SNP molecular marker related to red color character of prunus mira and application thereof

By developing a combination of SNP molecular markers related to the red trait of plum peel, rapid identification of plum peel color and efficient breeding were achieved, solving the problem of difficulty in identifying the red trait of plum peel in existing technologies, improving detection accuracy and reducing breeding costs.

CN114959103BActive Publication Date: 2025-12-19NANJING AGRICULTURAL UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202210697104.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-06-20
Publication Date
2025-12-19
Estimated Expiration
2042-06-20

AI Technical Summary

Technical Problem

The lack of effective SNP molecular markers in existing technologies for the identification and breeding of red plum peel traits results in slow breeding processes and high costs.

Method used

A combination of SNP molecular markers associated with the red trait of plum peel was developed, including 7 SNP molecular markers and specific primers. Through genome sequencing screening and functional annotation, it was used for rapid identification of plum peel color and molecular marker-assisted breeding.

Benefits of technology

It improved the accuracy of plum peel color detection to over 90%, reduced field testing costs, shortened the breeding process, and provided a foundation for the cloning of candidate anthocyanin synthesis genes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114959103B_ABST
    Figure CN114959103B_ABST
Patent Text Reader

Abstract

The application discloses an SNP molecular marker related to a plum fruit skin red character and application thereof. Seven high-quality and high-polymorphic SNP molecular markers are mined by resequencing data, and the markers can be used for accurate detection of plum varieties (strains) with different fruit skin colors, and have wide application universality. The markers are codominant markers, and have the advantages of specificity, sensitivity, high resolution and the like. The developed molecular markers are not affected by environmental conditions, can use seeds or any type of plant tissue, can realize rapid identification of resistance, reduce field test cost, thereby saving breeding cost and accelerating breeding process.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular biology, and particularly relates to a SNP molecular marker combination related to a fruit Mei skin red trait, specific primers and application thereof. BACKGROUND

[0002] The skin color is composed of the ground color and the surface color of the fruit surface, and is related to the content and proportion of chlorophyll, carotenoids (carotene, lutein and tomato red, etc.) and flavonoid pigments (flavone, flavonol and anthocyanin, etc.). The ground color of the fruit surface is mainly green, yellow and yellow-green, which is determined by the content and proportion of chlorophyll and carotenoids, and the surface color of the fruit surface is mainly red, blue and purple, which is the result of the synthesis and accumulation of anthocyanin and other flavonoids. Fruit commercialization is a process of improving fruit quality, maximum economic and use value with market economic demand as the guide and improving fruit economic benefit as the goal. Fruit quality is the comprehensive performance of external quality and internal quality, and the external quality of fruit usually includes fruit shape, size, uniformity, skin color, surface smoothness and luster, fruit point and other indexes. The skin color is closely related to the type and content of anthocyanin in the fruit skin, and good skin color is excellent fruit appearance quality, which can attract the attention of consumers and improve the commodity value.

[0003] Anthocyanin is a common water-soluble flavonoid substance, and is a branch product of flavonoid metabolism in the secondary metabolism-phenylalanine metabolic pathway of plants. Anthocyanin is an important secondary metabolite existing in flowers, fruits, leaves and many other organs of higher plants, has diverse structures and is widely distributed. Anthocyanin is synthesized in the cytoplasm and then transported to the vacuole for storage, and the color changes from red to purple with the change of the acid-base degree in the cell liquid. As a kind of edible natural pigment, anthocyanin is one of the most widely used food additives in the food industry, and is often used for color adjustment of processed products such as jelly, candy and jam. Anthocyanin is the main coloring matter in red wine, and is also the main factor determining the appearance quality and luster, and affects the internal quality such as taste together with other phenolic substances. Other fruits rich in anthocyanin such as blueberry, mulberry and waxberry are used to be deeply processed into dried fruits (blueberry and mulberry), jam (blueberry jam), fruit wine (mulberry wine and waxberry wine) and fruit juice beverages, etc. to enrich people's daily diet.

