A group of SNP molecular markers closely linked to eggplant flower number and its application

Abstract

The present invention provides a group of SNP molecular markers closely linked to the number of eggplant flowers and their application. The present invention performs QTL positioning on the eggplant flower number regulation gene and screens the molecular marker sites closely linked to the flower number regulation gene, which are the 95482695 and 95503318 SNP sites on chromosome 1, and the physical distance between the two markers is 20.6 Kb. The number of eggplant flowers can be predicted by two molecular markers, providing molecular assisted selection technical support for early identification and screening of eggplant high-yield variety breeding, while greatly shortening the traditional gene positioning time, reducing breeding workload and improving breeding efficiency.

Description

Technical Field

[0001] The invention belongs to the field of eggplant seed resource identification and breeding, and particularly relates to a SNP molecular marker tightly linked to the number of eggplant flowers and an application thereof. Background Art

[0002] Eggplant (Solanum melongena L) is an important vegetable belonging to the genus Solanum (Solanum L) of the family Solanaceae. Eggplant has strong hybrid vigor. Therefore, accurate identification and classification of existing germplasm resources are of great significance for the utilization of hybrid vigor. High yield is one of the main goals of eggplant breeding. The per-acre yield of eggplant is mainly determined by factors such as planting density, number of fruits per plant, and single fruit weight. The morphology and number of inflorescences are one of the main factors affecting the number of fruits per plant of eggplant.

[0003] The morphology and number of inflorescences are one of the main factors affecting crop yields. Existing studies have shown that increasing the number of inflorescences can significantly increase crop yields, so the formation mechanism of the structure and number of inflorescences has received increasing attention. We investigated more than 300 eggplant resources and found that the number of eggplant inflorescences has rich genetic diversity, and its yield is closely related to the number of flowers.

[0004] With the mature development of high-throughput sequencing technology, especially the development of a large number of SNP (single-base amplification polymorphism) markers, the application of high-density genetic maps to locate plant trait genes has become one of the hot spots for mining plant genes. Using high-throughput sequencing technology to develop a large number of SNP markers and develop trait-linked molecular markers for early screening of varieties to achieve the purpose of molecular-assisted breeding, it can greatly shorten the breeding cycle and improve breeding efficiency.

[0005] Problems with the existing technology: At present, it is time-consuming and laborious to breed eggplant flower quantity traits using traditional breeding methods. Generally, the number of inflorescences of commercial eggplants can only be known after the eggplants bloom. The breeding cycle is long and a large amount of work needs to be invested during this period. In addition, locating the eggplant flower quantity regulation gene, screening tightly linked molecular markers, developing molecular markers tightly linked to the eggplant flower quantity regulation gene, and establishing an early auxiliary selection technology system are of great significance to improving the yield of eggplant varieties, but the existing technology has not yet effectively achieved this. In order to solve the above problems, SNP molecular markers tightly linked to the eggplant flower quantity and their applications are provided on the basis of the existing technology. Summary of the invention

[0006] The key technical problem to be solved by the present invention is to provide SNP molecular markers closely linked to the number of eggplant flowers and their application. The present invention performs QTL positioning on the eggplant flower number regulation gene and screens the molecular marker sites closely linked to the flower number regulation gene, which are the 95482695 and 95503318 SNP sites on chromosome 1, and the physical distance between the two markers is 20.6Kb. The number of eggplant flowers can be predicted by two molecular markers, providing molecular assisted selection technical support for the early identification and screening of eggplant high-yield varieties, while greatly shortening the traditional gene positioning time, reducing the breeding workload and improving the breeding efficiency. The present invention adopts the following technical solutions:

[0007] 1. A group of SNP molecular markers closely linked to the eggplant flower number QTL locus, wherein the SNP molecular markers are located between the 95482695th (SNP molecular marker I) and 95503318th (SNP molecular marker II) SNP loci on chromosome 1 of eggplant, the 95482695th base is T or C, and the 95503318th base is G or T.

[0008] The sequences of 50 bases upstream and downstream of base 95482695 of chromosome 1 of eggplant are shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0009] The sequences of 50 bases upstream and downstream of base 95503318 of eggplant chromosome 1 are shown in SEQ ID NO: 3 and SEQ ID NO: 4.

