1195 1200 Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp 1205 1210 1215 Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu 1220 1225 1230 Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr 1235 1240 1245 Tyr Ala His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg 1250 1255 1260 Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn 1265 1270 1275 Gly Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu 1280 1285 1290 Lys Ser Asp Gly Phe Ala Asn Arg Asn Phe Met Gln Leu Ile His 1295 1300 1305 Asp Asp Ser Leu Thr Phe Lys Glu Asp Ile Gln Lys Ala Gln Val 1310 1315 1320 Ser Gly Gln Gly Asp Ser Leu His Glu His Ile Ala Asn Leu Ala 1325 1330 1335 Gly Ser Pro Ala Ile Lys Lys Gly Ile Leu Gln Thr Val Lys Val 1340 1345 1350 Val Asp Glu Leu Val Lys Val Met Gly Arg His Lys Pro Glu Asn 1355 1360 1365 Ile Val Ile Glu Met Ala Arg Glu Asn Gln Thr Thr Gln Lys Gly 1370 1375 1380 Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile Glu Glu Gly Ile 1385 1390 1395 Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro Val Glu Asn 1400 1405 1410 Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu Gln Asn 1415 1420 1425 Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg Leu 1430 1435 1440 Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu Lys 1445 1450 1455 Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn 1460 1465 1470 Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys 1475 1480 1485 Met Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr 1490 1495 1500 Gln Arg Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu 1505 1510 1515 Ser Glu Leu Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu 1520 1525 1530 Three Arg Gln With Three Lys His Val Only Gln With Asp Ser Arg 1535 1540 1545 Met Asn Thr Lys Tyr Asp Glu Asn Asp Lys Leu Ile Arg Glu Val 1550 1555 1560 Lys Val Ile Thr Leu Lys Ser Lys Leu Val Ser Asp Phe Arg Lys 1565 1570 1575 Asp Phe Gln Phe Tyr Lys Val Arg Glu Ile Asn Asn Tyr His His 1580 1585 1590 Only His Asp Only Tyr Leu Asn Only Val Val Gly Thr Only Leu Ile 1595 1600 1605 Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe Val Tyr Gly Asp Tyr 1610 1615 1620 Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys Ser Glu Gln Glu 1625 1630 1635 Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr Ser Asn Ile Met 1640 1645 1650 Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala Asn Gly Glu Ile Arg 1655 1660 1665 Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr Gly Glu Ile Val 1670 1675 1680 Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys Val Leu Ser 1685 1690 1695 Met Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln Thr Gly 1700 1705 1710 Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp Lys 1715 1720 1725 Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly 1730 1735 1740 Phe Asp Ser Pro Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys 1745 1750 1755 Val Glu Lys Gly Lys Ser Lys Lys Leu Lys Ser Val Lys Glu Leu 1760 1765 1770 Leu Gly Ile Thr Ile Met Glu Arg Ser Ser Phe Glu Lys Asn Pro 1775 1780 1785 Ile Asp Phe Leu Glu Ala Lys Gly Tyr Lys Glu Val Lys Lys Asp 1790 1795 1800 Leu Ile Ile Lys Leu Pro Lys Tyr Ser Leu Phe Glu Leu Glu Asn 1805 1810 1815 Gly Arg Lys Arg Met Leu Ala Ser Ala Gly Glu Leu Gln Lys Gly 1820 1825 1830 Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val Asn Phe Leu Tyr Leu 1835 1840 1845 Ala Ser His Tyr Glu Lys Leu Lys Gly Ser Pro Glu Asp Asn Glu 1850 1855 1860 Gln Lys Gln Leu Phe Val Glu Gln His Lys His Tyr Leu Asp Glu 1865 1870 1875 Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg Val Ile Leu Ala 1880 1885 1890 Asp Ala Asn Leu Asp Lys Val Leu Ser Ala Tyr Asn Lys His Arg 1895 1900 1905 Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile Ile His Leu Phe 1910 1915 1920 Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys Tyr Phe Asp 1925 1930 1935 Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu Val Leu 1940 1945 1950 Asp Ala Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu Thr 1955 1960 1965 Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala 1970 1975 1980 Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Glu Phe Glu Gly 1985 1990 1995 Arg Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro Gly 2000 2005 2010 Pro Thr Asn Leu Ser Asp Ile Ile Glu Lys Glu Thr Gly Lys Gln 2015 2020 2025 Leu Val Ile Gln Glu Ser Ile Leu Met Leu Pro Glu Glu Val Glu 2030 2035 2040 Glu Val Ile Gly Asn Lys Pro Glu Ser Asp Ile Leu Val His Thr 2045 2050 2055 Ala Tyr Asp Glu Ser Thr Asp Glu Asn Val Met Leu Leu Thr Ser 2060 2065 2070 Asp Ala Pro Glu Tyr Lys Pro Trp Ala Leu Val Ile Gln Asp Ser 2075 2080 2085 Asn Gly Glu Asn Lys Ile Lys Met Leu Ser Gly Gly Ser Pro Lys 2090 2095 2100 Lys Lys Arg Lys Val Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly 2105 2110 2115 Asp Val Glu Glu Asn Pro Gly Pro Thr Asn Leu Ser Asp Ile Ile 2120 2125 2130 Glu Lys Glu Thr Gly Lys Gln Leu Val Ile Gln Glu Ser Ile Leu 2135 2140 2145 Met Leu Pro Glu Glu Val Glu Glu Val Ile Gly Asn Lys Pro Glu 2150 2155 2160 Ser Asp Ile Leu Val His Thr Ala Tyr Asp Glu Ser Thr Asp Glu 2165 2170 2175 Asn Val Met Leu Leu Thr Ser Asp Ala Pro Glu Tyr Lys Pro Trp 2180 2185 2190 Ala Leu Val Ile Gln Asp Ser Asn Gly Glu Asn Lys Ile Lys Met 2195 2200 2205 Leo Ser Gly Gly Ser Pro Lys Lys Lys Arg Lys Val 2210 2215 2220 <210> 17 <211> 1914 <212> PRT <213> Artificial Sequence <220> <223> STEME-5 <400> 17 Met Glu Ala Ser Pro Ala Ser Gly Pro Arg His Leu Met Asp Pro His 1 5 10 15 Ile Phe Thr Ser Asn Phe Asn Asn Gly Ile Gly Arg His Lys Thr Tyr 20 25 30 Leu Cys Tyr Glu Val Glu Arg Leu Asp Asn Gly Thr Ser Val Lys Met 35 40 45 Asp Gln His Arg Gly Phe Leu His Asn Gln Ala Lys Asn Leu Leu Cys 50 55 60 Gly Phe Tyr Gly Arg His Ala Glu Leu Arg Phe Leu Asp Leu Val Pro 65 70 75 80 Ser Leu Gln Leu Asp Pro Ala Gln Ile Tyr Arg Val Thr Trp Phe Ile 85 90 95 Ser Trp Ser Pro Cys Phe Ser Trp Gly Cys Ala Gly Glu Val Arg Ala 100 105 110 Phe Leu Gln Glu Asn Thr His Val Arg Leu Arg Ile Phe Ala Ala Arg 115 120 125 Ile Tyr Asp Tyr Asp Pro Leu Tyr Lys Glu Ala Leu Gln Met Leu Arg 130 135 140 Asp Ala Gly Ala Gln Val Ser Ile Met Thr Tyr Asp Glu Phe Lys His 145 150 155 160 Cys Trp Asp Thr Phe Val Asp His Gln Gly Cys Pro Phe Gln Pro Trp 165 170 175 Asp Gly Leu Asp Glu His Ser Gln Ala Leu Ser Gly Arg Leu Arg Ala 180 185 190 Ile Leu Gln Asn Gln Gly Asn Ser Gly Gly Ser Ser Gly Gly Ser Ser 195 200 205 Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala Thr Pro Glu Ser Ser 210 215 220 Gly Gly Ser Ser Gly Gly Ser Ser Glu Val Glu Phe Ser His Glu Tyr 225 230 235 240 Trp Met Arg His Ala Leu Thr Leu Ala Lys Arg Ala Arg Asp Glu Arg 245 250 255 Glu Val Pro Val Gly Ala Val Leu Val Leu Asn Asn Arg Val Ile Gly 260 265 270 Glu Gly Trp Asn Arg Ala Ile Gly Leu His Asp Pro Thr Ala His Ala 275 280 285 Glu Ile Met Ala Leu Arg Gln Gly Gly Leu Val Met Gln Asn Tyr Arg 290 295 300 Leu Ile Asp Ala Thr Leu Tyr Val Thr Phe Glu Pro Cys Val Met Cys 305 310 315 320 Ala Gly Ala Met Ile His Ser Arg Ile Gly Arg Val Val Phe Gly Val 325 330 335 Arg Asn Ala Lys Thr Gly Ala Ala Gly Ser Leu Met Asp Val Leu His 340 345 350 Tyr Pro Gly Met Asn His Arg Val Glu Ile Thr Glu Gly Ile Leu Ala 355 360 365 Asp Glu Cys Ala Ala Leu Leu Cys Tyr Phe Phe Arg Met Pro Arg Gln 370 375 380 Val Phe Asn Ala Gln Lys Lys Ala Gln Ser Ser Thr Asp Ser Gly Gly 385 390 395 400 Ser Ser Gly Gly Ser Ser Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser 405 410 415 Ala Thr Pro Glu Ser Ser Gly Gly Ser Ser Gly Gly Ser Leu Lys Asp 420 425 430 Lys Lys Tyr Ser Ile Gly Leu Ala Ile Gly Thr Asn Ser Val Gly Trp 435 440 445 Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe Lys Val 450 455 460 Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile Gly Ala 465 470 475 480 Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu Lys Arg 485 490 495 Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys Tyr Leu 500 505 510 Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser Phe Phe 515 520 525 His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys His Glu 530 535 540 Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr His Glu 545 550 555 560 Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp Ser Thr 565 570 575 Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His Met Ile 580 585 590 Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro Asp Asn 595 600 605 Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr Asn Gln 610 615 620 Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala Lys Ala 625 630 635 640 Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn Leu Ile 645 650 655 Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn Leu Ile 660 665 670 Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe Asp Leu 675 680 685 Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp Asp Asp 690 695 700 Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp Leu Phe 705 710 715 720 Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp Ile Leu 725 730 735 Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser Met Ile 740 745 750 Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys Ala Leu 755 760 765 Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe Asp Gln 770 775 780 Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser Gln Glu 785 790 795 800 Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp Gly Thr 805 810 815 Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg Lys Gln 820 825 830 Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu Gly Glu 835 840 845 Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe Leu Lys 850 855 860 Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile Pro Tyr 865 870 875 880 Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp Met Thr 885 890 895 Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu Val Val 900 905 910 Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn Phe 915 920 925 Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser Leu Leu 930 935 940 Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr Val 945 950 955 960 Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys Lys 965 970 975 Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val Lys 980 985 990 Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp Ser Val 995 1000 1005 Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly Thr 1010 1015 1020 Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp 1025 1030 1035 Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu 1040 1045 1050 Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr 1055 1060 1065 Tyr Ala His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg 1070 1075 1080 Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn 1085 1090 1095 Gly Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu 1100 1105 1110 Lys Ser Asp Gly Phe Ala Asn Arg Asn Phe Met Gln Leu Ile His 1115 1120 1125 Asp Asp Ser Leu Thr Phe Lys Glu Asp Ile Gln Lys Ala Gln Val 1130 1135 1140 Ser Gly Gln Gly Asp Ser Leu His Glu His Ile Ala Asn Leu Ala 1145 1150 1155 Gly Ser Pro Ala Ile Lys Lys Gly Ile Leu Gln Thr Val Lys Val 1160 1165 1170 Val Asp Glu Leu Val Lys Val Met Gly Arg His Lys Pro Glu Asn 1175 1180 1185 Ile Val Ile Glu Met Ala Arg Glu Asn Gln Thr Thr Gln Lys Gly 1190 1195 1200 Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile Glu Glu Gly Ile 1205 1210 1215 Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro Val Glu Asn 1220 1225 1230 Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu Gln Asn 1235 1240 1245 Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg Leu 1250 1255 1260 Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu Lys 1265 1270 1275 Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn 1280 1285 1290 Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys 1295 1300 1305 Met Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr 1310 1315 1320 Gln Arg Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu 1325 1330 1335 Ser Glu Leu Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu 1340 1345 1350 Thr Arg Gln Ile Thr Lys His Val Ala Gln Ile Leu Asp Ser Arg 1355 1360 1365 Met Asn Thr Lys Tyr Asp Glu Asn Asp Lys Leu Ile Arg Glu Val 1370 1375 1380 Lys Val Ile Thr Leu Lys Ser Lys Leu Val Ser Asp Phe Arg Lys 1385 1390 1395 Asp Phe Gln Phe Tyr Lys Val Arg Glu Ile Asn Asn Tyr His His 1400 1405 1410 Ala His Asp Ala Tyr Leu Asn Ala Val Val Gly Thr Ala Leu Ile 1415 1420 1425 Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe Val Tyr Gly Asp Tyr 1430 1435 1440 Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys Ser Glu Gln Glu 1445 1450 1455 Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr Ser Asn Ile Met 1460 1465 1470 Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala Asn Gly Glu Ile Arg 1475 1480 1485 Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr Gly Glu Ile Val 1490 1495 1500 Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys Val Leu Ser 1505 1510 1515 Met Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln Thr Gly 1520 1525 1530 Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp Lys 1535 1540 1545 Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly 1550 1555 1560 Phe Asp Ser Pro Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys 1565 1570 1575 Val Glu Lys Gly Lys Ser Lys Lys Leu Lys Ser Val Lys Glu Leu 1580 1585 1590 Leu Gly Ile Thr Ile Met Glu Arg Ser Ser Phe Glu Lys Asn Pro 1595 1600 1605 Ile Asp Phe Leu Glu Ala Lys Gly Tyr Lys Glu Val Lys Lys Asp 1610 1615 1620 Leu Ile Ile Lys Leu Pro Lys Tyr Ser Leu Phe Glu Leu Glu Asn 1625 1630 1635 Gly Arg Lys Arg Met Leu Ala Ser Ala Gly Glu Leu Gln Lys Gly 1640 1645 1650 Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val Asn Phe Leu Tyr Leu 1655 1660 1665 Ala Ser His Tyr Glu Lys Leu Lys Gly Ser Pro Glu Asp Asn Glu 1670 1675 1680 Gln Lys Gln Leu Phe Val Glu Gln His Lys His Tyr Leu Asp Glu 1685 1690 1695 Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg Val Ile Leu Ala 1700 1705 1710 Asp Ala Asn Leu Asp Lys Val Leu Ser Ala Tyr Asn Lys His Arg 1715 1720 1725 Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile Ile His Leu Phe 1730 1735 1740 Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys Tyr Phe Asp 1745 1750 1755 Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu Val Leu 1760 1765 1770 Asp Ala Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu Thr 1775 1780 1785 Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala 1790 1795 1800 Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Glu Phe Ser Gly 1805 1810 1815 Gly Ser Thr Asn Leu Ser Asp Ile Ile Glu Lys Glu Thr Gly Lys 1820 1825 1830 Gln Leu Val Ile Gln Glu Ser Ile Leu Met Leu Pro Glu Glu Val 1835 1840 1845 Glu Glu Val Ile Gly Asn Lys Pro Glu Ser Asp Ile Leu Val His 1850 1855 1860 Thr Ala Tyr Asp Glu Ser Thr Asp Glu Asn Val Met Leu Leu Thr 1865 1870 1875 Ser Asp Ala Pro Glu Tyr Lys Pro Trp Ala Leu Val Ile Gln Asp 1880 1885 1890 Ser Asn Gly Glu Asn Lys Ile Lys Met Leu Ser Gly Gly Ser Pro 1895 1900 1905 Lys Lys Lys Arg Lys Val 1910 <210> 18 <211> 2112 <212> PRT <213> Artificial Sequence <220> <223> STEME-6 <400> 18 Met Glu Ala Ser Pro Ala Ser Gly Pro Arg His Leu Met Asp Pro His 1 5 10 15 Ile Phe Thr Ser Asn Phe Asn Asn Gly Ile Gly Arg His Lys Thr Tyr 20 25 30 Leu Cys Tyr Glu Val Glu Arg Leu Asp Asn Gly Thr Ser Val Lys Met 35 40 45 Asp Gln His Arg Gly Phe Leu His Asn Gln Ala Lys Asn Leu Leu Cys 50 55 60 Gly Phe Tyr Gly Arg His Ala Glu Leu Arg Phe Leu Asp Leu Val Pro 65 70 75 80 Ser Leu Gln Leu Asp Pro Ala Gln Ile Tyr Arg Val Thr Trp Phe Ile 85 90 95 Ser Trp Ser Pro Cys Phe Ser Trp Gly Cys Ala Gly Glu Val Arg Ala 100 105 110 Phe Leu Gln Glu Asn Thr His Val Arg Leu Arg Ile Phe Ala Ala Arg 115 120 125 Ile Tyr Asp Tyr Asp Pro Leu Tyr Lys Glu Ala Leu Gln Met Leu Arg 130 135 140 Asp Ala Gly Ala Gln Val Ser Ile Met Thr Tyr Asp Glu Phe Lys His 145 150 155 160 Cys Trp Asp Thr Phe Val Asp His Gln Gly Cys Pro Phe Gln Pro Trp 165 170 175 Asp Gly Leu Asp Glu His Ser Gln Ala Leu Ser Gly Arg Leu Arg Ala 180 185 190 Ile Leu Gln Asn Gln Gly Asn Ser Gly Gly Ser Ser Gly Gly Ser Ser 195 200 205 Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala Thr Pro Glu Ser Ser 210 215 220 Gly Gly Ser Ser Gly Gly Ser Ser Glu Val Glu Phe Ser His Glu Tyr 225 230 235 240 Trp Met Arg His Ala Leu Thr Leu Ala Lys Arg Ala Arg Asp Glu Arg 245 250 255 Glu Val Pro Val Gly Ala Val Leu Val Leu Asn Asn Arg Val Ile Gly 260 265 270 Glu Gly Trp Asn Arg Ala Ile Gly Leu His Asp Pro Thr Ala His Ala 275 280 285 Glu Ile Met Ala Leu Arg Gln Gly Gly Leu Val Met Gln Asn Tyr Arg 290 295 300 Leu Ile Asp Ala Thr Leu Tyr Val Thr Phe Glu Pro Cys Val Met Cys 305 310 315 320 Ala Gly Ala Met Ile His Ser Arg Ile Gly Arg Val Val Phe Gly Val 325 330 335 Arg Asn Ala Lys Thr Gly Ala Ala Gly Ser Leu Met Asp Val Leu His 340 345 350 Tyr Pro Gly Met Asn His Arg Val Glu Ile Thr Glu Gly Ile Leu Ala 355 360 365 Asp Glu Cys Ala Ala Leu Leu Cys Tyr Phe Phe Arg Met Pro Arg Gln 370 375 380 Val Phe Asn Ala Gln Lys Lys Ala Gln Ser Ser Thr Asp Ser Gly Gly 385 390 395 400 Ser Ser Gly Gly Ser Ser Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser 405 410 415 Ala Thr Pro Glu Ser Ser Gly Gly Ser Ser Gly Gly Ser Ser Glu Val 420 425 430 Glu Phe Ser His Glu Tyr Trp Met Arg His Ala Leu Thr Leu Ala Lys 435 440 445 Arg Ala Arg Asp Glu Arg Glu Val Pro Val Gly Ala Val Leu Val Leu 450 455 460 Asn Asn Arg Val Ile Gly Glu Gly Trp Asn Arg Ala Ile Gly Leu His 465 470 475 480 Asp Pro Thr Ala His Ala Glu Ile Met Ala Leu Arg Gln Gly Gly Leu 485 490 495 Val Met Gln Asn Tyr Arg Leu Ile Asp Ala Thr Leu Tyr Val Thr Phe 500 505 510 Glu Pro Cys Val Met Cys Ala Gly Ala Met Ile His Ser Arg Ile Gly 515 520 525 Arg Val Val Phe Gly Val Arg Asn Ala Lys Thr Gly Ala Ala Gly Ser 530 535 540 Leu Met Asp Val Leu His Tyr Pro Gly Met Asn His Arg Val Glu Ile 545 550 555 560 Thr Glu Gly Ile Leu Ala Asp Glu Cys Ala Ala Leu Leu Cys Tyr Phe 565 570 575 Phe Arg Met Pro Arg Gln Val Phe Asn Ala Gln Lys Lys Ala Gln Ser 580 585 590 Ser Thr Asp Ser Gly Gly Ser Ser Gly Gly Ser Ser Gly Ser Glu Thr 595 600 605 Pro Gly Thr Ser Glu Ser Ala Thr Pro Glu Ser Ser Gly Gly Ser Ser 610 615 620 Gly Gly Ser Leu Lys Asp Lys Lys Tyr Ser Ile Gly Leu Ala Ile Gly 625 630 635 640 Thr Asn Ser Val Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro 645 650 655 Ser Lys Lys Phe Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys 660 665 670 Lys Asn Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu 675 680 685 Only Thr Arg Leu Lys Arg Thr Ala Arg Arg Tyr Thr Arg Arg Lys 690,695,700 Asn Arg With Cys Tyr Leu Gln Glu With Phe Serving Asn Glu Met Ala Lys 705 710 715 720 Val Asp Asp Ser Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu 725 730 735 Glu Asp Lys Lys His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp 740,745,750 Glu Val Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys 755,760,765 Lys Leu Val Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu 770,775,780 Ala Leu Ala His Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly 785,790,795,800 Asp Leu Asn Pro Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu 805 810 815 Val Gln Thr Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser 820 825 830 Gly Val Asp Ala Lys Allele Leu Ser Ala Arg Ser Leu Ser Arg 835 840 845 Arg Leu Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly 850 855 860 Leu Phe Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe 865 870 875 880 Lys Ser Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys 885 890 895 Asp Thr Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp 900 905 910 Gln Tyr Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile 915 920 925 Leu Leu Ser Asp Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro 930 935 940 Leu Ser Ala Ser Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu 945 950 955 960 Thr Leu Leu Lys Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys 965 970 975 Glu Ile Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp 980 985 990 Gly Gly Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu 995 1000 1005 Glu Lys Met Asp Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg 1010 1015 1020 Glu Asp Leu Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile 1025 1030 1035 Pro His Gln Ile His Leu Gly Glu Leu His Ala Ile Leu Arg Arg 1040 1045 1050 Gln Glu Asp Phe Tyr Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile 1055 1060 1065 Glu Lys Ile Leu Thr Phe Arg Ile Pro Tyr Tyr Val Gly Pro Leu 1070 1075 1080 Ala Arg Gly Asn Ser Arg Phe Ala Trp Met Thr Arg Lys Ser Glu 1085 1090 1095 Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu Val Val Asp Lys Gly 1100 1105 1110 Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn Phe Asp Lys 1115 1120 1125 Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser Leu Leu Tyr 1130 1135 1140 Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr Val 1145 1150 1155 Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys 1160 1165 1170 Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr 1175 1180 1185 Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe 1190 1195 1200 Asp Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser 1205 1210 1215 Leu Gly Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp 1220 1225 1230 Phe Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val 1235 1240 1245 Leu Thr Leu Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg 1250 1255 1260 Leu Lys Thr Tyr Ala His Leu Phe Asp Asp Lys Val Met Lys Gln 1265 1270 1275 Leu Lys Arg Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys 1280 1285 1290 Leu Ile Asn Gly Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu 1295 1300 1305 Asp Phe Leu Lys Ser Asp Gly Phe Ala Asn Arg Asn Phe Met Gln 1310 1315 1320 Leu Ile His Asp Asp Ser Leu Thr Phe Lys Glu Asp Ile Gln Lys 1325 1330 1335 Ala Gln Val Ser Gly Gln Gly Asp Ser Leu His Glu His Ile Ala 1340 1345 1350 Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly Ile Leu Gln Thr 1355 1360 1365 Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly Arg His Lys 1370 1375 1380 Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln Thr Thr 1385 1390 1395 Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile Glu 1400 1405 1410 Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro 1415 1420 1425 Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr 1430 1435 1440 Leu Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile 1445 1450 1455 Asn Arg Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser 1460 1465 1470 Phe Leu Lys Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser 1475 1480 1485 Asp Lys Asn Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val 1490 1495 1500 Val Lys Lys Met Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys 1505 1510 1515 Leu Ile Thr Gln Arg Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg 1520 1525 1530 Gly Gly Leu Ser Glu Leu Asp Lys Ala Gly Phe Ile Lys Arg Gln 1535 1540 1545 Leu Val Glu Thr Arg Gln Ile Thr Lys His Val Ala Gln Ile Leu 1550 1555 1560 Asp Ser Arg Met Asn Thr Lys Tyr Asp Glu Asn Asp Lys Leu Ile 1565 1570 1575 Arg Glu Val Lys Val Ile Thr Leu Lys Ser Lys Leu Val Ser Asp 1580 1585 1590 Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg Glu Ile Asn Asn 1595 1600 1605 Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val Val Gly Thr 1610 1615 1620 Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe Val Tyr 1625 1630 1635 Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys Ser 1640 1645 1650 Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr Ser 1655 1660 1665 Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala Asn Gly 1670 1675 1680 Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr Gly 1685 1690 1695 Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys 1700 1705 1710 Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val 1715 1720 1725 Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn 1730 1735 1740 Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro Lys Lys 1745 1750 1755 Tyr Gly Gly Phe Asp Ser Pro Thr Val Ala Tyr Ser Val Leu Val 1760 1765 1770 Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu Lys Ser Val 1775 1780 1785 Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser Ser Phe Glu 1790 1795 1800 Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr Lys Glu Val 1805 1810 1815 Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser Leu Phe Glu 1820 1825 1830 Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala Gly Glu Leu 1835 1840 1845 Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val Asn Phe 1850 1855 1860 Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser Pro Glu 1865 1870 1875 Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys His Tyr 1880 1885 1890 Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg Val 1895 1900 1905 Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala Tyr Asn 1910 1915 1920 Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile Ile 1925 1930 1935 His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys 1940 1945 1950 Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys 1955 1960 1965 Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr Gly Leu 1970 1975 1980 Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp Lys Arg 1985 1990 1995 Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Glu 2000 2005 2010 Phe Ser Gly Gly Ser Thr Asn Leu Ser Asp Ile Ile Glu Lys Glu 2015 2020 2025 Thr Gly Lys Gln Leu Val Ile Gln Glu Ser Ile Leu Met Leu Pro 2030 2035 2040 Glu Glu Val Glu Glu Val Ile Gly Asn Lys Pro Glu Ser Asp Ile 2045 2050 2055 Leu Val His Thr Ala Tyr Asp Glu Ser Thr Asp Glu Asn Val Met 2060 2065 2070 Leu Leu Thr Ser Asp Ala Pro Glu Tyr Lys Pro Trp Ala Leu Val 2075 2080 2085 Ile Gln Asp Ser Asn Gly Glu Asn Lys Ile Lys Met Leu Ser Gly 2090 2095 2100 Gly Ser Pro Lys Lys Lys Arg Lys Val 2105 2110 <210> 19 <211> 2127 <212> PRT <213> Artificial Sequence <220> <223> STEME-NG <400> 19 Met Glu Ala Ser Pro Ala Ser Gly Pro Arg His Leu Met Asp Pro His 1 5 10 15 Ile Phe Thr Ser Asn Phe Asn Asn Gly Ile Gly Arg His Lys Thr Tyr 20 25 30 Leu Cys Tyr Glu Val Glu Arg Leu Asp Asn Gly Thr Ser Val Lys Met 35 40 45 Asp Gln His Arg Gly Phe Leu His Asn Gln Ala Lys Asn Leu Leu Cys 50 55 60 Gly Phe Tyr Gly Arg His Ala Glu Leu Arg Phe Leu Asp Leu Val Pro 65 70 75 80 Ser Leu Gln Leu Asp Pro Ala Gln Ile Tyr Arg Val Thr Trp Phe Ile 85 90 95 Ser Trp Ser Pro Cys Phe Ser Trp Gly Cys Ala Gly Glu Val Arg Ala 100 105 110 Phe Leu Gln Glu Asn Thr His Val Arg Leu Arg Ile Phe Ala Ala Arg 115 120 125 Ile Tyr Asp Tyr Asp Pro Leu Tyr Lys Glu Ala Leu Gln Met Leu Arg 130 135 140 Asp Ala Gly Ala Gln Val Ser Ile Met Thr Tyr Asp Glu Phe Lys His 145 150 155 160 Cys Trp Asp Thr Phe Val Asp His Gln Gly Cys Pro Phe Gln Pro Trp 165 170 175 Asp Gly Leu Asp Glu His Ser Gln Ala Leu Ser Gly Arg Leu Arg Ala 180 185 190 Ile Leu Gln Asn Gln Gly Asn Ser Gly Ser Glu Thr Pro Gly Thr Ser 195 200 205 Glu Ser Ala Thr Pro Glu Ser Ser Gly Gly Ser Ser Gly Gly Ser Ser 210 215 220 Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala Thr Pro Glu Ser Ser 225 230 235 240 Gly Gly Ser Ser Gly Gly Ser Ser Glu Val Glu Phe Ser His Glu Tyr 245 250 255 Trp Met Arg His Ala Leu Thr Leu Ala Lys Arg Ala Trp Asp Glu Arg 260 265 270 Glu Val Pro Val Gly Ala Val Leu Val His Asn Asn Arg Val Ile Gly 275 280 285 Glu Gly Trp Asn Arg Pro Ile Gly Arg His Asp Pro Thr Ala His Ala 290 295 300 Glu Ile Met Ala Leu Arg Gln Gly Gly Leu Val Met Gln Asn Tyr Arg 305 310 315 320 Leu Ile Asp Ala Thr Leu Tyr Val Thr Leu Glu Pro Cys Val Met Cys 325 330 335 Ala Gly Ala Met Ile His Ser Arg Ile Gly Arg Val Val Phe Gly Ala 340 345 350 Arg Asp Ala Lys Thr Gly Ala Ala Gly Ser Leu Met Asp Val Leu His 355 360 365 His Pro Gly Met Asn His Arg Val Glu Ile Thr Glu Gly Ile Leu Ala 370 375 380 Asp Glu Cys Ala Ala Leu Leu Ser Asp Phe Phe Arg Met Arg Arg Gln 385 390 395 400 Glu Ile Lys Ala Gln Lys Lys Ala Gln Ser Ser Thr Asp Ser Gly Gly 405 410 415 Ser Ser Gly Gly Ser Ser Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser 420 425 430 Ala Thr Pro Glu Ser Ser Gly Gly Ser Ser Gly Gly Ser Ser Glu Val 435 440 445 Glu Phe Ser His Glu Tyr Trp Met Arg His Ala Leu Thr Leu Ala Lys 450 455 460 Arg Ala Arg Asp Glu Arg Glu Val Pro Val Gly Ala Val Leu Val Leu 465 470 475 480 Asn Asn Arg Val Ile Gly Glu Gly Trp Asn Arg Ala Ile Gly Leu His 485 490 495 Asp Pro Thr Ala His Ala Glu Ile Met Ala Leu Arg Gln Gly Gly Leu 500 505 510 Val Met Gln Asn Tyr Arg Leu Ile Asp Ala Thr Leu Tyr Val Thr Phe 515 520 525 Glu Pro Cys Val Met Cys Ala Gly Ala Met Ile His Ser Arg Ile Gly 530 535 540 Arg Val Val Phe Gly Val Arg Asn Ala Lys Thr Gly Ala Ala Gly Ser 545 550 555 560 Leu Met Asp Val Leu His Tyr Pro Gly Met Asn His Arg Val Glu Ile 565 570 575 Thr Glu Gly Ile Leu Ala Asp Glu Cys Ala