[0004] Whole genome resequencing provides high-throughput molecular markers for constructing high-density genetic linkage maps, whole genome association study analysis and quantitative trait locus mapping at the genome level. SNP markers developed based on WGR are used to identify and verify SNP genotypes. Combined with traditional molecular markers for genetic mapping, candidate genes and SNP sites that cause phenotypes can be quickly mined. SNP markers are widely used in fruit trees such as pear, apple, grape and peach for genetic diversity and quantitative trait mapping. There are many reports on the quantitative trait mapping of fruit color. Compared with other DNA molecular markers, SNP molecular markers have the advantages of large number, genetic stability and easy detection, and are often used for positioning and molecular marker-assisted breeding of genes related to fruit skin color in pear, apple and grape. SNP molecular markers are widely used in plum germplasm identification, genetic evolution analysis and flower color gene mapping. However, there is no report on molecular markers related to fruit skin redness. Therefore, developing high polymorphic SNP molecular markers highly related to the biosynthesis of plum fruit skin anthocyanins will greatly accelerate the breeding process of excellent germplasm suitable for different processing needs of fruit plums. SUMMARY

[0005] The purpose of the present application is to provide a SNP molecular marker combination related to the fruit plum skin redness trait, specific primers and applications thereof.

[0006] The technical scheme of the present application is as follows:

[0007] In the first aspect, the SNP molecular markers related to the fruit plum skin redness trait obtained by genome sequencing and screening are identified and verified in different fruit plum varieties commonly used in processing and production, and significant SNP sites related to plum skin color are developed through functional annotation and analysis screening.

[0008] A SNP molecular marker combination related to the fruit plum skin redness trait, the molecular marker combination comprising the following 7 SNP molecular markers:

[0009]

[0010] The nucleotide sequences in which the PmSNP_1-7 are located are shown in SEQ ID NO. 1-7, respectively.

[0011] The above information is based on the plum genome version: GCA_000346735.1 P.mume_V1.0, 2014 / 02 / 28 of the database NCBI.

[0012] The specific primers of the SNP molecular marker combination related to the fruit plum skin redness trait, the sequence of the specific primers is as follows:

[0013]

[0014] A kit comprising the specific primer.

[0015] In a second aspect, based on the foregoing research results, the application provides application of the molecular marker combination in identification of different fruit peel color germplasm materials of Prunus mume or detection of anthocyanin synthesis genes.

[0016] Application of the SNP molecular marker combination, the specific primer or the kit in molecular marker assisted breeding of fruit Prunus mume.

[0017] Further, application of the SNP molecular marker combination, the specific primer or the kit in screening of red fruit peel Prunus mume.

[0018] A method for screening red fruit peel Prunus mume, the method comprising the steps of applying the SNP molecular marker combination, the specific primer or the kit.

[0019] Further, the method for screening red fruit peel Prunus mume comprises the following steps:

[0020] (1) extracting genomic DNA of the to-be-detected Prunus mume sample;

[0021] (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification by using the specific primer or the kit;

[0022] (3) performing sequencing on the purified PCR product to detect the genotype;

[0023] (4) comparing the detected seven genotypes with the SNP molecular marker combination, and if each genotype is the same, the to-be-detected Prunus mume sample is a red fruit peel Prunus mume.

[0024] Advantages: compared with the prior art, the application has the following advantages:

[0025] The application utilizes sequencing data and multi-year and multi-point phenotype data to perform correlation analysis, obtains SNP sites related to fruit peel color of Prunus mume, further develops SNP molecular markers related to fruit peel color of Prunus mume, and improves the detection accuracy to more than 90% through the molecular marker combination detection method.

[0026] The application also provides a candidate genomic interval for cloning candidate anthocyanin synthesis genes, identifies a chromosome segment related to fruit peel color of Prunus mume, and provides a basis for further gene cloning and utilization.

[0027] The use of the molecular marker developed in the application for assisted breeding can realize rapid identification of fruit peel color, reduce field test cost, thereby saving breeding cost and accelerating breeding process. BRIEF DESCRIPTION OF DRAWINGS

[0028] Figure 1 The plum fruit ecological light used for developing the molecular marker.