[0010] The upstream and downstream base sequence information of bases 95482695 and 95503318 on chromosome 1 of eggplant were selected from the eggplant V4 genome: https: / / solgenomics.net / ftp / genomes / Solanum_melongena_V4_Pangenome / .

[0011] The SNP marker is the conversion of T and C. The 50 base sequences upstream of the 95482695th base of chromosome 1 of eggplant are: TTAAATATAAGAAGTACTCCTTCTCTCCAACAATAGTTGTCCACTGTTGA. The 50 base sequences downstream of the 95482695th base of chromosome 1 of eggplant are: TTGACTCAGGGATTACAAAACAGTCAATAATAGGAATAATTTTATCAAAT

[0012] The SNP marker is the transition between G and T. The 50 base sequences upstream of the 95503318th base of chromosome 1 of eggplant are: TTACATGTTTTGCTAAAATTGTAGTAAGAAAAATGTATGTACTTTGGTGA. The 50 base sequences downstream of the 95503318th base of chromosome 1 of eggplant are: ATAAAGACTGTGCAGTGTGTGGCAATGTGCTATTATTGTCTGCTTCCTAT

[0013] The SNP molecular markers in the present invention are located at No. 95482695 and No. 95503318 of chromosome 1 of eggplant, the base No. 95482695 is T or C, and the base No. 95503318 is G or T, which can be used for early molecular marker-assisted selection of eggplant flower quantitative trait breeding, and the design is ingenious, the detection is simple and fast, the cost is low, it is not affected by the environment, and it is suitable for large-scale promotion and application; the present invention determines the position of the QTL site related to the eggplant flower quantitative trait through QTL-seq technology and genetic map positioning, and finds a molecular marker closely linked to the site, which can be used for molecular marker screening of eggplant flower quantitative traits, so that the workload for selecting eggplant varieties with target flower quantitative traits is greatly reduced, the selection time is greatly shortened, the breeding efficiency is also greatly improved, and it is suitable for large-scale promotion and application; the SNP markers closely linked to the eggplant flower quantity QTL site in the present invention are tested and tested, and the linkage and reliability are both high, which is of great significance for improving the accuracy and efficiency of molecular marker-assisted selection.

[0014] 2. A method for detecting a group of SNP molecular markers closely linked to the eggplant flower number QTL loci, comprising the following steps:

[0015] (1) Extracting the 50 base sequences upstream and the 50 base sequences downstream of the SNP molecular marker.

[0016] (2) The SNP molecular markers in the overall base sequence of step (1) are converted into KASP markers using primer design software.

[0017] (3) The entire base sequence in step (2) is subjected to a KASP-based SNP genotyping test through a genotyping detection platform.

[0018] The present invention can predict the number of eggplant flowers by detecting molecular markers related to the quantitative traits of eggplant flowers, and then accurately and quickly screen the superior individual plants of multi-flowered eggplants. The detection method of the molecular marker site is convenient and fast and is not affected by the environment. The present invention can detect the number of eggplant flowers, predict the number of eggplant flowers, effectively select eggplant seeds or seedlings that need different numbers of flowers, and can also be used for molecular marker-assisted breeding of the number of eggplant flowers, accelerate the process of breeding for the number of eggplant flowers, and is suitable for large-scale promotion and application. The present invention extracts DNA from seeds or seedling leaves of unknown eggplant materials, combines KASP primers to perform KASP molecular marker typing test, and the typing result of the marker can predict the fruit length of the eggplant, without waiting for measurement and judgment when the eggplant blooms as in conventional breeding, which can significantly improve breeding efficiency and save breeding costs. The primer design software can choose to use Oligo primer design software.

[0019] The invention develops KASP primers for detecting the number of eggplant flowers according to the located QTL loci of the number of eggplant flowers, which are used to detect the difference in the number of eggplant flowers expressed by the polymorphism of SNP loci, predict the number of eggplant flowers, and provide a reliable source of molecular markers for the pre-selection of the number of eggplant flowers.

[0020] Preferably, the reaction system in which the KASP is located comprises a KASP primer mixture, a KASP master mixture and a DNA template; the KASP primer mixture comprises a forward primer F-1, a forward primer F-2 and a reverse primer R; the KASP master mixture comprises an oligo sequence labeled with FAM at the tail of the forward primer F-1, an oligo sequence labeled with HEX at the tail of the forward primer F-2, a FAM dye, a HEX dye and a quencher; and the DNA template is eggplant genomic DNA. The substances in the reaction system provide a good reaction environment for the detection of the difference in the number of eggplant flowers expressed by the polymorphism of the SNP site, ensuring the smooth completion of the entire detection process.

