Double-stem padlock probes and their applications in microRNA detection

By designing a terminal double-stem padlock probe and combining it with hyperbranched rolling circle amplification technology, the sensitivity and specificity problems of microRNA detection in existing technologies are solved, and efficient and economical detection of multiple targets is achieved.

CN114990193BActive Publication Date: 2025-09-19THE FIRST AFFILIATED HOSPITAL OF ARMY MEDICAL UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202210736644.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-06-27
Publication Date
2025-09-19
Estimated Expiration
2042-06-27

AI Technical Summary

Technical Problem

Existing technologies make it difficult to achieve high sensitivity, high specificity and simultaneous multi-target detection of microRNAs, and experimental design is complex, time-consuming and costly.

Method used

A terminal double-stem padlock probe was designed. By modifying the stem-loop structure at both ends of the padlock probe and combining it with hyperbranched rolling circle amplification technology, splint R ligase was used to connect them into a ring. Specific primers and universal primers were used for amplification, and fluorescent or colorimetric signals were output for detection.

Benefits of technology

It achieves high sensitivity and high specificity, and can detect multiple microRNA targets simultaneously. The detection method is simple, low-cost and time-saving.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114990193B_ABST
    Figure CN114990193B_ABST
Patent Text Reader

Abstract

The present invention discloses a terminal double-stem padlock probe and its application in microRNA detection. The padlock probe includes a stem-loop junction sequence and a stem-loop sequence located at the 5' and 3' ends of the stem-loop junction sequence, respectively. The partial ring region and the terminal complementary region of the stem-loop are complementary to the target sequence to be detected. The stem-loop junction sequence can be randomly designed into a required functional sequence to achieve functions such as color development and targeting. The present invention utilizes stem-loop structural modification at both ends of the padlock probe, combined with super-branched rolling circle amplification technology or rolling circle amplification technology, thereby achieving a dual improvement in detection sensitivity and specificity, and can be applied to the simultaneous detection of multiple targets. The probe structure design and detection method of the present invention are simple, time-consuming, low-cost, easy to promote and apply, can sensitively and specifically perform simultaneous detection of multiple targets, and can output multiple qualitative and quantitative reporter signals.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of molecular biological detection, in particular to a terminal double-stem padlock probe, and also to the application of the terminal double-stem padlock probe in microRNA detection. Background Art

[0002] MicroRNA is a type of small non-coding RNA that plays an important role in the post-transcriptional regulation of genes in the human body. It is involved in many pathophysiological processes and is closely related to the occurrence and development of a series of diseases. A large number of studies have found that abnormal expression of microRNA is found in the blood and body fluids of patients with tumors, cardiovascular diseases, inflammation, etc. Therefore, it is considered to be a very promising biomarker. However, due to the low abundance of microRNA, effective signal amplification is usually required to detect its concentration. Moreover, the specificity of a single microRNA for disease diagnosis and treatment is poor, and the combined detection of multiple targets is usually required to provide effective clinical diagnosis and treatment information. Therefore, high-sensitivity, multi-target simultaneous detection of microRNA technologies needs to be developed and applied.

[0003] To achieve high sensitivity, high specificity, or simultaneous multi-target detection of microRNAs, a large number of studies are currently combining multiple molecular biology techniques or integrating them with various detection platforms to achieve improved sensitivity or specificity or simultaneous multi-target detection. However, the combined application of various techniques and platforms makes experimental design complex, time-consuming, and costly, and few studies have simultaneously addressed the three challenges of sensitivity, specificity, and simultaneous multi-target detection.

[0004] Therefore, it is urgent to design multi-target, highly specific and highly sensitive microRNA detection molecular probes to achieve a simple and economical solution to the three problems of sensitivity, specificity and simultaneous detection of multiple targets. Summary of the Invention

[0005] In light of this, one objective of the present invention is to provide a terminal double-stem padlock probe. This padlock probe is a modification of a conventional padlock probe with stem-loop structures at both ends. This probe effectively improves sensitivity and specificity, and by using different specific primers for hyperbranched rolling circle amplification, it can simultaneously detect different microRNA molecules. A second objective of the present invention is to provide a microRNA detection kit containing the terminal double-stem padlock probe. A third objective of the present invention is to provide the use of the terminal double-stem padlock probe in detecting at least one microRNA target. A fourth objective of the present invention is to provide a method for detecting microRNA using the terminal double-stem padlock probe.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] 1. A terminal double-stem padlock probe, wherein the padlock probe comprises a stem-loop junction sequence and stem-loop sequences located at the 5' and 3' ends of the stem-loop junction sequence, respectively. The partial circular region and the terminal complementary region of the stem-loop are complementary to the target sequence to be detected.