[0029] Figure 2 The SNP sequencing genotyping of PmSNP_1 and PmSNP_2.

[0030] Figure 3 UPGMA cluster diagram of 44 fruit plum germplasms.

[0031] Figure 4 Population structure of 44 fruit plum germplasms. DETAILED DESCRIPTION

[0032] The application will be further illustrated below in conjunction with specific examples, which should be understood as merely illustrating the application but not limiting the scope of the application. After reading the application, those skilled in the art can make various equivalent modifications to the application, which all fall within the scope defined by the appended claims. In the following examples, the experimental methods used are conventional methods unless otherwise specified. In the following examples, the materials, reagents, etc. can be obtained from commercial channels unless otherwise specified.

[0033] EXAMPLE

[0034] SNP molecular marker combination for fruit plum fruit peel red trait detection

[0035] The design process of the site in the application is as follows: the 28 SNP sites for fruit plum fruit peel color detection are obtained by comparing and screening the sites of the green plum and red plum through the resequencing data site information of the green plum and red plum; the SNP site and the flanking sequence are extracted; the primer sequence of the marker is designed and synthesized; and the marker is verified and detected to obtain the 7 SNP molecular markers of the application, which are as follows:

[0036] 1. Screening of 28 SNP molecular markers for fruit plum fruit peel red trait detection

[0037] By using the resequencing data site information of Prunus mume and Prunus mume var. atropurpurea, the SNP sites involved in the region of functional genes of anthocyanin synthesis in Prunus mume were screened. Among the 180,000 functional related sites collected, the sites of Prunus mume and Prunus mume var. atropurpurea were compared, and 3,143 completely matched site SNP markers of Prunus mume were obtained. Further sequence alignment and annotation of the obtained SNP markers to the reference genome (GCA_000346735.1 P.mume_V1.0) of Prunus mume were performed, and 28 best specific marker sites were obtained. According to the 28 SNP sites, SNP primers were designed, and 44 Prunus mume germplasm resources with different peel colors were selected for genotyping verification. A set of marker combinations with the least markers and capable of distinguishing all materials was selected, and finally 7 SNP markers for detecting the peel color of Prunus mume were selected. The 7 molecular markers are all high-quality, single-copy, high-polymorphic (the PIC value of 44 Prunus mume materials is higher than >=0.5), and the data detection rate is >90%. The ecological photos and basic information of the above 44 Prunus mume varieties are shown in Table 1 and Table 1. Figure 1 and Table 1.

[0038] Table 1: Molecular marker test Prunus mume varieties

[0039]

[0040] The basic information of the above 7 SNP molecular markers is shown in Table 2.

[0041] Table 2: Basic information of molecular markers

[0042]

[0043]

[0044] The nucleotide sequences of the 7 SNP molecular markers are as follows:

[0045] PmSNP_1

[0046] TTGCCCGGGTAAGTCAATGGTTTAACCTTCCTTCCCCAACACCACACCGTCCTCATGACTCACCGTCTAACTCTATCCATAACAACAAAACCACACTTTCTCGAGGAAAAGACACTCTCAGATTCCCGCAATTTCTCAGCCCCACAAAAACCCATGGCGCCAAAATCCTTCAACCCCAAAACCCAAACCTAC[T / A]CCTCCCCCCGACCTCCCGCCCCCTTCCCCACAGACCCCAACCTCTCCCTCACCTCCTTCCTCTTCCAATCCTCCACCTCCTTCCCCAACAACCTTGCCCTCGCCGACTCAGACACCGCCGAAACTCTAACC

[0047] PmSNP_2

[0048] TCCGGCCTTCTCCACCGAC[G / C]CCAAGCGCCTCCTCGTCTGCACAGGCCCCGTCGTCTCCATCTTTAGCACCTCCACCGGTTTACAGGTTTCCAGTTCTACCTTCCTCTTCCTCCTCAATTTACGCTCCCATACCCTCCCTCTTATGATAATATTTGGTTTTATTTGTTTAATTTAGATAGCTTCCTTGGAGGCTCACAATGCCTTGGTCACCTCCGTCATAGTAGTTCCCGGAAACAAAGCTCTGAGCTTTTGCTGGACTGCCTCCCTCGACGGCACCCTTCGCTATTGGGACTTTGCAGT