Ala Leu Leu Cys Tyr Phe 580 585 590 Phe Arg Met Pro Arg Gln Val Phe Asn Ala Gln Lys Lys Ala Gln Ser 595 600 605 Ser Thr Asp Ser Gly Gly Ser Ser Gly Gly Ser Ser Gly Ser Glu Thr 610 615 620 Pro Gly Thr Ser Glu Ser Ala Thr Pro Glu Ser Ser Gly Gly Ser Ser 625 630 635 640 Gly Gly Ser Asp Lys Lys Tyr Ser Ile Gly Leu Ala Ile Gly Thr Asn 645 650 655 Ser Val Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys 660 665 670 Lys Phe Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn 675 680 685 Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr 690,695,700 Arg Leu Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg 705 710 715 720 Cys Tyr Leu Gln Glu Phe Is Associated With Glue Met Ala Asp 725 730 735 Asp Ser Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp 740,745,750 Lys Lys His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val 755,760,765 Only Tyr His Glu Lys Pro Thr And Tyr His Leu Arg Lys Leu 770,775,780 Val Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu 785,790,795,800 His Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu 805 810 815 Asn Pro Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln 820 825 830 Thr Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val 835 840 845 Asp Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu 850 855 860 Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe 865 870 875 880 Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser 885 890 895 Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr 900 905 910 Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr 915 920 925 Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu 930 935 940 Ser Asp Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser 945 950 955 960 Ala Ser Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu 965 970 975 Leu Lys Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile 980 985 990 Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly 995 1000 1005 Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu 1010 1015 1020 Lys Met Asp Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu 1025 1030 1035 Asp Leu Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro 1040 1045 1050 His Gln Ile His Leu Gly Glu Leu His Ala Ile Leu Arg Arg Gln 1055 1060 1065 Glu Asp Phe Tyr Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu 1070 1075 1080 Lys Ile Leu Thr Phe Arg Ile Pro Tyr Tyr Val Gly Pro Leu Ala 1085 1090 1095 Arg Gly Asn Ser Arg Phe Ala Trp Met Thr Arg Lys Ser Glu Glu 1100 1105 1110 Thr Ile Thr Pro Trp Asn Phe Glu Glu Val Val Asp Lys Gly Ala 1115 1120 1125 Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn Phe Asp Lys Asn 1130 1135 1140 Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser Leu Leu Tyr Glu 1145 1150 1155 Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr Val Thr 1160 1165 1170 Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys Lys 1175 1180 1185 Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val 1190 1195 1200 Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp 1205 1210 1215 Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu 1220 1225 1230 Gly Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe 1235 1240 1245 Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu 1250 1255 1260 Thr Leu Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu 1265 1270 1275 Lys Thr Tyr Ala His Leu Phe Asp Asp Lys Val Met Lys Gln Leu 1280 1285 1290 Lys Arg Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu 1295 1300 1305 Ile Asn Gly Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp 1310 1315 1320 Phe Leu Lys Ser Asp Gly Phe Ala Asn Arg Asn Phe Met Gln Leu 1325 1330 1335 Ile His Asp Asp Ser Leu Thr Phe Lys Glu Asp Ile Gln Lys Ala 1340 1345 1350 Gln Val Ser Gly Gln Gly Asp Ser Leu His Glu His Ile Ala Asn 1355 1360 1365 Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly Ile Leu Gln Thr Val 1370 1375 1380 Lys Val Val Asp Glu Leu Val Lys Val Met Gly Arg His Lys Pro 1385 1390 1395 Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln Thr Thr Gln 1400 1405 1410 Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile Glu Glu 1415 1420 1425 Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro Val 1430 1435 1440 Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu 1445 1450 1455 Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn 1460 1465 1470 Arg Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe 1475 1480 1485 Leu Lys Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp 1490 1495 1500 Lys Asn Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val 1505 1510 1515 Lys Lys Met Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu 1520 1525 1530 Ile Thr Gln Arg Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly 1535 1540 1545 Gly Leu Ser Glu Leu Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu 1550 1555 1560 Val Glu Thr Arg Gln Ile Thr Lys His Val Ala Gln Ile Leu Asp 1565 1570 1575 Ser Arg Met Asn Thr Lys Tyr Asp Glu Asn Asp Lys Leu Ile Arg 1580 1585 1590 Glu Val Lys Val Ile Thr Leu Lys Ser Lys Leu Val Ser Asp Phe 1595 1600 1605 Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg Glu Ile Asn Asn Tyr 1610 1615 1620 His His Ala His Asp Ala Tyr Leu Asn Ala Val Val Gly Thr Ala 1625 1630 1635 Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe Val Tyr Gly 1640 1645 1650 Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys Ser Glu 1655 1660 1665 Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr Ser Asn 1670 1675 1680 Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala Asn Gly Glu 1685 1690 1695 Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr Gly Glu 1700 1705 1710 Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys Val 1715 1720 1725 Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln 1730 1735 1740 Thr Gly Gly Phe Ser Lys Glu Ser Ile Arg Pro Lys Arg Asn Ser 1745 1750 1755 Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr 1760 1765 1770 Gly Gly Phe Val Ser Pro Thr Val Ala Tyr Ser Val Leu Val Val 1775 1780 1785 Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu Lys Ser Val Lys 1790 1795 1800 Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser Ser Phe Glu Lys 1805 1810 1815 Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr Lys Glu Val Lys 1820 1825 1830 Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr Ser Leu Phe Glu Leu 1835 1840 1845 Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala Arg Phe Leu Gln 1850 1855 1860 Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val Asn Phe Leu 1865 1870 1875 Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser Pro Glu Asp 1880 1885 1890 Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys His Tyr Leu 1895 1900 1905 Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg Val Ile 1910 1915 1920 Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala Tyr Asn Lys 1925 1930 1935 His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile Ile His 1940 1945 1950 Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Arg Ala Phe Lys Tyr 1955 1960 1965 Phe Asp Thr Thr Ile Asp Arg Lys Val Tyr Arg Ser Thr Lys Glu 1970 1975 1980 Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr 1985 1990 1995 Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro 2000 2005 2010 Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys Thr Arg 2015 2020 2025 Asp Ser Gly Gly Ser Thr Asn Leu Ser Asp Ile Ile Glu Lys Glu 2030 2035 2040 Thr Gly Lys Gln Leu Val Ile Gln Glu Ser Ile Leu Met Leu Pro 2045 2050 2055 Glu Glu Val Glu Glu Val Ile Gly Asn Lys Pro Glu Ser Asp Ile 2060 2065 2070 Leu Val His Thr Ala Tyr Asp Glu Ser Thr Asp Glu Asn Val Met 2075 2080 2085 Ser Asp Ala Pro Glu Tyr Lys Pro Trp Ala Leu Val 2090 2095 2100 The Gln Asp Ser Asn Gly Glu Asn Lys Ile Lys Met Ser Gly 2105 2110 2115 Gly Ser Pro Lys Lys Arg Lys Val 2120 2125 <210> 20 <211> 6381 <212> DNA <213> Artificial Sequence <220> <223> STEME-1 (APOBEC3A-48aa linker-ecTadA-32aa linker-ecTadA7.10-32aa linker-nCas9 (D10A)-NLS-UGI-NLS) <400> 20 atggaggcca gcccggctag cggcccagg catctcatgg acccgcacat cttcaccagc 60 aacttcaaca acggcatcgg caggcacaag acctacttgt gctacgaggt ggagaggctc 120 vakaacggaa cctccgtgaa gatggaccaa cacaggggt tcctccacaa ccaagccaag 180 aacctcctct gcggcttcta cggcaggcac gccgagttga ggttcctcga cttggtgcca 240 tccctccaac tcgatccagc ccaaatctac cgcgtgacct ggttcatctc ctggtcccca 300 tgcttctcct ggggttgcgc cggcgaggtt cgggctttcc tccaagaaaa cacccacgtc 360 cgcctccgca tttcgccgc caggatctat gattacgacc ctctctacaa ggaggccctc 420 cagatgctgc gggacgccgg tgctcaggtg agtatcatga cctacgacga gttcaagcac 480 tgctgggaca ccttcgttga ccaccagggc tgcccattcc aaccatggga cggtctggat 540 gaacacagcc aagccttgtc cggcaggctc cgggccatcc tccaaaacca ggggaactcc 600 gggagcgaga cgccaggcac ctccgagtcg gccaccccag aatcttccgg cggatcttct 660 ggaggatcta gcggctccga gacaccagga acatccgaat ccgctacacc agagtcttct 720 ggaggatcta gcggaggatc ttccgaggtg gagttctctc acgagtattg gatgaggcac 780 gctcttacac ttgctaagag agcttgggac gaaagagaag tgccagttgg cgccgttctt 840 gtgcataata atagggtgat cggcgagggt tggaatagac caattggaag gcatgatcca 900 acagctcacg cagagattat ggctctcaga caaggcggcc tcgttatgca gaactacagg 960 ctcattgacg ctacactcta cgtgacactc gaaccttgcg ttatgtgcgc cggagctatg 1020 attcattcta ggattggcag ggtcgtgttt ggagctaggg acgctaaaac aggagccgcc 1080 ggatctctta tggacgtgtt gcatcatcca ggcatgaacc atagggtgga gattacagag 1140 ggcattcttg cagacgagtg cgctgctctt ctttccgatt tcttcaggat gagaaggcag 1200 gagattaagg cccagaagaa ggctcagtct tctacagata gcggaggatc ttccggagga 1260 tctagcggct ccgagacacc aggaacatcc gaaagcgcta caccagaatc tagcggaggc 1320 tcttccggag gatcttctga agtggagttc tcccacgagt attggatgag gcacgctctt 1380 acacttgcta aaagggctag ggacgaaagg gaagttccag ttggagctgt tctcgtgctc 1440 aataacaggg tgattggcga gggttggaat agagccattg gactccatga tccaacagct 1500 cacgcagaga ttatggctct tagacaaggc ggcctcgtta tgcagaatta cagactcatc 1560 gacgccacac tctacgttac cttcgaacct tgcgttatgt gcgccggagc tatgatccat 1620 tctaggattg gcagggtcgt gttcggcgtt agaaacgcta agacaggagc tgcaggctct 1680 cttatggacg ttcttcatta cccaggcatg aatcatagag tggagatcac agaaggcatt 1740 cttgcagcg agtgcgcagc tctcctttgc tatttttca ggatgccgag gcaagttttc 1800 aacgctcaga agaaggccca gtcttctaca gattccggcg gatcttctgg aggatctagc 1860 ggctccgaga caccaggaac atccgaatcc gctacaccag agtcttctgg aggatctagc 1920 ggaggatctg aagaagga ctcgatcggc ctcgccattg ggactaactc tgttggctgg 1980 gccgtgatca ccgacgagat caaggtgccc tcaaagaagt tcaaggtcct gggcaacacc 2040 gatcggcatt ccatcaagaa gaatctcatt ggcgctctcc tgttcgacag cggcgagacg 2100 gctgaggcta cgcggctcaa gcgcaccgcc cgcaggcggt acacgcgcag gaagaatcgc 2160 atctgctacc tgcaggagat tttctccaac gagatggcga aggttgacga ttctttcttc 2220 cagaggctgg aggagtcatt cctcgtggag gattaaga agcacgagcg gcatccaatc 2280 ttcggcaaca ttgtcgacga ggttgcctac cacgagaagt accctacgat ctaccatctg 2340 cggaagaagc tcgtggactc cacagataag gcggacctcc gcctgatcta cctcgctctg 2400 gcccacatga ttaagttcag gggccattc ctgatcgagg gggatctcaa cccggacaat 2460 agcgatgttg acaagctgtt catccagctc gtgcagacgt acaaccagct cttcgaggag 2520 aaccccatta atgcgtcagg cgtcgacgcg aaggctatcc tgtccgctag gctctcgaag 2580 tctcggcgcc tcgagaacct gatcgcccag ctgccgggcg agaagaagaa cggcctgttc 2640 gggaatctca ttgcgctcag cctggggctc acgcccaact tcaagtcgaa ttcgatctc 2700 gctgaggacg ccaagctgca gctctccaag gacacatacg acgatgacct ggataacctc 2760 ctggcccaga tcggcgatca gtacgcggac ctgttcctcg ctgccaagaa tctgtcggac 2820 gccatcctcc tgtctgatat tctcagggtg aaccgaga ttacgaaggc tccgctctca 2880 gcctccatga tcaagcgcta cgacgagcac catcaggatc tgaccctcct gaaggcgctg 2940 gtcaggcagc agctccccga gaagtacaag gagatctttct tcgatcagc gaagaacggc 3000 tacgctgggt acattgacgg cggggcctct caggaggagt tctacaagtt catcaagccg 3060 attctggaga agatggacgg cacggaggag ctgctggtga agctcaatcg cgaggacctc 3120 ctgaggaagc agcggacatt cgataacggc agcatcccac accagattca tctcggggag 3180 ctgcacgcta tcctgaggag gcaggagc ttctaccctt tcctcaagga taaccgcgag 3240 aagatcgaga agattctgac tttcaggatc ccgtactacg tcggcccact cgctaggggc 3300 aactcccgct tcgcttggat gacccgcaag tcagaggaga cgatcacgcc gtggaacttc 3360 gaggaggtgg tcgacaaggg cgctagcgct cagtcgttca tcgagaggat gacgaatttc 3420 gacaagaacc tgccaaatga gaaggtgctc cctaagcact cgctcctgta cgagtacttc 3480 acagtctaca acgagctgac taaggtgaag tatgtgaccg agggcatgag gaagccggct 3540 ttcctgtctg gggagcagaa gaaggccatc gtggacctcc tgttcaagac caaccggaag 3600 gtcacggtta agcagctcaa ggaggactac ttcaagaaga ttgagtgctt cgattcggtc 3660 gagatctctg gcgttgagga ccgcttcaac gcctccctgg ggacctacca cgatctcctg 3720 aagatcatta aggataagga cttcctggac aacgaggaga atgaggatat cctcgaggac 3780 attgtgctga cactcactct gttcgaggac cgggagatga tcgaggagcg cctgagact 3840 tacgcccatc tcttcgatga caggtcatg aagcagctca agaggagg gtacaccggc 3900 tgggggaggc tgagcaggaa gctcatcaac ggcattcggg acagcagtc cgggagacg 3960 atcctcgact tcctgaagag cgatggcttc gcgaaccgca atttcatgca gctgattcac 4020 gatgacagcc tcacattca ggaggatatc cagaaggctc aggtgagcgg ccagggggac 4080 tcgctgcacg agcatatcgc gaacctcgct ggctcgccag ctatcaagaa ggggattctg 4140 cagaccgtga aggttgtgga cgagctggtg aaggtcatgg gcaggcacaa gcctgagaac 4200 atcgtcattg agatggcccg ggagaatcag accacgcaga agggccagaa gaactcacgc 4260 gagaggatga agaggatcga ggaggcatt aggagctgg ggtcccagat cctcaggag 4320 cacccggtgg agaacacgca gctgcagaat gagaagctct acctgtacta cctccagaat 4380 ggccgcgata tgtagtgga ccaggagctg gatattaaca ggctcagcga ttacgacgtc 4440 gatcatatcg ttccacagtc attcctgaag gatgactcca ttgacaacaa ggtcctcacc 4500 aggtcggaca agaaccgggg caagtctgat aatgttcctt cagaggaggt cgttaagaag 4560 atgaagaact actggcgcca gctcctgaat gccaagctga tcacgcagcg gaagttcgat 4620 aacctcacaa aggctgagag gggcgggctc tctgagctgg acaaggcggg cttcatcaag 4680 aggcagctgg tcgagacacg gcagatcact aagcacgttg cgcagattct cgactcacgg 4740 atgaacacta agtacgatga gaatgacaag ctgatccgcg aggtgaaggt catcaccctg 4800 aagtcaaagc tcgtctccga cttcaggaag gatttccagt tctacaaggt tcgggagatc 4860 aacaattacc accatgccca tgacgcgtac ctgaacgcgg tggtcggcac agctctgatc 4920 aagaagtacc caaagctcga gagcgagttc gtgtacgggg actacaaggt ttacgatgtg 4980 aggaagatga tcgccaagtc ggagcaggag attggcaagg ctaccgccaa gtacttcttc 5040 tactctaaca ttatgaattt cttcaagaca gagatcactc tggccaatgg cgagatccgg 5100 aagcgccccc tcatcgagac gaacggcgag acgggggaga tcgtgtggga caagggcagg 5160 gatttcgcga ccgtcaggaa ggttctctcc atgccacaag tgaatatcgt caagaagaca 5220 gaggtccaga ctggcgggtt ctctaaggag tcaattctgc ctaagcgaa cagggacaag 5280 5340 gtggcctact cggtcctggt tgtggcgaag gttgagaagg gcaagtccaa gaagctcaag 5400 agcgtgaagg agctgctggg gatcacgatt atggagcgct ccagcttcga gaagaacccg 5460 atcgatttcc tggaggcgaa gggctacaag gaggtgaaga aggacctgat cattaagctc 5520 cccaagtact cactcttcga gctggagaac ggcaggaagc ggatgctggc ttccgctggc 5580 gagctgcaga agggaacga gctggctctg ccgtccaagt atgtgaactt cctctacctg 5640 gcctccact acgagaagct caagggcagc cccgaggaca agagcagaa gcagctgttc 5700 gtcgagcagc acaagcatta cctcgacgag atcattgagc agatttccga gttctccaag 5760 cgcgtgatcc tggccgacgc gaatctggat aaggtcctct ccgcgtacaa caagcaccgc 5820 gacaagccaa tcagggagca ggctgagaat atcattcatc tcttcaccct gacgaacctc 5880 ggcgcccctg ctgctttcaa gtacttcgac acaactatcg atcgcaagag gtacacaagc 5940 actaaggagg tcctggacgc gacctcatc caccagtcga taccggcct ctacgagacg 6000 cgcatcgacc tgtctcagct cgggggcgac aagcggccag cggcgacgaa gaggcgggg 6060 caggcgaaga agagaagga attctccggc ggcagcacca acctgtccga catcatcgag 6120 aaggagacgg gcaagcact cgtgatccag gagagcatcc tcatgctgcc agaggaggtg 6180 gaggaggtca tcggcaaca gccagagtcc gatacctgg tgcacaccgc ctacgacgag 6240 tccaccgacg agaacgtcat gctcctgacc agcgacgccc cagagtaca gccatgggcc 6300 ctcgtcatcc aggacagca cggggagaac aagatcaaga tgctgtcggg ggggagccca 6360 aaagaagc ggaggtgta g 6381 <210> 21 <211> 6291 <212> DNA <213> Artificial Sequence <220> <223> STEME-2 (ecTadA-32aa linker-ecTadA7.10-32aa linker-APOBEC3A-16aa linker-nCas9 (D10A)-NLS-UGI-NLS) <400> 21 atgtccgagg tggattctc tcacgagtat tggatgaggc acgctcttac acttgctaag 60 agagcttggg acgaaagaga agtgccagtt ggcgccgttc ttgtgcataa tatagggtg 120 atcggcgagg gttggaatag accaattgga aggcatgatc caacagctca cgcagagatt 180 atggctctca gacaaggcgg cctcgttatg cagaactaca ggctcattga cgctacactc 240 tacgtgacac tcgaaccttg cgttatgtgc gccggagcta tgattcattc taggattggc 300 agggtcgtgt ttggagctag ggacgctaaa acaggagccg ccggatctct tatggacgtg 360 ttgcatcatc caggcatgaa ccatagggtg gagattacag agggcattct tgcagacgag 420 tgcgctgctc ttctttccga tttcttcagg atgagaaggc aggagattaa ggcccagaag 480 aaggctcagt cttctacaga tagcggagga tcttccggag gatctagcgg ctccgagaca 540 ccaggaacat ccgaaagcgc tacaccagaa tctagcggag gctcttccgg aggatcttct 600 gaagtggagt tctcccacga gtattggatg aggcacgctc ttacacttgc taaaagggct 660 agggacgaaa gggaagttcc agttggagct gttctcgtgc tcaataacag ggtgattggc 720 gagggttgga atagagccat tggactccat gatccaacag ctcacgcaga gattatggct 780 cttagacaag gcggcctcgt tatgcagaat tacagactca tcgacgccac actctacgtt 840 accttcgaac cttgcgttat gtgcgccgga gctatgatcc attctaggat tggcagggtc 900 gtgttcggcg ttagaaacgc taagacagga gctgcaggct ctcttatgga cgttcttcat 960 tacccaggca tgaatcatag agtggagatc acagaaggca ttcttgcaga cgagtgcgca 1020 gctctccttt gctatttctt caggatgccg aggcaagttt tcaacgctca gaagaaggcc 1080 cagtcttcta cagattccgg cggatcttct ggaggatcta gcggctccga gacaccagga 1140 acatccgaat ccgctacacc agagtcttct ggaggatcta gcggaggatc tgaggccagc 1200 ccggctagcg gcccaaggca tctcatggac ccgcacatct tcaccagcaa cttcaacaac 1260 ggcatcggca ggcacaagac ctacttgtgc tacgaggtgg agaggctcga caacggaacc 1320 tccgtgaaga tggaccaaca cagggggttc ctccacaacc aagccaagaa cctcctctgc 1380 ggcttctacg gcaggcacgc cgagttgagg ttcctcgact tggtgccatc cctccaactc 1440 gatccagccc aaatctaccg cgtgacctgg ttcatctcct ggtccccatg cttctcctgg 1500 ggttgcgccg gcgaggttcg ggctttcctc caagaaaaca cccacgtccg cctccgcatt 1560 ttcgccgcca ggatctatga ttacgaccct ctctacaagg aggccctcca gatgctgcgg 1620 gacgccggtg ctcaggtgag tatcatgacc tacgacgagt tcaagcactg ctgggacacc 1680 ttcgttgacc accagggctg cccattccaa ccatgggacg gtctggatga acacagccaa 1740 gccttgtccg gcaggctccg ggccatcctc caaaaccagg ggaactccgg gagcgagacg 1800 ccaggcacct ccgagtcggc caccccagaa tctcttaagg acaagaagta ctcgatcggc 1860 ctcgccattg ggactaactc tgttggctgg gccgtgatca ccgacgagta caaggtgccc 1920 tcaaagagt tcaaggtcct gggcaacacc gatcggcatt ccatcaagaa gaatctcatt 1980 ggcgctctcc tgttcgacag cggcgagacg gctgaggcta cgcggctcaa gcgcaccgcc 2040 cgcaggcggt acacgcgcag gaagaatcgc atctgctacc tgcaggagat tttctccaac 2100 gagatggcga aggttgacga ttctttcttc cacaggctgg aggagtcatt cctcgtggag 2160 gaggataaga agcacgagcg gcatccaatc ttcggcaaca ttgtcgacga ggttgcctac 2220 cacgagaagt accctacgat ctaccatctg cggaagaagc tcgtggactc cacagataag 2280 gcggacctcc gcctgatcta cctcgctctg gcccacatga ttaagttcag gggccatttc 2340 ctgatcgagg gggatctcaa cccggacaat agcgatgttg acaagctgtt catccagctc 2400 gtgcagacgt aaaccagct cttcgaggag aaccccatta atgcgtcagg cgtcgacgcg 2460 aaggctatcc tgtccgctag gctctcgaag tctcggcgcc tcgagaacct gatcgcccag 2520 ctgccgggcg yours cggcctgttc gggaatctca ttgcgctcag cctggggctc 2580 acgcccaact tcaagtcgaa tttcgatctc gctgaggacg ccaagctgca gctctccaag 2640 gacacatacg acgatgacct ggataacctc ctggcccaga tcggcgatca gtacgcggac 2700 ctgttcctcg ctgccaagaa tctgtcggac gccatcctcc tgtctgatat tctcagggtg 2760 aacaccgaga ttacgaaggc tccgctctca gcctccatga tcaagcgcta cgacgagcac 2820 catcaggatc tgaccctcct gaaggcgctg gtcaggcagc agctccccga gaagcaag 2880 gagatcttct tcgatcagtc gaagacggc tacgctgggt acattgacgg cggggcctct 2940 caggaggagt tctacaagtt catcaagccg attctggaga agatggacgg cacggagagg 3000 ctgctggtga agctcaatcg cgaggacctc ctgaggaagc agcggacatt cgataacggc 3060 agcatcccac accagattca tctcggggag ctgcacgcta tcctgaggag gcaggaggac 3120 ttctaccctt tcctcaagga taaccgcgag aagatcgaga agattctgac tttcaggatc 3180 ccgtactacg tcggcccact cgctaggggc aactcccgct tcgcttggat gacccgcaag 3240 tcagaggaga cgatcacgcc gtggaacttc gaggaggtgg tcgacaaggg cgctagcgct 3300 cagtcgttca tcgagaggat gacgaatttc gacaagaacc tgccaaatga gaaggtgctc 3360 cctaagcact cgctcctgta cgagtacttc acagtctaca acgagctgac taaggtgaag 3420 tatgtgaccg agggcatgag gaagccggct ttcctgtctg gggagcagaa gaaggccatc 3480 gtggacctcc tgttcaagac caaccggaag gtcacggtta agcagctcaa ggaggactac 3540 ttcaagaaga ttgagtgctt cgattcggtc gagatctctg gcgttgagga ccgcttcaac 3600 gcctccctgg ggacctacca cgatctcctg aagatcatta aggataagga cttcctggac 3660 aacgaggaga tgaggat cctcgaggac attgtgctga cactcactct gttcgaggac 3720 cgggagatga tcgaggagcg cctgaagact taccccatc tcttcgatga caagttcatg 3780 aagcagctca agaggag gtacaccggc tgggggaggc tgagcagga gctcatcac 3840 ggcattcgggg acagcagtc cgggaagacg atcctcgact tcctgaagg cgatggcttc 3900 gcgaaccgca atttcatgca gctgattcac gatgacagcc tcacattca ggaggatatc 3960 cagaaggctc aggtgagcgg ccagggggac tcgctgcacg agcatatcgc gaacctcgct 4020 ggctcgccag ctatcaagaa ggggattctg cagaccgtga aggttgtgga cgagctggtg 4080 aaggtcatgg gcaggcacaa gcctgagaac atcgtcattg agatggcccg ggagaatcag 4140 accacgcaga agggccagaa gaactcacgc gagaggatga agaggatcga ggaggcatt 4200 aaggagctgg gctcccagat cctcaggag cacccggtgg agacacgca gctgcagaat 4260 gagaagctct acctgtacta cctccagaat ggccgcgata tgtagtgga ccaggagctg 4320 gatattaaca ggctcagcga ttacgacgtc gatcatatcg ttccacagtc attcctgaag 4380 gatgactcca ttgacaacaa ggtcctcacc aggtcggaca agaaccgggg caagtctgat 4440 aatgttcctt cagaggaggt cgttaagaag atgaagaact actggcgcca gctcctgaat 4500 gccaagctga tcacgcagcg gaagttcgat aacctcacaa aggctgagag gggcgggctc 4560 tctgagctgg acaaggcggg cttcatcaag aggcagctgg tcgagacacg gcagatcact 4620 aagcacgttg cgcagattct cgactcacgg atgaacacta agtacgatga gaatgacaag 4680 ctgatccgcg aggtgaaggt catcaccctg aagtcaaagc tcgtctccga cttcaggaag 4740 gatttccagt tctacaaggt tcgggagatc aacaattacc accatgccca tgacgcgtac 4800 ctgaacgcgg tggtcggcac agctctgatc aagaagtacc caaagctcga gagcgagttc 4860 gtgtacgggg actacaaggt ttacgatgtg aggaagatga tcgccaagtc ggagcaggag 4920 attggcaagg ctaccgccaa gtacttcttc tactctaaca ttatgaattt cttcaagaca 4980 gagatcactc tggccaatgg cgagatccgg aagcgccccc tcatcgagac gaacggcgag 5040 acgggggaga tcgtgtggga caagggcagg gatttcgcga ccgtcaggaa ggttctctcc 5100 atgccacaag tgaatatcgt aagaagaca gaggtccaga ctggcgggtt ctctaaggag 5160 5220 aagaagtcg gcgggtttcga cagccccact gtggcctact cggtcctggt tgtggcgaag 5280 gttgagaagg gcaagtccaa gaagctcaag agcgtgaagg agctgctggg gatcacgatt 5340 atggagcgct ccagcttcga gaagaacccg atcgatttcc tggaggcgaa gggctacaag 5400 gaggtgaag aggacctgat cattaagctc cccaagtact cactcttcga gctggagaac 5460 ggcaggaagc ggatgctggc ttccgctggc gagctgcaga agggaacga gctggctctg 5520 5580 cccgaggaca acgagcagaa gcagctgttc gtcgagcagc acaagcatta cctcgacgag 5640 atcattgagc agatttccga gttctccaag cgcgtgatcc tggccgacgc gaatctggat 5700 aaggtcctct ccgcgtacaa caagcaccgc gacaagccaa tcagggagca ggctgagaat 5760 atcattcatc tcttcaccct gacgaacctc ggcgcccctg ctgctttcaa gtacttcgac 5820 acactacg atcgcaagg gtacacaagc actaggagg tcctggacgc gacctcatc 5880 caccagtcga ttaccggcct ctacgagacg cgcatcgacc tgtctcagct cgggggcgac 5940 aagcggccag cggcgacgaa gaggcgggg caggcgaga agagaagga attctccggc 6000 ggcagcacca acctgtccga catcatcgag aaggagacgg gcaagcaact cgtgatccag 6060 gagagcatcc tcatgctgcc agaggaggtg gaggaggtca tcggcaaca gccagagtcc 6120 gatacctgg tgcacaccgc ctacgacgag tccaccgacg agaacgtcat gctcctgacc 6180 agcgacgccc cagagtacaa gccatgggcc ctcgtcatcc aggacagcaa cggggagaac 6240 aagatcaaga tgctgtcgggg ggggagcccca aagaagaagc gggaggtgta g 6291 <210> 22 <211> 6759 <212> DNA <213> Artificial Sequence <220> <223> STEME-3 (APOBEC3A-48aa linker-ecTadA-32aa linker-ecTadA7.10-32aa linker-nCas9 (D10A)-NLS-T2A-UGI-NLS-T2A-UGI-NLS) <400> 22 atggaggcca gccggctag cggcccaagg catctcatgg acccgcacat cttcaccagc 60 aacttcaaca acggcatcgg caggcacaag acctacttgt gctacgaggt ggagaggctc 120 gacaacggaa cctccgtgaa gatggaccaa cacagggggt tcctccacaa ccaagccaag 180 aacctcctct gcggcttcta cggcaggcac gccgagttga ggttcctcga cttggtgcca 240 tccctccaac tcgatccagc ccaaatctac cgcgtgacct ggttcatctc ctggtcccca 300 tgcttctcct ggggttgcgc cggcgaggtt cgggctttcc tccaagaaaa cacccacgtc 360 cgcctccgca tttcgccgc caggatctat gattacgacc ctctctacaa ggaggccctc 420 cagatgctgc gggacgccgg tgctcaggtg agtatcatga cctacgacga gttcaagcac 480 tgctgggaca ccttcgttga ccaccagggc tgcccattcc aaccatggga cggtctggat 540 gaacacagcc aagccttgtc cggcaggctc cgggccatcc tccaaaacca ggggaactcc 600 gggagcgaga cgccaggcac ctccgagtcg gccaccccag aatcttccgg cggatcttct 660 ggaggatcta gcggctccga gacaccagga acatccgaat ccgctacacc agagtcttct 720 ggaggatcta gcggaggatc ttccgaggtg gagttctctc acgagtattg gatgaggcac 780 gctcttacac ttgctaagag agcttgggac gaaagagaag tgccagttgg cgccgttctt 840 gtgcataata atagggtgat cggcgagggt tggaatagac caattggaag gcatgatcca 900 acagctcacg cagagattat ggctctcaga caaggcggcc tcgttatgca gaactacagg 960 ctcattgacg ctacactcta cgtgacactc gaaccttgcg ttatgtgcgc cggagctatg 1020 attcattcta ggattggcag ggtcgtgttt ggagctaggg acgctaaaac aggagccgcc 1080 ggatctctta tggacgtgtt gcatcatcca ggcatgaacc atagggtgga gattacagag 1140 ggcattcttg cagacgagtg cgctgctctt cttccgatt tcttcaggat gagaaggcag 1200 gagattaagg cccagaagaa ggctcagtct tctacagata gcggaggatc ttccggagga 1260 tctagcggct ccgagacacc aggaacatcc gaaagcgcta caccagaatc tagcggaggc 1320 tcttccggag gatcttctga agtggagttc tcccacgagt attggatgag gcacgctctt 1380 acacttgcta aaagggctag ggacgaaagg gaagttccag ttggagctgt tctcgtgctc 1440 aataacaggg tgattggcga gggttggaat agagccattg gactccatga tccaacagct 1500 cacgcagaga ttatggctct tagacaaggc ggcctcgtta tgcagaatta cagactcatc 1560 gacgccacac tctacgttac cttcgaacct tgcgttatgt gcgccggagc tatgatccat 1620 tctaggattg gcagggtcgt gttcggcgtt agaaacgcta agacaggagc tgcaggctct 1680 cttatggacg ttcttcatta cccaggcatg aatcatagag tggagatcac agaaggcatt 1740 cttgcagcg agtgcgcagc tctcctttgc tatttttca ggatgccgag gcaagttttc 1800 aacgctcaga agaaggccca gtcttctaca gattccggcg gatcttctgg aggatctagc 1860 ggctccgaga caccaggaac atccgaatcc gctacaccag agtcttctgg aggatctagc 1920 ggaggatctg aagaagga ctcgatcggc ctcgccattg ggactaactc tgttggctgg 1980 gccgtgatca ccgacgagat caaggtgccc tcaaagaagt tcaaggtcct gggcaacacc 2040 gatcggcatt ccatcaagaa gaatctcatt ggcgctctcc tgttcgacag cggcgagacg 2100 gctgaggcta cgcggctcaa gcgcaccgcc cgcaggcggt acacgcgcag gaagaatcgc 2160 atctgctacc tgcaggagat tttctccaac gagatggcga aggttgacga ttctttcttc 2220 cacaggctgg aggagtcatt cctcgtggag gaggataaga agcacgagcg gcatccaatc 2280 ttcggcaaca ttgtcgacga ggttgcctac cacgagaagt accctacgat ctaccatctg 2340 cgggaagaagc tcgtggactc cacagataag gcggacctcc gcctgatcta cctcgctctg 2400 gcccacatga ttaagttcag gggccatttc ctgatcgagg gggatctcaa cccggacaat 2460 agcgatgttg acaagctgtt catccagctc gtgcagacgt acaaccagct cttcgaggag 2520 aaccccatta atgcgtcagg cgtcgacgcg aaggctatcc tgtccgctag gctctcgaag 2580 tctcggcgcc tcgagaacct gatcgcccag ctgccgggcg agaagaagaa cggcctgttc 2640 gggaatctca ttgcgctcag cctggggctc acgcccaact tcaagtcgaa tttcgatctc 2700 gctgaggacg ccaagctgca gctctccaag gacacatacg acgatgacct ggataacctc 2760 ctggcccaga tcggcgatca gtacgcggac ctgttcctcg ctgccaagaa tctgtcggac 2820 gccatcctcc tgtctgatat tctcagggtg aacaccgaga ttacgaaggc tccgctctca 2880 gcctccatga tcaagcgcta cgacgagcac catcaggatc tgaccctcct gaaggcgctg 2940 gtcaggcagc agctccccga gaagtacaag gagatcttct tcgatcagtc gaagaacggc 3000 tacgctgggt acattgacgg cggggcctct caggaggagt tctacaagtt catcaagccg 3060 3120 ctgaggaagc agcggacatt cgataacggc agcatcccac accagattca tctcggggag 3180 3240 aagatcgaga agattctgac tttcaggatc ccgtactacg tcggcccact cgctaggggc 3300 aactcccgct tcgcttggat gacccgcaag tcagaggaga cgatcacgcc gtggaacttc 3360 gaggaggtgg tcgacaaggg cgctagcgct cagtcgttca tcgagaggat gacgaatttc 3420 gacaagaacc tgccaaatga gaaggtgctc cctaagcact cgctcctgta cgagtacttc 3480 acagtctaca acgagctgac taaggtgaag tatgtgaccg agggcatgag gaagccggct 3540 ttcctgtctg gggagcagaa gaaggccatc gtggacctcc tgttcaagac caaccggaag 3600 gtcacggtta agcagctcaa ggaggactac ttcaagaga ttgagtgctt cgattcggtc 3660 gagatctctg gcgttgagga ccgcttcac gcctccctgg ggacctacca cgatctcctg 3720 aagatcatta aggatagga cttcctggac aacgaggaga atgaggaat cctcgaggac 3780 attgtgctga cactcactct gttcgaggac cgggagatga tcgaggagcg cctgagact 3840 tacgcccatc tcttcgatga caggtcatg aagcagctca agaggagg gtacaccggc 3900 tgggggaggc tgagcaggaa gctcatcaac ggcattcggg acagcagtc cgggagacg 3960 atcctcgact tcctgaagag cgatggcttc gcgaaccgca atttcatgca gctgattcac 4020 gatgacagcc tcacattca ggaggatatc cagaaggctc aggtgagcgg ccagggggac 4080 tcgctgcacg agcatatcgc gaacctcgct ggctcgccag ctatcaagaa ggggattctg 4140 cagaccgtga aggttgtgga cgagctggtg aaggtcatgg gcaggcacaa gcctgagaac 4200 atcgtcattg agatggcccg ggagaatcag accacgcaga agggccagaa gaactcacgc 4260 gagaggatga agaggatcga ggaggcatt aggagctgg ggtcccagat cctcaggag 4320 cacccggtgg agaacacgca gctgcagaat gagaagctct acctgtacta cctccagaat 4380 ggccgcgata tgtatgtgga ccaggagctg gatattaaca ggctcagcga ttacgacgtc 4440 gatcatatcg ttccacagtc attcctgaag gatgactcca ttgacaacaa ggtcctcacc 4500 aggtcggaca agaaccgggg caagtctgat aatgttcctt cagaggaggt cgttaagaag 4560 atgaagaact actggcgcca gctcctgaat gccaagctga tcacgcagcg gaagttcgat 4620 aacctcacaa aggctgagag gggcgggctc tctgagctgg acaaggcggg cttcatcaag 4680 aggcagctgg tcgagacacg gcagatcact aagcacgttg cgcagattct cgactcacgg 4740 atgaacacta agtacgatga gaatgacaag ctgatccgcg aggtgaaggt catcaccctg 4800 aagtcaaagc