[0021] 3. Application of a group of SNP molecular markers tightly linked to the eggplant flower quantity QTL loci in early identification and screening of eggplant flower quantitative traits. The present invention develops molecular markers tightly linked to the trait within the located eggplant flower quantity QTL loci and verifies the reliability of the markers. The eggplant flower quantity can be predicted by detecting the molecular markers, providing a molecular marker-assisted selection technology for early identification and screening of eggplant flower quantitative traits.

[0022] SNP molecular marker I comprises the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2. The nucleotide sequence shown in SEQ ID NO.1 has a SNP site at the 51st base from the 5' end, and its base is T; the nucleotide sequence shown in SEQ ID NO.2 has a SNP site at the 51st base from the 5' end, and its base is C. When the base of the SNP site I in the allele is T, the number of eggplant flowers is a multi-flower trait; when the base of the SNP site I in the allele is C, the number of eggplant fruit flowers is a few-flower trait. The genotyping results of SNP molecular marker I are A for a multi-flower homozygous phenotype, C for a few-flower homozygous phenotype, and B for a heterozygous phenotype.

[0023] SNP molecular marker II includes nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4. The 51st base from the 5' end of the nucleotide sequence shown in SEQ ID NO.3 is SNP site II, and its base is G; the 51st base from the 5' end of the nucleotide sequence shown in SEQ ID NO.4 is SNP site II, and its base is T. When the base of the SNP site in the allele is G, the number of eggplant flowers is a multi-flower trait; when the base of the SNP site II in the allele is T, the number of eggplant fruit flowers is a few-flower trait. The genotyping results of SNP molecular marker II, A' represents the homozygous phenotype of many flowers in the F2 population, C' represents the homozygous phenotype of few flowers in the F2 population, and B' represents the heterozygous phenotype in the F2 population.

[0024] The invention has the beneficial effects that: the invention locates QTL for the number of eggplant flowers, and screens out molecular marker sites closely linked to the number of flowers, which are 95482695 and 95503318 SNP sites on chromosome 1, and the physical distance between the two markers is 20.6 Kb. The number of eggplant flowers can be predicted by two molecular markers, providing molecular assisted selection technical support for early identification and screening of eggplant high-yield variety breeding, while greatly shortening the traditional gene positioning time, reducing breeding workload and improving breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The figures are a survey of the number of flowers of the parents of the embodiments of the present invention (A) and a survey of the number of flowers of the F2 generation population (B).

[0026] Figure 2 This is the preliminary positioning result of the gene regulating the number of eggplant flowers in an embodiment of the present invention; among them, the preliminary positioning result of the gene regulating the number of eggplant flowers, SmFN1 is preliminarily positioned using the delta-SNP index, the green line represents the 0.95 significance association threshold, and the yellow line represents the 0.99 significance association threshold.

[0027] Figure 3It is the genotyping result of SNP molecular marker I in the embodiment of the present invention.

[0028] Figure 4 It is the genotyping result of SNP molecular marker II in the embodiment of the present invention.

[0029] Figure 5 This is the result of fine positioning of the gene regulating eggplant flower quantity according to the embodiment of the present invention. Specific implementation methods

[0030] The methods and devices used in the following embodiments of the present invention are conventional methods and devices unless otherwise specified; the equipment and reagents used are conventional equipment and reagents purchased by the reagent company. In order to make the purpose, technical scheme and advantages of the present invention clearer, the specific implementation methods of the present invention are described in detail in conjunction with specific embodiments. Examples of these preferred implementations are illustrated in the specific embodiments. It should also be noted that in order to avoid obscuring the technical scheme of the present invention due to unnecessary details, only the technical schemes and / or processing steps closely related to the scheme of the present invention are shown in the embodiments, and other details that are not very relevant are omitted.

