Probe sets and uses thereof

By designing specific probe sets and primers, and combining them with real-time PCR technology, the problem of rapid identification of the SARS-CoV-2 B.1.1.7 mutant strain was solved, achieving efficient and accurate typing and mutation detection, and improving the accuracy and efficiency of epidemic monitoring.

CN115011731BActive Publication Date: 2026-02-17BGI BIOTECH WUHAN CO LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202110235310.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-03-03
Publication Date
2026-02-17
Estimated Expiration
2041-08-14

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly and accurately identify the B.1.1.7 mutant strain of the novel coronavirus SARS-CoV-2, which increases the difficulty of epidemic prevention and control and the diagnosis of patients.

Method used

A probe set was designed, containing probes and primers specifically targeting sites 23063 and 23604 of the SARS-CoV-2 genome, for detecting N501Y and P681H mutations using quantitative real-time PCR, and for genotyping based on ΔCt and Ct values.

Benefits of technology

It enables rapid and accurate typing and mutation detection, reduces false negative and false positive rates, and improves the efficiency and accuracy of epidemic monitoring.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The application provides a probe set for B.1.1.7 typing of SARS-CoV-2, which comprises a first pair of probes, nucleic acid sequences of the first pair of probes are as follows: a first sequence of the first pair of probes: 5'-CCCACTTATGGTGTTGGTTAC-3' (SEQ ID NO: 1); and a second sequence of the first pair of probes: 5'-TCTCATCGGCGGGCA-3' (SEQ ID NO: 2). The probe set provided by the application can be used for efficient and accurate typing of SARS-CoV-2.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biological medicine, in particular, to a probe set and its use, more particularly, to a kit, a detection method of SARS-CoV-2, a typing method of SARS-CoV-2, and a method for detecting mutations of SARS-CoV-2 genome sites. BACKGROUND

[0002] The novel coronavirus is the pathogen that causes the novel coronavirus pneumonia. The World Health Organization officially named it 2019-nCoV on January 12, 2020, and the International Virus Classification Committee named it SARS-CoV-2 on February 11, 2020.

[0003] The novel coronavirus is a class of enveloped RNA viruses with a linear single-stranded positive strand genome, and the particles are round or oval with a diameter of about 60-140 nm. During the proliferation of the virus, substitution, deletion or insertion of base sequences in the genome often occurs, causing genetic mutations.

[0004] On December 14, 2020, the United Kingdom reported to the World Health Organization the emergence of a new B.1.1.7 coronavirus strain, which has undergone 17 non-identical mutations or deletions, of which ORF1ab has 4, Spike has 8, ORF8 has 3, and N has 2. The mutant strain has a mutation at N501Y, which enhances the binding ability of RBD to the human ACE2 receptor, and its transmission is 70% higher than that of the previous virus strain. The World Health Organization pointed out that although preliminary assessment shows that the B.1.1.7 coronavirus strain does not increase the severity of the disease, it will lead to higher incidence, more hospitalization and death cases, so more stringent public health measures need to be taken to control the spread of these mutant viruses. The World Health Organization also recommends that countries increase monitoring of the novel coronavirus to better understand the spread of the virus and monitor variants.

[0005] Therefore, developing a method and detection reagent for rapidly identifying the mutation spectrum B.1.1.7 of the novel coronavirus SARS-CoV-2 has a positive significance for epidemic prevention and control and diagnosis of patients. SUMMARY

[0006] In a first aspect, the present application provides a probe set for detecting SARS-CoV-2 B.1.1.7 lineage. According to an embodiment of the present application, the probe set comprises a first pair of probes, the nucleic acid sequences of which are as follows: first sequence of the first pair of probes: 5’-CCCACTTATGGTGTTGGTTAC-3’ (SEQ ID NO: 1); second sequence of the first pair of probes: 5’-TCTCATCGGCGGGCA-3’ (SEQ ID NO: 2). According to an embodiment of the present application, the probe set detects the 23063th and 23604th sites of the novel coronavirus genome sequence (the sequence positions of the genome of SARS-CoV-2 herein refer to the NC_045512.2 sequence). The pair of probes specifically detects the mutations N501Y and P681H that occur in the SARS-CoV-2 mutation spectrum B.1.1.7, wherein the first sequence of the first pair of probes is directed against the N501Y mutant, which changes the base at the 23063th site of the genome from A to T (A23063T), and the first sequence of the first pair of probes can specifically recognize the genome after the 23063th site is mutated to T; the second sequence of the first pair of probes is directed against the P681H mutant, which changes the base at the 23604th site of the genome from C to A (C23604A), and the first sequence of the first pair of probes can specifically recognize the genome after the 23604th site is mutated to A.

[0007] According to an embodiment of the present application, the above-mentioned probe set can further comprise at least one of the following additional technical features:

[0008] According to an embodiment of the present application, the probe set further comprises a second pair of probes, the nucleic acid sequences of which are as follows: first sequence of the second pair of probes: 5’-CCCACTAATGGTGTTGGTTAC-3’ (SEQ ID NO: 3); second sequence of the second pair of probes: 5’-TCTCCTCGGCGGGCA-3’ (SEQ ID NO: 4). According to an embodiment of the present application, the first sequence of the second pair of probes is directed against the 501N wild type, which has A at the 23063th site of the genome, and the first sequence of the second pair of probes can specifically recognize the novel coronavirus genome with A at the 23063th site; the second sequence of the second pair of probes is directed against the P681H wild type, which has C at the 23604th site of the novel coronavirus genome, and the second sequence of the second pair of probes can specifically recognize the wild type novel coronavirus genome with C at the 23604th site.

[0009] According to an embodiment of the present application, the probe set further comprises: a first pair of primers and a second pair of primers, the nucleic acid sequences of which are as follows: first pair of primers upstream sequence: 5'-CACCTTGTAATGGTGTTGAAGG-3' (SEQ ID NO: 5); first pair of primers downstream sequence: 5'-AGTTGCTGGTGCATGTAGAAG-3' (SEQ ID NO: 6); second pair of primers upstream sequence: 5'-GTGCAGGTATATGCGCTAGT-3' (SEQ ID NO: 7); second pair of primers downstream sequence: 5'-GCACCAAGTGACATAGTGTAGG-3' (SEQ ID NO: 8). According to an embodiment of the present application, the first pair of primers can be used for specific amplification of the nucleic acid sequence at site 23063 and upstream and downstream thereof of the novel coronavirus genome, and the second pair of primers can be used for specific amplification of the nucleic acid sequence at site 23604 and upstream and downstream thereof of the novel coronavirus genome. The first pair of primers and the second pair of primers in cooperation with the first pair of probe sets can be used for specific detection of whether the detected novel coronavirus genome is N501Y mutant and P681H mutant (i.e. B.1.1.7), and the first pair of primers and the second pair of primers in cooperation with the second pair of probe sets can be used for specific detection of whether the detected novel coronavirus genome is 501N wild type and 681P wild type. Using the above-mentioned probes and primers, the novel coronavirus can be simply, efficiently and accurately typed using qPCR technology, and it can be detected whether the to-be-tested genome belongs to the novel coronavirus and whether it is of the B.1.1.7 type.

[0010] According to an embodiment of the present application, the probe set further comprises a third pair of primers and a third probe, the nucleic acid sequences of which are as follows: third pair of primers upstream sequence: 5'-GAGGCATCCTCACCCTGA-3' (SEQ ID NO: 11); third pair of primers downstream sequence: 5'-AGCTCATTGTAGAAGGTGTGG-3' (SEQ ID NO: 12); third probe: 5'-CACCAACTGGGACGACATGGAGAAG-3' (SEQ ID NO: 13). According to an embodiment of the present application, the third pair of primers is an internal standard primer for novel coronavirus typing detection, and the third probe is an internal standard probe.

[0011] In a second aspect of the present application, the present application provides use of reagents in the preparation of a kit for typing SARS-CoV-2. According to embodiments of the present application, the reagents include the probe set described above. The reagents according to embodiments of the present application can be used to prepare a kit for efficient and accurate typing of SARS-CoV-2 virus, and the prepared kit can efficiently and accurately use the method of quantitative PCR to type SARS-CoV-2 virus in a sample to be tested, and can effectively distinguish the B.1.1.7 mutant lineage and the non-B.1.1.7 mutant lineage of SARS-CoV-2.

[0012] In a third aspect of the present application, the present application provides use of reagents in the preparation of a kit for detecting SARS-CoV-2. According to embodiments of the present application, the reagents include the probe set proposed in the first aspect of the present application. The reagents according to embodiments of the present application can be used to prepare a kit for efficient and accurate detection of SARS-CoV-2 virus, and the prepared kit can efficiently and accurately use the method of quantitative PCR to detect whether a sample to be tested carries SARS-CoV-2 virus.