tcgtctccga cttcaggaag gatttccagt tctacaaggt tcgggagatc 4860 aacaattacc accatgccca tgacgcgtac ctgaacgcgg tggtcggcac agctctgatc 4920 aagaagtacc caaagctcga gagcgagttc gtgtacgggg actacaaggt ttacgatgtg 4980 aggaagatga tcgccaagtc ggagcaggag attggcaagg ctaccgccaa gtacttcttc 5040 tactctaaca ttatgaattt cttcaagaca gagatcactc tggccaatgg cgagatccgg 5100 aagcgccccc tcatcgagac gaacggcgag acgggggaga tcgtgtggga caagggcagg 5160 gatttcgcga ccgtcaggaa ggttctctcc atgccacaag tgaatatcgt caagagaca 5220 gaggtccaga ctggcgggtt ctctaaggag tcaattctgc ctaagcgaa cagggacaag 5280 5340 gtggcctact cggtcctggt tgtggcgaag gttgagaagg gcaagtccaa gaagctcaag 5400 agcgtgaagg agctgctggg gatcacgatt atggagcgct ccagcttcga gaagaacccg 5460 atcgatttcc tggaggcgaa gggctacaag gaggtgaaga aggacctgat cattaagctc 5520 cccaagtact cactcttcga gctggagaac ggcaggaagc ggatgctggc ttccgctggc 5580 gagctgcaga agggaacga gctggctctg ccgtccaagt atgtgaactt cctctacctg 5640 gcctccact acgagaagct caagggcagc cccgaggaca agagcagaa gcagctgttc 5700 gtcgagcagc acaagcatta cctcgacgag atcattgagc agatttccga gttctccaag 5760 cgcgtgatcc tggccgacgc gatctggat aaggtccctct ccgcgtacaa caagcaccgc 5820 vakaagccaa tcagggagca ggctgagaat atcattcatc tctcaccct gacgaacctc 5880 ggcgcccctg ctgctttcaa gtactcgac acactacg atcgcaagg gtacacaagc 5940 actaaggagg tcctggacgc gacctcatc caccagtcga tccggcct ctacgagacg 6000 cgcatcgacc tgtctcagct cggggcgac aagcggccag cggcgacgaa gaggcgggg 6060 caggcgaga agagaagga attcgaggc agaggaagtc ttctaacatg cggtgacgtg 6120 gaggagaatc ccggccctac siacctgtcc gacatcatcg agaggagac gggcaagca 6180 ctcgtgatcc aggagcat cctcatgctg ccagaggagg tggaggt catcggcac 6240 aagccagagt ccgacatcct gtgcacacc gcctacgacg agtccaccga cgagaacgtc 6300 atgctcctga ccagcgacgc cccagagtac aagccatggg ccctcgtcat ccaggacagc 6360 aacggggaga aagatcaa gatgctgtcg ggggggagcc siaagaa gcggaaggtg 6420 gagggcagag gaagtcttct aacatgcggt gacgtggagg agaatcccgg ccctaccac 6480 ctgtccgaca tcatcgagaa ggagacgggc aagcaactcg tgatccagga gagcatccctc 6540 atgctgccag aggaggtgga ggaggtcatc ggcaacaagc cagagtccga catcctggtg 6600 cacaccgcct acgacgagtc caccgacgag aacgtcatgc tcctgaccag cgacgcccca 6660 gagtacaagc catggggccct cgtcatccag gagcaacg gggagaaa catxagatg 6720 ctgtcgggggg ggagcccaaa gagaagcgg aaggtgtag 6759 <210> 23 <211> 6663 <212> DNA <213> Artificial Sequence <220> <223> STEME-4 (ecTadA-32aa linker-ecTadA7.10-32aa linker-APOBEC3A-16aa linker-nCas9 (D10A)-NLS-T2A-UGI-NLS-T2A-UGI-NLS) <400> 23 atgtccgagg tggattctc tcacgagtat tggatgaggc acgctcttac acttgctaag 60 agagcttggg acgaaagaga agtgccagtt ggcgccgttc ttgtgcataa taatagggtg 120 atcggcgagg gttgaatag accaattgga aggcatgatc caacagctca cgcagagatt 180 atggctctca vakaaggcgg cctcgttatg cagaactaca ggctcattga cgctacactc 240 tacgtgacac tcgaaccttg cgttatgtgc gccggagcta tgattcattc taggattggc 300 agggtcgtgt ttggagctag ggacgctaaa acaggagccg ccggatctct tatggacgtg 360 ttgcatcatc caggcatgaa ccatagggtg gagattacag agggcattct tgcagacgag 420 tgcgctgctc ttctttccga tttcttcagg atgagaaggc aggagattaa ggcccagaag 480 aaggctcagt cttctacaga tagcggagga tcttccggag gatctagcgg ctccgagaca 540 ccaggaacat ccgaaagcgc tacaccagaa tctagcggag gctcttccgg aggatcttct 600 gaagtggagt tctcccacga gtattggatg aggcacgctc ttacacttgc taaaagggct 660 agggacgaaa gggaagttcc agttggagct gttctcgtgc tcaataacag ggtgattggc 720 gagggttgga atagagccat tggactccat gatccaacag ctcacgcaga gattatggct 780 cttagacaag gcggcctcgt tatgcagaat tacagactca tcgacgccac actctacgtt 840 accttcgaac cttgcgttat gtgcgccgga gctatgatcc attctaggat tggcagggtc 900 gtgttcggcg ttagaaacgc taagacagga gctgcaggct ctcttatgga cgttcttcat 960 tacccaggca tgaatcatag agtggagatc acagaaggca ttcttgcaga cgagtgcgca 1020 gctctccttt gctatttctt caggatgccg aggcaagttt tcaacgctca gaagaaggcc 1080 cagtcttcta cagattccgg cggatcttct ggaggatcta gcggctccga gacaccagga 1140 acatccgaat ccgctacacc agagtcttct ggaggatcta gcggaggatc tgaggccagc 1200 ccggctagcg gcccaaggca tctcatggac ccgcacatct tcaccagcaa cttcaacaac 1260 ggcatcggca ggcacaagac ctacttgtgc tacgaggtgg agaggctcga caacggaacc 1320 tccgtgaaga tggaccaaca cagggggttc ctccacaacc aagccaagaa cctcctctgc 1380 ggcttctacg gcaggcacgc cgagttgagg ttcctcgact tggtgccatc cctccaactc 1440 gatccagccc aaatctaccg cgtgacctgg ttcatctcct ggtccccatg cttctcctgg 1500 ggttgcgccg gcgaggttcg ggctttcctc caagaaaaca cccacgtccg cctccgcatt 1560 ttcgccgcca ggatctatga ttacgaccct ctctacaagg aggccctcca gatgctgcgg 1620 gacgccggtg ctcaggtgag tatcatgacc tacgacgagt tcaagcactg ctgggacacc 1680 ttcgttgacc accagggctg cccattccaa ccatgggacg gtctggatga acacagccaa 1740 gccttgtccg gcaggctccg ggccatcctc caaaaccagg ggaactccgg gagcgagacg 1800 ccaggcacct ccgagtcggc caccccagaa tctgacaaga agtactcgat cggcctcgcc 1860 attgggacta actctgttgg ctgggccgtg atcaccgacg agtacaaggt gccctcaaag 1920 aagttcaagg tcctgggcaa caccgatcgg cattccatca agaagaatct cattggcgct 1980 ctcctgtcg acagcggcga gacggctgag gctacgcggc tcaagcgcac cgcccgcagg 2040 cggtacacgc gcaggaagaa tcgcatctgc tacctgcagg agattttctc caacgagatg 2100 gcgaaggttg acgattcttt cttccacagg ctggaggagt cattcctcgt ggaggaggat 2160 aagaagcacg agcggcatcc aatcttcggc aacattgtcg acgaggttgc ctaccacgag 2220 aagtacccta cgatctacca tctgcggaag aagctcgtgg actccacaga taaggcggac 2280 ctccgcctga tctacctcgc tctggcccac atgattaagt tcaggggcca tttcctgatc 2340 gagggggatc tcaacccgga caatagcgat gttgacaagc tgttcatcca gctcgtgcag 2400 acgtacaacc agctcttcga ggagaacccc attaatgcgt caggcgtcga cgcgaaggct 2460 atcctgtccg ctaggctctc gaagtctcgg cgcctcgaga acctgatcgc ccagctgccg 2520 2580 aacttcaagt cgaattcga tctcgctgag gacgccaagc tgcagctctc caaggacaca 2640 tacgacgatg acctggataa cctcctggcc cagatcggcg atcagtacgc ggacctgttc 2700 ctcgctgcca agaatctgtc ggacgccatc ctcctgtctg atattctcag ggtgaacacc 2760 gagattacga aggctccgct ctcagcctcc atgatcaagc gctacgacga gcaccatcag 2820 gatctgaccc tcctgaaggc gctggtcagg cagcagctcc ccgagaagta caaggagatc 2880 ttcttcgaatc agtcgaagaa cggctacgct gggtacattg acggcggggc ctctcaggag 2940 gagttctaca agttcatcaa gccgattctg gagagatgg acggcacgga ggagctgctg 3000 3060 ccacaccaga ttcatctcgg ggagctccac gctatcctga ggaggcagga ggacttctac 3120 cctttcctca aggataaccg cgagaagatc gagaagattc tgactttcag gatcccgtac tacgtcggcc cactcgctag gggcaactcc cgcttcgctt ggatgacccg caagtcagag 3240 gagacgatca cgccgtggaa cttcgaggag gtggtcgaca agggcgctag cgctcagtcg ttcatcgaga ggatgacgaa tttcgacaag aacctgccaa atgagaaggt gctccctaag cactcgctcc tgtacgagta cttcacagtc tacaacgagc tgactaaggt gaagtatgtg accgagggca tgaggaagcc ggctttcctg tctggggagc agaagaaggc catcgtggac 3480 ctcctgttca agaccaccg gaaggtcacg gttaagcagc tcaaggagga ctacttcaag aagattgagt gcttcgattc ggtcgagatc tctggcgttg aggaccgctt caacgcctcc 3600 ctggggacct accacgatct cctgaagatc attack aggacttcct ggacaacgag gagaatgagg atatcctcga ggacattgtg ctgacactca ctctgttcga ggaccgggag atgatcgagg agcgcctgaa gacttacgcc catctcttcg atgacaaggt catgaagcag ctcaagagga ggaggtacac cggctgggggg aggctgagca ggaagctcat caacggcatt cgggacaagc agtccgggaa gacgatcctc gacttcctga agagcgatgg cttcgcgaac 3900 cgcaatttca tgcagctgat tcacgatgac agcctcacat tcaaggagga tatccagaag 3960 gctcaggtga gcggccaggg ggactcgctg cacgagcata tcgcgaacct cgctggctcg 4020 ccagctatca agaaggggat tctgcagacc gtgaaggttg tggacgagct ggtgaaggtc 4080 atgggcaggc acaagcctga gaacatcgtc attgagatgg cccgggagaa tcagaccacg 4140 cagaagggcc agaagaactc acgcgagagg atgaagagga tcgaggaggg cattaaggag 4200 ctggggtccc agatcctcaa ggagcacccg gtggagaaca cgcagctgca gaatgagaag 4260 ctctacctgt actacctcca gaatggccgc gatatgtatg tggaccagga gctggatatt 4320 aacaggctca gcgattacga cgtcgatcat atcgttccac agtcattcct gaaggatgac 4380 tccattgaca acaaggtcct caccaggtcg gacaagaacc ggggcaagtc tgataatgtt 4440 ccttcagagg aggtcgttaa gaagatgaag aactactggc gccagctcct gaatgccaag 4500 ctgatcacgc agcggaagtt cgataacctc acaaaggctg agaggggcgg gctctctgag 4560 ctggacaagg cgggcttcat caagaggcag ctggtcgaga cacggcagat cactaagcac 4620 4680 cgcgaggtga aggtcatcac cctgaagtca aagctcgtct ccgacttcag gaaggatttc 4740 cagttctaca aggttcggga gatcaacaat taccaccatg cccatgacgc gtacctgaac 4800 gcggtggtcg gcacagctct gatcaagaag tacccaaaagc tcgagagcga gttcgtgtac 4860 ggggactaca aggtttacga tgtgaggaag atgatcgcca agtcggagca ggagattggc 4920 aaggctaccg ccaagtactt cttctactct aacattatga attctttcaa gacagagatc 4980 actctggcca atggcgagat ccggaagcgc cccctcatcg agacgaacgg cgagacgggg 5040 gagatcgtgt gggacaaggg cagggatttc gcgaccgtca ggaaggttct ctccatgcca 5100 caagtgaata tcgtcaagaa gacagaggtc cagactggcg ggttctctaa ggagtcaatt 5160 ctgcctaagc ggaacagcga caagctcatc gcccgcaaga agactggga tccgaaag 5220 tacggcgggt tcgacagccc cactgtggcc tactcggtcc tggttgtggc gaaggttgag 5280 aagggcaagt ccaagaagct caagagcgtg aaggagctgc tggggatcac gattatggag 5340 cgctccagct tcgagaagaa cccgatcgat ttcctggagg cgaagggcta caaggaggtg 5400 aagaaggacc tgatcattaa gctccccaag tactcactct tcgagctgga gaacggcagg 5460 aagcggatgc tggcttccgc tggcgagctg cagaagggga acgagctggc tctgccgtcc 5520 aagtatgtga acttcctcta cctggcctcc cactacgaga agctcaaggg cagccccgag 5580 gacaacgagc agaagcagct gttcgtcgag cagcacaagc attacctcga cgagatcatt 5640 gagcagattt ccgagtctc caagcgcgtg atcctggccg acgcgaatct ggataaggtc 5700 ctctccgcgt acaacaagca ccgcgacaag ccaatcaggg agcaggctga gaatatcatt 5760 catctcttca ccctgacgaa cctcggcgcc cctgctgctt tcaagtactt cgacacaact 5820 atcgatcgca agaggtacac aagcactaag gaggtcctgg acgcgaccct catccaccag 5880 tcgattaccg gcctctacga gacgcgcatc gacctgtctc agctcggggg cgacaagcgg 5940 ccagcggcga cgaagaaggc ggggcaggcg aagaagaaga aggaattcga gggcagagga 6000 agtcttctaa catgcggtga cgtggaggag atcccggcc ctaccacct gtccgacatc 6060 atcgagaagg agacgggcaa gcaaccgtg atccaggaga gcatcctcat gctgccagag 6120 gaggtggagg aggtcatcgg siacaagcca gagtccgaca tcctggtgca caccgcctac 6180 gacgagtcca ccgacgagaa cgtcatgctc ctgaccagcg acgccccaga gtacaagcca 6240 tgggccctcg tcatccagga cagcaacggg gagacacaga tcagatgct gtcgggggggg 6300 agcccaaga agaagcggaa ggtggaggc agaggaagtc ttctaacatg cggtgacgtg 6360 gaggagaatc ccggccctac siacctgtcc gacatcatcg agaggagac gggcaagcaa 6420 ctcgtgatcc aggagcat cctcatgctg ccagaggagg tggaggt catcggcac 6480 aagccagagt ccgacatcct gtgcacacc gcctacgacg agtccaccga cgagaacgtc 6540 atgctcctga ccagcgacgc cccagagtac aagccatggg ccctcgtcat ccaggacagc 6600 aacggggaga aagatcaa gatgctgtcg ggggggagcc siaagaa gcggaaggtg 6660 tag 6663 <210> 24 <211> 5745 <212> DNA <213> Artificial Sequence <220> <223> STEME-5 (APOBEC3A-32aa linker-ecTadA7.10-32aa linker-nCas9 (D10A)-NLS-UGI-NLS) <400> 24 atggaggcca gccggctag cggcccaagg catctcatgg acccgcacat cttcaccagc 60 aacttcaaca acggcatcgg caggcacaag acctacttgt gctacgaggt ggagaggctc 120 gacaacggaa cctccgtgaa gatggaccaa cacagggggt tcctccacaa ccaagccaag 180 aacctcctct gcggcttcta cggcaggcac gccgagttga ggttcctcga cttggtgcca 240 tccctccaac tcgatccagc ccaaatctac cgcgtgacct ggttcatctc ctggtcccca 300 tgcttctcct ggggttgcgc cggcgaggtt cgggctttcc tccaagaaaa cacccacgtc 360 cgcctccgca tttcgccgc caggatctat gattacgacc ctctctacaa ggaggccctc 420 cagatgctgc gggacgccgg tgctcaggtg agtatcatga cctacgacga gttcaagcac 480 tgctgggaca ccttcgttga ccaccagggc tgcccattcc aaccatggga cggtctggat 540 gaacacagcc aagccttgtc cggcaggctc cgggccatcc tccaaaacca ggggaacagc 600 ggaggatctt ccggaggatc tagcggctcc gagacaccag gaacatccga aagcgctaca 660 ccagaatcta gcggaggctc ttccggagga tcttctgaag tggagttctc ccacgagtat 720 tggatgaggc acgctcttac acttgctaaa agggctaggg acgaaaggga agttccagtt 780 ggagctgttc tcgtgctcaa taacagggtg attggcgagg gttggaatag agccattgga 840 ctccatgatc caacagctca cgcagagatt atggctctta gacaaggcgg cctcgttatg 900 cagaattaca gactcatcga cgccacactc tacgttacct tcgaaccttg cgttatgc 960 gccggagcta tgatccattc taggattggc agggtcgtgt tcggcgttag aaacgctaag 1020 acaggagctg caggctctct tatggacgtt cttcattacc caggcatgaa tcatagagtg 1080 gagatcacag aaggcattct tgcagacgag tgcgcagctc tcctttgcta tttcttcagg 1140 atgccgaggc aagttttcaa cgctcagaag aaggcccagt cttctacaga ttccggcgga 1200 tcttctggag gatctagcgg ctccgagaca ccaggaacat ccgaatccgc tacaccagag 1260 tcttctggag gatctagcgg aggatctctt aaggacaaga agtactcgat cggcctcgcc 1320 attgggacta actctgttgg ctgggccgtg atcaccgacg agtacaaggt gccctcaaag 1380 aagttcaagg tcctgggcaa caccgatcgg cattccatca agaagaatct cattggcgct 1440 ctcctgtcg acagcggcga gacggctgag gctacgcggc tcaagcgcac cgcccgcagg 1500 cggtacacgc gcaggaagaa tcgcatctgc tacctgcagg agattttctc caacgagatg 1560 gcgaaggttg acgattcttt cttccacagg ctggaggagt cattcctcgt ggaggaggat 1620 aagaagcacg agcggcatcc aatcttcggc aacattgtcg acgaggttgc ctaccacgag 1680 aagtacccta cgatctacca tctgcggaag aagctcgtgg actccacaga taaggcggac 1740 ctccgcctga tctacctcgc tctggcccac atgattaagt tcaggggcca tttcctgatc 1800 gagggggatc tcaacccgga caatagcgat gttgacaagc tgttcatcca gctcgtgcag 1860 acgtacaacc agctcttcga ggaacccc attaatgcgt caggcgtcga cgcgaaggct 1920 atcctgtccg ctaggctctc gaagtctcgg cgcctcgaga acctgatcgc ccagctgccg 1980 ggcgagaaga agaacggcct gttcgggaat ctcattgcgc tcagcctggg gctcacgccc 2040 aacttcaagt cgaatttcga tctcgctgag gacgccaagc tgcagctctc caaggacaca 2100 tacgacgatg acctggataa cctcctggcc cagatcggcg atcagtacgc ggacctgttc 2160 ctcgctgcca agaatctgtc ggacgccatc ctcctgtctg atattctcag ggtgaacacc 2220 gagattacga aggctccgct ctcagcctcc atgatcaagc gctacgacga gcaccatcag 2280 gatctgaccc tcctgaaggc gctggtcagg cagcagctcc ccgagaagta caaggagatc 2340 ttcttcgatc agtcgaagaa cggctacgct gggtacattg acggcggggc ctctcaggag 2400 gagttctaca agttcatcaa gccgattctg gagaagatgg acggcacgga ggagctgctg 2460 gtgaagctca atcgcgagga cctcctgagg aagcagcgga cattcgataa cggcagcatc 2520 ccacaccaga ttcatctcgg ggagctgcac gctatcctga ggaggcagga ggacttctac 2580 cctttcctca aggataaccg cgagaagatc gagaagattc tgactttcag gatcccgtac 2640 tacgtcggcc cactcgctag gggcaactcc cgcttcgctt ggatgacccg caagtcagag 2700 gagacgatca cgccgtggaa cttcgaggag gtggtcgaca agggcgctag cgctcagtcg 2760 ttcatcgaga ggatgacgaa tttcgacaag aacctgccaa atgagaaggt gctccctaag 2820 cactcgctcc tgtacgagta cttcacagtc tacaacgagc tgactaaggt gaagtatgtg 2880 accgagggca tgaggaagcc ggctttcctg tctggggagc agaagaaggc catcgtggac 2940 ctcctgttca agaccaaccg gaaggtcacg gttaagcagc tcaaggagga ctacttcaag 3000 aagattgagt gcttcgattc ggtcgagatc tctggcgttg aggaccgctt caacgcctcc 3060 ctggggacct accacgatct cctgaagatc attaaggata aggacttcct ggacaacgag 3120 gagaatgagg atatcctcga ggacattgtg ctgacactca ctctgttcga ggaccgggag 3180 atgatcgagg agcgcctgaa gacttacgcc catctcttcg atgacaaggt catgaagcag 3240 ctcaagagga ggaggtacac cggctggggg aggctgagca ggaagctcat caacggcatt 3300 cgggacaagc agtccgggaa gacgatcctc gacttcctga agagcgatgg cttcgcgaac 3360 cgcaatttca tgcagctgat tcacgatgac agcctcacat tcaaggagga tatccagaag 3420 gctcaggtga gcggccaggg ggactcgctg cacgagcata tcgcgaacct cgctggctcg 3480 ccagctatca agaaggggat tctgcagacc gtgagaggttg tggacgagct ggtgaagggtc 3540 atgggcaggc acagcctga gaacatcgtc attgagatgg cccgggagaa tcagaccacg 3600 cagaagggcc agaagaactc acggcgagggg agagagg tcgaggggg cattaaggg 3660 ctggggtccc agatccca ggagcacccg gtggagaca cgcagctgca gatgagaag 3720 ctctacctgt actacctcca gatggccgc gatatgtag tggaccagga gctggatatt 3780 aacaggctca gcgattacga cgtcgatcat atcgttccac agtcattcct gaaggatgac 3840 tccattgaca acaagtcct caccaggtcg gandagaacc ggggcaagtc tgataatgtt 3900 ccttcagagg aggtcgttaa gagatgaag aactactggc gccagctcct gatgccaag 3960 ctgatcacgc agcggaagtt cgataacctc aaaaggctg agaggggcgg gctctctgag 4020 ctggacaagg cgggcttcat cagaggcag ctggtcgaga cacggcagat cactaagcac 4080 gttgcgcaga ttctcgactc acggatgaac actaagtacg atgagaatga caagctgatc 4140 cgcgaggtga agtcatcac cctgaagtca aagctcgtct ccgacttcag gaaggatttc 4200 cagttctaca aggttcggga gatcaacaat taccaccatg cccatgacgc gtacctgaac 4260 gcggtggtcg gcacagctct gatcaagaag tacccaaaagc tcgagagcga gttcgtgtac 4320 ggggactaca aggtttacga tgtgaggaag atgatcgcca agtcggagca ggagattggc 4380 aaggctaccg ccaagtactt cttctactct aacattatga attctttcaa gacagagatc 4440 actctggcca atggcgagat ccggaagcgc cccctcatcg agacgaacgg cgagacgggg 4500 gagatcgtgt gggacaaggg cagggatttc gcgaccgtca ggaaggttct ctccatgcca 4560 caagtgaata tcgtcaagaa gacagaggtc cagactggcg ggttctctaa ggagtcaatt 4620 ctgcctaagc ggaacagcga caagctcatc gcccgcaaga agactggga tccgaaag 4680 tacggcgggt tcgacagccc cactgtggcc tactcggtcc tggttgtggc gaaggttgag 4740 aagggcaagt ccaagaagct caagagcgtg aaggagctgc tggggatcac gattatggag 4800 cgctccagct tcgagaagaa cccgatcgat ttcctggagg cgaagggcta caaggaggtg 4860 aagaaggacc tgatcattaa gctcccccaag tactcactct tcgagctgga gaacggcagg 4920 aagcggatgc tggcttccgc tggcgagctg cagaagggga acgagctggc tctgccgtcc 4980 aagtatgtga acttcctcta cctggcctcc cactacgaga agctcaaggg cagccccgag 5040 gacaacgagc agaagcagct gttcgtcgag cagcacaagc attacctcga cgagatcatt 5100 gagcagattt ccgagtctc caagcgcgtg atcctggccg acgcgaatct ggataaggtc 5160 ctctccgcgt acaacaagca ccgcgacaag ccaatcaggg agcaggctga gaatatcatt 5220 catctcttca ccctgacgaa cctcggcgcc cctgctgctt tcaagtactt cgacacaact 5280 atcgatcgca agaggtacac aagcactaag gaggtcctgg acgcgaccct catccaccag 5340 tcgattaccg gcctctacga gacgcgcatc gacctgtctc agctcggggg cgacaagcgg 5400 ccagcggcga cgaagaaggc ggggcaggcg aagaagaaga aggaattctc cggcggcagc 5460 accaacctgt ccgacatcat cgagaaggag acgggcaagc aactcgtgat ccaggagagc 5520 atcctcatgc tgccagagga ggtggaggag gtcatcggca acaagccaga gtccgacatc 5580 ctggtgcaca ccgcctacga cgagtccacc gacgagaacg tcatgctcct gaccagcgac 5640 gccccagagt acaagccatg ggccctcgtc atccaggaca gcaacgggga gaacaagatc 5700 aagatgctgt cgggggggag cccaaagaag aagcggaagg tgtag 5745 <210> 25 <211> 6339 <212> DNA <213> Artificial Sequence <220> <223> STEME-6 (APOBEC3A-32aa linker-ecTadA7.10-32aa linker-ecTadA7.10-32aa linker-nCas9 (D10A)-NLS-UGI-NLS) <400> 25 atggaggcca gccggctag cggcccaagg catctcatgg acccgcacat cttcaccagc 60 aacttcaaca acggcatcgg caggcacaag acctacttgt gctacgaggt ggagaggctc 120 gacaacggaa cctccgtgaa gatggaccaa cacagggggt tcctccacaa ccaagccaag 180 aacctcctct gcggcttcta cggcaggcac gccgagttga ggttcctcga cttggtgcca 240 tccctccaac tcgatccagc ccaaatctac cgcgtgacct ggttcatctc ctggtcccca 300 tgcttctcct ggggttgcgc cggcgaggtt cgggctttcc tccaagaaaa cacccacgtc 360 cgcctccgca tttcgccgc caggatctat gattacgacc ctctctacaa ggaggccctc 420 cagatgctgc gggacgccgg tgctcaggtg agtatcatga cctacgacga gttcaagcac 480 tgctgggaca ccttcgttga ccaccagggc tgcccattcc aaccatggga cggtctggat 540 gaacacagcc aagccttgtc cggcaggctc cgggccatcc tccaaaacca ggggaacagc 600 ggaggatctt ccggaggatc tagcggctcc gagacaccag gaacatccga aagcgctaca 660 ccagaatcta gcggaggctc ttccggagga tcttctgaag tggagttctc ccacgagtat 720 tggatgaggc acgctcttac acttgctaaa agggctaggg acgaaaggga agttccagtt 780 ggagctgttc tcgtgctcaa taacagggtg attggcgagg gttggaatag agccattgga 840 ctccatgatc caacagctca cgcagagatt atggctctta gacaaggcgg cctcgttatg 900 cagaattaca gactcatcga cgccacactc tacgttacct tcgaaccttg cgttatgc 960 gccggagcta tgatccattc taggattggc agggtcgtgt tcggcgttag aaacgctaag 1020 acaggagctg caggctctct tatggacgtt cttcattacc caggcatgaa tcatagagtg 1080 gagatcacag aaggcattct tgcagacgag tgcgcagctc tcctttgcta tttcttcagg 1140 atgccgaggc aagttttcaa cgctcagaag aaggcccagt cttctacaga ttccggcgga 1200 tcttctggag gatctagcgg ctccgagaca ccaggaacat ccgaatccgc tacaccagag 1260 tcttctggag gatctagcgg aggatcttct gaagtggagt tctcccacga gtattggatg 1320 aggcacgctc ttacacttgc taaaagggct agggacgaaa gggaagttcc agttggagct 1380 gttctcgtgc tcaataacag ggtgattggc gagggttgga atagagccat tggactccat 1440 gatccaacag ctcacgcaga gattatggct cttagacaag gcggcctcgt tatgcagaat 1500 tacagactca tcgacgccac actctacgtt accttcgaac cttgcgttat gtgcgccgga 1560 gctatgatcc attctaggat tggcagggtc gtgttcggcg ttagaaacgc taagacagga 1620 gctgcaggct ctcttatgga cgttcttcat tacccaggca tgaatcatag agtggagatc 1680 acagaaggca ttcttgcaga cgagtgcgca gctctcctttt gctatttctt caggatgccg 1740 aggcaagttt tcaacgctca gaagaaggcc cagtcttcta cagattccgg cggatcttct 1800 ggaggatcta gcggctccga gacaccagga acatccgaat ccgctacacc agagtcttct 1860 ggaggatcta gcggaggatc tcttaaggac aagaagtact cgatcggcct cgccattggg 1920 actaactctg ttggctgggc cgtgatcacc gacgagtaca aggtgccctc aaagaagttc 1980 aaggtcctgg gcaacaccga tcggcattcc atcaagaaga atctcattgg cgctctcctg 2040 ttcgacagcg gcgagacggc tgaggctacg cggctcaagc gcaccgcccg caggcggtac 2100 acgcgcagga agaatcgcat ctgctacctg caggagattt tctccaacga gatggcgaag 2160 gttgacgatt ctttcttcca caggctggag gagtcattcc tcgtggagga ggataagaag 2220 cacgagcggc atccaatctt cggcaacatt gtcgacgagg ttgcctacca cgagaagtac 2280 cctacgatct accatctgcg gaagaagctc gtggactcca cagataaggc ggacctccgc 2340 ctgatctacc tcgctctggc ccacatgatt aagttcaggg gccatttcct gatcgagggg 2400 gatctcaacc cggacaatag cgatgttgac aagctgttca tccagctcgt gcagacgtac 2460 aaccagctct tcgaggagaa ccccattaat gcgtcaggcg tcgacgcgaa ggctatcctg 2520 tccgctaggc tctcgaagtc tcggcgcctc gagaacctga tcgcccagct gccgggcgag 2580 aagagaacg gcctgttcgg gatctcatt gcgctcagcc tggctcac gcccaacttc 2640 aagtcgaatt tcgatctcgc tgaggacgcc aagctgcagc tctccaagga cacatacgac 2700 gatgacctgg ataacctccct ggcccagatc ggcgatcagt acggcggacct gttcctcgct 2760 gccaagaatc tgtcggacgc catcctcctg tctgatattc tcagggtgaa caccgagatt 2820 acgaaggctc cgctctcagc ctccatgatc aagcgctacg acgagcacca tcaggatctg 2880 accctcctga aggcgctggt caggcagcag ctccccgaga agtacagga gatctcttc 2940 gatcagtcga agaacggcta cgctgggtac attgacggcg gggccctca ggaggagttc 3000 tacaagttca tcaagccgat tctggagag atggacggca cggaggagct gctggtgaag 3060 ctcaatcgcg aggaccct gaggaagcag cggacattcg ataacggcag catcccacac 3120 cagattcatc gcacgcttc ctgaggaggc agggactt ctaccctttc 3180 ctcaggata accgcgagaa gatcgagaag attctgactt tcaggatccc gtactacgtc 3240 ggccactcg ctaggggcaa ctcccgctc gcttggatga cccgcaagtc agaggagacg 3300 atcacgccgt ggaacttcga ggaggtggtc gacaagggcg ctagcgctca gtcgttcatc 3360 gagaggatga cgaatttcga caagaacctg ccaaatgaga aggtgctccc taagcactcg 3420 ctcctgtacg agtacttcac agtctacaac gagctgacta aggtgaagta tgtgaccgag 3480 ggcatgagga agccggcttt cctgtctggg gagcagaaga aggccatcgt ggacctcctg 3540 ttcaagacca accggaaggt cacggttaag cagctcaagg aggactactt caagaagatt 3600 gagtgcttcg attcggtcga gatctctggc gttgaggacc gcttcaacgc ctccctgggg 3660 acctaccacg atctcctgaa gatcattaag gataaggact tcctggacaa cgaggagaat 3720 gaggatatcc tcgaggacat tgtgctgaca ctcactctgt tcgaggaccg ggagatgatc 3780 gaggagcgcc tgaagactta cgcccatctc ttcgatgaca aggtcatgaa gcagctcaag 3840 aggaggaggt acaccggctg ggggaggctg agcaggaagc tcatcaacgg cattcgggac 3900 aagcagtccg ggaagacgat cctcgacttc ctgaagagcg atggcttcgc gaaccgcaat 3960 ttcatgcagc tgattcacga tgacagcctc acattcaagg aggatatcca gaaggctcag 4020 gtgagcggcc aggggactc gctccacgag catatcgcga acctcgctgg ctcgccagct 4080 atcaagaagg ggattctgca gaccgtgaag gttgtggacg agctggtgaa ggtcatgggc 4140 aggcacaagc ctgagaacat cgtcattgag atggcccggg agaatcagac cacgcagaag 4200 ggccagaaga actcacggagagagatgaag aggatcgagg agggcattaa ggagctgggg 4260 tcccagatcc tcaaggagca cccggtggag aacacgcagc tgcagaatga gaagctctac 4320 ctgtactacc tccagaatgg ccgcgatatg tatgtggacc aggagctga tattaacagg 4380 ctcagcgatt acgacgtcga tcatatcgtt ccacagtcat tcctgaagga tgactccatt 4440 gacaacaagg tcctcaccag gtcggacaag aaccggggca agtctgataa tgttccttca 4500 gagaggtcg ttaagagat gaaactac tggcgccagc tcctgaatgc caagctgatc 4560 acgcagcgga agttcgataa cctcacaaag gctgagaggg gcgggctctc tgagctggac 4620 aaggcgggct tcatcaagag gcagctggtc gagacacggc agatcactaa gcacgttgcg 4680 4740 gtgaaggtca tcaccctgaa gtcaaagctc gtctccgact tcaggaagga tttccagttc 4800 tacaaggttc gggagatcaa caattaccac catgcccatg acgcgtacct gaacgcggtg 4860 gtcggcacag ctctgatcaa gaagtaccca aagctcgaga gcgagttcgt gtacggggac 4920 tacaaggttt acgatgtgag gaagatgatc gccaagtcgg agcaggagat tggcaaggct 4980 accgccaagt acttcttcta ctctaacatt atgaatttct tcaagacaga gatcactctg 5040 gccaatggcg agatccggaa gcgccccctc atcgagacga acggcgagac gggggagatc 5100 gtgtgggaca agggcaggga tttcgcgacc gtcaggaagg ttctctccat gccacaagtg 5160 aatatcgtca agaagacaga ggtccagact ggcgggttct ctaaggagtc aattctgcct 5220 aagcggaaca gcgacaagct catcgcccgc aagaaggact gggatccgaa gaagtacggc 5280 gggttcgaca gccccactgt ggcctactcg gtcctggttg tggcgaaggt tgagaagggc 5340 aagtccaaga agctcaagag cgtgaaggag ctgctgggga tcacgattat ggagcgctcc 5400 agcttcgaga agaacccgat cgatttcctg gaggcgaagg gctacaagga ggtgaagaag 5460 gacctgatca ttaagctccc caagtactca ctctcgagc tggagaacgg caggaagcgg 5520 atgctggctt ccgctggcga gctgcagaag gggaacgagc tggctctgcc gtccaagtat 5580 gtgaacttcc tctacctggc ctcccactac gagaagctca agggcagccc cgaggacac 5640 gagcagaagc agctgttcgt cgagcagcac agcattacc tcgacgagat cattgagcag 5700 atttccgagt tctccaagcg cgtgatccctg gccgacgcga atctggataa ggtccctcc 5760 gcgtacaaca agcaccgcga caagccaatc agggagcagg ctgagaat cattcatctc 5820 ttcaccctga cgaacctcgg cgcccctgct gctttcaagt acttcgacac actactcgat 5880 cgcaagaggt accaagcac taaggaggtc ctggacgcga ccctcatcca ccagtcgatt 5940 accggccctct acgagacgcg catcgacctg tctcagctcg ggggcgacaa gcggccagcg 6000 gcgacgaaga aggcggggca ggcgagaag agaaggaat tctccggcgg cagcaccac 6060 ctgtccgaca tcatcgagaa ggagacgggc aagcaactcg tgatccagga gagcatccctc 6120 atgctgccag aggaggtgga ggaggtcatc ggcaacaagc cagagtccga catcctggtg 6180 cacaccgcct acgacgagtc caccgacgag aacgtcatgc tctgaccag cgacgcccca 6240 gagtacaagc catgggccct cgtcatccag gacagcaacg gggagaacaa gatcaagatg 6300 ctgtcggggg ggagcccaaa gaagaagcgg aaggtgtag 6339 <210> 26 <211> 6384 <212> DNA <213> Artificial Sequence <220> <223> STEME-NG (APOBEC3A-48aa linker-ecTadA-32aa linker-ecTadA7.10-32aa linker-nCas9-NG (D10A)-NLS-UGI-NLS) <400> 26 atggaggcca gccggctag cggcccaagg catctcatgg acccgcacat cttcaccagc 60 aacttcaaca acggcatcgg caggcacaag acctacttgt gctacgaggt ggagaggctc 120 gacaacggaa cctccgtgaa gatggaccaa cacagggggt tcctccacaa ccaagccaag 180 aacctcctct gcggcttcta cggcaggcac gccgagttga ggttcctcga cttggtgcca 240 tccctccaac tcgatccagc ccaaatctac cgcgtgacct ggttcatctc ctggtcccca 300 tgcttctcct ggggttgcgc cggcgaggtt cgggctttcc tccaagaaaa cacccacgtc 360 cgcctccgca tttcgccgc caggatctat gattacgacc ctctctacaa ggaggccctc 420 cagatgctgc gggacgccgg tgctcaggtg agtatcatga cctacgacga gttcaagcac 480 tgctgggaca ccttcgttga ccaccagggc tgcccattcc aaccatggga cggtctggat 540 gaacacagcc aagccttgtc cggcaggctc cgggccatcc tccaaaacca ggggaactcc 600 gggagcgaga cgccaggcac ctccgagtcg gccaccccag aatcttccgg cggatcttct 660 ggaggatcta gcggctccga gacaccagga acatccgaat ccgctacacc agagtcttct 720 ggaggatcta gcggaggatc ttccgaggtg gagttctctc acgagtattg gatgaggcac 780 gctcttacac ttgctaagag agcttgggac gaaagagaag tgccagttgg cgccgttctt 840 gtgcataata atagggtgat cggcgagggt tggaatagac caattggaag gcatgatcca 900 acagctcacg cagagattat ggctctcaga caaggcggcc tcgttatgca gaactacagg 960 ctcattgacg ctacactcta cgtgacactc gaaccttgcg ttatgtgcgc cggagctatg 1020 attcattcta ggattggcag ggtcgtgttt ggagctaggg acgctaaaac aggagccgcc 1080 ggatctctta tggacgtgtt gcatcatcca ggcatgaacc atagggtgga gattacagag 1140 ggcattcttg cagacgagtg cgctgctctt ctttccgatt tcttcaggat gagaaggcag 1200 gagattaagg cccagaagaa ggctcagtct tctacagata gcggaggatc ttccggagga 1260 tctagcggct ccgagacacc aggaacatcc gaaagcgcta caccagaatc tagcggaggc 1320 tcttccggag gatcttctga agtggagttc tcccacgagt attggatgag gcacgctctt 1380 acacttgcta aaagggctag ggacgaaagg gaagttccag ttggagctgt tctcgtgctc 1440 aataacaggg tgattggcga gggttggaat agagccattg gactccatga tccaacagct 1500 cacgcagaga ttatggctct tagacaaggc ggcctcgtta tgcagaatta cagactcatc 1560 gacgccacac tctacgttac cttcgaacct tgcgttatgt gcgccggagc tatgatccat 1620 tctaggattg gcagggtcgt gttcggcgtt agaaacgcta agacaggagc tgcaggctct 1680 cttatggacg ttcttcatta cccaggcatg aatcatagag tggagatcac agaaggcatt 1740 cttgcagacg agtgcgcagc tctcctttgc tatttcttca ggatgccgag gcaagttttc 1800 aacgctcaga agaaggccca gtcttctaca gattccggcg gatcttctgg aggatctagc 1860 ggctccgaga caccaggaac atccgaatcc gctacaccag agtcttctgg aggatctagc 1920 ggaggatctg aagaagga ctcgatcggc ctcgccattg ggactaactc tgttggctgg 1980 gccgtgatca ccgacgagat caaggtgccc tcaaagaagt tcaaggtcct gggcaacacc 2040 gatcggcatt ccatcaagaa gaatctcatt ggcgctctcc tgttcgacag cggcgagacg 2100 gctgaggcta cgcggctcaa gcgcaccgcc cgcaggcggt acacgcgcag gaagaatcgc 2160 atctgctacc tgcaggagat tttctccaac gagatggcga aggttgacga ttctttcttc 2220 cagaggctgg aggagtcatt cctcgtggag gattaaga agcacgagcg gcatccaatc 2280 ttcggcaaca ttgtcgacga ggttgcctac cacgagaagt accctacgat ctaccatctg 2340 cggaagaagc tcgtggactc cacagataag gcggacctcc gcctgatcta cctcgctctg 2400 gcccacatga ttaagttcag gggccatttc ctgatcgagg gggatctcaa cccggacaat 2460 agcgatgttg acaagctgtt catccagctc gtgcagacgt aaccagct cttcgaggag 2520 aaccccatta atgcgtcagg cgtcgacgcg aaggctatcc tgtccgctag gctctcgaag 2580 tctcggcgcc tcgagaacct gatcgcccag ctgccgggcg yours cggcctgttc 2640 gggaatctca ttgcgctcag cctggggctc acgcccaact tcaagtcgaa tttcgatctc 2700 gctgaggacg ccaagctgca gctctccaag gacacatacg acgatgacct ggataacctc 2760 ctggcccaga tcggcgatca gtacgcggac ctgttcctcg ctgccaagaa tctgtcggac 2820 gccatcctcc tgtctgatat tctcagggtg aacaccgaga ttacgaaggc tccgctctca 2880 gcctccatga tcaagcgcta cgacgagcac catcaggatc tgaccctcct gaaggcgctg 2940 gtcaggcagc agctccccga gaagtacaag gagatcttct tcgatcagtc gaagaacggc 3000 tacgctgggt acattgacgg cggggcctct caggaggagt tctacaagtt catcaagccg 3060 3120 ctgaggaagc agcggacatt cgataacggc agcatcccac accagattca tctcggggag 3180 3240 aagatcgaga agattctgac tttcaggatc ccgtactacg tcggcccact cgctaggggc 3300 aactcccgct tcgcttggat gacccgcaag tcagaggaga cgatcacgcc gtggaacttc 3360 gaggaggtgg tcgacaaggg