[0049] PmSNP_3

[0050] GCA GCT TGA CCA TCC CCA TAT CAA AAT AAT AAC TAC CAG CAG CTG CGA AGC TGA AGC TGAACTACTTGAAGTAGCAGTCATTGACATTATTGAAGAAAAGCATAGTTGTCCGTTTGA TGAC GAG CTA AAT GAC CAC AAG TAC AGT AG[C / G]AGT AGC AGT AGT AGT AGT CTCTACCTGATATACCTCATGAGTAACGCCCATGGCATGATCATGTTGATGGTCACTCAA AACCCCATTTGAATTTGGATCCTTCTGCAGTAACTCAACATTGTCCATCAATTCATTAAATGTAC CCA ACAACCCACCAT

[0051] PmSNP_4

[0052] AAATTAATCAAATAATGAAGAGATCAGCACAACTTGTGTTCATCCCAGCCCCAGGCGCTGGCCACATCGTGTCAACGGTCGAGATCGCAAAGCAACTCGTTGCTCAAGATGACCAGCTCTTCATCACCATCCTCATCATGAAGCTCCCCTTCGACAAGCTCTTCACCAATACAGACCCTTCAATCTCACACCGCATCAGCTTCGTCAACCTCCCGGA[G / C]TTCCACATCGACACACAGGGCCTTGCCTTCACCTCCTTCATCAAAACA

[0053] PmSNP_5

[0054] AGCCAGAGCCAGTTCTTGGAATTGGGTTTGATCAAAAACTGTGAAGCTGCCAAATGCAACATAGATGACTGAGTTG[A / T]GTGGCTGTTGATCCAGCCACTGCAAGCAAGTTGAGTCTTGTGGCCAAAAGGAGCCTGCTGAATTTCCGACCCGGTTGCTTGCCAAGAGTGGGCCTATTGGTAAAATTTCAGGGGCCGAGGTGAATGCTTCTGGCTCAAAGTCATATGTTGAGTTGCAAACAAGCCTTTCTACCAGTTTCAGAGTCCTGTTGATTCTTAACATTACCTCAAATATCATTTTCTGAGTGGTAAAGTCACCTATGCATGCCCACACAAAGTCTTTAGTGTTCATGGTGGGCATG

[0055] PmSNP_6

[0056] CACATTTTGTTCCTCCCGCCAATCTGCCACGTAAGTCGCCACTCTCCTATAAAATTTCTCCTTAAACACCTCCCACACTTGGTACTTGTAGTGATTTATAACCAACACTCCCCTATCCACATTCACAGGCTCGTACCCAT[T / A]CCTAAGATGAAAATGGTGCACCACATTGATCAATGTTGAGTTCAATGCCTCAGGCCTAACAATACTCTTGTGCCTCTCGGGGGCGGCCAACCGACACGTGTACCCGACCGTGACGCCTTGAACAGGAACTCGTCTGAGGCCCGAAGGCCCAAAACTGTA

[0057] PmSNP_7

[0058] ATTAAATGCCTTTGAATTGGTAAGGGAGTTGGGATTGGCTGTGGAAATCAACATGGAGTATAGGAGGAGCTTTTATGGGGA[T / G]AGTCCGAAGGTTGTGAAGGCAGAAGAGATAGAGAGAGGAATAAGGGAGGTGATGGTGCAGGATAGTGATTTAAGGAAGAGGGTGAAAGAGACGAGTGAGAAGAGCAAGGCGGCTTTGATGGATGGTGGGTCCTCACACTCTTCATTGGGACATTTTCTTGATCAGATTTTTCTTTGATATATAAATAAAATATATATTCGGTGGTTCTGATTTTG

[0059] 2. Primer design

[0060] SNP marker design: The 8 SNP molecular markers screened were designed for SNP primers using Oligo 7 software. Each SNP marker consisted of 2 forward and reverse primer sequences, and the primer sequences are shown in Table 3.