[0013] In a fourth aspect, the present application provides a method for detecting SARS-CoV-2, which is used for non-diagnostic purposes. According to embodiments of the present application, the method comprises performing fluorescent quantitative PCR detection on a sample to be tested using the probe set provided in the first aspect of the present application, wherein the probes in the probe set provided in the first aspect of the present application further carry a fluorescent group; and detecting the signal of the fluorescent group carried by any one of the first pair of probes and the second pair of probes, which indicates that the sample to be tested contains SARS-CoV-2 nucleic acid. According to embodiments of the present application, the first pair of probes and the second pair of probes are respectively directed to the mutant and wild type of the 23063th site and the 23604th site of the novel coronavirus genome sequence, wherein the mutant is A23063T and C23604A, and the first pair of primers and the second pair of primers can respectively specifically amplify the nucleic acid sequences upstream and downstream of the 23063th site and the 23604th site of the novel coronavirus genome sequence, thereby realizing the detection of the wild type novel coronavirus with the 23063th site being A and the 23604th site being C, or the detection of the B.1.1.7 lineage novel coronavirus with the 23063th site being T and the 23604th site being A.The two ends of the probe are respectively provided with a fluorescent group and a quencher group, at this time, the fluorescent group and the quencher group are close to each other, and the fluorescent light emitted by the fluorescent group cannot be detected; when the 23063th site of the to-be-tested genomic nucleic acid is A, the first sequence of the second pair of probes can be complementary to the to-be-tested genomic nucleic acid; when the first pair of primers is synthesized and amplified by taking the to-be-tested genomic nucleic acid as a template, the first sequence of the second pair of probes is amplified to the position of the first sequence of the second pair of probes, so that the first sequence of the second pair of probes is broken, and the fluorescent group and the quencher group are released; at this time, the fluorescent group and the quencher group are far away from each other, the signal of the fluorescent group is captured, a specific fluorescent signal is detected, and it is indicated that the SARS-CoV-2 virus exists in the to-be-tested sample, and the SARS-CoV-2 virus is a wild-type novel coronavirus with the 23063th site; when the 23063th site of the to-be-tested genomic nucleic acid is T, the first sequence of the first pair of probes can be complementary to the to-be-tested genomic nucleic acid; when the first pair of primers is synthesized and amplified by taking the to-be-tested genomic nucleic acid as a template, the first sequence of the first pair of probes is amplified to the position of the first sequence of the first pair of probes, so that the first sequence of the first pair of probes is broken, and the fluorescent group and the quencher group are released; at this time, the fluorescent group and the quencher group are far away from each other, the signal of the fluorescent group is captured, a specific fluorescent signal is detected, and it is indicated that the SARS-CoV-2 virus exists in the to-be-tested sample, and the SARS-CoV-2 virus is a mutant novel coronavirus with the 23063th site being T; when the 23604th site of the to-be-tested genomic nucleic acid is C, the second sequence of the second pair of probes can be complementary to the to-be-tested genomic nucleic acid; when the second pair of primers is synthesized and amplified by taking the to-be-tested genomic nucleic acid as a template, the second sequence of the second pair of probes is amplified to the position of the second sequence of the second pair of probes, so that the second sequence of the second pair of probes is broken, and the fluorescent group and the quencher group are released; at this time, the fluorescent group and the quencher group are far away from each other, the signal of the fluorescent group is captured, a specific fluorescent signal is detected, and it is indicated that the SARS-CoV-2 virus exists in the to-be-tested sample, and the SARS-CoV-2 virus is a wild-type novel coronavirus with the 23604th site; when the 23604th site of the to-be-tested genomic nucleic acid is A, the second sequence of the first pair of probes can be complementary to the to-be-tested genomic nucleic acid; when the first pair of primers is synthesized and amplified by taking the to-be-tested genomic nucleic acid as a template, the second sequence of the first pair of probes is amplified to the position of the second sequence of the first pair of probes, so that the second sequence of the first pair of probes is broken, and the fluorescent group and the quencher group are released; at this time, the fluorescent group and the quencher group are far away from each other, the signal of the fluorescent group is captured, a specific fluorescent signal is detected, and it is indicated that the SARS-CoV-2 virus exists in the to-be-tested sample, and the SARS-CoV-2 virus is a mutant novel coronavirus with the 23604th site being A.

[0014] According to the embodiments of the present application, the fluorescent group is selected from at least one of FAM, ROX, VIC, CY5, CY3, HEX, 5-TAMRA, TET and JOE. According to the embodiments of the present application, any fluorescent group that can be used in fluorescent quantitative PCR can be used.

[0015] In a fifth aspect, the present application provides a method for typing SARS-CoV-2 for non-diagnostic purposes. According to an embodiment of the present application, the method comprises the following steps: performing a fluorescent quantitative PCR detection on a sample to be tested by using the probe set according to the first aspect of the present application, wherein the probes in the probe set according to the first aspect of the present application further carry fluorescent groups, and the first sequence of the first pair of probes and the first sequence of the second pair of probes carry a first fluorescent group, and the second sequence of the first pair of probes and the second sequence of the second pair of probes carry a second fluorescent group; detecting the Ct values of the first fluorescent group and the second fluorescent group channels respectively to obtain the ΔCt values of the first fluorescent group channel and / or the second fluorescent group channel respectively, wherein the ΔCt = the Ct value obtained by using the second pair of probes - the Ct value obtained by using the first pair of probes; and obtaining the typing of the SARS-CoV-2 according to the ΔCt and Ct values. The inventors have found through a large number of studies that the use of the probe set according to the present application for typing detection of SARS-CoV-2, combined with the ΔCt and Ct value information of the fluorescent quantitative PCR performed, can efficiently and accurately perform typing detection, and the false negative and false positive rates are low.

[0016] According to an embodiment of the present application, the above-mentioned method can further comprise at least one of the following additional technical features:

[0017] According to an embodiment of the present application, when the Ct value of the first fluorescent group channel is not greater than 41 and not less than 4, and the Ct value of the second fluorescent group channel is not greater than 41 and not less than -4, it indicates that the sample to be tested contains SARS-CoV-2 B.1.1.7 type.

[0018] According to an embodiment of the present application, the first fluorescent group and the second fluorescent group are each independently selected from at least one of the following: FAM, ROX, VIC, CY5, CY3, HEX, 5-TAMRA, TET and JOE. According to an embodiment of the present application, the type of fluorescent group is not particularly limited, and any fluorescent group that can be used for fluorescent quantitative PCR can be used. The quencher used can be BHQ1, MGB, etc., and any quencher that can be used for fluorescent quantitative PCR can be used.

[0019] In a sixth aspect, the present application provides a method for detecting mutations of SARS-CoV-2 genomic sites, the mutations being A23063T and / or C23604A. According to an embodiment of the present application, the method comprises performing a fluorescent quantitative PCR on a sample to be tested using the probe set as provided in the first aspect of the present application, wherein the probes in the probe set further comprise fluorescent groups, and the first sequence of the first pair of probes and the first sequence of the second pair of probes carry a first fluorescent group, and the second sequence of the first pair of probes and the second sequence of the second pair of probes carry a second fluorescent group; detecting the Ct values of the first fluorescent group and the second fluorescent group channels respectively to obtain the ΔCt of the first fluorescent group channel and / or the second fluorescent group channel respectively, wherein the ΔCt = the Ct value obtained using the second pair of probes - the Ct value obtained using the first pair of probes; and determining the mutations based on the ΔCt and the Ct values. The method according to an embodiment of the present application can be used to detect mutations of SARS-CoV-2, and in combination with the ΔCt and Ct values of the fluorescent quantitative PCR performed, the method can efficiently and accurately detect whether the SARS-CoV-2 has A23063T and / or C213604A mutations, and the false negative and false positive rates are low.

[0020] According to an embodiment of the present application, the method further comprises at least one of the following additional technical features:

[0021] According to an embodiment of the present application, when the Ct value of the first fluorescent group channel is not greater than 41 and the ΔCt is not less than 4, it indicates that the sample to be tested contains SARS-CoV-2 A23063T mutant; when the Ct value of the first fluorescent group channel is not greater than 41 and the ΔCt is not greater than -4, it indicates that the sample to be tested contains SARS-CoV-2 A23063 wild type; when the Ct value of the second fluorescent group channel is not greater than 41 and the ΔCt is not less than 4, it indicates that the sample to be tested contains SARS-CoV-2 C23604A mutant; and when the Ct value of the second fluorescent group channel is not greater than 41 and the ΔCt is not greater than -4, it indicates that the sample to be tested contains SARS-CoV-2 C23604 wild type.

[0022] In a seventh aspect, the present application provides a kit for typing SARS-CoV-2. According to an embodiment of the present application, the kit comprises the probe set as provided in the first aspect of the present application. The kit according to an embodiment of the present application can be used to efficiently and accurately type a sample to be tested to determine whether the sample to be tested is of the mutant lineage B.1.1.7. The kit can further comprise enzymes, buffers, dNTPs and other reagents required for fluorescent quantitative PCR.