[0008] Preferably, the length of the stem-loop connecting sequence is 10 to 100 nt; the length of the loop region of the stem-loop sequence is 3 to 25 nt, and the length of the complementary region is 3 to 15 bp.

[0009] Preferably, the stem-loop linker sequence of the present invention is a freely editable DNA functional region.

[0010] Preferably, the functional region is rich in C base repeat sequences, and the transcribed G base repeat sequences can be folded into a G-quadruplex DNA enzyme to catalyze the colorless substrate to develop color.

[0011] 2. A microRNA detection kit containing the terminal double-stem padlock probe comprises at least one of the terminal double-stem padlock probes, splint R ligase, a specific primer complementary to the stem-loop region of the terminal double-stem padlock probe, a universal primer having the same base sequence as a segment of the stem-loop junction sequence, and a hyperbranched rolling circle amplification reagent or a rolling circle amplification reagent.

[0012] 3. Use of the terminal double-stem padlock probe in detecting at least one microRNA target.

[0013] 4. A method for detecting microRNA using the terminal double-stem padlock probe, comprising adding at least one terminal double-stem padlock probe to a solution containing at least one target microRNA to be detected. After the target microRNA opens the stem loops at both ends of the terminal double-stem padlock probe, the terminal double-stem padlock probe is ligated into a ring using splint R ligase. The ringed chain is then used as a template for hyperbranched rolling circle amplification, and the target molecule is detected by outputting a fluorescent signal. Alternatively, the ringed chain is used as a template for rolling circle amplification, and the target molecule is detected by a colorimetric signal.

[0014] Preferably, the method for ligating into a ring is as follows: the terminal double-stem-loop chain is incubated with the microRNA to be detected and splint R ligase in 0.05×splintR buffer solution at 25°C for 1 hour, and then inactivated at 85°C for 20 minutes to effectively ring the terminal double-stem padlock probe.

[0015] Preferably, the method for detecting target molecules by outputting fluorescence signals through hyperbranched rolling circle amplification of the present invention is as follows: adding specific primers, universal primers, dNTPs, DNA polymerase, Super EvaGreen and buffer to the circular chain, using a fluorescence quantitative PCR instrument to monitor fluorescence in real time at 55° C., and observing the peak time of the exponential amplification curve;

[0016] The specific primer is complementary to the stem-loop region of the terminal double-stem padlock probe, initiating a rolling circle amplification reaction to form a long chain with a repetitive sequence; the universal primer is identical to a base sequence of a segment of the connecting sequence between the stem-loop, is complementary to the long chain of repetitive sequences formed by rolling circle amplification, and amplifies using the long chain of repetitive sequences as a template.

[0017] Preferably, the rolling circle amplification method for detecting target molecules by colorimetric signals is as follows: specific primers, dNTPs, DNA polymerase and a corresponding buffer system are added to the ring chain, incubated at 30°C for 1 hour, and then inactivated at 65°C for 20 minutes to obtain a repeated long-chain DNA sequence with a G-rich sequence, and then KCl and TE buffer are added to the reaction system, incubated at 37°C for 30 minutes to form a G-quadruplex, followed by adding hemin and incubating at 37°C for 30 minutes to form a G-quadruplex DNA enzyme, and then adding a TMB colorimetric substrate system. After incubation at 37°C for 30 minutes, it can be observed that the colorless TMB substrate is oxidized to blue.

[0018] The present invention has the following beneficial effects: the present invention discloses a terminal double-stem padlock probe, which improves sensitivity and specificity by modifying the stem-loop structure at both ends of the padlock probe and combining it with the hyperbranched rolling circle amplification technology, and can achieve simultaneous detection of multiple targets. The detection method is simple, time-saving, and low-cost, and also has the following advantages and positive effects:

[0019] 1) Provides a new method for highly sensitive and specific molecular detection using padlock probes;

[0020] 2) Detection sensitivity and specificity can be optimized by simply modifying the end structure of the padlock probe. The middle sequence of the probe can be flexibly designed as needed to achieve the loading of various DNA functional structures;