[0031] Example 1

[0032] This embodiment provides a group of SNP molecular markers that are closely linked to the number of eggplant flowers, the SNP molecular markers comprising SNP molecular marker I and SNP molecular marker II; the SNP molecular marker I comprises the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2, and the 51st base from the 5' end of the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2 is SNP site I; the SNP molecular marker II comprises the nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4, and the 51st base from the 5' end of the nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4 is SNP site II;

[0033] Further, the SNP site I and SNP site II are located at base 95482695 and base 95503318 of chromosome 1 of eggplant, respectively, and the base 95482695 (SNP site I) is T or C; the base 95503318 (SNP site II) is G or T;

[0034] The SEQ ID NO.1 is TTAAATATAAGAAGTACTCCTTCTCTCCAACAATAGTTGTCCACTGTTGA[T / C]TTGACTCAGGGATTACAAAACAGTCAATAATAGGAATAATTTTATCAAAT;

[0035] The SEQ ID NO.2 is TTACATGTTTTGCTAAAATTGTAGTAAGAAAAATGTATGTACTTTGGTGA[G / T]ATAAAGACTGTGCAGTGTGTGGCAATGTGCTATTATTGTCTGCTTCCTAT.

[0036] Example 2

[0037] This example provides the steps of positioning and applying SNP molecular markers closely linked to eggplant flower number, which are as follows:

[0038] 1. Analysis of the genetic laws of flower number

[0039] By screening the seed quality sources, we obtained the inbred lines with many flowers (NY) and few flowers (KY), and obtained the F1 material ( Figure 1 A). Then, F2 seeds were obtained by self-pollination of F1. Field survey results showed that the number of flowers of NY material was 6-7, the number of flowers of KY material was 1-2, and the number of flowers of F1 material was 4-5, and there was a significant difference among the three.

[0040] The inflorescence data of 1000 individual plants in the F2 population were investigated and correlation analysis was performed ( Figure 1 B), the results showed that the eggplant inflorescence index in the F2 population basically conformed to the normal distribution, which was a quantitative trait and could be used for QTL positioning.

[0041] 2. Preliminary localization of genes regulating flower number

[0042] (1) Sample collection

[0043] Using the constructed F2 generation flower number segregation population, 30 leaves of eggplant varieties with many flowers were selected to construct the mixed pool M-pool, and 30 leaves of eggplant varieties with few flowers were selected to construct the mixed pool L-pool for BSA cluster separation analysis.

[0044] (2) BSA cluster separation analysis

[0045] In the early stage of this study, Beijing Berry Genomics Co., Ltd. was commissioned to perform genome resequencing on the mixed pools M-pool and L-pool. The sequencing process is to first extract the genomic DNA of the plant material, randomly break the genomic DNA into short DNA fragments with enzymes, and then perform blunt end repair. Then connect the dA tails at both ends of the DNA fragments and connect the sequencing adapters. The DNA fragments with adapters are purified by AMPure XP magnetic beads, and fragments in the range of 300-400bp are selected for PCR amplification. The constructed library is purified and checked, and then sequenced on the HiSeq X10 PE150 machine.

[0046] (3) Sequencing data analysis

[0047] BSA-Seq was used to analyze the F2 generation segregation population, and the sequencing results were obtained. The data were analyzed and a total of 364,615 SNP sites and 49,802 InDel polymorphic sites were screened. The SNP-index and InDel-index of the two offspring were analyzed, and △(SNP-index) and △(InDel-index) were calculated, that is, the difference between the two offspring frequencies. The offspring SNP and InDel frequencies were then combined to obtain the All-index, and △(All-index) was calculated. The above data were then used to draw a distribution map on eggplant chromosomes, and the distribution of All-index on 12 chromosomes was obtained ( Figure 2 ). The confidence level of 95% was selected as the screening threshold, and the window above the confidence level was selected as the candidate interval of eggplant flower number-related genes (92.74-99.60Mb). There were 4988 candidate polymorphic marker sites in this interval. The polymorphic SNP sites were selected in segments to narrow the range, and the base sequences of 50bp upstream and downstream were extracted respectively. According to the primer design principles, KASP marker primers were designed.