[0061] Table 3. List of primers used for molecular marker development

[0062]

[0063] 3. SNP detection

[0064] Using Table 3, 300-1,000 bp PCR products containing SNP sites were amplified. 1 μl of DNA was amplified with 1 μM of forward and reverse primers, 0.2 mM dNTP, 3 mM MgCl2, and 2 U Taq DNA polymerase using the following cycle program: 95 °C for 5 min, then 94 °C for 30 s, 60 °C for 30 s, 72 °C for 90 s, for a total of 40 cycles, and a final extension at 72 °C for 10 min. The PCR products were detected by 1% agarose gel electrophoresis. The purified PCR products were sequenced by Genescript Biotech (Nanjing). The sequencing file was checked using NovoSNP software, and genotypes were detected by extracting or comparing peak signals.

[0065] Genotyping of all SNP sites was obtained by Sanger sequencing, as shown in Table 4. Figure 2 As shown in Table 4, PmSNP_1 and PmSNP_2 SNP sequencing genotyping were common T / A and C / G genotypes, including heterozygous and homozygous mutations.

[0066] 4. Verification of 7 SNP molecular markers for detection of fruit Mei fruit peel red trait

[0067] The SNP primer polymorphism was analyzed by PopGene 1.32 software, and the effective allele number (Ne), observed heterozygosity (Ho), expected heterozygosity (He), average heterozygosity (Ha), gene heterozygosity (H), minor allele frequency (MAF), Shannon information index (I), and polymorphism information content (PIC) were calculated.

[0068] The polymorphism information content (PIC) is an index of species diversity. PIC>0.5 in the population indicates that the site is highly polymorphic; when 0.25PIC<0.5, the site is moderately polymorphic; and PIC<0.25, the site shows low polymorphism. The polymorphisms of the 7 SNP sites measured are all higher than 0.5, belonging to highly polymorphic SNP sites.

[0069] Using the 7 polymorphisms, 968 genetic distance and similarity coefficient data were obtained from 44 fruit plum samples. The genetic similarity of red plum type ‘Hongding’ and ‘Ruanliaohongmei’ was the highest (0.989), and the genetic similarity of green plum type ‘Xinnuoxiaomei’ and red plum type ‘Zhonghong’ was the lowest (0.412). The genetic similarity coefficient was 0.03 by quantitative distribution analysis, and the highest genetic similarity coefficient in the 44 varieties was 0.81, with bilateral asymmetry. By chi-square test, they were all not normally distributed (P<0.01), showing left-skewed distribution. According to the SNP genetic similarity coefficient matrix, as shown in Figure 3 , the 44 varieties were divided into two subgroups. As shown in Figure 3 , 6 varieties were assigned to subgroup I, and 38 varieties were assigned to subgroup II. The 6 red plum varieties were assigned to subgroup I, and all green plum varieties were assigned to subgroup II.

[0070] Based on 28 SNP sites from 44 varieties, the fruit plum variety population structure was studied. The STRUCTURE software was run, K ranged from 1 to 10, and 10 independent runs were performed for each K. The maximum ΔK was detected at K=2, so it was inferred that the variety population was divided into 2 clusters, including 10 and 34 germplasm Figure 4 (A).

[0071] The maximum likelihood values obtained by 10 operations corresponding to K = 2 are compared, the variety population structure of Meiyu is drawn, and the qi value corresponding to one variety belonging to the subpopulation is obtained. The results show that most of the red plum varieties (10 / 15) are classified into cluster I (He: 0.3352, Fst: 0.1773), and the qi of 4 red plum varieties is greater than 0.9; 34 varieties are classified into cluster II (He: 0.2817, Fst: 0.2800), of which 6 are red plum varieties and 28 are green plum varieties, most of the green plum varieties (82%) in cluster I have qi values greater than 0.9, and the other 6 red plum varieties range from 0.523 to 0.745. In this study, the subgroups classified according to structure and fruit skin color are analyzed, and it is found that the fruit plum classification result based on structure has great correlation with the fruit color classified according to morphology. For example, most of the red plum varieties are classified into cluster I, and most of the green plum varieties are classified into cluster II. Figure 4 B).