[0021] 3) Simultaneous detection of multiple targets can be achieved by simply introducing specific primers into the hyperbranched rolling circle amplification or rolling circle amplification steps. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to make the purpose, technical solutions and beneficial effects of the present invention more clear, the present invention provides the following drawings for illustration:

[0023] Figure 1 For the modification and connection of the lock probe;

[0024] Figure 2 It is a hyperbranched rolling circle amplification;

[0025] Figure 3 is the circularization efficiency of different padlock probes;

[0026] Figure 4 Detection performance of different padlock probes for miR-10b (a: amplification curve; b: miR-10b positive / negative; c: miR-10b specificity);

[0027] Figure 5 Detection performance of the double-stem probe at the end of miR-10b (a: linearity of the stemless probe; b: linearity of the double-stem probe; c: specificity of the double-stem probe);

[0028] Figure 6 Comparison of sensitivity performance of four miRNA padlock probes with different structures;

[0029] Figure 7 Comparison of the specific performance of four miRNA padlock probes with different structures;

[0030] Figure 8 The results are for simultaneous detection of multiple targets;

[0031] Figure 9 Rolling circle amplification and G-quartet visualization. DETAILED DESCRIPTION

[0032] The present invention will be further described below with reference to the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it. However, the embodiments are not intended to limit the present invention.

[0033] The key to the present invention is the design of the padlock probe. By employing a double-stem design at the end of the probe, it effectively suppresses negative signals in the absence of the target and interference signals caused by mutations or other microRNAs, thereby improving detection sensitivity and specificity.

[0034] Example 1

[0035] Use the NUPACK website (http: / / nupack.org / partition / new) to design padlock probes. Design the traditional linear DNA probe into a DNA probe with two stem loops a and b at the 5' and 3' ends respectively (e.g. Figure 1 As shown), a stem-loop linker sequence and a stem-loop sequence structure located at the 5' and 3' ends of the stem-loop linker sequence are formed, wherein the partial circular region and the terminal complementary region of the stem-loop are complementary to the sequence of the target microRNA; the stem-loop linker sequence is designed to be a C-base-rich repeat sequence, and the resulting padlock probe is named a terminal double-stem padlock probe.

[0036] In the present invention, the stem-loop linker sequence is preferably 10 to 100 nt long; the loop region of the stem-loop sequence is preferably 3 to 25 nt long, and the complementary region is preferably 3 to 15 bp long. A stem-loop linker sequence shorter than 10 bp makes it difficult to construct a functional sequence, while a stem-loop linker sequence longer than 100 bp makes it difficult to efficiently and effectively form a loop. A stem-loop linker sequence shorter than 3 bp makes it difficult to form a loop, while a stem-loop linker sequence longer than 25 bp becomes a meaningless sequence if not involved in other functional structures, and excessive length affects loop formation. A complementary region shorter than 3 bp makes it difficult to form a stable secondary structure, while a complementary region longer than 15 bp makes it difficult to be opened by short microRNA targets.

[0037] During the detection, after the stem loops at both ends of the microRNA to be tested are opened, the double-stem padlock probe is connected into a ring using splint R ligase, and then the sequence connected into the ring is used as a template for super-branched rolling circle amplification or rolling circle amplification.

[0038] The specific method is as follows: the terminal double-stem-circle chain is incubated with the target and splint R ligase in 0.05×splintR buffer solution at 25℃ for 1 hour, and then inactivated at 85℃ for 20 minutes to effectively circularize the terminal double-stem padlock probe. The circularized product is digested with nuclease I and nuclease III to obtain a pure circular chain, such as Figure 2 shown.

[0039] Specific primers, universal primers, dNTPs, DNA polymerase, SuperEvaGreen, and the corresponding buffer system are then added to the resulting circular chain. Real-time fluorescence monitoring is performed using a fluorescence quantitative PCR instrument at 55°C, observing the peak time of the exponential amplification curve. In this system, the specific primers are complementary to the stem-loop region of the DNA probe, initiating the rolling circle amplification reaction to form long chains containing repetitive sequences. The universal primer shares a base sequence with a segment of the linker between the stem and loop of the DNA probe, complementing the long chain of repetitive sequences formed by rolling circle amplification and using it as a template for amplification. The amplified sequence of the universal primer is identical to the circular chain sequence, and the specific primer can then use it as a template for amplification. In this way, the specific primers and universal primers continuously amplify using each other's amplified sequences as templates, forming a large number of branched double-stranded structures. Super EvaGreen fluorescently stains the double-stranded chains in the system, and real-time fluorescence quantitative monitoring effectively reflects the exponential amplification state of super-branched rolling circle amplification.