[0023] Additional aspects and advantages of the invention will be set forth in part in the description which follows, and in part will be obvious from the description, or may be learned by practice of the invention. Attached Figure Description

[0024] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the description of the embodiments taken in conjunction with the following drawings, in which:

[0025] Figure 1 The results of the detection of the FAM channel of the SARS-CoV-2 501N and 681P wild-type template (1.0E+06 copies / mL) by compositions 1 and 2 according to embodiments of the present invention are shown. The solid line represents the detection results of the SARS-CoV-2 501N and 681P wild-type template (1.0E+06 copies / mL) by composition 1, and the dashed line represents the detection results of the SARS-CoV-2 501N and 681P wild-type template (1.0E+06 copies / mL) by composition 2.

[0026] Figure 2 The results of the detection of SARS-CoV-2 501N and 681P wild-type templates (1.0E+06 copies / mL) in the CY5 channel according to compositions 1 and 2 of the present invention are shown. The solid line represents the detection results of SARS-CoV-2 501N and 681P wild-type templates (1.0E+06 copies / mL) in the CY5 channel according to composition 1, and the dashed line represents the detection results of SARS-CoV-2 501N and 681P wild-type templates (1.0E+06 copies / mL) in the CY5 channel according to composition 2.

[0027] Figure 3 The results of the detection of the FAM channel of the SARS-CoV-2 N501Y and P681H mutant template (1.0E+06 copies / mL) by compositions 1 and 2 according to embodiments of the present invention are shown. The solid line represents the detection results of the SARS-CoV-2 N501Y and P681H mutant template (1.0E+06 copies / mL) by composition 1, and the dashed line represents the detection results of the SARS-CoV-2 N501Y and P681H mutant template (1.0E+06 copies / mL) by composition 1.

[0028] Figure 4is the detection result of the CY5 channel of the new coronavirus SARS-CoV-2 N501Y and P681H mutant template (1.0E+06 copies / mL) detected by the composition 1 and 2 according to the embodiment of the present application, wherein the solid line is the detection result of the CY5 channel of the new coronavirus SARS-CoV-2 N501Y and P681H mutant template (1.0E+06 copies / mL) detected by the composition 1, and the dotted line is the detection result of the CY5 channel of the new coronavirus SARS-CoV-2 N501Y and P681H mutant template (1.0E+06 copies / mL) detected by the composition 2;

[0029] Figure 5 is the detection result of the FAM channel of the gradient concentration new coronavirus SARS-CoV-2 501N and 681P wild type template detected by the composition 1 according to the embodiment of the present application;

[0030] Figure 6 is the detection result of the CY5 channel of the gradient concentration new coronavirus SARS-CoV-2 501N and 681P wild type template detected by the composition 1 according to the embodiment of the present application;

[0031] Figure 7 is the detection result of the FAM channel of the gradient concentration new coronavirus SARS-CoV-2 N501Y and P681H mutant template detected by the composition 2 according to the embodiment of the present application;

[0032] Figure 8 is the detection result of the CY5 channel of the gradient concentration new coronavirus SARS-CoV-2 N501Y and P681H mutant template detected by the composition 2 according to the embodiment of the present application;

[0033] Figure 9 is the detection result of the FAM channel of the new coronavirus SARS-CoV-2 N501Y and P681H wild type and the new coronavirus SARS-CoV-2 N501Y and P681H mutant template with a concentration of 1.0E+06 copies / mL detected by the composition 1 according to the embodiment of the present application, wherein the solid line is the detection result of the wild type template, and the cross line is the detection result of the mutant template;

[0034] Figure 10 is the detection result of the FAM channel of the new coronavirus SARS-CoV-2 N501Y and P681H wild type and the new coronavirus SARS-CoV-2 N501Y and P681H mutant template with a concentration of 1.0E+06 copies / mL detected by the composition 1 according to the embodiment of the present application, wherein the solid line is the detection result of the wild type template, and the cross line is the detection result of the mutant template;

[0035] Figure 11 is the FAM channel detection result of the novel coronavirus SARS-CoV-2 N501Y and P681H wild type and mutant type templates at a concentration of 1.0E+06 copies / mL according to the control example 501N-3 probe composition, wherein the solid line is the detection result of the wild type template, and the cross line is the detection result of the mutant type template;

[0036] Figure 12 is the FAM channel detection result of the novel coronavirus SARS-CoV-2 N501Y and P681H wild type and mutant type templates at a concentration of 1.0E+06 copies / mL according to the control example 501N-4 probe composition, wherein the solid line is the detection result of the wild type template, and the cross line is the detection result of the mutant type template;

[0037] Figure 13 is the FAM channel detection result of the novel coronavirus SARS-CoV-2 N501Y and P681H wild type and mutant type templates at a concentration of 1.0E+06 copies / mL according to the composition 2 of the embodiment of the present application, wherein the solid line is the detection result of the mutant type template, and the cross line is the detection result of the wild type template;

[0038] Figure 14 is the FAM channel detection result of the novel coronavirus SARS-CoV-2 N501Y and P681H wild type and mutant type templates at a concentration of 1.0E+06 copies / mL according to the control example 501Y-2 probe composition, wherein the solid line is the detection result of the mutant type template, and the cross line is the detection result of the wild type template;

[0039] Figure 15 is the FAM channel detection result of the novel coronavirus SARS-CoV-2 N501Y and P681H wild type and mutant type templates at a concentration of 1.0E+06 copies / mL according to the control example 501Y-3 probe composition, wherein the solid line is the detection result of the mutant type template, and the cross line is the detection result of the wild type template;

[0040] Figure 16is the detection result of the novel coronavirus SARS-CoV-2 N501Y and P681H wild type and mutant template of 1.0E+06 copies / mL concentration according to the control example 501Y-2 probe composition, the detection result of the FAM channel. The solid line is the detection result of the mutant template, and the cross line is the detection result of the wild type template;

[0041] Figure 17 is the detection result of the novel coronavirus SARS-CoV-2 N501Y and P681H wild type and mutant template of 1.0E+06 copies / mL concentration according to the composition 1 of the application, the detection result of the CY5 channel. The solid line is the detection result of the wild type template, and the cross line is the detection result of the mutant template;

[0042] Figure 18 is the detection result of the novel coronavirus SARS-CoV-2 N501Y and P681H wild type and mutant template of 1.0E+06 copies / mL concentration according to the control example 681P-2 probe composition, the detection result of the CY5 channel. The solid line is the detection result of the wild type template, and the cross line is the detection result of the mutant template;

[0043] Figure 19 is the detection result of the novel coronavirus SARS-CoV-2 N501Y and P681H wild type and mutant template of 1.0E+06 copies / mL concentration according to the control example 681P-3 probe composition, the detection result of the CY5 channel. The solid line is the detection result of the wild type template, and the cross line is the detection result of the mutant template;

[0044] Figure 20 is the detection result of the novel coronavirus SARS-CoV-2 N501Y and P681H wild type and mutant template of 1.0E+06 copies / mL concentration according to the control example 681P-4 probe composition, the detection result of the CY5 channel. The solid line is the detection result of the wild type template, and the cross line is the detection result of the mutant template;

[0045] Figure 21is the detection result of the CY5 channel according to the composition 2 of the present application detecting the novel coronavirus SARS-CoV-2 N501Y and P681H wild type and mutant template of the novel coronavirus SARS-CoV-2 N501Y and P681H at a concentration of 1.0E+06 copies / mL. Among them, the solid line is the detection result of the mutant template, and the cross line is the detection result of the wild type template;

[0046] Figure 22 is the detection result of the CY5 channel according to the composition 2 of the present application detecting the novel coronavirus SARS-CoV-2 N501Y and P681H wild type and mutant template of the novel coronavirus SARS-CoV-2 N501Y and P681H at a concentration of 1.0E+06 copies / mL. Among them, the solid line is the detection result of the mutant template, and the cross line is the detection result of the wild type template;

[0047] Figure 23 is the detection result of the CY5 channel according to the composition 2 of the present application detecting the novel coronavirus SARS-CoV-2 N501Y and P681H wild type and mutant template of the novel coronavirus SARS-CoV-2 N501Y and P681H at a concentration of 1.0E+06 copies / mL. Among them, the solid line is the detection result of the mutant template, and the cross line is the detection result of the wild type template;

[0048] Figure 24 is the detection result of the CY5 channel according to the composition 2 of the present application detecting the novel coronavirus SARS-CoV-2 N501Y and P681H wild type and mutant template of the novel coronavirus SARS-CoV-2 N501Y and P681H at a concentration of 1.0E+06 copies / mL. Among them, the solid line is the detection result of the mutant template, and the cross line is the detection result of the wild type template;

[0049] Figure 25 is the amplification curve of the FAM channel of the clinical positive sample detected according to the compositions 1 and 2 of the embodiment of the present application, wherein the dotted line is the amplification curve of the FAM channel of the clinical positive sample detected by composition 1, and the solid line is the amplification curve of the FAM channel of the clinical positive sample detected by composition 2;

[0050] Figure 26 is the amplification curve of the CY5 channel of the clinical positive sample detected according to the compositions 1 and 2 of the embodiment of the present application, wherein the dotted line is the amplification curve of the CY5 channel of the clinical positive sample detected by composition 1, and the solid line is the amplification curve of the CY5 channel of the clinical positive sample detected by composition 2. DETAILED DESCRIPTION

[0051] Embodiments of the present application are described in detail below with reference to the attached drawing figures, wherein the implementations shown are by way of illustration only and not by way of limitation. The embodiments described below are examples of implementations and are not intended to limit the present application in any way.