cgctagcgct cagtcgttca tcgagaggat gacgaatttc 3420 gacaagaacc tgccaaatga gaaggtgctc cctaagcact cgctcctgta cgagtacttc 3480 acagtctaca acgagctgac taaggtgaag tatgtgaccg agggcatgag gaagccggct 3540 ttcctgtctg gggagcagaa gaaggccatc gtggacctcc tgttcaagac caaccggaag 3600 gtcacggtta agcagctcaa ggaggactac ttcaagaaga ttgagtgctt cgattcggtc 3660 gagatctctg gcgttgagga ccgcttcaac gcctccctgg ggacctacca cgatctcctg 3720 aagatcatta aggataagga cttcctggac aacgaggaga atgaggatat cctcgaggac 3780 attgtgctga cactcactct gttcgaggac cgggagatga tcgaggagcg cctgaagact 3840 tacgcccatc tcttcgatga caaggtcatg aagcagctca agagggag gtacaccggc 3900 tgggggaggc tgagcaggaa gctcatcaac ggcattcggg acaagcagtc cgggaagacg 3960 atcctcgact tcctgaagag cgatggcttc gcgaaccgca atttcatgca gctgattcac 4020 gatgacagcc tcacattca ggaggatatc cagaaggctc aggtgagcgg ccagggggac 4080 tcgctgcacg agcatatcgc gaacctcgct ggctcgccag ctatcaagaa ggggattctg 4140 cagaccgtga aggttgtgga cgagctggtg aaggtcatgg gcaggcacaa gcctgagaac 4200 atcgtcattg agatggcccg ggagaatcag accacgcaga agggccagaa gaactcacgc 4260 gagaggatga agaggatcga ggaggcatt aggagctgg ggtcccagat cctcaggag 4320 cacccggtgg agaacacgca gctgcagaat gagaagctct acctgtacta cctccagaat 4380 ggccgcgata tgtagtgga ccaggagctg gatattaaca ggctcagcga ttacgacgtc 4440 gatcatatcg ttccacagtc attcctgaag gatgactcca ttgacaacaa ggtcctcacc 4500 aggtcggaca agaccgggg caagtctgat aatgttcctt cagaggaggt cgttaagaag 4560 atgagaact actggcgcca gctcctgaat gccaagctga tcaccagcg gaagttcgat 4620 aacctcacaa aggctgagag gggcggggctc tctgagctgg acaggcggg cttcatcaag 4680 aggcagctgg tcgagacacg gcagatcact aagcacgttg cgcagattct cgactcacgg 4740 atgaacacta agtacgatga gaatgacaag ctgatccgcg aggtgaaggt catcaccctg 4800 aagtcaaagc tcgtctccga cttcaggaag gatttccagt tctacaaggt tcgggagatc 4860 aacaattacc accatgccca tgacgcgtac ctgaacgcgg tggtcggcac agctctgatc 4920 aagaagtacc caaagctcga gagcgagttc gtgtacgggg actacaaggt ttacgatgtg 4980 aggaagatga tcgccaagtc ggagcaggag attggcaagg ctaccgccaa gtacttcttc 5040 tactctaaca ttatgaattt cttcaagaca gagatcactc tggccaatgg cgagatccgg 5100 aagcgccccc tcatcgagac gaacggcgag acgggggaga tcgtgtggga caagggcagg 5160 gatttcgcga ccgtcaggaa ggttctctcc atgccacaag tgaatatcgt caagaagaca 5220 gaggtccaga ctggcgggtt ctctaaggag tcaattcggc ctaagcggaa cagcgacaag 5280 ctcatcgccc gcaagaagga ctgggatccg aagaagtacg gcgggttcgt cagccccact 5340 gtggcctact cggtcctggt tgtggcgaag gttgagaagg gcaagtccaa gaagctcaag 5400 agcgtgaagg agctgctggg gatcacgatt atggagcgct ccagcttcga gaagaacccg 5460 atcgatttcc tggaggcgaa gggctacaag gaggtgaaga aggacctgat cattaagctc 5520 cccaagtact cactcttcga gctggagaac ggcaggaagc ggatgctggc ttccgctcgc 5580 ttcctgcaga agggggaacga gctggctctg ccgtccaagt atgtgaactt cctctacctg 5640 gcctccact acgagaagct caagggcagc cccgaggaca agagcagaa gcagctgttc 5700 gtcgagcagc acaagcatta cctcgacgag atcattgagc agatttccga gttctccaag 5760 cgcgtgatcc tggccgacgc gaatctggat aaggtcctct ccgcgtacaa caagcaccgc 5820 gacaagccaa tcagggagca ggctgagaat atcattcatc tcttcaccct gacgaacctc 5880 ggcgccccctc gtgctttcaa gtacttcgac acaactatcg atcgcaaggt atacagaagc 5940 actaaggagg tcctggacgc gaccctcatc caccagtcga ttaccggcct ctacgagacg 6000 cgcatcgacc tgtctcagct cggggcgac aagcggccag cggcgacgaa gaaggcgggg 6060 ccgcgactcc ggcggcagca cgaacctctc cgacatcatc 6120 gagaaggaga cgggcaagca gctcgtgatc caggagagca tcctcatgct gccggaggag 6180 gtggaggagg tcatcggcaa caagcccgag tccgacatcc tcgtgcacac cgcctacgac 6240 gagtccacgg acgagaacgt catgctcctg acgagcgacg ctccagagta caagccatgg 6300 gctctcgtga tccaggacag caacggcgag aacaagatca agatgctgtc cggcggctcc 6360 ccaaagaaga agcggaaggt gtag 6384 <210> 27 <211> 79 <212> RNA <213> Artificial Sequence <220> <223> sgRNA <400> 27 guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc cguuaucaac uugaaaaagu 60 ggcaccgagu cggugcuuu 79 <210> 28 <211> 89 <212> RNA <213> Artificial Sequence <220> <223> esgRNA <400> 28 guuuaagagc uaugcuggaa acagcauagc aaguuuaaau aaggcuaguc cguuaucaac 60 uugaaaaagu ggcaccgagu cggugcuuu 89 <210> 29 <211> 1700 <212> PRT <213> Artificial Sequence <220> <223> A3A-PBE-NG (APOBEC3A-16aa linker-nCas9 (D10A)-NLS-UGI-NLS) <400> 29 Met Glu Ala Ser Pro Ala Ser Gly Pro Arg His Leu Met Asp Pro His 1 5 10 15 Ile Phe Thr Ser Asn Phe Asn Asn Gly Ile Gly Arg His Lys Thr Tyr 20 25 30 Leu Cys Tyr Glu Val Glu Arg Leu Asp Asn Gly Thr Ser Val Lys Met 35 40 45 Asp Gln His Arg Gly Phe Leu His Asn Gln Ala Lys Asn Leu Leu Cys 50 55 60 Gly Phe Tyr Gly Arg His Ala Glu Leu Arg Phe Leu Asp Leu Val Pro 65 70 75 80 Ser Leu Gln Leu Asp Pro Ala Gln Ile Tyr Arg Val Thr Trp Phe Ile 85 90 95 Ser Trp Ser Pro Cys Phe Ser Trp Gly Cys Ala Gly Glu Val Arg Ala 100 105 110 Phe Leu Gln Glu Asn Thr His Val Arg Leu Arg Ile Phe Ala Ala Arg 115 120 125 Ile Tyr Asp Tyr Asp Pro Leu Tyr Lys Glu Ala Leu Gln Met Leu Arg 130 135 140 Asp Ala Gly Ala Gln Val Ser Ile Met Thr Tyr Asp Glu Phe Lys His 145 150 155 160 Cys Trp Asp Thr Phe Val Asp His Gln Gly Cys Pro Phe Gln Pro Trp 165 170 175 Asp Gly Leu Asp Glu His Ser Gln Ala Leu Ser Gly Arg Leu Arg Ala 180 185 190 Ile Leu Gln Asn Gln Gly Asn Ser Gly Ser Glu Thr Pro Gly Thr Ser 195 200 205 Glu Ser Ala Thr Pro Glu Ser Leu Lys Asp Lys Lys Tyr Ser Ile Gly 210 215 220 Leu Ala Ile Gly Thr Asn Ser Val Gly Trp Ala Val Ile Thr Asp Glu 225 230 235 240 Tyr Lys Val Pro Ser Lys Lys Phe Lys Val Leu Gly Asn Thr Asp Arg 245 250 255 His Ser Ile Lys Lys Asn Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly 260 265 270 Glu Thr Ala Glu Ala Thr Arg Leu Lys Arg Thr Ala Arg Arg Arg Tyr 275 280 285 Thr Arg Arg Lys Asn Arg Ile Cys Tyr Leu Gln Glu Ile Phe Ser Asn 290 295 300 Glu Met Ala Lys Val Asp Asp Ser Phe Phe His Arg Leu Glu Glu Ser 305 310 315 320 Phe Leu Val Glu Glu Asp Lys Lys His Glu Arg His Pro Ile Phe Gly 325 330 335 Asn Ile Val Asp Glu Val Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr 340 345 350 His Leu Arg Lys Lys Leu Val Asp Ser Thr Asp Lys Ala Asp Leu Arg 355 360 365 Leu Ile Tyr Leu Ala Leu Ala His Met Ile Lys Phe Arg Gly His Phe 370 375 380 Leu Ile Glu Gly Asp Leu Asn Pro Asp Asn Ser Asp Val Asp Lys Leu 385 390 395 400 Phe Ile Gln Leu Val Gln Thr Tyr Asn Gln Leu Phe Glu Glu Asn Pro 405 410 415 Ile Asn Ala Ser Gly Val Asp Ala Lys Ala Ile Leu Ser Ala Arg Leu 420 425 430 Ser Lys Ser Arg Arg Leu Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu 435 440 445 Lys Lys Asn Gly Leu Phe Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu 450 455 460 Thr Pro Asn Phe Lys Ser Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu 465 470 475 480 Gln Leu Ser Lys Asp Thr Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala 485 490 495 Gln Ile Gly Asp Gln Tyr Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu 500 505 510 Ser Asp Ala Ile Leu Leu Ser Asp Ile Leu Arg Val Asn Thr Glu Ile 515 520 525 Thr Lys Ala Pro Leu Ser Ala Ser Met Ile Lys Arg Tyr Asp Glu His 530 535 540 His Gln Asp Leu Thr Leu Leu Lys Ala Leu Val Arg Gln Gln Leu Pro 545 550 555 560 Glu Lys Tyr Lys Glu Ile Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala 565 570 575 Gly Tyr Ile Asp Gly Gly Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile 580 585 590 Lys Pro Ile Leu Glu Lys Met Asp Gly Thr Glu Glu Leu Leu Val Lys 595 600 605 Leu Asn Arg Glu Asp Leu Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly 610 615 620 Ser Ile Pro His Gln Ile His Leu Gly Glu Leu His Ala Ile Leu Arg 625 630 635 640 Arg Gln Glu Asp Phe Tyr Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile 645 650 655 Glu Lys Ile Leu Thr Phe Arg Ile Pro Tyr Tyr Val Gly Pro Leu Ala 660 665 670 Arg Gly Asn Ser Arg Phe Ala Trp Met Thr Arg Lys Ser Glu Glu Thr 675 680 685 Ile Thr Pro Trp Asn Phe Glu Glu Val Val Asp Lys Gly Ala Ser Ala 690 695 700 Gln Ser Phe Ile Glu Arg Met Thr Asn Phe Asp Lys Asn Leu Pro Asn 705 710 715 720 Glu Lys Val Leu Pro Lys His Ser Leu Leu Tyr Glu Tyr Phe Thr Val 725 730 735 Tyr Asn Glu Leu Thr Lys Val Lys Tyr Val Thr Glu Gly Met Arg Lys 740 745 750 Pro Ala Phe Leu Ser Gly Glu Gln Lys Lys Ala Ile Val Asp Leu Leu 755 760 765 Phe Lys Thr Asn Arg Lys Val Thr Val Lys Gln Leu Lys Glu Asp Tyr 770 775 780 Phe Lys Lys Ile Glu Cys Phe Asp Ser Val Glu Ile Ser Gly Val Glu 785 790 795 800 Asp Arg Phe Asn Ala Ser Leu Gly Thr Tyr His Asp Leu Leu Lys Ile 805 810 815 Ile Lys Asp Lys Asp Phe Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu 820 825 830 Glu Asp Ile Val Leu Thr Leu Thr Leu Phe Glu Asp Arg Glu Met Ile 835 840 845 Glu Glu Arg Leu Lys Thr Tyr Ala His Leu Phe Asp Asp Lys Val Met 850 855 860 Lys Gln Leu Lys Arg Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg 865 870 875 880 Lys Leu Ile Asn Gly Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu 885 890 895 Asp Phe Leu Lys Ser Asp Gly Phe Ala Asn Arg Asn Phe Met Gln Leu 900 905 910 Ile His Asp Asp Ser Leu Thr Phe Lys Glu Asp Ile Gln Lys Ala Gln 915 920 925 Val Ser Gly Gln Gly Asp Ser Leu His Glu His Ile Ala Asn Leu Ala 930 935 940 Gly Ser Pro Ala Ile Lys Lys Gly Ile Leu Gln Thr Val Lys Val Val 945 950 955 960 Asp Glu Leu Val Lys Val Met Gly Arg His Lys Pro Glu Asn Ile Val 965 970 975 Ile Glu Met Ala Arg Glu Asn Gln Thr Thr Gln Lys Gly Gln Lys Asn 980 985 990 Ser Arg Glu Arg Met Lys Arg Ile Glu Glu Gly Ile Lys Glu Leu Gly 995 1000 1005 Ser Gln Ile Leu Lys Glu His Pro Val Glu Asn Thr Gln Leu Gln 1010 1015 1020 Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu Gln Asn Gly Arg Asp Met 1025 1030 1035 Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg Leu Ser Asp Tyr Asp 1040 1045 1050 Val Asp His Ile Val Pro Gln Ser Phe Leu Lys Asp Asp Ser Ile 1055 1060 1065 Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg Gly Lys Ser 1070 1075 1080 Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys Asn Tyr 1085 1090 1095 Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys Phe 1100 1105 1110 Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp 1115 1120 1125 Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile 1130 1135 1140 Thr Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys 1145 1150 1155 Tyr Asp Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr 1160 1165 1170 Leu Lys Ser Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe 1175 1180 1185 Tyr Lys Val Arg Glu Ile Asn Asn Tyr His His Ala His Asp Ala 1190 1195 1200 Tyr Leu Asn Ala Val Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro 1205 1210 1215 Lys Leu Glu Ser Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp 1220 1225 1230 Val Arg Lys Met Ile Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala 1235 1240 1245 Thr Ala Lys Tyr Phe Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys 1250 1255 1260 Thr Glu Ile Thr Leu Ala Asn Gly Glu Ile Arg Lys Arg Pro Leu 1265 1270 1275 Ile Glu Thr Asn Gly Glu Thr Gly Glu Ile Val Trp Asp Lys Gly 1280 1285 1290 Arg Asp Phe Ala Thr Val Arg Lys Val Leu Ser Met Pro Gln Val 1295 1300 1305 Asn Ile Val Lys Lys Thr Glu Val Gln Thr Gly Gly Phe Ser Lys 1310 1315 1320 Glu Ser Ile Arg Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala Arg 1325 1330 1335 Light Light Asp Trp Asp Pro Light Light Tyr Gly Gly Phe Val Ser Pro 1340 1345 1350 Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val Glu Lys Gly 1355 1360 1365 Lys Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr 1370 1375 1380 Ile Met Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu 1385 1390 1395 Glu Ala Lys Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys 1400 1405 1410 Leu Pro Lys Tyr Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg 1415 1420 1425 Met Leu Ala Ser Ala Arg Phe Leu Gln Lys Gly Asn Glu Leu Ala 1430 1435 1440 Leu Pro Ser Lys Tyr Val Asn Phe Leu Tyr Leu Ala Ser His Tyr 1445 1450 1455 Glu Lys Leu Lys Gly Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu 1460 1465 1470 Phe Val Glu Gln His Lys His Tyr Leu Asp Glu Ile Ile Glu Gln 1475 1480 1485 Ile Ser Glu Phe Ser Lys Arg Val Ile Leu Ala Asp Ala Asn Leu 1490 1495 1500 Asp Lys Val Leu Ser Ala Tyr Asn Lys His Arg Asp Lys Pro Ile 1505 1510 1515 Arg Glu Gln Ala Glu Asn Ile Ile His Leu Phe Thr Leu Thr Asn 1520 1525 1530 Leu Gly Ala Pro Arg Ala Phe Lys Tyr Phe Asp Thr Thr Ile Asp 1535 1540 1545 Arg Lys Val Tyr Arg Ser Thr Lys Glu Val Leu Asp Ala Thr Leu 1550 1555 1560 Ile His Gln Ser Ile Thr Gly Leu Tyr Glu Thr Arg Ile Asp Leu 1565 1570 1575 Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala Thr Lys Lys Ala 1580 1585 1590 Gly Gln Ala Lys Lys Lys Lys Glu Phe Ser Gly Gly Ser Thr Asn 1595 1600 1605 Leu Ser Asp Ile Ile Glu Lys Glu Thr Gly Lys Gln Leu Val Ile 1610 1615 1620 Gln Glu Ser Ile Leu Met Leu Pro Glu Glu Val Glu Glu Val Ile 1625 1630 1635 Gly Asn Lys Pro Glu Ser Asp Ile Leu Val His Thr Ala Tyr Asp 1640 1645 1650 Glu Ser Thr Asp Glu Asn Val Met Leu Leu Thr Ser Asp Ala Pro 1655 1660 1665 Glu Tyr Lys Pro Trp Ala Leu Val Ile Gln Asp Ser Asn Gly Glu 1670 1675 1680 Asn Lys Ile Lys Met Leu Ser Gly Gly Ser Pro Lys Lys Lys Arg 1685 1690 1695 Lys Val 1700 <210> 30 <211> 1797 <212> PRT <213> Artificial Sequence <220> <223> PABE7-NG (ecTadA-32aa linker-ecTadA7.10-32aa linker-nCas9-NG (D10A)-NLS-NLS-NLS) <400> 30 Met Ser Glu Val Glu Phe Ser His Glu Tyr Trp Met Arg His Ala Leu 1 5 10 15 Thr Leu Ala Lys Arg Ala Trp Asp Glu Arg Glu Val Pro Val Gly Ala 20 25 30 Val Leu Val His Asn Asn Arg Val Ile Gly Glu Gly Trp Asn Arg Pro 35 40 45 Ile Gly Arg His Asp Pro Thr Ala His Ala Glu Ile Met Ala Leu Arg 50 55 60 Gln Gly Gly Leu Val Met Gln Asn Tyr Arg Leu Ile Asp Ala Thr Leu 65 70 75 80 Tyr Val Thr Leu Glu Pro Cys Val Met Cys Ala Gly Ala Met Ile His 85 90 95 Ser Arg Ile Gly Arg Val Val Phe Gly Ala Arg Asp Ala Lys Thr Gly 100 105 110 Ala Ala Gly Ser Leu Met Asp Val Leu His His Pro Gly Met Asn His 115 120 125 Arg Val Glu Ile Thr Glu Gly Ile Leu Ala Asp Glu Cys Ala Ala Leu 130 135 140 Leu Ser Asp Phe Phe Arg Met Arg Arg Gln Glu Ile Lys Ala Gln Lys 145 150 155 160 Lys Ala Gln Ser Ser Thr Asp Ser Gly Gly Ser Ser Gly Gly Ser Ser 165 170 175 Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser Ala Thr Pro Glu Ser Ser 180 185 190 Gly Gly Ser Ser Gly Gly Ser Ser Glu Val Glu Phe Ser His Glu Tyr 195 200 205 Trp Met Arg His Ala Leu Thr Leu Ala Lys Arg Ala Arg Asp Glu Arg 210 215 220 Glu Val Pro Val Gly Ala Val Leu Val Leu Asn Asn Arg Val Ile Gly 225 230 235 240 Glu Gly Trp Asn Arg Ala Ile Gly Leu His Asp Pro Thr Ala His Ala 245 250 255 Glu Ile Met Ala Leu Arg Gln Gly Gly Leu Val Met Gln Asn Tyr Arg 260 265 270 Leu Ile Asp Ala Thr Leu Tyr Val Thr Phe Glu Pro Cys Val Met Cys 275 280 285 Ala Gly Ala Met Ile His Ser Arg Ile Gly Arg Val Val Phe Gly Val 290 295 300 Arg Asn Ala Lys Thr Gly Ala Ala Gly Ser Leu Met Asp Val Leu His 305 310 315 320 Tyr Pro Gly Met Asn His Arg Val Glu Ile Thr Glu Gly Ile Leu Ala 325 330 335 Asp Glu Cys Ala Ala Leu Leu Cys Tyr Phe Phe Arg Met Pro Arg Gln 340 345 350 Val Phe Asn Ala Gln Lys Lys Ala Gln Ser Ser Thr Asp Ser Gly Gly 355 360 365 Ser Ser Gly Gly Ser Ser Gly Ser Glu Thr Pro Gly Thr Ser Glu Ser 370 375 380 Ala Thr Pro Glu Ser Ser Gly Gly Ser Ser Gly Gly Ser Asp Lys Lys 385 390 395 400 Tyr Ser Ile Gly Leu Ala Ile Gly Thr Asn Ser Val Gly Trp Ala Val 405 410 415 Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Phe Lys Val Leu Gly 420 425 430 Asn Thr Asp Arg His Ser Ile Lys Lys Asn Ile Gly Ala Leu 435 440 445 Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu Lys Arg Thr Ala 450 455 460 Arg Arg Thr Thr Arg Lys Asn Arg Ile Cys Tyr Leu Gln Glu 465 470 475 480 Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser Phe Phe His Arg 485,490,495 Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys His Glu Arg His 500 505 510 Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr His Glu Lys Tyr 515,520,525 Pro Thr Ile Tyr His Leu Arg Lys Leu Val Asp Ser Thr Asp Lys 530 535 540 Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His Met Ile Lys Phe 545 550 555 560 Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro Asp Asn Ser Asp 565 570 575 Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr Asn Gln Leu Phe 580 585 590 Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala Lys Ala Ile Leu 595 600 605 Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn Leu Ile Ala Gln 610 615 620 Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn Leu Ile Ala Leu 625 630 635 640 Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe Asp Leu Ala Glu 645 650 655 Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp Asp Asp Leu Asp 660 665 670 Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp Leu Phe Leu Ala 675 680 685 Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp Ile Leu Arg Val 690 695 700 Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser Met Ile Lys Arg 705 710 715 720 Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys Ala Leu Val Arg 725 730 735 Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe Asp Gln Ser Lys 740 745 750 Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser Gln Glu Glu Phe 755 760 765 Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp Gly Thr Glu Glu 770 775 780 Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg Lys Gln Arg Thr 785 790 795 800 Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu Gly Glu Leu His 805 810 815 Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe Leu Lys Asp Asn 820 825 830 Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile Pro Tyr Tyr Val 835 840 845 Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp Met Thr Arg Lys 850 855 860 Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu Val Val Asp Lys 865 870 875 880 Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn Phe Asp Lys 885 890 895 Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser Leu Leu Tyr Glu 900 905 910 Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr Val Thr Glu 915 920 925 Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys Lys Ala Ile 930 935 940 Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val Lys Gln Leu 945 950 955 960 Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp Ser Val Glu Ile 965 970 975 Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly Thr Tyr His Asp 980 985 990 Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp Asn Glu Glu Asn 995 1000 1005 Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr Leu Phe Glu 1010 1015 1020 Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala His Leu 1025 1030 1035 Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr Thr 1040 1045 1050 Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp 1055 1060 1065 Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly 1070 1075 1080 Phe Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu 1085 1090 1095 Thr Phe Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly 1100 1105 1110 Asp Ser Leu His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala 1115 1120 1125 Ile Lys Lys Gly Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu 1130 1135 1140 Val Lys Val Met Gly Arg His Lys Pro Glu Asn Ile Val Ile Glu 1145 1150 1155 Met Ala Arg Glu Asn Gln Thr Thr Gln Lys Gly Gln Lys Asn Ser 1160 1165 1170 Arg Glu Arg Met Lys Arg Ile Glu Glu Gly Ile Lys Glu Leu Gly 1175 1180 1185 Ser Gln Ile Leu Lys Glu His Pro Val Glu Asn Thr Gln Leu Gln 1190 1195 1200 Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu Gln Asn Gly Arg Asp Met 1205 1210 1215 Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg Leu Ser Asp Tyr Asp 1220 1225 1230 Val Asp His Ile Val Pro Gln Ser Phe Leu Lys Asp Asp Ser Ile 1235 1240 1245 Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg Gly Lys Ser 1250 1255 1260 Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys Asn Tyr 1265 1270 1275 Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys Phe 1280 1285 1290 Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp 1295 1300 1305 Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile 1310 1315 1320 Thr Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys 1325 1330 1335 Tyr Asp Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr 1340 1345 1350 Leu Lys Ser Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe 1355 1360 1365 Tyr Lys Val Arg Glu Ile Asn Asn Tyr His His Ala His Asp Ala 1370 1375 1380 Tyr Leu Asn Ala Val Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro 1385 1390 1395 Lys Leu Glu Ser Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp 1400 1405 1410 Val Arg Lys Met Ile Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala 1415 1420 1425 Thr Ala Lys Tyr Phe Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys 1430 1435 1440 Thr Glu Ile Thr Leu Ala Asn Gly Glu Ile Arg Lys Arg Pro Leu 1445 1450 1455 Ile Glu Thr Asn Gly Glu Thr Gly Glu Ile Val Trp Asp Lys Gly 1460 1465 1470 Arg Asp Phe Ala Thr Val Arg Lys Val Leu Ser Met Pro Gln Val 1475 1480 1485 Asn Ile Val Lys Lys Thr Glu Val Gln Thr Gly Gly Phe Ser Lys 1490 1495 1500 Glu Ser Ile Arg Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala Arg 1505 1510 1515 Light Light Asp Trp Asp Pro Light Light Tyr Gly Gly Phe Val Ser Pro 1520 1525 1530 Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val Glu Lys Gly 1535 1540 1545 Lys Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr 1550 1555 1560 Ile Met Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu 1565 1570 1575 Glu Ala Lys Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys 1580 1585 1590 Leu Pro Lys Tyr Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg 1595 1600 1605 Met Leu Ala Ser Ala Arg Phe Leu Gln Lys Gly Asn Glu Leu Ala 1610 1615 1620 Leu Pro Ser Lys Tyr Val Asn Phe Leu Tyr Leu Ala Ser His Tyr 1625 1630 1635 Glu Lys Leu Lys Gly Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu 1640 1645 1650 Phe Val Glu Gln His Lys His Tyr Leu Asp Glu Ile Ile Glu Gln 1655 1660 1665 Ile Ser Glu Phe Ser Lys Arg Val Ile Leu Ala Asp Ala Asn Leu 1670 1675 1680 Asp Lys Val Leu Ser Ala Tyr Asn Lys His Arg Asp Lys Pro Ile 1685 1690 1695 Arg Glu Gln Ala Glu Asn Ile Ile His Leu Phe Thr Leu Thr Asn 1700 1705 1710 Leu Gly Ala Pro Arg Ala Phe Lys Tyr Phe Asp Thr Thr Ile Asp 1715 1720 1725 Arg Lys Val Tyr Arg Ser Thr Lys Glu Val Leu Asp Ala Thr Leu 1730 1735 1740 Ile His Gln Ser Ile Thr Gly Leu Tyr Glu Thr Arg Ile Asp Leu 1745 1750 1755 Ser Gln Leu Gly Gly Asp Ser Gly Gly Ser Pro Lys Lys Lys Arg 1760 1765 1770 Lys Val Ser Gly Gly Ser Pro Lys Lys Lys Arg Lys Val Ser Gly 1775 1780 1785 Gly Ser Pro Lys Lys Lys Arg Lys Val 1790 1795 <210> 31 <211> 1400 <212> PRT <213> Artificial Sequence <220> <223> pCas9-NG (NLS-nCas9-NG-NLS) <400> 31 Met Ala Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala 1 5 10 15 Ala Asp Lys Lys Tyr Ser Ile Gly Leu Ala Ile Gly Thr Asn Ser Val 20 25 30 Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe 35 40 45 Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile 50 55 60 Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu 65 70 75 80 Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys 85 90 95 Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser 100 105 110 Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys 115 120 125 His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr 130 135 140 His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp 145 150 155 160 Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His 165 170 175 Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro 180 185 190 Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr 195 200 205 Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala 210 215 220 Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn 225 230 235 240 Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn 245 250 255 Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe 260 265 270 Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp 275 280 285 Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp 290 295 300 Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp 305 310 315 320 Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser 325 330 335 Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys 340 345 350 Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe 355 360 365 Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser 370 375 380 Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp 385 390 395 400 Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg 405 410 415 Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu 420 425 430 Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe 435 440 445 Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile 450 455 460 Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp 465 470 475 480 Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu 485 490 495 Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr 500 505 510 Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser 515 520 525 Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys 530 535 540 Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln 545 550 555 560 Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr 565 570 575 Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp 580 585 590 Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly 595 600 605 Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp 610 615 620 Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr 625 630 635 640 Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala 645 650 655 His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr 660 665 670 Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp 675 680 685 Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe 690 695 700 Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe 705 710 715 720 Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu 725 730 735 His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly 740 745 750 Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly 755 760 765 Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln 770 775 780 Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile 785 790 795 800 Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro 805 810 815 Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu 820 825 830 Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg 835 840 845 Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu Lys 850 855 860 Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg 865 870 875 880 Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys 885 890 895 Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys 900 905 910 Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp 915 920 925 Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr 930 935 940 Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp 945 950 955 960 Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser 965 970 975 Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg 980 985 990 Glu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val 995 1000 1005 Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu 1010 1015 1020 Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile 1025 1030 1035 Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe 1040 1045 1050 Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu 1055 1060 1065 Ala Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly 1070 1075 1080 Glu Thr Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr 1085 1090 1095 Val Arg Lys Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys 1100 1105 1110 Thr Glu Val Gln Thr Gly Gly Phe Ser Lys Glu Ser Ile Arg Pro 1115 1120 1125 Lys Arg Asn Ser Asp Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp 1130 1135 1140 Pro Lys Lys Tyr Gly Gly Phe Val Ser Pro Thr Val Ala Tyr Ser 1145 1150 1155 Val Leu Val Val Ala Lys Val Glu Lys Gly Lys Ser Lys Lys Leu 1160 1165 1170 Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met Glu Arg Ser 1175 1180 1185 Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys Gly Tyr 1190 1195 1200 Lys Glu Val Lys Asp Leu Ile Ile Lys Pro Lys Tyr Ser 1205 1210 1215 Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala 1220 1225 1230 Arg Phe Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr 1235 1240 1245 Validity Of Leu Tyr Leu Ala Is Tyr Glu Lys Leu Lys Gly 1250 1255 1260 Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His 1265 1270 1275 Lys His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser 1280 1285 1290 Lys Arg Is A Lion And Asp Is A Asn Lion Asp Lys Val Lion Ser 1295 1300 1305 Only Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu 1310 1315 1320 Asn Ile Ile His You Are The One Pro Arg 1325 1330 1335 Ala Phe Lys Tyr Phe Asp Thr Thr Ile Asp Arg Lys Val Tyr Arg 1340 1345 1350 Ser Thr Lys Glu Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile 1355 1360 1365 Thr Gly Leu Tyr Glu Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly 1370 1375 1380 Asp Lys Arg Pro Ala Ala Thr Lys Lys Ala Gly Gln Ala Lys Lys 1385 1390 1395 Lys Lys 1400 Brief description of the attached diagram