[0040] To demonstrate the effectiveness of the probes designed by the present invention, the following probes were designed: Figure 3 The ring chain 1 (traditional non-stem padlock probe), ring chain 2 (a stem padlock probe), ring chain 3 (b stem padlock probe) and ring chain 4 (ab stem padlock probe) shown in the structure were subjected to ring formation reaction respectively, and the results were as follows Figure 3The results showed that the circularization efficiency of the double-stem padlock probe (ab-stem padlock probe) was improved compared with the traditional stemless padlock probe and was better than the padlock probe with only a single stem (the 3' end stem was named a stem and the 5' end stem was named b stem).

[0041] Example 2

[0042] Using miRNA-10b as the detection target, stemless, a-stem, b-stem, and ab-terminal double-stem padlock probes were designed. The specific sequences are as follows:

[0043] Stemless sequence: 5'-pggttctacagggtacactttccttggttcagccccatccctcccatccccttcttcttacatgcacaaattc-3' (SEQ ID NO. 1);

[0044] a Stem: 5'-pggttctacagggtacactttccttggttcagccccatccctcccatccccttcttgaatcatgcacaaattc-3' (SEQ ID NO. 2);

[0045] b stem: 5'-pggttctacagggtacagagtagaaccttcatccccatccctcccatccccttcttcttacatgcacaaattc-3'

[0046] (SEQ ID NO. 3).

[0047] ab double stem: 5'-pggttctacagggtacagagtagaaccttcatccccatccctcccatccccttcttgaatcatgcacaaattc-3' (SEQ ID NO. 4).

[0048] Then, the detection performance of the conventional padlock probe and the double-stem padlock probe of the present invention were compared by using the hyperbranched rolling circle amplification protocol. Figure 4 and Figure 5 The results showed that the double-stem padlock probe could effectively inhibit the negative amplification signal (the difference in the time between the positive and negative peaks ΔT increased, Figure 4 , a, and Figure 4 , b), which is beneficial to improve the detection sensitivity. And compared with the padlock probe with only a stem or b stem, the padlock probe with both ends has the largest positive and negative ΔT value. Further comparison of the specificity of the padlock probe with no stem, a stem, b stem and ab end double stem showed that the padlock probe with ab end double stem showed the best specificity for single base mutations ( Figure 4, c) The linearity, sensitivity and specificity of the hyperbranched rolling circle amplification system based on ab-terminal double-stem padlock probes are as follows Figure 5 , the linearity of the terminal double-stem probe system ( Figure 5 , b) is 5nM~0.5fM, and the correlation coefficient R 2 The sensitivity LOD was 112.2aM, which was higher than that of the stemless probe system (5nM~500fM) and the sensitivity (LOD173.6fM) ( Figure 5 , a) increased by about 1000 times. The results of the specificity of the double-stem padlock probe ( Figure 5 , c) shows that the detection system based on the terminal double-stem padlock probe can effectively distinguish single base mutations. In summary, it is proved that the terminal double-stem padlock probe of the present invention has better sensitivity and specificity than the traditional padlock probe.

[0049] Example 3

[0050] To verify the reproducibility of the terminal double-stem padlock probe design, stemless, a-stem, b-stem, and ab double-stem padlock probes were designed for miR-21, miR-155, miR-192, and miR-26a according to the protocol of the present invention.

[0051] The specific probe sequences are as follows:

[0052] miR-21

[0053] No stem: 5'-pgtctgataagctagtctatagaaaccttcactcccatccctcccatccccttctacaatctactcaacatca-3' (SEQ ID NO. 5);

[0054] a stem: 5'-pgtctgataagctagtctatagaaaccttcactcccatccctcccatccccttcttgatgaatctcaacatca-3' (SEQ ID NO.6)

[0055] b Stem: 5'-pgtctgataagctacaacatatcagacttcactcccatccctcccatccccttctacaatctactcaacatca-3' (SEQ ID NO.7)

[0056] ab double stem: 5'-pgtctgataagctacaacatatcagacttcactcccatccctcccatccccttcttgatgaatctcaacatca-3' (SEQ ID NO.8)

[0057] miR-155

[0058] Stemless: 5’-pacgattagcattaacacataccaaccttcactcccatccctcccatccccttcttgaatcatgacccctatc-3’ (SEQ ID NO.9)