[0052] Furthermore, the terms "first", "second", and the like, do not denote any quantity or order but are used only to distinguish one element from another. Thus, a feature defined with "first", "second" may include at least one of the features. In the description of the present application, the meaning of "a plurality" is at least two, for example, two, three, etc., unless otherwise specifically defined.

[0053] It should be noted that in this text, the terms "new coronavirus", "SARS-CoV-2", "new crown virus" all refer to the pathogen that causes COVID-19.

[0054] It should be noted that in this text, the terms "(23063T)" and "(23604A)" refer to the 23063th and 23604th bases of the new coronavirus genome sequence with Genebank accession number: NC_045512.2.

[0055] It should be noted that in this text, the terms "sequence around the 501st site of S gene" and "sequence around the 681st site" refer to the sequence containing the 501st site of S gene and the 681st site of S gene, and the 50-100 bp bases upstream and downstream thereof.

[0056] The new coronavirus (genomic reference sequence NC_045512.2) N501Y and P681H mutant insertion sequence (SEQ ID NO: 9) is:

[0057] ATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCT AACAATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTTTAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGT GTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACTTATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGAC CTAAAAAGTCTACTAATTTGGTTAAAAACAAATGTGTCAATTTCAACTTCAATGGTTTAACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTCTGCCTTTCCAACAATTTGGCAGAGACATTGCTG ACACTACTGATGCTGTCCGTGATCCACAGACACTTGAGATTCTTGACATTACACCATGTTCTTTTGGTGGTGTCAGTGTTATAACACCAGGAACAAATACTTCTAACCAGGTTGCTGTTCTTTATCAGGATG TTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTTACTCCTACTTGGCGTGTTTATTCTACAGGTTCTAATGTTTTTCAAACACGTGCAGGCTGTTTAATAGGGGCTGAACATGTCAACAACTC ATATGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATTCTCATCGGCGGGCACGTAGTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTGGTGCAGAAA ATTCAGTTGCTTACTCTAATAACTCTATTGCCATACCCACAAATTTTACTATTAGTGTTACCACAGAAATTCTACCAGTGTCCACCAATTAAAGATTTTGGTGGTTTTAATTTTTCACAAATATTACCAGATCCATCAAAACC. (SEQ ID NO: 9)

[0058] The novel coronavirus (Genomic Reference Sequence NC_045512.2) 501N and 681P wild type insert sequence (SEQ ID NO: 10) is:

[0059] ATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCT AACAATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGT GTTGAAGGTTTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACTAATGGTGTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCAACTGTTTGTGGAC CTAAAAAGTCTACTAATTTGGTTAAAAACAAATGTGTCAATTTCAACTTCAATGGTTTAACAGGCACAGGTGTTCTTACTGAGTCTAACAAAAAGTTTCTGCCTTTCCAACAATTTGGCAGAGACATTGCTG ACACTACTGATGCTGTCCGTGATCCACAGACACTTGAGATTCTTGACATTACACCATGTTCTTTTGGTGGTGTCAGTGTTATAACACCAGGAACAAATACTTCTAACCAGGTTGCTGTTCTTTATCAGGATG TTAACTGCACAGAAGTCCCTGTTGCTATTCATGCAGATCAACTTACTCCTACTTGGCGTGTTTATTC TACAGGTTCTAATGTTTTTCAAACACGTGCAGGCTGTTTAATAGGGGCTGAACATGTCAACAACTCATATGAGTGTGACATACCCATTGGTGCAGGTATATGCGCTAGTTATCAGACTCAGACTAATTCTCC TCGGCGGGCACGTAGTGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTGGTGCAGAAAATTCAGTTGCTTACTCTAATAACTCTATTGCCATACCCACAAATTTTACTATTAGTGTTACCACAG AAATTCTACCAGTGTCCACCAATTAAAGATTTTGGTGGTTTTAATTTTTCACAAATATTACCAGATCCATCAAAACC. (SEQ ID NO: 10)

[0060] In a first aspect of the application, the present application proposes a probe set for B.1.1.7 sublineage of SARS-CoV-2. According to an embodiment of the present application, a first pair of probes is included, the nucleic acid sequences of which are as follows: first sequence of the first pair of probes: 5’-CCCACTTATGGTGTTGGTTAC-3’ (SEQ ID NO: 1); second sequence of the first pair of probes: 5’-TCTCATCGGCGGGCA-3’ (SEQ ID NO: 2). The inventors found that the above-mentioned probes can specifically recognize and bind to the mutation sites according to the mutation spectrum of the new coronavirus (genomic reference sequence NC_045512.2) B.1.1.7 mutation at N501Y and P681H.

[0061] In some embodiments, the 5’ end and 3’ end of the probe are respectively modified with a fluorescent group and a quenching group. N501Y mutant probe: 5’-CCCACTTATGGTGTTGGTTAC-3’ (SEQ ID NO: 1) probe modification 5’ end FAM, 3’ end MGB; P681H mutant probe: 5’-TCTCATCGGCGGGCA-3’ (SEQ ID NO: 2) probe modification 5’ end CY5, 3’ end MGB.

[0062] In some embodiments, the probe set further includes a second pair of probes, the nucleic acid sequences of which are as follows: first sequence of the second pair of probes: 5’-CCCACTAATGGTGTTGGTTAC-3’ (SEQ ID NO: 3); second sequence of the second pair of probes: 5’-TCTCCTCGGCGGGCA-3’ (SEQ ID NO: 4).

[0063] In some embodiments, the 5’ end and 3’ end of the probe are respectively modified with a fluorescent group and a quenching group. 501N wild-type probe: 5’-CCCACTAATGGTGTTGGTTAC-3’ (SEQ ID NO: 3) probe modification 5’ end FAM, 3’ end MGB; 681P wild-type probe: 5’-TCTCCTCGGCGGGCA-3’ (SEQ ID NO: 4) probe modification 5’ end CY5, 3’ end MGB.

[0064] In some embodiments, the probe set further comprises a first pair of primers and a second pair of primers, the nucleic acid sequences of which are as follows: first pair of primers upstream sequence: 5'-CACCTTGTAATGGTGTTGAAGG-3' (SEQ ID NO: 5); first pair of primers downstream sequence: 5'-AGTTGCTGGTGCATGTAGAAG-3' (SEQ ID NO: 6); second pair of primers upstream sequence: 5'-GTGCAGGTATATGCGCTAGT-3' (SEQ ID NO: 7); second pair of primers downstream sequence: 5'-GCACCAAGTGACATAGTGTAGG-3' (SEQ ID NO: 8). Wherein the first pair of primers is the 501 (i.e. genome site 23063) primer, and the second pair of primers is the 681 (i.e. genome site 23604) primer.

[0065] In some embodiments, the probe set further comprises a third pair of primers and a third probe, the nucleic acid sequences of which are as follows: third pair of primers upstream sequence: 5'-GAGGCATCCTCACCCTGA-3' (SEQ ID NO: 11); third pair of primers downstream sequence: 5'-AGCTCATTGTAGAAGGTGTGG-3' (SEQ ID NO: 12); third probe: 5'-CACCAACTGGGACGACATGGAGAAG-3' (SEQ ID NO: 13). Wherein, the third pair of primers is an internal standard primer, and the third probe is an internal standard probe, and the two ends of the probe are modified with a fluorescent group and a quencher group, respectively. In some preferred embodiments, the third probe is modified with HEX at the 5' end and BHQ1 at the 3' end.

[0066] In some embodiments, the above-mentioned probe set can be used to distinguish whether the 501 site of the novel coronavirus SARS-CoV-2 (genomic reference sequence NC_045512.2) is the 501N wild type (23063A) or the N501Y mutant type (23063T), and can distinguish whether the 681 site is the 681P wild type (23604C) or the P681H mutant type (23604A). By detecting the type of the site, the B.1.1.7 mutant lineage of the novel coronavirus SARS-CoV-2 and the non-B.1.1.7 mutant lineage can be distinguished, and it can be determined whether the SARS-CoV-2 virus infected by the patient is the B.1.1.7 type, and the clinical features and disease progression can be predicted, and the variation and epidemic regularity of the novel coronavirus can be determined, which has a positive significance for epidemic prevention and control and diagnosis of patients. In addition, it provides a new detection method for scientific research on the characteristics of novel coronavirus nucleic acid, protein, etc., vaccine development, etc., which has a positive significance.

[0067] Using the probe set of the present application, the Ct value of the specific target site detected by the corresponding type of MGB probe is small, the detection sensitivity is high, the difference between the Ct value of the specific template and the Ct value of the non-specific template is large, and the specificity is good. The probe set of the comparative example of the present application has a larger Ct value for detecting the specific template than the probe set of the present application, the detection sensitivity is relatively poor, the difference between the Ct value of the specific template and the Ct value of the non-specific template is also smaller than that of the probe set of the present application, and the specificity is also relatively poor.