[0072] The present application develops SNP molecular markers based on genome resequencing to study the genetic diversity of 44 varieties. According to the PIC value, a total of 7 SNPs markers show high polymorphism (PIC>0.5). By constructing an evolutionary tree, all 44 varieties are divided into 2 categories, most of the red plum varieties are assigned to cluster I, and all the green plum varieties are assigned to cluster II, which means that the developed molecular markers can effectively distinguish red plum and green plum varieties, and provide a possibility as effective molecular markers for the related molecular marker assisted breeding of fruit skin color in the future. SEQUENCE LISTING <110> Nanjing Agricultural University <120> SNP molecular markers related to plum fruit skin redness and their applications <160> 21 <170> SIPOSequenceListing 1.0 <210> 1 <211> 324 <212> DNA <213> Prunus mume Prunus mume Sieb. et Zucc. <400> 1 ttgcccgggt aagtcaatgg tttaaccttc cttccccaac accacaccgt cctcatgact 60 caccgtctaa ctctatccat aacaacaaaa ccacactttc tcgaggaaaa gacactctca 120 GATTCCCGCA ATTTCTCAGC CCCACAAAAA CCCATGGCGC CAAATCCTTC AACCCCAAA 180 ACCCAAACCT ACTCCTCCCC CCGACCTCCC GCCCCCTTCC CCACAGACCC CAACCTCTCC 240 CTCACCTCCT TCCTCTTCCA ATCCTCCACC TCCTTCCCCT ACAACCTTGC CCCTCGCCGA 300 TCAGACACCG CCGAAACTCT AACC 324 <210> 2 <211> 300 <212> DNA <213> Prunus mume Prunus mume Sieb. et Zucc. <400> 2 TCCGGCCTTC TCCACCGACG CCAAGCGCCT CCTCGTCTGC ACAGGCCCCG TCGTCTCCAT 60 CTTTCCTCCT CTTCTCCTCT CTTCTCCTCT CTTCTCCTCT CTTCTCCTCT CTTCTCCTCT 120 ACGCTCCCAT ACCCTCCCTC TTATGATAAT ATTTCCTTCT ATTTCTTCTA TTTCCTCCTC 180 TTCTCTCCTC CTCTCTCCTC CTCTCTCCTC CTCTCTCCTC CTCTCTCCTC CTCTCTCCTC 240 TCTGAGCTTT TGCTGGACTG CCTCCCTCGA CGGCACCCTT CGCTATTGGG ACTTTGCAGT 300 <210> 3 <211> 307 <212> DNA <213> Prunus mume Prunus mume Sieb. et Zucc. <400> 3 gcagcttgac catcctccat atcaaaataa taactaccag cagctgccga agctgaagct 60 gaactacttg aagtagcagt cattgacatt attgaagaaa agcatagttg tccgtttgat 120 gacgagctca aatgaccaca agtagtagca gtagcagtag tagtagtctc tacctgatat 180 acctcatgag taacgcccat ggcatgatca tgttgatggt cactcaaaac cccatttgaa 240 tttggatcct tctgcagtaa ctcaacattg tccatcaatt cattaaatgt acccaacaac 300 ccaccat 307 <210> 4 <211> 266 <212> DNA <213> Me (Prunus mume Sieb. et Zucc.) <400> 4 aaattaatca aataatgaag agatcagcac aacttgtgtt catcccagcc ccaggcgctg 60 gccacatcgt gtcaacggtc gagatcgcaa agcaactcgt tgctcaagat gaccagctct 120 tcatcaccat cctcatcatg aagctcccct tcgacaagct cttcaccaat acagaccctt 180 caatctcaca ccgcatcagc ttcgtcaacc tcccggagtt ccacatcgac acacagggcc 240 ttgccttcac ctccttcatc aaaaca 266 <210> 5 <211> 358 <212> DNA <213> MEI Prunus mume Sieb. et Zucc. <400> 5 agccagagcc agttcttgga attgggtttg atcaaaaact gtgaagctgc caaatgcaac 60 atagatgact gagttgtgtg gctgttgatc cagccactgc aagcaagttg agtcttgtgg 120 ccaaaaggag cctgctgaat ttccgacccg gttgcttgcc aagagtgggc ctattggtaa 180 aatttcaggg gccgaggtga atgcttctgg ctcaaagtca tatgttgagt tgcaaacaag 240 cctttctacc agtttcagag tcctgttgat tcttaacatt acctcaaata tcattttctg 300 agtggtaaag tcacctatgc atgcccacac aaagtcttta gtgttcatgg tgggcatg 358 <210> 6 <211> 300 <212> DNA <213> MEI Prunus mume Sieb. et