[0059] Stem a: 5’-pacgattagcattaacacataccaaccttcactcccatccctcccatccccttcttgatacatgacccctatc-3’ (SEQ ID NO.10)

[0060] Stem b: 5’-pacgattagcattaacacactaatcgtttcactcccatccctcccatccccttcttgaatcatgacccctatc-3’ (SEQ ID NO.11)

[0061] Stem ab: 5’-pacgattagcattaacagactaatcgtttcactcccatccctcccatccccttcttgatacatgacccctatc-3’ (SEQ ID NO.12)

[0062] miR-192

[0063] Stemless: 5’-pattcataggtcagtcgccatacgtagcatcactcccatccctcccatccccatcttgaatcttaggctgtca-3’ (SEQ ID NO.13)

[0064] Stem a: 5’-pattcataggtcagtcgccatacgtagcatcactcccatccctcccatccccatcttgactcttaggctgtca-3’ (SEQ ID NO.14)

[0065] Stem b: 5’-pattcataggtcagtcgcgctatgaatcatcactcccatccctcccatccccatcttcactcttaggctgtca-3’ (SEQ ID NO.15)

[0066] ab double stem:5'-pattcataggtcagtcgcgctatgaatcatcactcccatccctcccatccccatcttgactcttaggctgtca-3'(SEQ ID NO.16)

[0067] miR-26a

[0068] Stemless: 5'-ptggattacttgaacacatacgaaccattaactcccatccctcccatccccttcttgaatcaacagcctatcc-3' (SEQ ID NO. 17)

[0069] a stem: 5'-ptggattacttgaacacatacgaaccattaactcccatccctcccatccccttcttggatcaacagcctatcc-3' (SEQ ID NO. 18)

[0070] b Stem: 5'-ptggattacttgaacagatgtaatccattaactcccatccctcccatccccttcttgaatcaacagcctatcc-3' (SEQ ID NO. 19)

[0071] ab double stem:5'-ptggattacttgaacagatgtaatccattaactcccatccctcccatccccttcttggatcaacagcctatcc-3'(SEQ ID NO.20)

[0072] The detection performance of four different structured padlock probes in each group was further compared using the hyperbranched rolling circle amplification protocol. Figure 6 and Figure 7 In the detection of positive and negative samples, the four groups of padlock probes with different structures all showed that the ab double stem had a longer positive and negative ΔT value ( Figure 6 ), suggesting that the ab double-stem padlock probe design can achieve higher sensitivity. In the detection of single-base mutation samples, four groups of padlock probes with different structures all showed that the ab double-stem had better specificity ( Figure 7 ).

[0073] Example 4

[0074] To further explore the potential of the above detection system for simultaneous detection of multiple targets, three targets, miR-10b, miR-21, and miR-155, were selected and a multi-target detection system in a 96-well plate was designed using a hyperbranched rolling circle amplification protocol ( Figure 8The results showed that when multiple targets are present simultaneously, specific primers used in hyperbranched rolling circle amplification alone can effectively distinguish different targets, enabling simultaneous detection of multiple targets.

[0075] Therefore, the terminal double-stem padlock probe of the present invention has the characteristics of high sensitivity and specificity, and can realize the simultaneous detection of multiple targets.

[0076] In the present invention, the middle section of the lock probe is designed to be a C-rich sequence, which can realize the TMB oxidation color development of the G-quadruplex DNA enzyme. According to the circular chain formed by the same method as Example 1, specific primers, dNTPs, DNA polymerase and the corresponding buffer system are added to the circular product. After incubation at 30°C for 1 hour, it is inactivated at 65°C for 20 minutes to obtain a repetitive long-chain DNA sequence with a G-rich sequence. KCl and TE buffer are added to the above reaction system, and incubated at 37°C for 30 minutes to form a G-quadruplex. Subsequently, a certain concentration of hemin is added, and the G-quadruplex DNA enzyme is incubated at 37°C for 30 minutes. Then, the TMB color development substrate system is added, and the colorless TMB substrate is observed to be oxidized to blue after incubation at 37°C for 30 minutes. The results are as shown below. Figure 9 shown.

[0077] In summary, the present invention can use terminal double-stem padlock probes to perform hyperbranched rolling circle amplification or rolling circle amplification, and achieve fluorescent quantitative analysis of multiple targets or color analysis that can be interpreted by the naked eye by outputting fluorescent signals or color development signals.