[0068] In some embodiments, the composition of the present application can be used for fluorescence quantitative PCR detection.

[0069] In some embodiments, in the probe set, the probe for the N501Y site of the novel coronavirus SARS-CoV-2 is labeled with a different fluorescent reporter group than the probe for the P681H site, and the detection channels of the fluorescent reporter groups are different, so that the detection of the N501Y site and the P681H site can be carried out simultaneously according to different fluorescent channels.

[0070] In some embodiments, the composition further comprises: an internal standard upstream primer, an internal standard downstream primer and an internal standard probe for detection.

[0071] In some embodiments, the fluorescent reporter group can be selected from FAM, HEX, ROX, VIC, CY5, 5-TAMRA, TET, CY3 and JOE, but is not limited thereto.

[0072] In a specific embodiment, the fluorescent reporter group at the 5' end of the 501N and N501Y probes shown as SEQ ID NO: 3 and SEQ ID NO: 1 is FAM; the 3' end of the probe is labeled with a quencher group MGB; and the fluorescent reporter group at the 5' end of the 681P and P681H probes shown as SEQ ID NO: 4 and SEQ ID NO: 2 is CY5; the 3' end of the probe is labeled with a quencher group MGB.

[0073] In some embodiments, the internal standard probe shown as SEQ ID NO: 9 is also included in the embodiment, the fluorescent reporter group at the 5' end of the probe is HEX; the 3' end of the probe is labeled with a quencher group BHQ1.

[0074] In some embodiments, the amount of primer in the composition is 60-300 nM; the amount of probe in the composition is 50-200 nM.

[0075] In a specific embodiment, the two probe compositions of the present application are present in separate reaction tubes.

[0076] In some embodiments, the components of the composition of the present application are present in admixture.

[0077] In a second aspect of the present application, the present application provides use of reagents in the manufacture of a kit for typing SARS-CoV-2. According to embodiments of the present application, the reagents comprise the probe set as provided in the first aspect of the present application.

[0078] In a third aspect of the present application, the present application provides use of reagents in the manufacture of a kit for detecting SARS-CoV-2. According to embodiments of the present application, the reagents comprise the probe set as provided in the first aspect of the present application.

[0079] In a fourth aspect of the present application, the present application provides a method for detecting SARS-CoV-2 for non-diagnostic purposes. According to embodiments of the present application, the probe set as provided in the first aspect of the present application is used for RT-qPCR detection of a sample to be tested, and the probes in the probe set as provided in the first aspect of the present application further carry fluorescent groups; detection of the fluorescent group signals carried by either of the first pair of probes and the second pair of probes is indicative of the presence of SARS-CoV-2 nucleic acid in the sample to be tested.

[0080] In some embodiments, the fluorescent groups are selected from at least one of FAM, ROX, VIC, CY5, CY3, HEX, 5-TAMRA, TET, and JOE.

[0081] In a fifth aspect of the present application, the present application provides a method for typing SARS-CoV-2 for non-diagnostic purposes. According to embodiments of the present application, the probe set as provided in the first aspect of the present application is used for fluorescent quantitative PCR detection of a sample to be tested, and the probes in the probe set as provided in the first aspect of the present application further carry fluorescent groups, wherein the first sequence of the first pair of probes and the first sequence of the second pair of probes carry a first fluorescent group, and the second sequence of the first pair of probes and the second sequence of the second pair of probes carry a second fluorescent group; the Ct values of the first fluorescent group and the second fluorescent group channels are detected independently to obtain the ΔCt values of the first fluorescent group channel and / or the second fluorescent group channel, respectively, wherein the ΔCt = the Ct value obtained using the second pair of probes - the Ct value obtained using the first pair of probes; and the typing of the SARS-CoV-2 is obtained according to the ΔCt and the Ct values.

[0082] Further, when the Ct value of the first fluorescent group channel is not greater than 41 and not less than 4, and the Ct value of the second fluorescent group channel is not greater than 41 and not less than -4, it is indicative of the presence of SARS-CoV-2 B.1.1.7 in the sample to be tested.

[0083] In some embodiments, the first fluorescent group and the second fluorescent group are each independently selected from at least one of FAM, ROX, VIC, CY5, CY3, HEX, 5-TAMRA, TET and JOE.

[0084] In some embodiments, the method comprises the following steps:

[0085] 1) nucleic acid extraction of the sample to be tested;

[0086] 2) fluorescence quantitative PCR amplification of the nucleic acid obtained in step 1) using the probe set of the present application as described above;

[0087] 3) amplification curve result analysis.

[0088] In the present application, the sample type for detection can be a throat swab, alveolar lavage fluid, nasopharyngeal swab, sputum, etc., but is not limited thereto.

[0089] Further, the reaction conditions of the fluorescence quantitative PCR are as follows:

[0090] Reverse transcription, temperature 50°C, time 5-10 minutes, 1 cycle; cDNA pre-denaturation, temperature 95°C, time 1-5 minutes, 1 cycle; denaturation, temperature 95°C, time 5-10 seconds, annealing, temperature 55°C, time 10-15 seconds, 45 cycles.

[0091] In a specific embodiment, a rapid identification method for the novel coronavirus SARS-CoV-2 mutant lineage B.1.1.7 is provided, and the specific steps of the method are the same as the above-mentioned typing method.

[0092] In the sixth aspect of the present application, a method for detecting mutations of SARS-CoV-2 genomic sites A23063T and / or C23604A is provided. According to an embodiment of the present application, the probe set provided in the first aspect of the present application is used for fluorescence quantitative PCR detection of the sample to be tested, and the probes in the probe set provided in the first aspect of the present application further carry fluorescent groups, wherein the first sequence of the first pair of probes and the first sequence of the second pair of probes carry a first fluorescent group, and the second sequence of the first pair of probes and the second sequence of the second pair of probes carry a second fluorescent group; the Ct values of the first fluorescent group and the second fluorescent group channels are detected respectively to obtain the ΔCt of the first fluorescent group channel and / or the second fluorescent group channel, wherein the ΔCt = the Ct value obtained by using the second pair of probes - the Ct value obtained by using the first pair of probes; and the site mutation is determined according to the ΔCt and the Ct value.

[0093] Further, when the Ct value of the first fluorescent group channel is not greater than 41 and the ACt is not less than 4, it is an indication that the sample to be tested contains the A23063T mutant of SARS-CoV-2; when the Ct value of the first fluorescent group channel is not greater than 41 and the ACt is not greater than -4, it is an indication that the sample to be tested contains the A23063 wild type of SARS-CoV-2; when the Ct value of the second fluorescent group channel is not greater than 41 and the ACt is not less than 4, it is an indication that the sample to be tested contains the C23604A mutant of SARS-CoV-2; when the Ct value of the second fluorescent group channel is not greater than 41 and the ACt is not greater than -4, it is an indication that the sample to be tested contains the C23604 wild type of SARS-CoV-2.

[0094] In some embodiments, the method comprises the following steps:

[0095] 1) nucleic acid extraction of the sample to be tested;

[0096] 2) performing fluorescent quantitative PCR amplification on the nucleic acid extracted in step 1) using the probe set of the present application as described above;

[0097] 3) amplification curve result analysis.

[0098] In the present application, the sample type for detection can be a throat swab, alveolar lavage fluid, nasopharyngeal swab, sputum, etc., but is not limited thereto.

[0099] Further, the reaction conditions of the fluorescent quantitative PCR are as follows:

[0100] Reverse transcription at a temperature of 50°C for 5-10 minutes, 1 cycle; cDNA pre-denaturation at a temperature of 95°C for 1-5 minutes, 1 cycle; denaturation at a temperature of 95°C for 5-10 seconds, annealing at a temperature of 55°C for 10-15 seconds, 45 cycles.

[0101] In a specific embodiment, a rapid identification method for the novel coronavirus SARS-CoV-2 mutation lineage B.1.1.7 is provided, which comprises the following specific steps:

[0102] 1) nucleic acid extraction of the sample to be tested;

[0103] 2) performing fluorescent quantitative PCR amplification on the nucleic acid extracted in step 1) using the probe set of the present application as described above;

[0104] 3) amplification curve analysis.

[0105] Further, the reaction conditions of the fluorescent quantitative PCR are as follows:

[0106] Reverse transcription, temperature 50℃, time 5-10 minutes, 1 cycle; cDNA pre-denaturation, temperature 95℃, time 1-5 minutes, 1 cycle; denaturation, temperature 95℃, time 5-10 seconds, annealing, temperature 55℃, time 10-15 seconds, 45 cycles.

[0107] In a seventh aspect of the present application, a kit for typing SARS-CoV-2 is provided. According to embodiments of the present application, the kit comprises the probe set according to the first aspect of the present application.

[0108] Further, the kit further comprises a PCR reaction solution and an RT-PCR detection enzyme solution.

[0109] A common PCR reaction solution is composed of Tris-HCl, MgCl2, etc. buffer system and dNTPs. The total volume in a single PCR reaction tube is generally 20-50 μL. A common RT-PCR enzyme solution is composed of reverse transcriptase and DNA polymerase.