Zucc. <400> 6 cacattttgt tcctcccgcc aatctgccac gtaagtcgcc actctcctat aaaatttctc 60 cttaaacacc tcccacactt ggtacttgta gtgatttata accaacactc ccctatccac 120 attcacaggc tcgtacccat tcctaagatg aaaatggtgc accacattga tcaatgttga 180 attcacaggc tcgtacccat tcctaagatg aaaatggtgc accacattga tcaatgttga 180gttcaatgcct caggcctaac aatactcttg tcgctctcgg ggcggccaac cgacacgt 240 gtacccgacc gtgacgcctt gaacaggaac tcgtctgagg cccgaaggcc caaaactgta 300 <210> 7 <211> 297 <212> DNA <213> Artificial Sequence Prunus mume Sieb. et Zucc. <400> 7 attaaatgcct ttgaattggtaagggagttgggattggct gtggaaatca acatggagta 60 taggaggagc ttttatgggg agagtccgaa ggttgtgaag gcagaagaga tagagagagg 120 aataagggag gtgatggtgc aggatagtga tttaaggaag agggtgaaag agacgagtga 180 gaagagcaag gcggctttga tggatggtgg gtcctcacac tcttcattgg gacattttct 240 tgatcagatt tttctttgat atataaataa aatatatatt cggtggttct gattttg 297 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <400> 8 ttgcccgggt aagtcaatgg 20 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <400> 9 ggttagagtt tcggcggtgt 20 <210> 10 <211> 18 <212> DNA <213> Artificial Sequence <400> 10 tccggccttc tccaccga 18 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <400> 11 actgcaaagt cccaatagcg aag 23 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <400> 12 gcagcttgac catcctccat a 21 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <400> 13 atggtgggtt gttgggtaca t 21 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <400> 14 aaattaatca aataatgaag agat 24 <210> 15 <211> 19 <212> DNA <213> Artificial Sequence <400> 15 tgttttgatg aaggaggtg 19 <210> 16 <211> 19 <212> DNA <213> Artificial Sequence <400> 16 ggcgacttgc ttgcttacg 19 <210> 17 <211> 22 <212> DNA <213> Artificial Sequence <400> 17 catgcccacc atgaacacta aa 22 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <400> 18 cacattttgt tcctcccgcc 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <400> 19 tacagttttg ggccttcggg 20 <210> 20 <211> 22 <212> DNA <213> Artificial Sequence <400> 20 attaaatgcc tttgaattgg ta 22 <210> 21 <211> 20 <212> DNA <213> Artificial Sequence <400> 21 caaaatcaga accaccgaat 20

Claims

1. Use of a combination of SNPs for screening of red-fleshed plum fruits, characterized in that, The SNP combination comprises the following 7 SNPs:

2. A method of selecting red-fleshed plum fruit, characterized by, The method comprises the step of screening by using the SNP combination, characterized in that the SNP combination comprises the following 7 SNPs: The method comprises the following steps: (1) extracting genomic DNA of the to-be-tested plum sample; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification by using specific primers; the sequences of the specific primers are as follows: (3) sequencing the purified PCR product to detect the genotype; (4) comparing the detected 7 genotypes with the SNP combination, and if each genotype is the same as the red trait-related allele, the to-be-tested plum sample is a red-skinned plum.

Citation Information

Patent Citations

  • Chromosome inversion co-segregated with purple leaf character of plum blossom and application of chromosome inversion

    CN117965793A