[0075] Figure 1 STEME performs base editing via the fusion of cytidine and adenine deaminase. (a) STEME-mediated C:G>T:A and / or A:T>G:C base editing strategies. (b) Structures of STEME-1, STEME-2, STEME-3, and STEME-4. ecTadA7.10: Evolved E. coli TadA; aa, amino acid; XTEN: 16-amino acid linker.

[0076] Figure 2 pOsU3-esgRNA expression vector. (a) Construct of pOsU3-esgRNA. (b) Sequence and stem-loop comparison between the native sgRNA scaffold and the esgRNA scaffold. esgRNA is preferably used in this invention.

[0077] Figure 3 Editing efficiency of STEME-1, STEME-2, STEME-3, and STEME-4 in protoplasts. (a) Comparison of C>T base editing frequencies among A3A-PBE and the four STEME constructs (n=3). (b) Comparison of A>G base editing frequencies among PABE-7 and the four STEME constructs (n=3). Untreated protoplast samples were used as controls. Values ​​and error bars reflect the mean ± sem of three independent biological replicates.

[0078] Figure 4 The activity and purity of STEME-1, STEME-2, STEME-3 and STEME-4 in rice protoplasts. (a)-(f) are the target sequences of OsAAT, OsACC, OsCDC48, OsDEP1, OsEV and OsOD, respectively.