[0110] In a specific embodiment, the specific components of the second probe set according to the present application are shown in Table 1.

[0111] Table 1:

[0112] Material Name Material Concentration Amount per reaction 2x PCR MIX 2× 15 μL purified water 2.81 μL 501 site forward primer 100 μM 0.1 μL 501 site reverse primer 100 μM 0.1 μL 501 N wild type probe 100 μM 0.03 μL 681 site forward primer 100 μM 0.1 μL 681 site forward primer 100 μM 0.1 μL 681 wild type probe 100 μM 0.03 μL internal standard forward primer 100 μM 0.1 μL internal standard reverse primer 100 μM 0.1 μL internal standard probe 100 μM 0.03 μL

[0113] In a specific embodiment, the specific components of the first probe set according to the present application are shown in Table 2.

[0114] Table 2:

[0115]

[0116]

[0117] Further, the concentration of the detection probe in the probe set is 60-300 nM; and the amount of the probe in the probe set is 50-200 nM.

[0118] Further, the amount of the detection enzyme solution is 1 μL-3 μL per reaction; and the concentration of the DNA polymerase in the detection enzyme solution is 5 U / μL.

[0119] Further, the kit further comprises a positive control. The positive control contains sequences near the 501st codon and sequences near the 681st codon of the S gene of the novel coronavirus genome, and wherein the 501st codon of the S gene is 501N wild type (23063A) or N501Y mutation (23063T), and the 681st codon of the S gene is 681P (23604C) or 681H (23604A) type.

[0120] The present application will be described below with reference to specific examples, it should be noted that these examples are merely descriptive and do not limit the present application in any way.

[0121] Example 1, primers and probes used in the present application

[0122] The primers and probes used in the present application are as follows:

[0123] Composition 1:

[0124] 501N wild type probe: 5'-CCCACTAATGGTGTTGGTTAC-3' probe modified 5' end FAM, 3' end MGB (SEQ ID NO: 3);

[0125] 681H wild type probe: 5'-TCTCCTCGGCGGGCA-3' probe modified 5' end CY5, 3' end MGB (SEQ ID NO: 4);

[0126] Composition 2:

[0127] N501Y mutant probe: 5'-CCCACTTATGGTGTTGGTTAC-3' probe modified 5' end FAM, 3' end MGB (SEQ ID NO: 1);

[0128] P681H mutant probe: 5'-TCTCATCGGCGGGCA-3' probe modified 5' end CY5, 3' end MGB (SEQ ID NO: 2);

[0129] Among them, each probe composition also includes:

[0130] 501 forward primer: 5'-CACCTTGTAATGGTGTTGAAGG-3' (SEQ ID NO: 5);

[0131] 501 reverse primer: 5'-AGTTGCTGGTGCATGTAGAAG-3' (SEQ ID NO: 6);

[0132] 681 forward primer: 5'-GTGCAGGTATATGCGCTAGT-3' (SEQ ID NO: 7);

[0133] 681 reverse primer: 5'-GCACCAAGTGACATAGTGTAGG-3' (SEQ ID NO: 8);

[0134] Internal standard forward primer: 5'-GAGGCATCCTCACCCTGA-3' (SEQ ID NO: 11);

[0135] Internal standard reverse primer: 5'-AGCTCATTGTAGAAGGTGTGG-3' (SEQ ID NO: 12);

[0136] Internal standard probe: 5'-CACCAACTGGGACGACATGGAGAAG-3' probe modified 5' end HEX, 3' end BHQ1 (SEQ ID NO: 13)

[0137] Example 2, rapid identification method of novel coronavirus SARS-CoV-2 mutant strain B.1.1.7

[0138] The detection sample of the present application is a throat swab, alveolar lavage fluid, nasopharyngeal swab, sputum, etc., but is not limited thereto. The following operations are performed:

[0139] Step one: use MGI nucleic acid extraction reagent (Ehanian license 20200167) to extract the sample to be detected and the positive control, and the specific operation is performed according to the instructions of the extraction kit.

[0140] Step two: take the corresponding amount of composition and detection enzyme liquid in the proportion of 18.5 μL of each composition and 1.5 μL of detection enzyme liquid, mix well, and divide into each reaction tube with a volume of 20 μL per reaction. Add 10 μL of the extracted sample nucleic acid to be detected to each reaction tube, then cover the PCR tube cover, centrifuge for a moment, and then place it in a real-time fluorescent PCR instrument;

[0141] Step three: react and detect according to the following cycle conditions (fluorescence collection selects FAM channel CY5 channel and HEX channel)

[0142] Amplification conditions:

[0143]

[0144]

[0145] Step four: result analysis

[0146] 1. The target detection signal is FAM, CY5;

[0147] 2. Setting of baseline: The baseline is generally set as 3-15 cycles, which can be adjusted according to actual conditions. The adjustment principle is as follows: a region with stable fluorescence signal before exponential amplification is selected, the start point (Start) avoids signal fluctuation in the initial stage of fluorescence acquisition, and the end point (End) is 2 cycles less than the Ct of the sample with the earliest exponential amplification. The setting principle of the threshold line is that the threshold line just exceeds the highest point of the amplification curve (irregular noise line) of the normal blank control.

[0148] 3. If the Ct value of the VIC channel in the two compositions is > 35, and there is no amplification signal or the Ct value of the FAM and CY5 channels is > 41, re-detection is required.

[0149] If the Ct value of the VIC channel in the two compositions is < 35, and there is no amplification signal or the Ct value of the FAM and CY5 channels is > 41, the sample concentration is lower than the detection lower limit and cannot be identified.

[0150] If in the two compositions, in the FAM and CY5 channels, there is an amplification signal in one composition and the Ct value is < 41, the Ct difference value of the corresponding channel is calculated. See Table 1.

[0151] If the Ct value of the FAM channel in composition 1 or composition 2 is < 41, ΔCt (ΔCt = Ct value of the FAM channel of composition 1 - Ct value of the FAM channel of composition 2) is calculated.

[0152] When ΔCt > 4, it is N501Y (mutant), when ΔCt < -4, it is 501N (wild type), and if one of the compositions has no Ct value in the FAM channel, it is calculated with a Ct value of 45.

[0153] If the Ct value of the CY5 channel in composition 1 or composition 2 is < 41, ΔCt (ΔCt = Ct value of the CY5 channel of composition 1 - Ct value of the CY5 channel of composition 2) is calculated.

[0154] When ΔCt > 4, it is P681H (mutant), when ΔCt < -4, it is 681P (wild type), and if one of the compositions has no Ct value in the CY5 channel, it is calculated with a Ct value of 45.

[0155] Table 3:

[0156]

[0157] Example 3, specific detection of the composition of the application

[0158] The compositions described in Example 1 of the present application were used to perform the detection according to the method described in Example 2. The samples were two high-concentration (concentration of 1.0E+06 copies / mL) pseudovirus samples. The compositions 1 and 2 were used to detect SARS-CoV-2 (genomic reference sequence NC_045512.2) 501N and 681P wild-type pseudovirus templates and SARS-CoV-2 N501Y and P681H mutant pseudovirus templates, respectively, and the results are shown in Figure 1 - Figure 4 Table 4 below.

[0159] Table 4:

[0160]

[0161] As can be seen from Table 4, the detection Ct values of compositions 1 and 2 for SARS-CoV-2 501N and 681P wild-type pseudovirus templates and SARS-CoV-2 N501Y and P681H mutant pseudovirus templates are significantly different, and the minimum value of each ΔCt is 7.6, which is still much greater than the requirement of ΔCT>4 in the result determination method described in Example 2, and the specificity is excellent.

[0162] Example 4, sensitivity detection of compositions of the present application

[0163] The compositions 1 and 2 described in Example 1 of the present application were used to perform the detection according to the detection method described in Example 2. The samples used were pseudovirus samples (SARS-CoV-2 501N and 681P wild-type pseudovirus and SARS-CoV-2 N501Y and P681H mutant pseudovirus) diluted with physiological saline in a gradient, and each concentration gradient was 1.0E+06 copies / mL, 1.0E+05 copies / mL, 1.0E+04 copies / mL, 1.0E+03 copies / mL, 1.0E+02 copies / mL, and 1.0E+01 copies / mL. The first composition and the second composition were used to detect specific templates of different concentrations, respectively, and the results are shown in Figure 5 - Figure 8 1.0E+02 copies / mL and 1.0E+01 copies / mL samples had no amplification curves.

[0164] The minimum detection concentration of the first composition was 1.0E+03 copies / mL (10 copies / reaction).

[0165] The minimum detection concentration of the second composition was 1.0E+03 copies / mL (10 copies / reaction).