[0078] The above embodiments are merely preferred embodiments for the purpose of fully illustrating the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are within the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims. Sequence Listing <110> The First Affiliated Hospital of the Army Medical University of the Chinese People's Liberation Army <120> Double-stem padlock probes and their applications in microRNA detection <160> 20 <170> SIPOSequenceListing 1.0 <210> 1 <211> 72 <212> DNA <213> Artificial Sequence <400> 1 ggttctacag ggtacacttt ccttggttca gccccatccc tcccatcccc ttcttcttac 60 atgcacaaat tc 72 <210> 2 <211> 72 <212> DNA <213> Artificial Sequence <400> 2 ggttctacag ggtacacttt ccttggttca gccccatccc tcccatcccc ttcttgaatc 60 atgcacaaat tc 72 <210> 3 <211> 72 <212> DNA <213> Artificial Sequence <400> 3 ggttctacag ggtacagagt agaaccttca tccccatccc tcccatcccc ttcttcttac 60 atgcacaaat tc 72 <210> 4 <211> 72 <212> DNA <213> Artificial Sequence <400> 4 ggttctacag ggtacagagt agaaccttca tccccatccc tcccatcccc ttcttgaatc 60 atgcacaaat tc 72 <210> 5 <211> 72 <212> DNA <213> Artificial Sequence <400> 5 gtctgataag ctagtctata gaaaccttca ctcccatccc tcccatcccc ttctacaatc 60 tactcaacat ca 72 <210> 6 <211> 72 <212> DNA <213> Artificial Sequence <400> 6 gtctgataag ctagtctata gaaaccttca ctcccatccc tcccatcccc ttcttgatga 60 atctcaacat ca 72 <210> 7 <211> 72 <212> DNA <213> Artificial Sequence <400> 7 gtctgataag ctacaacata tcagacttca ctcccatccc tcccatcccc ttctacaatc 60 tactcaacat ca 72 <210> 8 <211> 72 <212> DNA <213> Artificial Sequence <400> 8 gtctgataag ctacaacata tcagacttca ctcccatccc tcccatcccc ttcttgatga 60 atctcaacat ca 72 <210> 9 <211> 72 <212> DNA <213> Artificial Sequence <400> 9 acgattagca ttaacacata ccaaccttca ctcccatccc tcccatcccc ttcttgaatc 60 atgaccccta tc 72 <210> 10 <211> 72 <212> DNA <213> Artificial Sequence <400> 10 acgattagca ttaacacata ccaaccttca ctcccatccc tcccatcccc ttcttgatac 60 atgaccccta tc 72 <210> 11 <211> 72 <212> DNA <213> Artificial Sequence <400> 11 acgattagca ttaacacact aatcgtttca ctcccatccc tcccatcccc ttcttgaatc 60 atgaccccta tc 72 <210> 12 <211> 72 <212> DNA <213> Artificial Sequence <400> 12 acgattagca ttaacagact aatcgtttca ctcccatccc tcccatcccc ttcttgatac 60 atgaccccta tc 72 <210> 13 <211> 72 <212> DNA <213> Artificial Sequence <400> 13 attcataggt cagtcgccat acgtagcatc actcccatcc ctcccatccc catcttgaat 60 cttaggctgt ca 72 <210> 14 <211> 72 <212> DNA <213> Artificial Sequence <400> 14 attcataggt cagtcgccat acgtagcatc actcccatcc ctcccatccc catcttgact 60 cttaggctgt ca 72 <210> 15 <211> 72 <212> DNA <213> Artificial Sequence <400> 15 attcataggt cagtcgcgct atgaatcatc actcccatcc ctcccatccc catcttcact 60 cttaggctgt ca 72 <210> 16 <211> 72 <212> DNA <213> Artificial Sequence <400> 16 attcataggt cagtcgcgct atgaatcatc actcccatcc ctcccatccc catcttgact 60 cttaggctgt ca 72 <210> 17 <211> 72 <212> DNA <213> Artificial Sequence <400> 17 tggattactt gaacacatac gaaccattaa ctcccatccc tcccatcccc ttcttgaatc 60 aacagcctat cc 72 <210> 18 <211> 72 <212> DNA <213> Artificial Sequence <400> 18 tggattactt gaacacatac gaaccattaa ctcccatccc tcccatcccc ttcttggatc 60 aacagcctat cc 72 <210> 19 <211> 72 <212> DNA <213> Artificial Sequence <400> 19 tggattactt gaacagatgt aatccattaa ctcccatccc tcccatcccc ttcttgaatc 60 aacagcctat cc 72 <210> 20 <211> 72 <212> DNA <213> Artificial Sequence <400> 20 tggattactt gaacagatgt aatccattaa ctcccatccc tcccatcccc ttcttggatc 60 aacagcctat cc 72