[0079] Figure 5 Comparison of base editing efficiencies of STEME-1, STEME-5, and STEME-6 in rice protoplasts. (a) Structures of STEME-5 and STEME-6. ecTadA7.10: evolved E. coli TadA; aa, amino acid; XTEN: 16-amino acid linker. (b) Comparison of C>T base editing frequencies in A3A-PBE, STEME-1, STEME-5, and STEME-6 constructs. (c) Comparison of A>G base editing frequencies in PABE-7, STEME-1, STEME-5, and STEME-6 constructs. Untreated protoplast samples were used as controls. Values ​​and error bars reflect the mean ± sem of three independent biological replicates.

[0080] Figure 6 Insertion / deletion (indel) efficiency of STEME in rice protoplasts compared to Cas9. (a) Comparison of indel efficiency of A3A-PBE, PABE-7, STEME-1, STEME-2, STEME-3, and STEME-4 constructs in rice protoplasts. (b) Comparison of indel efficiency of A3A-PBE, PABE-7, STEME-1, STEME-5, and STEME-6 constructs in rice protoplasts. Untreated protoplast samples were used as controls. Values ​​and error bars reflect the mean ± sem of three independent biological replicates.

[0081] Figure 7 STEME-NG for saturation de novo mutagenesis in rice protoplasts. (a) Percentage of 20nt target sequences containing NGGPAM and NG PAM in the rice genome. (b) Structure of STEME-NG.

[0082] Figure 8 Design of NG PAM targets at different rice loci. (a) Structures of A3A-PBE-NG, PABE7-NG, and pCas9-NG. ecTadA7.10: evolved E. coli TadA; aa, amino acid; XTEN: 16-amino acid linker. (b) Sequences of 16 NG PAM targets from four loci in the rice genome. (c) Loci OsAAT, OsCDC48, OsDEP1, and OsODEV and their NG PAM target sequence diagrams.

[0083] Figure 9 STEME-NG can broadly edit target sequences with NGA, NGT, NGC, or NGG PAM. STEME-1 was used as a control with NGG PAM and untreated protoplast samples. Values ​​and error bars reflect the mean ± sem of three independent biological replicates.

[0084] Figure 10 Activity and purity of STEME-NG in rice protoplasts. (a)-(p) are NG PAM target sequences from the OsAAT, OsCDC48, OsDEP1 and OsEVOD loci, respectively.

[0085] Figure 11 The basal editing efficiencies of A3A-PBE-NG and PABE7-NG in rice protoplasts for C>T and A>G, respectively, were assessed. Both A3A-PBE-NG(a) and PABE7-NG(b) demonstrated broad-spectrum editing capabilities for NGA, NGT, NGC, or NGG PAM targets. Untreated protoplast samples served as controls. Values ​​and error bars reflect the mean ± sem of three independent biological replicates.

[0086] Figure 12 Saturation de novo mutagenesis of key domains of the OsACC protein using STEME-NG. (a) Overview of the OsACC protein domains using Pfam. Target sequences were designed using NGD (D=A, T, or G) PAM and HCN (H=A, T, or C) PAM. (b) Saturation mutagenesis of 168 bp on the coding strand of the OsACC CT domain in rice protoplasts. Maximum values ​​were calculated when different sgRNAs converted the same cytidine, adenosine, thymidine, and guanosine. Values ​​and error bars reflect the mean ± sem of three independent biological replicates. (c) Heatmap showing the conversion saturation of STEME-NG at the 56 amino acids involved in (b) in rice protoplasts. Silent mutations, missense mutations, and nonsense mutations were all collected statistically.

[0087] Figure 13 A 168 bp saturation mutation of the CT domain on OsACC was performed in rice protoplasts using A3A-PBE-NG. A3A-PBE-NG (a) and the untreated control (b) are shown. Maximum values ​​were calculated when different sgRNAs were converted to the same cytidine and guanosine. Values ​​and error bars reflect the mean ± sem of three independent biological replicates. Summary of the Invention

[0089] I. Definition

[0090] In this invention, unless otherwise stated, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, the terms and laboratory procedures related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and immunology used herein are all widely used terms and routine procedures in their respective fields. For example, the standard recombinant DNA and molecular cloning techniques used in this invention are well known to those skilled in the art and are described more fully in the following literature: Sambrook, J., Fritsch, EF, and Maniatis, T., Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989 (hereinafter referred to as "Sambrook"). Meanwhile, to better understand this invention, definitions and explanations of relevant terms are provided below.

[0091] As used herein, the term “and / or” covers all combinations of items connected by the term and should be regarded as if each combination had been listed separately herein. For example, “A and / or B” covers “A,” “A and B,” and “B.” For example, “A, B, and / or C” covers “A,” “B,” “C,” “A and B,” “A and C,” “B and C,” and “A and B and C.”

[0092] When the term "comprising" is used herein to describe a protein or nucleic acid sequence, the protein or nucleic acid may consist of the stated sequence, or may have additional amino acids or nucleotides at one or both ends of the protein or nucleic acid, while still possessing the activities described in this invention. Furthermore, those skilled in the art will understand that the methionine encoded by the start codon at the N-terminus of a polypeptide may be retained in certain practical situations (e.g., when expressed in a specific expression system) without substantially affecting the polypeptide's function. Therefore, when describing a specific polypeptide amino acid sequence in this specification and claims, although it may not contain the methionine encoded by the start codon at the N-terminus, the sequence containing that methionine is still included, and correspondingly, its encoding nucleotide sequence may also contain the start codon; and vice versa.

[0093] The term "genome," as used in this article, encompasses not only chromosomal DNA located in the cell nucleus but also organelle DNA located in subcellular components of the cell, such as mitochondria and plastids.

[0094] "Genetically modified organism" or "genetically modified cell" refers to an organism or cell whose genome contains exogenous polynucleotides or modified genes or expression regulatory sequences. For example, exogenous polynucleotides can be stably integrated into the genome of an organism or cell and inherited across generations. Exogenous polynucleotides can be integrated into the genome alone or as part of a recombinant DNA construct. Modified genes or expression regulatory sequences are those in the genome of an organism or cell that contain one or more deoxynucleotide substitutions, deletions, or additions.

[0095] In relation to a sequence, “exogenous” means a sequence that originates from a foreign species, or, if from the same species, a sequence whose composition and / or loci have been significantly altered from its natural form through deliberate human intervention.

[0096] "Polynucleotide," "nucleic acid sequence," "nucleotide sequence," or "nucleic acid fragment" are used interchangeably and are single-stranded or double-stranded RNA or DNA polymers, optionally containing synthetic, non-natural, or modified nucleotide bases. Nucleotides are designated by their single-letter names as follows: "A" for adenosine or deoxyadenosine (corresponding to RNA or DNA, respectively), "C" for cytidine or deoxycytidine, "G" for guanosine or deoxyguanosine, "U" for uridine, "T" for deoxythymidine, "R" for purine (A or G), "Y" for pyrimidine (C or T), "K" for G or T, "H" for A, C, or T, "D" for A, T, or G, "I" for inosine, and "N" for any nucleotide.

[0097] The terms “polypeptide,” “peptide,” and “protein” are used interchangeably in this invention to refer to polymers of amino acid residues. The term applies to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acids, as well as to naturally occurring amino acid polymers. The terms “polypeptide,” “peptide,” “amino acid sequence,” and “protein” may also include modified forms, including but not limited to glycosylation, lipid linkage, sulfation, γ-carboxylation, hydroxylation, and ADP-ribosylation of glutamate residues.

[0098] As used in this invention, "expression construct" refers to a vector, such as a recombinant vector, suitable for expressing a nucleotide sequence of interest in an organism. "Expression" refers to the production of a functional product. For example, the expression of a nucleotide sequence can refer to the transcription of the nucleotide sequence (e.g., transcription to generate mRNA or functional RNA) and / or the translation of RNA into a precursor or mature protein.

[0099] The "expression construct" of the present invention may be a linear nucleic acid fragment, a circular plasmid, a viral vector, or, in some embodiments, may be a translatable RNA (such as mRNA), for example, RNA transcribed in vitro.

[0100] The "expression construct" of the present invention may contain regulatory sequences and nucleotide sequences of interest from different sources, or regulatory sequences and nucleotide sequences of interest from the same source but arranged in a manner different from those normally found in nature.

[0101] "Regulatory sequence" and "regulatory element" are used interchangeably, referring to nucleotide sequences located upstream (5' non-coding sequence), in the middle, or downstream (3' non-coding sequence) of a coding sequence that affect the transcription, RNA processing, or stability or translation of the relevant coding sequence. Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences.

[0102] A "promoter" refers to a nucleic acid fragment that controls the transcription of another nucleic acid fragment. In some embodiments of the present invention, a promoter is a promoter capable of controlling gene transcription in a cell, regardless of whether it originates from the cell. A promoter can be a constitutive promoter, a tissue-specific promoter, a developmental regulatory promoter, or an inducible promoter.

[0103] "Constraint promoters" refer to promoters that generally cause gene expression in most cell types and under most conditions. "Tissue-specific promoters" and "tissue-preferred promoters" are used interchangeably and refer to promoters that are primarily, but not necessarily, expressed specifically in one tissue or organ, and may also be expressed in a specific cell type. "Developmental regulatory promoters" are promoters whose activity is determined by developmental events. "Inducible promoters" selectively express manipulated DNA sequences in response to endogenous or exogenous stimuli (environment, hormones, chemical signals, etc.).

[0104] Examples of promoters include, but are not limited to, polymerase (pol) I, pol II, or pol III promoters. Examples of pol I promoters include the chicken RNA pol I promoter. Examples of pol II promoters include, but are not limited to, the cytomegalovirus Immediate Early (CMV) promoter, the Rous sarcoma virus long terminal repeat (RSV-LTR) promoter, and the simian virus 40 (SV40) Immediate Early promoter. Examples of pol III promoters include the U6 and H1 promoters. Inducible promoters such as metallothionein promoters can be used. Other examples of promoters include the T7 phage promoter, the T3 phage promoter, the β-galactosidase promoter, and the Sp6 phage promoter. When used for plants, promoters can be the cauliflower mosaic virus 35S promoter, the maize Ubi-1 promoter, the wheat U6 promoter, the rice U3 promoter, and the rice actin promoter.

[0105] As used herein, the term "operably linked" refers to the linking of a regulatory element (e.g., but not limited to, promoter sequences, transcription termination sequences, etc.) to a nucleic acid sequence (e.g., coding sequences or open reading frames) such that transcription of the nucleotide sequence is controlled and regulated by the transcriptional regulatory element. Techniques for operably linking regulatory element regions to nucleic acid molecules are known in the art.

[0106] "Introducing" nucleic acid molecules (e.g., plasmids, linear nucleic acid fragments, RNA, etc.) or proteins into an organism refers to transforming the organism's cells with the nucleic acid or protein, enabling the nucleic acid or protein to perform its function within the cell. The term "transformation" as used in this invention includes stable transformation and transient transformation. "Stable transformation" refers to the introduction of a foreign nucleotide sequence into the genome, resulting in the stable inheritance of the foreign gene. Once stable transformation occurs, the foreign nucleic acid sequence is stably integrated into the genome of the organism and its genome in any subsequent generations. "Transient transformation" refers to the introduction of a nucleic acid molecule or protein into a cell to perform its function without the stable inheritance of the foreign gene. In transient transformation, the foreign nucleic acid sequence does not integrate into the genome.

[0107] "Temperament" refers to the physiological, morphological, biochemical, or physical characteristics of a cell or organism.

[0108] "Agronomic traits" specifically refer to measurable parameters of crop plants, including but not limited to: leaf greenness, grain yield, growth rate, total biomass or accumulation rate, fresh weight at maturity, dry weight at maturity, fruit yield, seed yield, total nitrogen content of plants, nitrogen content of fruits, nitrogen content of seeds, nitrogen content of plant vegetative tissues, total free amino acid content of plants, free amino acid content of fruits, free amino acid content of seeds, free amino acid content of plant vegetative tissues, total protein content of plants, protein content of fruits, protein content of seeds, protein content of plant vegetative tissues, herbicide resistance and drought resistance, nitrogen uptake, root lodging, harvest index, stem lodging, plant height, ear height, ear length, disease resistance, cold resistance, salt tolerance, and tiller number, etc.

[0109] II. Base Editing Fusion Protein

[0110] In one aspect, the present invention provides a base editing fusion protein comprising a nucleic acid targeting domain, a cytosine deamination domain, and an adenine deamination domain.

[0111] In the embodiments described herein, "base editing fusion protein" and "base editor" are used interchangeably, referring to proteins that can mediate the substitution of one or more nucleotides of a target sequence in the genome in a sequence-specific manner.

[0112] As used herein, a “nucleic acid targeting domain” refers to a domain capable of mediating the attachment of the base-editing fusion protein to a specific target sequence in the genome in a sequence-specific manner (e.g., via guide RNA). In some embodiments, the nucleic acid targeting domain comprises at least one (e.g., one) CRISPR effector polypeptide.

[0113] As used herein, the term "CRISPR effector protein" generally refers to a nuclease (CRISPR nuclease) or a functional variant thereof that is present in the naturally occurring CRISPR system. The term encompasses any CRISPR-based effector protein capable of sequence-specific targeting within cells.

[0114] As used herein, a “functional variant” of a CRISPR nuclease means one that retains at least the guide RNA-mediated sequence-specific targeting ability. Preferably, the functional variant is a nuclease-inactivating variant, i.e., lacking double-stranded nucleic acid cleavage activity. However, CRISPR nucleases lacking double-stranded nucleic acid cleavage activity also encompass nickases, which form a nick in a double-stranded nucleic acid molecule but do not completely cleave the double-stranded nucleic acid. In some preferred embodiments of the invention, the CRISPR effector protein of the invention possesses nickase activity. In some embodiments, the functional variant recognizes a different PAM (pre-intermediate sequence adjacent motif) sequence relative to the wild-type nuclease.

[0115] “CRISPR effector proteins” can be derived from Cas9 nucleases, including Cas9 nucleases or functional variants thereof. The Cas9 nuclease can be a Cas9 nuclease from a different species, such as spCas9 from *S. pyogenes* or SaCas9 derived from *S. aureus*. “Cas9 nuclease” and “Cas9” are used interchangeably herein, referring to RNA-guided nucleases comprising the Cas9 protein or fragments thereof (e.g., proteins containing the active DNA-cutting domain of Cas9 and / or the gRNA-binding domain of Cas9). Cas9 is a component of the CRISPR / Cas (clustered, regularly spaced short palindromic repeats and related systems) genome editing system, capable of targeting and cleaving DNA target sequences to form DNA double-strand breaks (DSBs) under the guidance of guide RNA. An exemplary amino acid sequence of wild-type spCas9 is shown in SEQ ID NO:1.

[0116] “CRISPR effector proteins” can also be derived from Cpf1 nucleases, including Cpf1 nucleases or their functional variants. The Cpf1 nucleases can be Cpf1 nucleases from different species, such as those from Francisella novicida U112, Acidaminococcus sp. BV3L6, and Lachnospiraceae bacterium ND2006.

[0117] Available “CRISPR effector proteins” can also be derived from Cas3, Cas8a, Cas5, Cas8b, Cas8c, Cas10d, Cse1, Cse2, Csy1, Csy2, Csy3, GSU0054, Cas10, Csm2, Cmr5, Cas10, Csx11, Csx10, Csf1, Csn2, Cas4, C2c1, C2c3, or C2c2 nucleases, for example, including these nucleases or their functional variants.

[0118] In some embodiments, the CRISPR effector protein is a nuclease-inactivated Cas9. The DNA-cutting domain of the Cas9 nuclease is known to contain two subdomains: the HNH nuclease subdomain and the RuvC subdomain. The HNH subdomain cleaves the strand complementary to the gRNA, while the RuvC subdomain cleaves the non-complementary strand. Mutations in these subdomains can inactivate the nuclease activity of Cas9, forming a "nuclease-inactivated Cas9." The nuclease-inactivated Cas9 still retains its gRNA-directed DNA binding ability.

[0119] The nuclease-inactivated Cas9 described in this invention can be derived from Cas9 of different species, such as Cas9 derived from *Streptococcus pyogenes* (SpCas9) or Cas9 derived from *Staphylococcus aureus* (SaCas9). Simultaneously, mutations in the HNH nuclease subdomain and RuvC subdomain of Cas9 (e.g., containing mutants D10A and H840A) render the Cas9 nuclease inactive, resulting in a nuclease-dead Cas9 (dCas9). Mutating and inactivating one of the subdomains can impart nickase activity to Cas9, thus obtaining Cas9 nickase (nCas9), for example, nCas9 containing only the mutant D10A.

[0120] Therefore, in some embodiments of the present invention, the nuclease-inactivated Cas9 variant of the present invention comprises, relative to wild-type Cas9, the amino acid substitutions D10A and / or H840A, wherein the amino acid numbers refer to SEQ ID NO:1. In some preferred embodiments, the nuclease-inactivated Cas9 comprises, relative to wild-type Cas9, the amino acid substitution D10A, wherein the amino acid numbers refer to SEQ ID NO:1. In some embodiments, the nuclease-inactivated Cas9 comprises the amino acid sequence (nCas9(D10A)) shown in SEQ ID NO:2.

[0121] When used for gene editing, Cas9 nucleases typically require a 5'-NGG-3' PAM (pre-intercalation sequence adjacent motif) at the 3' end of the target sequence. However, the inventors have surprisingly discovered that this PAM sequence occurs very infrequently in certain species, such as rice, significantly limiting gene editing in these species. Therefore, this invention preferably utilizes CRISPR effector proteins that recognize different PAM sequences, such as functional variants of Cas9 nucleases with different PAM sequences.

[0122] In some preferred embodiments, the CRISPR effector protein is a Cas9 variant that recognizes the PAM sequence 5'-NG-3'. The Cas9 variant recognizing the PAM sequence 5'-NG-3' is also referred to herein as Cas9-NG. In some embodiments, Cas9-NG comprises, relative to wild-type Cas9, the following amino acid substitutions: R1335V, L1111R, D1135V, G1218R, E1219F, A1322R, and T1337R, wherein the amino acid numbers refer to SEQ ID NO:1.

[0123] In some preferred embodiments, the CRISPR effector protein is a nuclease-inactivated Cas9 variant that recognizes the PAM sequence 5'-NG-3'. In some embodiments, the nuclease-inactivated Cas9 variant that recognizes the PAM sequence 5'-NG-3' comprises, relative to wild-type Cas9, the following amino acid substitutions: D10A, R1335V, L1111R, D1135V, G1218R, E1219F, A1322R, T1337R, wherein the amino acid numbers refer to SEQ ID NO:1. In some embodiments, the nuclease-inactivated Cas9 variant that recognizes the PAM sequence 5'-NG-3' comprises the amino acid sequence shown in SEQ ID NO:3 (nCas9-NG(D10A)).