[0166] Example 5, compositions of the present application for detecting novel coronavirus SARS-CoV-2 mutant lineage B.1.1.7

[0167] Using the composition described in Example 1 of the present application, detection was carried out according to the method described in Example 2. The sample was a clinical positive sample to extract nucleic acid. Detection was carried out using composition 1 and composition 2 respectively, and the results are shown in FIG. 1 and FIG. 2, where the dashed line is the amplification curve of composition 1, and the solid line is the amplification curve of composition 2. From the figures, it can be judged that the sample S gene 501 site is N501Y mutant type, and the 681 site is P681H mutant, which is consistent with the sample type. Figure 25 and Figure 26

[0168] Detection of SARS-CoV-2 virus B.1.1.7 mutant spectrum by comparative example, additional probe composition of the present application

[0169] In the process of creating the present application, different specific recognition probes were designed for different types of S gene 501 site and S gene 681 site. These probes all follow the design principle of MGB probe, so that they can selectively recognize specific target sites. The sequences of some comparative probes are as follows:

[0170] 501N wild type comparative probe:

[0171] 501N-2: 5'-GCTGATTTTGACACATGGTTTAGC-3' (SEQ ID NO: 14);

[0172] 501N-3: 5'-GCTGATTTTGACACATGGTTTATC-3' (SEQ ID NO: 15);

[0173] 501N-4: 5'-GCTGATTTTGACACATGGTTTCGC-3' (SEQ ID NO: 16);

[0174] N501Y mutant type probe:

[0175] N501Y-2: 5'-GCTGATTTTGACACATGGTTTAGT-3' (SEQ ID NO: 17);

[0176] N501Y-3: 5'-GCTGATTTTGACACATGGTTTCGT-3' (SEQ ID NO: 18);

[0177] N501Y-4: 5'-GCTGATTTTGACACATGGTTTATT-3' (SEQ ID NO: 19);

[0178] 681P wild type comparative probe:

[0179] ​681P-2: 5'-ATCGGTAATTATACAGTTTCCTCTTT-3' (SEQ ID NO: 20);

[0180] 681P-3: 5'-ATCGGTAATTATACAGTTTCCTGGTT-3' (SEQ ID NO: 21);

[0181] 681P-4: 5'-ATCGGTAATTATACAGTTTCCTGGGT-3' (SEQ ID NO: 22);

[0182] P681H mutant contrast probe:

[0183] P681H-2: 5'-ATCGGTAATTATACAGTTTCCTCTTC-3' (SEQ ID NO: 23);

[0184] P681H-3: 5'-ATCGGTAATTATACAGTTTCCTGGTC-3' (SEQ ID NO: 24);

[0185] P681H-4: 5'-ATCGGTAATTATACAGTTTCCTGAGC-3' (SEQ ID NO: 25).

[0186] Using these probes, combined with the 501, 681 forward primer, reverse primer in Example 1 into compositions, detection was carried out according to the method described in Example 2. The sample is two kinds of concentration of 1.0E+06 copies / mL of pseudovirus sample. The detection results are shown in Figure 9 to Figure 24 , wherein Figure 9 is the detection result of the 501N probe composition in the composition 1 of the application; Figure 10 is the detection result of the control example 501N-2 probe composition; Figure 11 is the detection result of the control example 501N-3 probe composition; Figure 12 is the detection result of the control example 501N-4 probe composition; Figure 13 is the detection result of the 501Y probe composition in the composition 2 of the application; Figure 14 is the detection result of the control example 501Y-2 probe composition; Figure 15 is the detection result of the control example 501Y-3 probe composition; Figure 16 is the detection result of the control example 501Y-4 probe composition; Figure 17 is the detection result of the 681P probe composition in the composition 1 of the application; Figure 18 is the detection result of the control example 681P-2 probe composition; Figure 19 is the detection result of the control example 681P-3 probe composition;Figure 20 The detection results of the 681P-4 probe composition in the control example 2; Figure 21 The detection results of the 681H probe composition in the composition 2 of the present application; Figure 22 The detection results of the 681H-4 probe composition in the control example 2; Figure 23 The detection results of the 681H-4 probe composition in the control example 2; Figure 24 The detection results of the 681H-4 probe composition in the control example 2.

[0187] In the above results, the solid line represents the results of each probe amplifying its specific template (for example, the 501N probe detects the wild-type template of the novel coronavirus 501N (20063A) and 681P (23604C) — the 501 site in the template is 501N (23063A)), and the dotted line represents the results of the probe amplifying the non-specific template (for example, the 501Y (20063T) and 681H (23604A) mutant template — the 501 site in the template is 501Y (23063T)).

[0188] The main indicators for evaluating the advantages and disadvantages of the primers are the sensitivity and specificity of the primers. The smaller the Ct value of the primer for detecting and amplifying the specific target, the higher the sensitivity; the larger the absolute value of the difference between the Ct value of the specific template and the Ct value of the non-specific template detected by the same probe at the same concentration, the better the specificity.

[0189] As can be seen from the comparison of the detection results of the various comparative examples and embodiments, the comprehensive performance of the sensitivity and specificity of the probe of each comparative example is poorer than that of the primer probe composition of the present application.

[0190] In the description of the specification, the description of the terms "one embodiment", "some embodiments", "an example", "a specific example", or "some examples" means that the specific features, structures, materials or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present application. In the specification, the illustrative description of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any appropriate manner in any one or more embodiments or examples. In addition, those skilled in the art can combine and combine the different embodiments or features of the embodiments described in the specification without contradiction.

[0191] Although the embodiments of the present application have been shown and described above, it should be understood that the above embodiments are exemplary and cannot be construed as limiting the present application, and those skilled in the art can make changes, modifications, replacements and variations to the above embodiments within the scope of the present application. SEQUENCE LISTING <110> shenzhen huaada gene co. ltd.; shenzhen huaada gene co., ltd. huada biotech (wuhan) co., ltd. <120> probe sets and uses thereof <130> bi3210253 <160> 25 <170> patentin version 3.5 <210> 1 <211> 21 <212> dna <213> artificial sequence <220> <223> first pair of probes first sequence <400> 1 cccacttatg gtgttggtta c 21 <210> 2 <211> 15 <212> dna <213> artificial sequence <220> <223> first pair of probes second sequence <400> 2 tctcatcggc gggca 15 <210> 3 <211> 21 <212> dna <213> artificial sequence <220> <223> second pair of probes first sequence <400> 3 cccactaatg gtgttggtta c 21 <210> 4 <211> 15 <212> dna <213> artificial sequence <220> <223> second pair of probes second sequence <400> 4 tctcctcggc gggca 15 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> First pair of primers upstream sequence <400> 5 caccttgtaa tggtgttgaa gg 22 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> First pair of primers downstream sequence <400> 6 agttgctggt gcatgtagaa g 21 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Second pair of primers upstream sequence <400> 7 gtgcaggtat atgcgctagt 20 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Second pair of primers downstream sequence <400> 8 gcaccaagtg acatagtgta gg 22 <210> 9 <211> 999 <212> DNA <213> Artificial Sequence <220> <223> N501Y and P681H mutant insert sequence <400> 9 attgctgatt ataattataa attaccagat gattttacag gctgcgttat agcttggaat 60 tctaacaatc ttgattctaa ggttggtggt aattataatt acctgtttag attgtttagg 120 aagtctaatc tcaaaccttt tgagagagat atttcaactg aaatctatca ggccggtagc 180 acaccttgta atggtgttga aggttttaat tgttactttc ctttacaatc atatggtttc 240 caacccactt atggtgttgg ttaccaacca tacagagtag tagtactttc ttttgaactt 300 ctacatgcac cagcaactgt ttgtggacct aaaaagtcta ctaatttggt taaaaacaaa 360 tgtgtcaatt tcaacttcaa tggtttaaca ggcacaggtg ttcttactga gtctaacaaa 420 aagtttctgc ctttccaaca atttggcaga gacattgctg acactactga tgctgtccgt 480 gatccacaga cacttgagat tcttgacatt acaccatgtt cttttggtgg tgtcagtgtt 540 ataacaccag gaacaaatac ttctaaccag gttgctgttc tttatcagga tgttaactgc 600 acagaagtcc ctgttgctat tcatgcagat caacttactc ctacttggcg tgtttattct 660 acaggttcta atgtttttca aacacgtgca ggctgtttaa taggggctga acatgtcaac 720 aactcatatg agtgtgacat acccattggt gcaggtatat gcgctagtta tcagactcag 780 actaattctc atcggcgggc acgtagtgta gctagtcaat ccatcattgc ctacactatg 840 tcacttggtg cagaaaattc agttgcttac tctaataact ctattgccat acccacaaat 900 tttactatta gtgttaccac agaaattcta ccagtgtcca ccaattaaag attttggtgg 960 ttttaatttt tcacaaatat taccagatcc atcaaaacc 999 <210> 10 <211> 999 <212> DNA <213> Artificial Sequence <220> <223> 501N and 681P wild type insert sequence <400> 10 attgctgatt ataattataa attaccagat gattttacag gctgcgttat agcttggaat 60 tctaacaatc ttgattctaa ggttggtggt aattataatt acctgtatag attgtttagg 120 aagtctaatc tcaaaccttt tgagagagat atttcaactg aaatctatca ggccggtagc 180 acaccttgta atggtgttga aggttttaat tgttactttc ctttacaatc atatggtttc 240 caacccacta atggtgttgg ttaccaacca tacagagtag tagtactttc ttttgaactt 300 tttactatta gtgttaccac agaaattcta ccagtgtcca ccaattaaag attttggtgg 960 tttactatta gtgttaccac agaaattcta ccagtgtcca ccaattaaag attttggtgg 960 tttactatta gtgttaccac agaaattcta ccagtgtcca ccaattaaag attttggtgg 960 tttactatta gtgttaccac agaaattcta ccagtgtcca ccaattaaag attttggtgg 960 tttactatta gtgttaccac agaaattcta ccagtgtcca ccaattaaag attttggtgg 960 tttactatta gtgttaccac agaaattcta ccagtgtcca ccaattaaag attttggtgg 960 tttactatta gtgttaccac agaaattcta ccagtgtcca ccaattaaag attttggtgg 960 tttactatta gtgttaccac agaaattcta ccagtgtcca ccaattaaag attttggtgg 960 tttactatta gtgttaccac agaaattcta ccagtgtcca ccaattaaag attttggtgg 960 tttactatta gtgttaccac agaaattcta ccagtgtcca ccaattaaag attttggtgg 960 tttactatta gtgttaccac agaaattcta ccagtgtcca ccaattaaag attttggtgg 960 tttactatta gtgttaccac agaaattcta ccagtgtcca ccaattaaag attttggtgg 960 tttactatta gtgttaccac agaaattcta ccagtgtcca ccaattaaag attttggtgg 960<210> 11 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Third primer upstream sequence <400> 11 gaggcatcct caccctga 18 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Third primer downstream sequence <400> 12 agctcattgt agaaggtgtg g 21 <210> 13 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Third probe <400> 13 caccaactgg gacgacatgg agaag 25 <210> 14 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 501N-2 <400> 14 gctgattttg acacatggtt tagc 24 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 501N-3 <400> 15 gctgattttg acacatggtt tatc 24 <210> 16 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> 501N-4 <400> 16 gctgattttg acacatggtt tcgc 24 <210> 17 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> N501Y -2 <400> 17 gctgattttg acacatggtt tagt 24 <210> 18 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> N501Y -3 <400> 18 gctgattttg acacatggtt tcgt 24 <210> 19 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> N501Y -4 <400> 19 gctgattttg acacatggtt tatt 24 <210> 20 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> 681P -2 <400> 20 atcggtaatt atacagtttc ctcttt 26 <210> 21 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> 681P ‑3 <400> 21 atcggtaatt atacagtttc ctggtt 26 <210> 22 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> 681P ‑4 <400> 22 atcggtaatt atacagtttc ctgggt 26 <210> 23 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> P681H ‑2 <400> 23 atcggtaatt atacagtttc ctcttc 26 <210> 24 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> P681H ‑3 <400> 24 atcggtaatt atacagtttc ctggtc 26 <210> 25 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> P681H ‑4 <400> 25 atcggtaatt atacagtttc ctgagc 26