Claims

1. A double-stem lock probe, characterized in that: The padlock probe includes a stem-loop junction sequence and stem-loop sequences located at the 5' and 3' ends of the stem-loop junction sequence, respectively. The partial loop region and terminal complementary region of the stem-loop sequence are complementary to the sequence of the target microRNA to be detected. The stem-loop junction sequence is 10 to 100 nt long. The loop region of the stem-loop sequence is 3 to 25 nt long, and the complementary region is 3 to 15 bp long. The stem-loop junction sequence is a C-base-rich repeat sequence, which forms a G-base-rich repeat sequence that can fold into a G-quartet after transcription.

2. A microRNA detection kit comprising the double-stem padlock probe according to claim 1, characterized in that: The method comprises at least one of the terminal double-stem padlock probes, splint R ligase, a specific primer complementary to the stem-loop region of the terminal double-stem padlock probe, a universal primer having the same base sequence as a segment of the stem-loop connecting sequence, and a hyperbranched rolling circle amplification reagent or a rolling circle amplification reagent.

3. Use of the double-stem padlock probe according to claim 1 in detecting at least one microRNA target.

4. The method for detecting microRNA using the double-stem padlock probe according to claim 1, characterized in that: At least one of the terminal double-stem padlock probes is added to a solution containing at least one target microRNA to be detected. After the microRNA to be detected opens the stem loops at both ends of the terminal double-stem padlock probe, the terminal double-stem padlock probe is connected into a ring using splint R ligase. Then, the ring chain connected into the ring is used as a template for hyperbranched rolling circle amplification, and the target molecule is detected by outputting a fluorescent signal; or the ring chain connected into the ring is used as a template for rolling circle amplification, and the target molecule is detected by a colorimetric signal.

5. The method according to claim 4, characterized in that: The method for ligating into a ring is as follows: the terminal double-stem ring chain is incubated with the microRNA to be detected and splint R ligase in 0.05×splintR buffer solution at 25°C for 1 hour, and then inactivated at 85°C for 20 minutes to effectively ring the terminal double-stem padlock probe.

6. The method according to claim 4, characterized in that: The method for detecting target molecules by outputting fluorescence signals through hyperbranched rolling circle amplification is as follows: adding specific primers, universal primers, dNTPs, DNA polymerase, Super EvaGreen and buffer to the ring chain, using a fluorescence quantitative PCR instrument to monitor fluorescence in real time at 55° C., and observing the peak time of the exponential amplification curve; The specific primer is complementary to the stem-loop region of the terminal double-stem padlock probe, initiating a rolling circle amplification reaction to form a long chain with a repetitive sequence; the universal primer is identical to a base sequence of a segment of the connecting sequence between the stem-loop, is complementary to the long chain of repetitive sequences formed by rolling circle amplification, and amplifies using the long chain of repetitive sequences as a template.

7. The method according to claim 6, characterized in that: The rolling circle amplification method for detecting target molecules through colorimetric signals is as follows: specific primers, dNTPs, DNA polymerase, and a corresponding buffer system are added to the ring chain, incubated at 30°C for 1 hour, and then inactivated at 65°C for 20 minutes to obtain a repetitive long-chain DNA sequence with a G-rich sequence. KCl and TE buffer are then added to the reaction system, and the reaction is incubated at 37°C for 30 minutes to form a G-quadruplex. Hemin is then added and incubated at 37°C for 30 minutes to form a G-quadruplex DNA enzyme. A TMB colorimetric substrate system is then added and incubated at 37°C for 30 minutes, whereby the colorless TMB substrate is observed to be oxidized to blue.

Citation Information

Patent Citations

  • MiRNA detection method and its application

    CN104342486A

  • Double-strand DNA detection method based on stem, loop and claw probe and biosensor

    CN110184327A

  • DNA insertion and deletion variation capture probe and application thereof

    CN116287121A

  • Open circle probes with intramolecular stem structures

    US20030022167A1