[0124] As used herein, a "cytosine deamination domain" refers to a domain capable of accepting single-stranded DNA as a substrate and catalyzing the deamination of cytidine or deoxycytidine to uracil or deoxyuracil, respectively. In some embodiments, the cytosine deamination domain comprises at least one (e.g., one or two) cytosine deamination enzyme polypeptide.

[0125] In this invention, the cytidine deamination domain in the fusion protein can deaminate the cytidine in the single-stranded DNA generated during the formation of the fusion protein-guide RNA-DNA complex, converting it to U, and then achieve C to T base substitution through base mismatch repair.

[0126] Examples of cytosine deaminases that can be used in this invention include, but are not limited to, APOBEC1 deaminase, activation-induced cytidine deaminase (AID), APOBEC3G, CDA1, human APOBEC3A deaminase, or functional variants thereof. In some embodiments, the cytosine deaminase is human APOBEC3A deaminase or a functional variant thereof. In some embodiments, human APOBEC3A deaminase comprises the amino acid sequence shown in SEQ ID NO:4.

[0127] As used herein, an "adenine deamination domain" refers to a domain capable of accepting single-stranded DNA as a substrate and catalyzing the formation of inosine (I) from adenosine or deoxyadenosine (A). In some embodiments, the adenine deamination domain comprises at least one (e.g., one) DNA-dependent adenine deamination enzyme polypeptide.

[0128] In this invention, the adenine deamination domain in the fusion protein can deaminate adenosine in the single-stranded DNA generated during the formation of the CRISPR effector protein-guide RNA-DNA complex and convert it into inosine (I). Since DNA polymerase treats inosine (I) as guanine (G), the substitution from A to G can be achieved through base mismatch repair.

[0129] In some embodiments, the DNA-dependent adenine deaminase is a variant of E. coli tRNA adenine deaminase TadA (ecTadA). An exemplary wild-type ecTadA amino acid sequence is shown in SEQ ID NO:5; however, the wild-type ecTadA amino acid sequence may also omit the N-terminal methionine in SEQ ID NO:5.

[0130] In some embodiments, the DNA-dependent adenine deaminase comprises one or more mutations selected from the following groups relative to wild-type ecTadA:

[0131] 1) A106V and D108N;

[0132] 2) D147Y and E155V;

[0133] 3) L84F, H123Y, and I156F;

[0134] 4) A142N;

[0135] 5) H36L, R51L, S146C and K157N;

[0136] 6) P48S / T / A;

[0137] 7) A142N;

[0138] 8) W23L / R;

[0139] 9) R152H / P,

[0140] The amino acid number is referenced from SEQ ID NO:5.

[0141] In some preferred embodiments of the present invention, the DNA-dependent adenine deaminase comprises the following mutations relative to wild-type ecTadA: W23R, H36L, R51L, S146C, K157N, A106V, D108N, P48A, L84F, H123Y, I156F, D147Y, E155V, and R152P, wherein the amino acid numbers are as per SEQ ID NO:5.

[0142] In some preferred embodiments of the present invention, the DNA-dependent adenine deaminase comprises an amino acid sequence as shown in SEQ ID NO:6.

[0143] Since E. coli tRNA adenine deaminase (ecTadA) usually functions as a dimer, it is expected that the formation of a dimer between two DNA-dependent adenine deaminases or the formation of a dimer between a DNA-dependent adenine deaminase and a wild-type adenine deaminase could significantly enhance the editing activity of fusion proteins A to G.

[0144] In some preferred embodiments, the adenine deamination domain comprises two of the DNA-dependent adenine deaminases.

[0145] In some preferred embodiments, the adenine deamination domain further comprises a corresponding wild-type adenine deaminase (e.g., E. coli tRNA adenine deaminase TadA) fused to the DNA-dependent adenine deaminase (e.g., a DNA-dependent variant of E. coli tRNA adenine deaminase TadA). In some preferred embodiments, the DNA-dependent adenine deaminase (e.g., a DNA-dependent variant of E. coli tRNA adenine deaminase TadA) is fused to the C-terminus of the corresponding wild-type adenine deaminase (e.g., E. coli tRNA adenine deaminase TadA).

[0146] In some embodiments, the two DNA-dependent adenine deaminases (e.g., a DNA-dependent variant of E. coli tRNA adenine deaminase TadA) or the DNA-dependent adenine deaminase (e.g., a DNA-dependent variant of E. coli tRNA adenine deaminase TadA) are fused with the corresponding wild-type adenine deaminase (e.g., E. coli tRNA adenine deaminase TadA) via a linker.

[0147] In some preferred embodiments, the adenine deamination domain comprises the amino acid sequence shown in SEQ ID NO:7 or 8.

[0148] In some embodiments of the present invention, the nucleic acid targeting domain, the cytosine deamination domain, and the adenine deamination domain are fused via a linker.

[0149] As used herein, a "linker" can be a non-functional amino acid sequence of 1-50 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 20-25, 25-50) or more amino acids without secondary or higher structures. For example, the linker can be a flexible linker, such as GGGGS, GS, GAP, (GGGGS)x3, GGS, and (GGS)x7. In some embodiments, the linker is 32 amino acids long, for example, the linker contains the amino acid sequence shown in SEQ ID NO:9. In some embodiments, the linker is 48 amino acids long, for example, the linker contains the amino acid sequence shown in SEQ ID NO:10. In some preferred embodiments, the linker is an XTEN linker containing the amino acid sequence shown in SEQ ID NO:11.

[0150] In some embodiments, the base-editing fusion protein comprises, from N-terminus to C-terminus, a cytosine deamination domain, an adenine deamination domain, and a nucleic acid targeting domain in the following order.

[0151] Furthermore, in cells, uracil DNA glycosyltransferase catalyzes the removal of U from DNA and initiates base excision repair (BER), resulting in the repair of U:G to C:G. Therefore, without any theoretical limitations, the combination of the base editing fusion protein of this invention with a uracil DNA glycosyltransferase inhibitor (UGI) will be able to increase the efficiency of C to T base editing.

[0152] In some embodiments, the base-editing fusion protein is co-expressed with a uracil DNA glycosylation inhibitor (UGI).

[0153] In some embodiments, the base-editing fusion protein further comprises a uracil DNA glycosylation inhibitor (UGI).

[0154] In some implementations, the UGI is connected to other parts of the base-editing fusion protein via a connector.

[0155] In some implementations, UGI is linked to other parts of the base-editing fusion protein via a "self-cleaving peptide".

[0156] As used herein, "self-cleaving peptide" refers to a peptide that can self-cleave within a cell. For example, the self-cleaving peptide may contain a protease recognition site, thereby being recognized and specifically cleaved by intracellular proteases. Alternatively, the self-cleaving peptide may be a 2A peptide. 2A peptides are a class of short peptides derived from viruses whose self-cleavage occurs during translation. When two different target peptides are expressed in the same reading frame using a 2A peptide, the two target peptides are generated in an almost 1:1 ratio. Commonly used 2A peptides include P2A from porcine techovirus-1, T2A from the β-tetrasomatic moth virus (Thosea asigna virus), E2A from equine rhinitis A virus, and F2A from foot-and-mouth disease virus. Various functional variants of these 2A peptides are also known in the art and can be used in this invention.

[0157] Preferably, the self-cleaving peptide is not present between or within the nucleic acid targeting domain, the cytosine deamination domain, and the adenine deamination domain. In some embodiments, the UGI is located at the N-terminus or C-terminus of the base-editing fusion protein, preferably the C-terminus.

[0158] In some specific embodiments, the uracil DNA glycosylation inhibitor (UGI) comprises the amino acid sequence shown in SEQ ID NO:12.

[0159] In some embodiments of the invention, the fusion protein may further comprise a nuclear localization sequence (NLS). Generally, one or more NLSes in the fusion protein should have sufficient strength to drive the fusion protein to accumulate in the nucleus of the cell in an amount sufficient to enable its base-editing function. Generally, the strength of nuclear localization activity is determined by the number and location of the NLSes in the fusion protein, the use of one or more specific NLSes, or a combination of these factors.

[0160] In some embodiments of the invention, the NLS of the fusion protein of the invention may be located at the N-terminus and / or the C-terminus. In some embodiments of the invention, the NLS of the fusion protein of the invention may be located between the adenine deamination domain, the cytosine deamination domain, the nucleic acid targeting domain, and / or the UGI. In some embodiments, the fusion protein comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLS. In some embodiments, the fusion protein comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLS at or near the N-terminus. In some embodiments, the fusion protein comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more NLS at or near the C-terminus. In some embodiments, the polypeptide comprises a combination of these, such as one or more NLS at the N-terminus and one or more NLS at the C-terminus. When more than one NLS is present, each may be selected independently of the other NLS.

[0161] Generally, NLS consists of one or more short sequences of positively charged lysine or arginine exposed on the surface of a protein, but other types of NLS are also known. Non-limiting examples of NLS include: KKRKV, PKKKRKV, or KRPAATKKAGQAKKKK.

[0162] Furthermore, depending on the location of the DNA to be edited, the fusion protein of the present invention may also include other localization sequences, such as cytoplasmic localization sequences, chloroplast localization sequences, mitochondrial localization sequences, etc.

[0163] In some embodiments, the base-editing fusion protein comprises any of the amino acid sequences shown in SEQ ID NO:13-19.

[0164] III. Base Editing System

[0165] In another aspect, the present invention provides a base editing system for modifying target nucleic acid regions in a genome, comprising:

[0166] i) The base-editing fusion protein of the present invention and / or an expression construct containing a nucleotide sequence encoding the base-editing fusion protein; and / or

[0167] ii) at least one guide RNA and / or at least one expression construct containing a nucleotide sequence encoding said at least one guide RNA,

[0168] The at least one guide RNA targets at least one target sequence within the target nucleic acid region.

[0169] As used herein, a "base editing system" refers to a combination of components required for base editing of the genome in a cell or organism. The individual components of such a system, such as base editing fusion proteins or one or more guide RNAs, may exist independently or in any combination as a composition.

[0170] As used herein, "guide RNA" and "gRNA" are used interchangeably and refer to RNA molecules capable of forming a complex with a CRISPR effector protein and targeting the target sequence by means of a certain degree of identity with the target sequence. Guide RNA targets the target sequence through base pairing with the complementary strand of the target sequence. For example, the gRNA used by Cas9 nuclease or its functional variants typically consists of partially complementary crRNA and tracrRNA molecules forming a complex, wherein the crRNA contains a guide sequence (also called a seed sequence) that is sufficiently identical with the target sequence to hybridize with the complementary strand of the target sequence and guide the CRISPR complex (Cas9 + crRNA + tracrRNA) to specifically bind to the target sequence. However, it is known in the art that single guide RNAs (sgRNAs) can be designed that simultaneously contain the characteristics of both crRNA and tracrRNA. The gRNA used by Cpf1 nuclease or its functional variants typically consists only of mature crRNA molecules, which can also be referred to as sgRNA. Designing suitable gRNAs based on the CRISPR nuclease used and the target sequence to be edited is within the capabilities of those skilled in the art.

[0171] In some specific embodiments of the present invention, for example when the CRISPR effector protein is Cas9 or a functional variant thereof, the sgRNA sequence may include the following scaffold sequence:

[0172] 5'-guuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuu-3' (SEQ ID NO:27, corresponding to Figure 2 sgRNA scaffold) or

[0173] 5'-guuuaagagcuaugcuggaaacagcauagcaaguuuaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuu-3'(SEQ ID NO:28, corresponding to Figure 2The esgRNA scaffold. The guide sequence (also called the seed sequence, which is the same as the target sequence) in the sgRNA is located at the 5' end of the above scaffold sequence.

[0174] The target sequence targeted by the guide RNA typically contains 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides, preferably 20 nucleotides. Correspondingly, the guide sequence in the guide RNA typically contains 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides, preferably 20 nucleotides.

[0175] Typically, the target sequence targeted by the guide RNA also requires a PAM sequence at one end, such as the 3' end, to be recognized by the CRISPR effector protein (or fusion protein)-guide RNA complex. The location, type, and length of the required PAM for the target sequence depend on the CRISPR effector protein used. In some preferred embodiments, the PAM sequence is 5'-NGG-3' located at the 3' end of the target sequence.

[0176] After the base editing system of the present invention is introduced into the cell, the base editing fusion protein and the guide RNA can form a complex, and the complex specifically targets the target sequence under the guidance of the guide RNA, resulting in one or more Cs being replaced by Ts and / or one or more Aes being replaced by Gs in the target sequence.

[0177] In some embodiments, the C to T base editing window of the base editing fusion protein of the present invention is located at positions 1-17 of the target sequence. That is, the base editing fusion protein of the present invention can replace one or more Cs with Ts in the range of positions 1-17 from the 5' end of the target sequence.

[0178] In some embodiments, the A to G base editing windows of the base editing fusion protein of the present invention are located at positions 4-8 of the target sequence. That is, the base editing fusion protein of the present invention can replace one or more A's in the range of positions 4-8 from the 5' end of the target sequence with G's.

[0179] In some embodiments, the at least one guide RNA can target a target sequence located on a sense strand (e.g., a protein-coding strand) and / or an antisense strand within a target nucleic acid region of the genome. When the guide RNA targets the sense strand (e.g., a protein-coding strand), the base editing composition of the present invention can cause one or more Cs within the target sequence on the sense strand (e.g., a protein-coding strand) to be replaced by Ts and / or one or more As to be replaced by Gs. When the guide RNA targets the antisense strand, the base editing composition of the present invention can cause one or more Gs within the target sequence on the sense strand (e.g., a protein-coding strand) to be replaced by As and / or one or more Ts to be replaced by Cs.

[0180] In order to achieve effective expression in cells, in some embodiments of the present invention, the nucleotide sequence encoding the base-editing fusion protein is codon-optimized for the organism whose genome is to be modified.

[0181] Codon optimization refers to the modification of nucleic acid sequences to enhance expression in host cells of interest by replacing at least one codon of the natural sequence with codons that are used more frequently or most frequently in the gene in the host cell (e.g., about 1, 2, 3, 4, 5, 10, 15, 20, 25, 50 or more codons) while maintaining the natural amino acid sequence. Different species exhibit specific preferences for certain codons of specific amino acids. Codon preference (differences in codon use between organisms) is often associated with the translation efficiency of messenger RNA (mRNA), which is thought to depend on the nature of the codons being translated and the availability of specific transfer RNA (tRNA) molecules. The dominance of selected tRNAs in a cell generally reflects the codons most frequently used for peptide synthesis. Therefore, genes can be customized to achieve optimal gene expression in a given organism based on codon optimization. Codon utilization tables are readily available, for example in... www.kazusa.orjp / codon / The codons used are available in the Codon Usage Database, and these tables can be adapted in different ways. See Nakamura Y. et al., “Codon usage tabulated from the international DNA sequence databases: status for the year 2000. Nucl. Acids Res., 28:292 (2000).

[0182] In some embodiments, the base-editing fusion protein of the present invention is encoded by any of the nucleotide sequences shown in SEQ ID NO:20-26.

[0183] Organisms whose genomes can be modified using the base editing system of the present invention include any organism suitable for base editing, preferably eukaryotes. Examples of organisms include, but are not limited to, mammals such as humans, mice, rats, monkeys, dogs, pigs, sheep, cattle, and cats; poultry such as chickens, ducks, and geese; and plants, including monocots and dicots, for example, crop plants, including but not limited to wheat, rice, corn, soybeans, sunflowers, sorghum, rapeseed, alfalfa, cotton, barley, millet, sugarcane, tomatoes, tobacco, cassava, and potatoes. Preferably, the organism is a plant. More preferably, the organism is rice.

[0184] IV. Methods for producing genetically modified cells

[0185] In another aspect, the present invention also provides a method for generating at least one genetically modified cell, comprising introducing the base editing system of the present invention into at least one said cell, thereby causing substitution of one or more nucleotides in a target nucleic acid region of said at least one cell.

[0186] In some embodiments, the method further includes the step of screening cells from the at least one cell for cells having one or more desired nucleotide substitutions.

[0187] In some embodiments, the method of the present invention is performed in vitro. For example, the cells are isolated cells, or cells in isolated tissues or organs.

[0188] In another aspect, the present invention also provides genetically modified organisms comprising genetically modified cells or their progeny cells produced by the methods of the present invention. Preferably, the genetically modified cells or their progeny cells have one or more desired nucleotide substitutions.

[0189] In this invention, the target nucleic acid region to be modified can be located anywhere in the genome, such as within a functional gene like a protein-coding gene, or in a gene expression regulatory region such as a promoter or enhancer region, thereby achieving modification of the gene function or gene expression. In some embodiments, the desired nucleotide substitution leads to the desired modification of gene function or gene expression.

[0190] In some embodiments, the target nucleic acid region is associated with a trait of the cell or organism. In some embodiments, mutations in the target nucleic acid region lead to an alteration in the trait of the cell or organism. In some embodiments, the target nucleic acid region is located in a coding region of a protein. In some embodiments, the target nucleic acid region encodes a function-related motif or domain of the protein. In some preferred embodiments, substitution of one or more nucleotides in the target nucleic acid region results in amino acid substitution in the amino acid sequence of the protein. In some embodiments, the substitution of one or more nucleotides leads to an alteration in the function of the protein.

[0191] In the method of the present invention, the base editing system can be introduced into cells using various methods well known to those skilled in the art.

[0192] Methods for introducing the base editing system of the present invention into cells include, but are not limited to: calcium phosphate transfection, protoplast fusion, electroporation, liposome transfection, microinjection, viral infection (such as baculovirus, vaccinia virus, adenovirus, adeno-associated virus, lentivirus and other viruses), gene gun method, PEG-mediated protoplast transformation, and Agrobacterium tumefaciens-mediated transformation.

[0193] Cells that can be base-edited by the method of the present invention can be derived from, for example, mammals such as humans, mice, rats, monkeys, dogs, pigs, sheep, cattle, and cats; poultry such as chickens, ducks, and geese; and plants, including monocots and dicots, preferably crop plants, including but not limited to wheat, rice, corn, soybeans, sunflowers, sorghum, rapeseed, alfalfa, cotton, barley, millet, sugarcane, tomatoes, tobacco, cassava, and potatoes.

[0194] V. Applications in Plants

[0195] The base-editing fusion protein, base-editing system, and method for generating genetically modified cells of the present invention are particularly suitable for genetic modification of plants. Preferably, the plant is a crop plant, including but not limited to wheat, rice, corn, soybean, sunflower, sorghum, rapeseed, alfalfa, cotton, barley, millet, sugarcane, tomato, tobacco, cassava, and potato. More preferably, the plant is rice.

[0196] In another aspect, the present invention provides a method for producing genetically modified plants, comprising introducing the base editing system of the present invention into at least one of the plants, thereby causing substitution of one or more nucleotides in a target nucleic acid region in the genome of the at least one plant.

[0197] In some embodiments, the method further includes screening from the at least one plant for plants having one or more desired nucleotide substitutions.

[0198] In the method of this invention, the base editing composition can be introduced into plants using various methods well known to those skilled in the art. Methods that can be used to introduce the base editing system of this invention into plants include, but are not limited to: gene gun method, PEG-mediated protoplast transformation, Agrobacterium-mediated transformation, plant virus-mediated transformation, pollen tube pathway method, and ovary injection method. Preferably, the base editing composition is introduced into plants via transient transformation.

[0199] In the method of this invention, modification of the target sequence can be achieved simply by introducing or generating the base-editing fusion protein and guide RNA in plant cells, and the modification can be stably inherited without the need for stable transformation of the plant with exogenous polynucleotides encoding the components of the base-editing system. This avoids the potential off-target effects of a stably existing (continuously generated) base-editing composition and also avoids the integration of exogenous nucleotide sequences into the plant genome, thus providing higher biosafety.

[0200] In some preferred embodiments, the introduction is performed without selection pressure, thereby avoiding the integration of exogenous nucleotide sequences into the plant genome.

[0201] In some embodiments, the introduction includes converting the base editing system of the present invention into isolated plant cells or tissues, and then regenerating the converted plant cells or tissues into complete plants. Preferably, the regeneration is performed without selection pressure, that is, without using any selection agents targeting the selection genes carried on the expression vector during tissue culture. Not using selection agents can improve the regeneration efficiency of the plants, resulting in modified plants free of exogenous nucleotide sequences.

[0202] In other embodiments, the base editing system of the present invention can be transferred to specific parts of a whole plant, such as leaves, shoot tips, pollen tubes, young spikelets, or hypocotyls. This is particularly suitable for the transfer of plants that are difficult to regenerate through tissue culture.

[0203] In some embodiments of the present invention, in vitro expressed proteins and / or in vitro transcribed RNA molecules (e.g., the expression construct is an in vitro transcribed RNA molecule) are directly transformed into the plant. The proteins and / or RNA molecules enable base editing in plant cells and are subsequently degraded by the cells, avoiding the integration of exogenous nucleotide sequences into the plant genome.

[0204] Therefore, in some embodiments, using the methods of the present invention to genetically modify and breed plants can yield plants whose genomes are free of foreign polynucleotide integration, i.e., non-transgene-free modified plants.

[0205] In some embodiments of the invention, the modified target nucleic acid region is associated with plant traits such as agronomic traits, whereby the substitution of one or more nucleotides results in the plant having altered (preferably improved) traits, such as agronomic traits, relative to the wild-type plant.

[0206] In some embodiments, the method further includes the step of screening plants having one or more desired nucleotide substitutions and / or desired traits such as agronomic traits.

[0207] In some embodiments of the invention, the method further includes obtaining offspring of the genetically modified plant. Preferably, the genetically modified plant or its offspring has one or more desired nucleotide substitutions and / or desired traits such as agronomic traits.

[0208] In another aspect, the present invention also provides genetically modified plants or their offspring or portions thereof, wherein said plants are obtained by the methods described above. In some embodiments, the genetically modified plants or their offspring or portions thereof are non-GMO. Preferably, the genetically modified plants or their offspring have the desired genetic modification and / or desired traits such as agronomic traits.

[0209] In another aspect, the present invention also provides a plant breeding method, comprising crossing a genetically modified first plant, obtained by the method described above, containing one or more nucleotide substitutions in a target nucleic acid region, with a second plant not containing the one or more nucleotide substitutions, thereby introducing the one or more nucleotide substitutions into the second plant. Preferably, the genetically modified first plant has desired traits such as agronomic traits.

[0210] VI. Methods for in-situ saturation mutagenesis of endogenous target nucleic acid regions in cells or organisms

[0211] On the other hand, the present invention provides a method for performing in situ saturation mutagenesis on an endogenous target nucleic acid region in a cell or organism to obtain a mutation of interest within the target nucleic acid region, including...

[0212] i) Provide a population of the cells or organisms;

[0213] ii) Introducing the base editing system of the present invention into a population of said cells or organisms, resulting in one or more mutations in the endogenous target nucleic acid region of said cells or organisms;

[0214] iii) Screening the population of said cells or organisms for cells or organisms containing mutations of interest; and optionally iv) Identifying said mutations of interest.

[0215] In some embodiments, the method of the present invention is performed in vitro. For example, the cells are isolated cells, or cells in isolated tissues or organs.

[0216] In some embodiments, the base editing system comprises multiple guide RNAs and / or multiple expression constructs containing nucleotide sequences encoding the multiple guide RNAs. In some embodiments, the multiple guide RNAs target different target sequences within a target nucleic acid region.

[0217] In some implementations, the multiple guide RNAs can be 2-250 or more, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 300 or more.

[0218] In some embodiments, at least some of the target sequences and / or complementary sequences of the various guide RNAs partially overlap and / or are adjacent to each other. Thus, the base editing system of the present invention can achieve base editing of relatively long target nucleic acid regions. For example, the length of the target nucleic acid region can be approximately 20 bp to approximately 10,000 bp or longer, such as approximately 20 bp, approximately 40 bp, approximately 60 bp, approximately 80 bp, approximately 100 bp, approximately 120 bp, approximately 140 bp, approximately 160 bp, approximately 180 bp, approximately 200 bp, approximately 300 bp, approximately 400 bp, approximately 500 bp, approximately 1000 bp, approximately 1500 bp, approximately 2000 bp, approximately 3000 bp, approximately 4000 bp, approximately 5000 bp, approximately 6000 bp or longer. When the target nucleic acid region is a protein-coding region, the target nucleic acid sequence can encode an amino acid sequence of approximately 5 to approximately 2000 amino acids in length, for example, it can encode an amino acid sequence of approximately 5, approximately 10, approximately 15, approximately 20, approximately 25, approximately 30, approximately 35, approximately 40, approximately 45, approximately 50, approximately 60, approximately 70, approximately 80, approximately 90, approximately 100, approximately 125, approximately 150, approximately 200, approximately 250, approximately 500, approximately 750, approximately 1000, approximately 1500, approximately 2000 or more amino acids in length.

[0219] In some implementations, the target sequences targeted by the various guide RNAs substantially cover the target nucleic acid region.

[0220] In some implementations, at least a portion of the multiple guide RNAs targets the sense strand of the target nucleic acid region.

[0221] In some implementations, at least a portion of the multiple guide RNAs targets the antisense strand of the target nucleic acid region.

[0222] In some embodiments, the multiple guide RNAs and / or multiple expression constructs containing nucleotide sequences encoding the multiple guide RNAs can be independently introduced into a population of cells or organisms. In some embodiments, the multiple guide RNAs and / or multiple expression constructs containing nucleotide sequences encoding the multiple guide RNAs can be combined and introduced into a population of cells or organisms. For example, each guide RNA or its expression construct may be introduced into a subpopulation of the cells or organisms, ultimately all subpopulations constituting a population of cells or organisms already introduced into the gene editing system; or, a mixture of two guide RNAs or their expression constructs may be used to introduce into a subpopulation of the cells or organisms, ultimately all subpopulations constituting a population of cells or organisms already introduced into the gene editing system; and so on.

[0223] In some implementations, the mutation is a nucleotide substitution, such as a C to T substitution, an A to G substitution, a G to A substitution, or a T to C substitution.

[0224] In some embodiments, the target nucleic acid region is located in the coding region of a protein. In some embodiments, the target nucleic acid region encodes a function-related motif or domain of the protein. In some embodiments, the mutation in the target nucleic acid region can be a silent mutation, a missense mutation, or a nonsense mutation. In some preferred embodiments, the mutation in the target nucleic acid region results in an amino acid substitution in the amino acid sequence of the protein. In some embodiments, the mutation results in an alteration of the protein's function.

[0225] As used herein, the term “saturation” does not necessarily mean that the population of cells or organisms contains mutations in all nucleotides of the target nucleic acid region or all amino acid sequences encoded by the target nucleic acid region. The term also covers “near-saturation” mutations, such as mutations in more than 50% of the nucleotides of the target nucleic acid region or more than 50% of the amino acid sequences encoded by the target nucleic acid region.

[0226] In some embodiments, the target nucleic acid region is associated with a trait of the cell or organism. In some embodiments, mutations in the target nucleic acid region lead to changes in the trait of the cell or organism. Therefore, in some embodiments, mutations of interest can be screened based on changes in the trait of the cell or organism.

[0227] As used herein, "mutation of interest" generally refers to a mutation that causes a change in the trait of interest in a cell or organism. Therefore, in step iii), cells or organisms with mutations of interest can be screened by screening for cells or organisms with changes in the trait of interest.