[0048] 3. KASP experiment to finely locate genes regulating eggplant flower number

[0049] The KASP reaction system includes a KASP primer mixture, a KASP master mixture and a DNA template; the KASP primer mixture includes a forward primer F-1, a forward primer F-2 and a reverse primer; the KASP master mixture includes an oligo sequence labeled with FAM at the tail of the forward primer F-1, an oligo sequence labeled with HEX at the tail of the forward primer F-2, a FAM dye, a HEX dye and a quencher; the DNA template is eggplant genomic DNA. The specific steps are as follows:

[0050] a. PCR reaction was carried out on ABIQ6 plus fluorescence quantitative PCR instrument using 384-well PCR plate. The specific reaction system was 5 μL: 1 μL DNA (60 ng μL-1), 2.5 ul KASP Master mix (2×), 0.21 μL primer mixture (prepared by mixing F_FAM, F_HEX and R with a concentration of 10 μmoL-1 in a volume ratio of 1:1:1), and ddH2O was added to 5 μL.

[0051] b. PCR cycle reaction program: 1. Pre-denaturation: denaturation at 94℃ for 15min; 2. Denaturation: denaturation at 94℃ for 20s, annealing at 61℃ for 60s, for a total of 10 cycles (starting from the second cycle, the temperature is reduced by 0.6℃ each cycle); 3. Denaturation: denaturation at 94℃ for 20s, annealing at 55℃ for 60s, for a total of 26 cycles; 4. Cool down to 37℃ and keep for 1min.

[0052] The KASP genotyping technique was used to locate the genes of the F2 generation segregating population, such as Figure 3 As shown, it is located between two SNP markers SNP molecular marker I and SNP molecular marker II, wherein SNP molecular marker I is located at 95482695 of SMEL4Ch1, and SNP molecular marker II is located at 95503318 of SMEL4Ch1, with a distance of 20.6Kb, wherein the nucleotide sequence of SNP molecular marker I is TTAAATATAAGAAGTACTCCTTCTCTCCAACAATAGTTGTCCACTGTTGA[T / C]TTGACTCAGGGATTACAAAACAGTCAATAATAGGAATAATTTTATCAAAT, wherein [] marks the change of T→C (i.e., the SNP site base at the 50th base from the 5' end is T or C).

[0053] The nucleotide sequence of SNP molecular marker II is TTACATGTTTTGCTAAAATTGTAGTAAGAAAAATGTATGTACTTTGGTGA[G / T]ATAAAGACTGTGCAGTGTGTGGCAATGTGCTATTATTGTCTGCTTCCTAT, wherein [] marks the change of G→T (ie, the SNP site base at the 50th base from the 5' end is G or T).

[0054] As shown in SEQ ID NO.5-7, the nucleotide sequence of the KASP marker primer used to detect SNP molecular marker I is:

[0055] Forward primer F-1 is GAAGGTGACCAAGTTCATGCTTCCAACAATAGTTGTCCACTGTTGAT; forward primer F-2 is GAAGGTCGGAGTCAACGGATTCCAACAATAGTTGTCCACTGTTGAC; reverse primer R is CCTATTATTGACTGTTTTGTAATCCCTGAG.

[0056] As shown in SEQ ID NO.8-10, the nucleotide sequence of the KASP marker primer used to detect the SNP molecular marker II is:

[0057] The forward primer F-1 is GAAGGTGACCAAGTTCATGCTAGTAAGAAAAATGTATGTACTTTGGTGAG; the forward primer F-2 is GAAGGTCGGAGTCAACGGATTTAGTAAGAAAAATGTATGTACTTTGGTGAT; the reverse primer R is GCACATTGCCACACACTGCACAG.

[0058] The SNP molecular marker I comprises the nucleotide sequences shown in SEQ ID NO.1 and SEQ ID NO.2, wherein the 51st base from the 5' end of the nucleotide sequence shown in SEQ ID NO.1 is a SNP site, and its base is T; the 51st base from the 5' end of the nucleotide sequence shown in SEQ ID NO.2 is a SNP site, and its base is C. When the base of the SNP site I in the allele is T, the number of eggplant flowers is a trait of many flowers; when the base of the SNP site I in the allele is C, the number of eggplant fruit flowers is a trait of few flowers.

[0059] like Figure 3 As shown in the figure, the genotyping results of SNP molecular marker Ⅰ, A represents the homozygous phenotype with many flowers, C represents the homozygous phenotype with few flowers, and B represents the heterozygous phenotype.

[0060] The SNP molecular marker II comprises the nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4, wherein the 51st base from the 5' end of the nucleotide sequence shown in SEQ ID NO.3 is SNP site II, and its base is G; the 51st base from the 5' end of the nucleotide sequence shown in SEQ ID NO.4 is SNP site II, and its base is T. When the base of the SNP site in the allele is G, the number of eggplant flowers is a trait of many flowers; when the base of the SNP site II in the allele is T, the number of eggplant fruit flowers is a trait of few flowers.