Claims

1. A probe set for SARS-CoV-2 B.1.1.7 genotyping, characterized in that, The first pair of probes has the following nucleic acid sequence: First probe first sequence: 5'-CCCACTTATGGTGTTGGTTAC-3' (SEQ ID NO:1); The second sequence of the first pair of probes: 5'-TCTCATCGGCGGGCA-3' (SEQ ID NO:2); The second pair of probes has the following nucleic acid sequences: The first sequence of the second pair of probes: 5'-CCCACTAATGGTGTTGGTTAC-3' (SEQ ID NO:3); The second pair of probes has the second sequence: 5'-TCTCCTCGGCGGGCA-3' (SEQ ID NO:4); The nucleic acid sequences of the first and second primer pairs are shown below: The upstream sequence of the first primer pair is: 5'-CACCTTGTAATGGTGTTGAAGG-3' (SEQ ID NO:5); The downstream sequence of the first primer pair is: 5'-AGTTGCTGGTGCATGTAGAAG-3' (SEQ ID NO:6); The upstream sequence of the second primer pair is: 5'-GTGCAGGTATATGCGCTAGT-3' (SEQ ID NO:7); The downstream sequence of the second primer pair is: 5'-GCACCAAGTGACATAGTGTAGG-3' (SEQ ID NO:8).

2. The probe assembly according to claim 1, characterized in that, It further includes a third pair of primers and a third probe, the nucleic acid sequences of which are shown below: The upstream sequence of the third primer pair is: 5'-GAGGCATCCTCACCCTGA-3' (SEQ ID NO:11); The downstream sequence of the third primer pair: 5'-AGCTCATTGTAGAAGGTGTGG-3' (SEQ ID NO:12); Third probe: 5'-CACCAACTGGGACGACATGGAGAAG-3' (SEQ ID NO:13).

3. The use of the reagent in the preparation of the kit, the kit being used for SARS-CoV-2 typing, characterized in that, The reagent comprises the probe set as described in any one of claims 1 to 2.

4. The use of the reagent in the preparation of the kit, the kit being used for the detection of SARS-CoV-2, characterized in that, The reagent comprises the probe set as described in any one of claims 1 to 2.

5. A method for detecting SARS-CoV-2, said method for non-diagnostic purposes, characterized in that, RT-qPCR detection of the sample to be tested was performed using the probe set according to any one of claims 1-2, wherein the probes in the probe set according to any one of claims 1-2 further carry fluorescent groups; The detection of fluorescent group signals carried by either the first pair of probes or the second pair of probes is an indication that the sample to be tested contains SARS-CoV-2 nucleic acid.

6. The method according to claim 5, characterized in that, The fluorescent group is selected from at least one of the following: FAM, ROX, VIC, CY5, CY3, HEX, 5-TAMRA, TET, and JOE.

7. A SARS-CoV-2 typing method, said method for non-diagnostic purposes, characterized in that, The probe set according to any one of claims 1 to 2 is used to perform real-time PCR detection on the sample to be tested. The probes in the probe set according to any one of claims 1 to 2 further carry fluorescent groups, wherein the first sequence of the first pair of probes and the first sequence of the second pair of probes carry a first fluorescent group, and the second sequence of the first pair of probes and the second sequence of the second pair of probes carry a second fluorescent group. The Ct values ​​of the first fluorescent group and the second fluorescent group channel are detected independently, so as to obtain the ΔCt value of the first fluorescent group channel and / or the second fluorescent group channel independently, wherein the ΔCt = Ct value obtained using the second pair of probes - Ct value obtained using the first pair of probes; The SARS-CoV-2 genotype is obtained based on the ΔCt and Ct values.

8. The method according to claim 7, characterized in that, When the Ct value of the first fluorescent channel is not greater than 41 and not less than 4, and the Ct value of the second fluorescent channel is not greater than 41 and not less than -4, it indicates that the sample to be tested contains SARS-CoV-2 B.1.1.

7.

9. The method according to claim 8, characterized in that, The first fluorescent group and the second fluorescent group are each independently selected from at least one of the following: FAM, ROX, VIC, CY5, CY3, HEX, 5-TAMRA, TET and JOE.

10. A method for detecting SARS-CoV-2 genomic site mutations, said method for non-diagnostic purposes, wherein the site mutations are A23063T and / or C23604A, characterized in that, The probe set according to any one of claims 1 to 2 is used to perform real-time PCR detection on the sample to be tested. The probes in the probe set according to any one of claims 1 to 2 further carry fluorescent groups, wherein the first sequence of the first pair of probes and the first sequence of the second pair of probes carry a first fluorescent group, and the second sequence of the first pair of probes and the second sequence of the second pair of probes carry a second fluorescent group. The Ct values ​​of the first fluorescent group and the second fluorescent group channel are detected independently, so as to independently obtain the ΔCt of the first fluorescent group channel and / or the second fluorescent group channel, wherein the ΔCt = Ct value obtained using the second pair of probes - Ct value obtained using the first pair of probes; Based on the ΔCt and Ct values, the site mutation is determined.

11. The method according to claim 10, characterized in that, When the Ct value of the first fluorescent group channel is not greater than 41 and ΔCt is not less than 4, it is an indicator that the sample to be tested contains the A23063T mutant of SARS-CoV-2. When the Ct value of the first fluorescent group channel is not greater than 41 and ΔCt is not greater than -4, it is an indicator that the sample to be tested contains the wild-type A23063 of SARS-CoV-2. When the Ct value of the second fluorescent group channel is not greater than 41 and ΔCt is not less than 4, it is an indicator that the sample to be tested contains the C23604A mutant of SARS-CoV-2. When the Ct value of the second fluorescent group channel is not greater than 41 and ΔCt is not greater than -4, it is an indication that the sample to be tested contains the wild-type C23604 of SARS-CoV-2.

12. A kit for SARS-CoV-2 typing, characterized in that, Includes the probe set as described in any one of claims 1 to 2.

Citation Information

Patent Citations

  • Gene of novel coronavirus B.1.1.7 British mutant strain RBD and application of gene

    CN113046370A

  • Primer composition and kit for rapidly detecting novel coronavirus N501Y mutation

    CN113046476A

  • Method for detecting SARS-CoV-2 variant strain nucleic acid and application thereof

    CN113249522A

  • Method and kit for detecting and screening new coronavirus N501Y mutation

    CN113355459A