[0228] The cells can be derived from, for example, mammals such as humans, mice, rats, monkeys, dogs, pigs, sheep, cattle, and cats; poultry such as chickens, ducks, and geese; and plants, including monocots and dicots, preferably crop plants, including but not limited to wheat, rice, corn, soybeans, sunflowers, sorghum, rapeseed, alfalfa, cotton, barley, millet, sugarcane, tomatoes, tobacco, cassava, and potatoes. Preferably, the cells are plant cells, more preferably crop plant cells, and even more preferably rice cells.

[0229] The organism may be, for example, mammals such as humans, mice, rats, monkeys, dogs, pigs, sheep, cattle, and cats; poultry such as chickens, ducks, and geese; and plants, including monocots and dicots, preferably crop plants, including but not limited to wheat, rice, corn, soybeans, sunflowers, sorghum, rapeseed, alfalfa, cotton, barley, millet, sugarcane, tomatoes, tobacco, cassava, and potatoes. Preferably, the organism is a plant, more preferably a crop plant, and even more preferably rice.

[0230] For plants, especially crop plants, the changes in traits of interest include improved agronomic traits, including but not limited to increased growth rate, increased yield, increased nutrient content, increased cold resistance, increased drought resistance, increased insect resistance, increased disease resistance, increased herbicide resistance, etc.

[0231] For animals, especially mammals such as humans, the trait changes of interest include, but are not limited to, drug resistance.

[0232] VII. Therapeutic Applications

[0233] This invention also covers the application of the base editing system of this invention in disease treatment.

[0234] By modifying disease-related genes using the base editing system of this invention, it is possible to achieve upregulation, downregulation, inactivation, activation, or mutation correction of disease-related genes, thereby achieving disease prevention and / or treatment. For example, the target nucleic acid region described in this invention can be located within the protein-coding region of the disease-related gene, or, for example, within gene expression regulatory regions such as promoter regions or enhancer regions, thereby enabling modification of the function or expression of the disease-related gene. Therefore, the modification of disease-related genes described herein includes modification of the disease-related gene itself (e.g., protein-coding region), as well as modification of its expression regulatory regions (e.g., promoters, enhancers, introns, etc.).

[0235] "Disease-associated" genes are any genes that produce transcriptional or translational products at abnormal levels or in abnormal forms in cells derived from tissues affected by a disease, compared to tissues or cells from non-disease control groups. In cases where altered expression is associated with the onset and / or progression of the disease, it can be a gene expressed at abnormally high levels; it can also be a gene expressed at abnormally low levels. Disease-associated genes also refer to genes with one or more mutations or genetic variations that are directly responsible for or linked to one or more genes responsible for the etiology of the disease in disequilibrium. Such mutations or genetic variations are, for example, single nucleotide variants (SNVs). The transcribed or translated products can be known or unknown and can be at normal or abnormal levels.

[0236] Therefore, the present invention also provides a method for treating diseases in subjects in need, comprising delivering an effective amount of the base editing system of the present invention to the subject to modify genes associated with the disease.

[0237] The present invention also provides the use of the base editing system of the present invention in the preparation of pharmaceutical compositions for treating diseases in subjects of need, wherein the base editing system is used to modify genes associated with said disease.

[0238] The present invention also provides pharmaceutical compositions for treating diseases in subjects of need, comprising the base editing system of the present invention and optionally a pharmaceutically acceptable vector, wherein the base editing system is used to modify genes associated with the disease.

[0239] In some implementations, the object is a mammal, such as a human.

[0240] Examples of the diseases mentioned include, but are not limited to, tumors, inflammation, Parkinson's disease, cardiovascular disease, Alzheimer's disease, autism, drug addiction, age-related macular degeneration, schizophrenia, and genetic diseases.

[0241] VIII. Reagent Kit

[0242] This invention also includes kits for use with the methods of the invention, the kits comprising the base-editing fusion protein of the invention and / or expression constructs containing a nucleotide sequence encoding said base-editing fusion protein, or comprising the base-editing system of the invention. The kits generally include labels indicating the intended use and / or method of use of the kit contents. Terminology labels include any written or documented material provided on or with the kit or otherwise with the kit. The kits of the invention may also contain suitable materials for constructing expression vectors in the base-editing systems of the invention. The kits of the invention may also contain reagents suitable for converting the base-editing fusion protein or base-editing composition of the invention into cells. Example

[0243] The present invention will be further illustrated by way of embodiments below, but the present invention is not limited to the scope of the described embodiments.

[0244] Experimental Materials and Methods

[0245] plasmid construction

[0246] The cytidine deaminase, adenosine deaminase, nCas9(D10A), and UGI moieties of STEME-1, STEME-2, STEME-3, and STEME-4 were codon-optimized for cereals and commercially synthesized (GENEWIZ, Suzhou, China). The Cas9 variant nCas9-NG(D10A), containing the R1335V / L1111R / D1135V / G1218R / E1219F / A1322R / T1337R mutation, was obtained from the mutant nCas9(D10A) via Gibson assembly (Mut Express MultiS Fast Mutagenesis Kit, Vazyme, Nanjing, China). PCR in this work was performed using TransStart FastPfu DNA polymerase (TransGen Biotech). Various structures were assembled into the pJIT163 backbone using the Gibson assembly method (Mut Express MultiS Fast Mutagenesis Kit, Vazyme, Nanjing, China). The esgRNA construct pOsU3-esgRNA was prepared as described previously (Reference 1). The annealed target sequence was inserted into the BsaI-digested pOsU3-esgRNA. To construct the pH-STEME and pH-STEME-NG binary vectors, STEME-1 or STEME-NG and the OsU3-esgRNA expression cassette were cloned together into the pHUE411 backbone (Reference 2).

[0247] Protoplast transfection

[0248] The protoplasts used in this study were prepared using the japonica rice variety Nipponbare. Protoplast isolation and transformation were performed as described previously (Reference 3). 10 μg of a base editor and sgRNA plasmid DNA were introduced into protoplasts via PEG-mediated transfection, with an average transformation efficiency of 40–55%. Transfected protoplasts were incubated at 23°C. Sixty hours post-transfection, protoplasts were collected to extract genomic DNA for amplicon deep sequencing.

[0249] DNA extraction

[0250] Genomic DNA was extracted from protoplasts using the DNA quick Plant System (Tiangen Biotech, Beijing, China). Target sequences were amplified using specific primers, and amplicones were purified using the EasyPure PCR Purification Kit (TransGen Biotech, Beijing, China). Quantification was performed using a NanoDrop™ 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA).

[0251] Amplicon deep sequencing and data analysis

[0252] To test the coverage of transformed esgRNA, direct PCR was performed to amplify the protospacer region of a binary vector derived from transgenic callus. Barcodes were added to both ends of the PCR products using primers. For other amplicons, two rounds of PCR were performed. In the first round of PCR, the target region was amplified using site-specific primers. In the second round of PCR, forward and reverse barcodes were added to the ends of the PCR products for library construction. Equal volumes of PCR products were pooled and purified via gel DNA extraction, and the samples were commercially sequenced using the Illumina NextSeq 500 platform (Genewiz, Suzhou, China). The protospacer sequence in the sequencing reads was examined to analyze C>T and / or A>G substitutions and insertions / deletions (indels). Using genomic DNA extracted from three independent protoplast samples, the amplicons for each target sequence were sequenced three times.

[0253] Example 1: Construction of an endogenous sequence-targeted saturation mutagenesis editor (STEME)

[0254] Recently, CRISPR-mediated single-base editing strategies, known as cytosine base editors (CBE) or adenine base editors (ABE), have been used to generate C:G>T:A or A:T>G:C base transversions within the editing window. Both CBE and ABE fuse Cas9 variants (nCas9 or dCas9) with their corresponding deaminases, laying the foundation for saturating mutations of C / G or A / T on the coding strand by targeting both coding and non-coding strands.

[0255] In this invention, a novel base editor was designed that can simultaneously generate C:G>T:A and A:T>G:C mutations at the same target site using only one sgRNA, aiming to perform saturated targeting endogenous mutagenesis (STEM) on selected target genes. The inventors fused cytosine deaminase and adenine deaminase into a novel deaminase, developing a saturated targeting endogenous mutagenesis editor (STEME). In addition to the fused deaminase, STEME also includes nCas9 (D10A) and a uracil DNA glycosylase inhibitor (UGI). Figure 1 a). This fused deaminase can deaminate C and / or A within the deamination window. nCas9 promotes intracellular mismatch repair (MMR), and UGI inhibits uracil DNA glycosylase (UDG), allowing damaged DNA strands to be repaired according to the deaminated target strand. After replication, the C:G>T:A and A:T>G:C mutations are ultimately achieved. Figure 1 a).

[0256] In previous studies, the inventors developed a cytosine base editor A3A-PBE based on the human cytosine deaminase APOBEC3A, which has a high efficiency and wide editing window in plants, and an adenine base editor PABE-7, which consists of an artificially evolved ecTadA-ecTadA7.10 heterodimer and an nCas9 with three NLS at the N-terminus. To simultaneously achieve C:G>T:A and A:T>G:C mutations, the inventors designed two forms of fusion deaminases: APOBEC3A-ecTadA-ecTadA7.10 and ecTadA-ecTadA7.10-APOBEC3A, and fused them to the N-terminus of nCas9(D10A), respectively. Furthermore, one UGI or two freely expressed UGIs (linked via T2A peptides) were fused to the C-terminus of nCas9(D10A), constructing four vectors: STEME-1, STEME-2, STEME-3, and STEME-4. Figure 1 b). All STEME vectors were optimized according to crop codons and expressed by the maize Ubiquitin-1 (Ubi-1) promoter.

[0257] To study the base editing characteristics of STEME, the inventors designed six target sequences on the rice genome: OsAAT, OsACC, OsCDC48, OsDEP1, OsEV, and OsOD, as shown in Table 1 below. PAM sequences are indicated in bold and underline.

[0258] Table 1

[0259]

[0260] A 20 nt sgRNA spacer was constructed into an esgRNA vector driven by the OsU3 promoter. Figure 2 Each sgRNA was co-transformed into rice protoplasts with STEME-1, STEME-2, STEME-3, and STEME-4, respectively. A3A-PBE and PABE-7 served as controls for C>T and A>G, respectively, while wild-type Cas9 served as a control for indel generation. Amplicon sequencing was performed on each sample, yielding approximately 30,000–310,000 reads per sample, and base editing efficiency was analyzed. The results showed that all four STEME vectors could generate efficient C>T and / or A>G base transversions in rice protoplasts. STEME-1 exhibited the highest C>T efficiency (0.1%–61.61%). Figure 3 a and Figure 4 ).

[0261] STEME's base editing window for C>T is consistent with A3A-PBE, ranging from C1 to C17. Figure 3 a and Figure 4 STEME-1 achieved an average editing efficiency of 29.59% from C5 to C14, which is 1.3 times that of A3A-PBE. Figure 3 a and Figure 4 Meanwhile, A>G base transversions were observed in all six target sequences, and STEME-1 still exhibited the highest A>G efficiency (0.69%-15.5%) among the four vectors. Figure 3 b and Figure 4 The A>G base editing window of STEME is consistent with that of PABE-7, ranging from A4 to A8. However, all four STEMEs (0.07%-15.5%) produced lower A>G base editing efficiency than PABE-7 (1.74%-21.54%). Figure 3 b and Figure 4 ).

[0262] Since ecTad7.10 evolved in E. coli in monomeric form, it is speculated that ecTadA7.10 monomers or homodimers can increase the A>G activity of STEME. By replacing APOBEC3A-ecTadA-ecTadA7.10 in the STEME-1 vector with APOBEC3A-ecTadA7.10 or APOBEC3A-ecTadA7.10-ecTadA7.10 fusion proteins, STEME-5 and STEME-6 were constructed. Figure 5 a) and validated using six target sequences using the method of Example 1.

[0263] Amplicon sequencing analysis of the STEME-5 and STEME-6 groups revealed that the C>T base editing efficiency of STEME-5 and STEME-6 was similar to that of STEME-1. Figure 5 b), but the editing efficiency of A>G is still lower than that of STEME-1 and PABE-7. Figure 5 c). The decreased A>G base editing efficiency of the STEME vector is consistent with previous studies, namely that the presence of extra residues at the N-terminus of the ecTadA-ecTadA7.10 heterodimer reduces adenine deaminase activity. Based on amplicon sequencing data from rice protoplasts, STEME showed high product purity at all six tested target sites. Figure 4 Furthermore, the indels efficiency it generated was consistent with that of the untreated group, and far lower than that of Cas9 (6.3%-15.61%). Figure 6 ).

[0264] The above findings demonstrate that STEME, particularly STEME-1, can achieve C:G>T:A and / or A:T>G:C base transversions using only one sgRNA. STEME-1 produces higher C:G>T:A base editing efficiency at C5 to C14 than A3A-PBE, while A:T>G:C base transversions can increase the types of targeted mutations for directed evolution through saturation mutations.

[0265] Example 2: Optimization of STEME

[0266] Cas9, derived from *Streptococcus pyogenes*, requires NGG PAM at its target sequences, which limits the number of available sgRNAs on the rice genome. Bioinformatics analysis of the rice reference genome showed that using Cas9-NG (VRVRFRR) expanded the editable range to 79%, while using Cas9 alone could only target 19% of the rice genome. Figure 7 a). Therefore, in order to expand the editing scope of STEME, nCas9(D10A) on STEME-1 was replaced with nCas9-NG(D10A), and STEME-NG was constructed. Figure 7 b).

[0267] To investigate the activity of the Cas9-NG variant in rice, A3A-PBE-NG, PABE7-NG, and pCas9-NG were also constructed. Figure 8 a). 20nt target sequences with PAM values ​​of NGA, NGT, NGC, and NGG were designed within 80bp regions of the OsAAT, OsCDC48, OsDEP1, and OsODEV loci to reduce the impact of chromatin state. Figure 8 b) and c), and the target sequence was constructed into the pOsU3-esgRNA vector.

[0268] Rice protoplasts were co-transformed with a sgRNA vector targeting NG PAM and STEME-NG, with STEME-1 and a sgRNA targeting NGGPAM serving as controls. Amplicon sequencing results showed that STEME-NG exhibited editing activity on target sequences with PAM values ​​of NGA, NGT, NGC, and NGG. Figure 9 and Figure 10 STEME-NG can edit cytosine in C1 to C17 and adenine in A4 to A8, but like STEME-1, the base editing efficiency for A>G is lower than that for C>T. Figure 9 Like the Cas9-NG (VRVRFRR) variant, STEME-NG exhibits reduced activity at the NGG PAM target compared to STEME-1. Figure 9 and Figure 10 It exhibits high editing activity on NGA and NGT PAM. Figure 9 and Figure 10 Of the NGC target sites tested, STEME-NG exhibited high editing activity only at the OsODEV-NGC target site, while its editing activity at the other three NGC target sites was relatively low. Figure 9 and Figure 10 ).

[0269] The activities of A3A-PBE-NG and PABE7-NG at the NGA, NGT, NGC, and NGG PAM target sites are consistent with those of STEME-NG. Figure 11Furthermore, similar to the untreated group, STEME-NG, A3A-PBE-NG, and PABE7-NG all exhibited lower indel values ​​compared to pCas9-NG. In summary, the activities of STEME-NG, A3A-PBE-NG, and PABE7-NG on NG PAMs are primarily dependent on the activity of Cas9-NG. They all favor NGD PAMs (D = A, T, or G) rather than NGC PAMs. STEME-NG significantly expands the range of C>T and / or A>G base editing on the genome, promoting variation through saturation mutations and directed evolution in plants.

[0270] Example 3: STEME-mediated saturation de novo mutagenesis

[0271] This embodiment uses OsACC as an example to illustrate the ability of STEME-mediated saturation de novo mutations in protoplasts to generate directed evolution.

[0272] Acetyl-coenzyme A carboxylase (ACC) is a key enzyme in the lipid synthesis pathway, and its carboxyltransferase (CT) domain is the herbicide-resistant active site. Figure 12 a). It has been reported that amino acid substitutions in the CT domain of ACC enzymes can confer herbicide resistance in weeds. Therefore, the inventors designed 20 target sequences on a 168bp sequence encoding 56 amino acids within the CT domain, including 11 NGD (D = A, T, or G) PAM target sequences (i.e., targeting the sense strand) and 9 HCN (H = A, C, or T) PAM target sequences (i.e., targeting the antisense strand). Figure 12 a, Table 2). Targeting the sense chain will result in C to T and / or A to G substitutions on the coding chain, while targeting the antisense chain will result in G to A and / or T to C substitutions on the coding chain.

[0273] Table 2

[0274]

[0275]

[0276] Using STEME-NG, these 20 target sites can cover 90.32% of the C, 40.43% of the A, 77.78% of the G and 38.89% of the T on the coding strand, for a total coverage of 61.31% of the bases on the coding strand. Figure 12 a, Table 3).

[0277] Table 3

[0278]

[0279] These 20 target sequences were constructed into the pOsU3-esgRNA vector and co-transformed into rice protoplasts with STEME-NG. A3A-PBE-NG and pCas9-NG served as controls for C>T and indels, respectively. Amplicon sequencing results showed that STEME-NG edited 96.43% of C to T, 63.16% of A to G, 92.86% of G to A, and 42.86% of T to C, with average editing efficiencies of 11.5%, 0.35%, 13.33%, and 0.45%, respectively. Figure 12 (b, Table 3). However, compared to STEME-NG, A3A-PBE-NG, using the same 20 target sites, only edited 89.29% of the covered C to T and 92.86% of the covered G to A sites. Figure 13 a, Table 3). The untreated group showed no base transversions ( Figure 13 (b) For specific amplicones, using the same 20 target sequences, STEME-NG generated 212 mutation types, 2.7 times that of A3A-PBE-NG. Of these 212 mutation types, 18.4% were generated by simultaneous mutations of C:G>T:A and A:T>G:C. On these 20 target sequences, pCas9-NG still exhibited higher indel efficiency (0.32%–39.72%) than both STEME-NG and A3A-PBE-NG.

[0280] Since base editor-mediated amino acid mutations play a crucial role in directed protein evolution, the inventors analyzed the substitution efficiency of 56 targeted edited amino acids. The results showed that 41 amino acids were substituted, including silent mutations, missense mutations, and nonsense mutations. Figure 12 c). Near-saturation mutations of 56 amino acids (73.2%) can be achieved using only 20 sgRNAs. There are 24 positions with one amino acid substitution, 12 positions with two amino acid substitutions, and 5 positions with three amino acid substitutions. Figure 12 c). A3A-PBE-NG replaces 33 amino acids, including 26 positions with one amino acid substitution, 6 positions with two amino acid substitutions, and 1 position with three amino acid substitutions. Figure 13c). The above results demonstrate that the combined use of NG PAM and CN PAM in rice protoplasts enables STEME-NG to generate a wide variety of mutant types along the coding strand. Unlike recently reported directed evolution methods that rely on bacteria and yeast (e.g., PACE, EvolvR, CREATE, CHANGE, etc.), STEME can directly generate saturated de novo mutant types in situ and can be used for the directed evolution of plant proteins.

[0281] References

[0282] 1.Li,C.et al.Expanded base editing in rice and wheat using a Cas9-adenosine deaminase fusion.Genome Biol.19,59(2018).

[0283] 2. Xing, HLet al. A CRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 14, 327 (2014).

[0284] 3. Shan, Q. et al. Rapid and efficient gene modification in rice and Brachypodium using TALENs. Mol. Plant 6, 1365-1368 (2013).

[0285] Sequence Description

[0286] >SEQ ID NO:1 Wild-type spCas9 amino acid sequence

[0287] >SEQ ID NO:2 nCas9(D10A) amino acid sequence

[0288] >SEQ ID NO:3 nCas9-NG(D10A) amino acid sequence

[0289] >SEQ ID NO:4 APOBEC3A deaminase amino acid sequence

[0290] >SEQ ID NO:5 Wild-type ecTadA amino acid sequence

[0291] >SEQ ID NO:6 DNA-dependent adenine deaminase ecTadA 7.10 amino acid sequence

[0292] >SEQ ID NO:7 Adenine deamination domain ecTadA7.10-ecTadA7.10 amino acid sequence

[0293] >SEQ ID NO:8 Adenine deamination domain ecTadA-ecTadA 7.10 amino acid sequence

[0294] >SEQ ID NO:9 32aa connector

[0295] >SEQ ID NO:10 48aa connector

[0296] >SEQ ID NO:11XTEN connector

[0297] >SEQ ID NO:12 Uracil DNA Glycosyltransferase Inhibitor (UGI) Amino Acid Sequence

[0298] >SEQ ID NO:13 STEME-1 amino acid sequence

[0299] >SEQ ID NO:14 STEME-2 amino acid sequence

[0300] >SEQ ID NO:15 STEME-3 amino acid sequence

[0301] >SEQ ID NO:16 STEME-4 amino acid sequence

[0302] >SEQ ID NO:17 STEME-5 amino acid sequence

[0303] >SEQ ID NO:18 STEME-6 amino acid sequence

[0304] >SEQ ID NO:19 STEME-NG amino acid sequence

[0305] >SEQ ID NO:20 STEME-1(APOBEC3A-48aa linker-ecTadA-32aa linker-ecTadA7.10-32aa linker-nCas9(D10A)-NLS-UGI-NLS) encoded sequence

[0306] >SEQ ID NO:21 STEME-2(ecTadA-32aa linker-ecTadA7.10-32aa linker-APOBEC3A-16aa linker-nCas9(D10A)-NLS-UGI-NLS) encoded sequence

[0307] >SEQ ID NO:22 STEME-3(APOBEC3A-48aa linker-ecTadA-32aa linker-ecTadA7.10-32aa linker-nCas9(D10A)-NLS-T2A-UGI-NLS-T2A-UGI-NLS) encoded sequence

[0308] >SEQ ID NO:23 STEME-4(ecTadA-32aa linker-ecTadA7.10-32aa linker-APOBEC3A-16aa linker-nCas9(D10A)-NLS-T2A-UGI-NLS-T2A-UGI-NLS) encoded sequence

[0309] >SEQ ID NO:24 STEME-5(APOBEC3A-32aa linker-ecTadA7.10-32aa linker-nCas9(D10A)-NLS-UGI-NLS) encoded sequence

[0310] >SEQ ID NO:25 STEME-6(APOBEC3A-32aa linker-ecTadA7.10-32aa linker-ecTadA7.10-32aa linker-nCas9(D10A)-NLS-UGI-NLS) encoded sequence

[0311] >SEQ ID NO:26 STEME-NG(APOBEC3A-48aa linker-ecTadA-32aa linker-ecTadA7.10-32aa linker-nCas9-NG(D10A)-NLS-UGI-NLS) coding sequence

[0312] >SEQ ID NO:27 sgRNA scaffold sequence

[0313] >SEQ ID NO:28 esgRNA scaffold sequence

[0314] >SEQ ID NO:29 A3A-PBE-NG(APOBEC3A-16aa linker-nCas9(D10A)-NLS-UGI-NLS) amino acid sequence

[0315] >SEQ ID NO:30PABE7-NG(ecTadA-32aa linker-ecTadA7.10-32aa linker-nCas9-NG(D10A)-NLS-NLS-NLS) amino acid sequence

[0316] >SEQ ID NO:31pCas9-NG(NLS-nCas9-NG-NLS) amino acid sequence

Claims

1. A base editing fusion protein, comprising a nucleic acid targeting domain, a cytosine deamination domain APOBEC3A and an adenine deamination domain ecTadA-ecTadA7.10, wherein the cytosine deamination domain and the adenine deamination domain constitute a fusion deaminase, and the domain of the fusion deaminase is i) APOBEC3A-ecTadA-ecTadA7.10, or ii) ecTadA-ecTadA7.10-APOBEC3A; the fusion deaminase is fused to the N-terminus of a nuclease-inactivated Cas9, and the C-terminus of the nuclease-inactivated Cas9 is fused to one or two uracil DNA glycosylase inhibitors (UGI); The amino acid sequence of the nuclease-inactivated Cas9 is shown in SEQ ID NO: 2 or SEQ ID NO: 3; the amino acid sequence of the cytosine deamination domain APOBEC3A is shown in SEQ ID NO: 4; the amino acid sequence of the adenine deamination domain ecTadA-ecTadA7.10 is shown in SEQ ID NO: 8; the amino acid sequence of the uracil DNA glycosylase inhibitor UGI is shown in SEQ ID NO: 12; The nucleic acid targeting domain, the cytosine deamination domain and the adenine deamination domain are fused via a linker, and the amino acid sequence of the linker is selected from SEQ ID NOs: 9-11.

2. The base editing fusion protein of claim 1, wherein the base editing fusion protein further comprises one or more nuclear localization sequences (NLS).

3. The base editing fusion protein of claim 1 or 2, wherein the amino acid sequence of the fusion protein is as shown in any one of SEQ ID NO: 13-16, 19.

4. The base editing fusion protein of claim 1 or 2, wherein the amino acid sequence of the fusion protein is as shown in any one of SEQ ID NO: 13 and 19.

5. A base editing system for modifying a target nucleic acid region in a genome, comprising: i) the base editing fusion protein of any one of claims 1 to 4 and / or an expression construct containing a nucleotide sequence encoding the base editing fusion protein; and / or ii) at least one guide RNA and / or at least one expression construct comprising a nucleotide sequence encoding said at least one guide RNA, Wherein the at least one guide RNA is directed against at least one target sequence within the target nucleic acid region.

6. The base editing system of claim 5, wherein the guide RNA is a sgRNA, and the sgRNA comprises a scaffold sequence shown in SEQ ID NO:27 or SEQ ID NO:

28.

7. The base editing system of claim 5, wherein the target sequence targeted by the guide RNA comprises a PAM sequence at the 3' end, and the PAM sequence is selected from 5'-NGG-3' or 5'-NG-3'.

8. The base editing system of claim 5, wherein at least one guide RNA is directed against a target sequence located on the sense strand and / or antisense strand of a target nucleic acid region in the cell genome.

9. A non-therapeutic method for producing at least one genetically modified cell, comprising introducing the base editing system of any one of claims 5-8 into at least one of the cells, thereby resulting in one or more nucleotide substitutions within a target nucleic acid region in the at least one cell.

10. The method of claim 9, further comprising the step of screening the at least one cell for cells having the desired one or more nucleotide substitutions.

11. The method of claim 9 or 10, wherein the base editing system is introduced into the cell by a method selected from the following methods: calcium phosphate transfection, protoplast fusion, electroporation, liposome transfection, microinjection, viral infection, gene gun technique, PEG-mediated protoplast transformation, and Agrobacterium-mediated transformation.

12. The method of claim 9 or 10, wherein the cell is from a mammal, poultry or plant.

13. The method of claim 12, wherein the mammal is selected from humans, mice, rats, monkeys, dogs, pigs, sheep, cattle, and cats; the poultry is selected from chickens, ducks, and geese; and the plant is selected from wheat, rice, corn, soybeans, sunflowers, sorghum, rapeseed, alfalfa, cotton, barley, millet, sugarcane, tomatoes, tobacco, cassava, and potatoes.

14. Use of the base editing fusion protein of any one of claims 1-4, an expression construct containing a nucleotide sequence encoding the base editing fusion protein, or the base editing system of any one of claims 5-8 in the preparation of a kit for producing at least one genetically modified cell.

15. The use according to claim 14, wherein the cell is from a mammal, poultry or plant.

16. The method of claim 15, wherein the mammal is selected from humans, mice, rats, monkeys, dogs, pigs, sheep, cattle, and cats; the poultry is selected from chickens, ducks, and geese; and the plant is selected from wheat, rice, corn, soybeans, sunflowers, sorghum, rapeseed, alfalfa, cotton, barley, millet, sugarcane, tomatoes, tobacco, cassava, and potatoes.

Images