[0061] like Figure 4As shown, the genotyping results of SNP molecular marker II, A′ represents the homozygous phenotype with many flowers in the F2 population, C′ represents the homozygous phenotype with few flowers in the F2 population, and B′ represents the heterozygous phenotype in the F2 population.

[0062] like Figure 5 The figure below shows the results of fine positioning of genes regulating eggplant flower number by KASP genotyping, and found that there is a QTL locus in this region, with a LOD value of 11.85 and a PVE value of 24.84%. Through genome retrieval, a transcription factor is found in this interval.

[0063] The above is only a specific implementation of the present application. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present application. These improvements and modifications should also be regarded as the scope of protection of the present application. Sequence Listing <110> South Subtropical Crops Research Institute, Chinese Academy of Tropical Agricultural Sciences <120> A group of SNP molecular markers closely linked to eggplant flower number and its application <160> 10 <170> SIPOSequenceListing 1.0 <210> 1 <211> 101 <212> DNA <213> Solanum melongena <400> 1 ttaaatataa gaagtactcc ttctctccaa caatagttgtccactgttga tttgactcag 60 ggattacaaa acagtcaata ataggaataa ttttatcaaa t 101 <210> 2 <211> 101 <212> DNA <213> Solanum melongena <400> 2 ttaaatataa gaagtactcc ttctctccaa caatagttgt ccactgttga cttgactcag 60 ggattacaaa acagtcaata ataggaataa ttttatcaaa t 101 <210> 3 <211> 101 <212> DNA <213> Solanum melongena <400> 3 ttacatgttt tgctaaaatt gtagtaagaa aaatgtatgt actttggtga gataaagact 60 gtgcagtgtg tggcaatgtg ctattattgt ctgcttccta t 101 <210> 4 <211> 101 <212> DNA <213> Solanum melongena <400> 4 ttacatgttt tgctaaaatt gtagtaagaa aaatgtatgt actttggtga tataaagact 60 gtgcagtgtg tggcaatgtg ctattattgt ctgcttccta t 101 <210> 5 <211> 47 <212> DNA <213> Solanum melongena <400> 5 gaaggtgacc aagttcatgc ttccaacaat agttgtccac tgttgat 47 <210> 6 <211> 46 <212> DNA <213> Solanum melongena <400> 6 gaaggtcgga gtcaacggat tccaacaata gttgtccact gttgac 46 <210> 7 <211> 29 <212> DNA <213> Solanum melongena <400> 7 ctattattga ctgttttgta atccctgag 29 <210> 8 <211> 50 <212> DNA <213> Solanum melongena <400> 8 gaaggtgacc aagttcatgc tagtaagaaa aatgtatgta cttttggtgag 50 <210> 9 <211> 51 <212> DNA <213> Solanum melongena <400> 9 gaaggtcgga gtcaacggat ttagtaagaa aaatgtatgt actttggtga t 51 <210> 10 <211> 23 <212> DNA <213> Solanum melongena <400> 10 gcacattgcc acacactgca cag 23

Claims

1. Application of eggplant SNP molecular markers in early identification and screening of eggplant flower quantitative traits, characterized in that The SNP molecular marker is located at the 95482695th base of chromosome 1 of eggplant. When the site is T, the number of eggplant flowers is a multi-flower trait, and the site and the 50bp sequences upstream and downstream are shown in the sequence table SEQ ID NO.1; when the site is C, the number of eggplant flowers is a few-flower trait, and the site and the 50bp sequences upstream and downstream are shown in the sequence table SEQ ID NO.

2.

2. Application of eggplant SNP molecular markers in early identification and screening of eggplant flower quantitative traits, characterized in that The SNP molecular marker is located at the 95503318th base of chromosome 1 of eggplant. When the site is G, the number of eggplant flowers is a multi-flower trait, and the site and the 50bp sequences upstream and downstream are shown in the sequence table SEQ ID NO.3; when the site is T, the number of eggplant flowers is a few-flower trait, and the site and the 50bp sequences upstream and downstream are shown in the sequence table SEQ ID NO.4.

Images