Molecular marker primer set for detecting protein content in wheat grains and its application

Abstract

The present invention discloses a KASP molecular marker for detecting the protein content of wheat grains and its application. The present invention detects a new main effect QTL site Qgpc.1BL that controls the protein content of grains. After identification and screening of markers on both sides, it is clear that the genotype of its tightly linked marker AX‑89694598 has the highest phenotypic significance with the protein content of grains, and accordingly develops a KASP marker primer set for efficient screening of the protein content of wheat grains. By using the primer set of the present invention to perform PCR amplification on wheat genomic DNA, it is possible to directly determine whether the allele variation of the low protein content of grains of Yangmai No. 5 is carried out by KASP typing. The detection method is simple to operate, the detection result is very intuitive, and the detection effect is obvious and effective. Screening using the molecular marker can greatly improve the work efficiency of selecting the high and low protein content of grains in wheat quality breeding.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker detection of high and low protein content in wheat grains, and relates to a molecular marker primer set significantly correlated with detecting high and low protein content in wheat grains and an application thereof. Background Art

[0002] The gluten type of Chinese wheat presents a situation of "small at both ends and large in the middle", that is, there are more medium-gluten types suitable for making noodles, while hard, high-protein, strong-gluten wheat suitable for making high-quality bread and soft, low-protein, weak-gluten wheat for making high-quality biscuits and cakes are extremely scarce. Therefore, strengthening the basic research on Chinese wheat quality traits, especially protein content, is of great significance to improving Chinese wheat quality and cultivating special varieties. Grain protein content is the main selection index for wheat quality breeding. Most studies have shown that the protein content of grains or flour is greatly affected by environmental effects, and it cannot be effectively determined in low generations (determining protein content requires a certain amount of seed samples, and the amount of low-generation seeds is small and precious, resulting in insufficient sample size for determination). Therefore, the use of traditional breeding methods for protein content selection has problems such as low accuracy and efficiency, and delayed selection. Molecular marker-assisted selection breeding can select for protein content traits at the DNA level. Not only is the result stable, but selection can also be carried out at the seedling stage, reducing the cost of phenotypic evaluation and improving wheat breeding efficiency. With the rapid development of wheat genomics and molecular breeding technology, it is an effective breeding method to use gene chip technology to discover loci significantly associated with grain protein content, and then use tightly linked single nucleotide polymorphism (SNP) markers to select varieties (lines) with high or low protein content. In recent years, molecular markers have been used to locate multiple QTLs that affect wheat grain protein content, mainly distributed on chromosomes 1D, 2A, 2B, 2D, 3D, 5A, 5D, 6B, 6D and 7A. Wheat grain protein content is a typical quantitative trait, and so far, few loci that are tightly linked to grain protein content and can exist stably in multiple environments have been reported.

[0003] KASP is the abbreviation of competitive allele-specific PCR (Kompetitive Allele Specific PCR), which can accurately determine the alleles of SNPs and InDels at specific sites in a wide range of genomic DNA samples (even some complex genomic DNA samples). KASP has high throughput, is fast and stable, and is an ideal and practical molecular marker for breeding. In recent years, this technology has been widely used in breeding applications such as wheat disease resistance, dwarfing and vernalization genes / locus, but its application in high-throughput screening of wheat quality, especially grain protein content, is rare.

[0004] The wheat-growing area in the middle and lower reaches of the Yangtze River is a dominant industrial belt for weak-gluten wheat production in my country. Yangmai No. 5 is an early weak-gluten wheat variety in the middle and lower reaches of the Yangtze River. It has high yield and disease resistance and has won the first prize of the National Science and Technology Progress Award. It has been used as a parent to breed high-quality weak-gluten and disease-resistant wheat varieties such as Yangmai No. 10, Yangmai No. 11, Yangmai No. 12 and Yangmai No. 19. Therefore, Yangmai No. 5 was used as the research object to deeply reveal the genetic basis of its grain protein content and develop breeding-usable molecular markers that are significantly related to low grain protein content, which is conducive to the efficient creation of weak-gluten wheat germplasm with stable quality, and lay a theoretical foundation and provide new ways for the selection and breeding of weak-gluten wheat varieties in the middle and lower reaches of the Yangtze River. Summary of the invention

[0005] The purpose of the present invention is to overcome the defects in the prior art and provide a linkage molecular marker for molecular marker-assisted selection of high and low grain protein content in wheat breeding. The present invention uses Wheat 55K wheat high-throughput gene chip to obtain genotype data, and combined with two years of grain protein content determination, a major effect QTL locus significantly associated with grain protein content was detected. Qgpc.1BL , and the allele variation that reduces the grain protein content all comes from Yangmai No. 5. After comparing and screening the markers on both sides, it was determined that the marker most closely linked to its function is AX-111712993. Based on this, a KASP marker primer set was developed for efficient screening of grain protein content.

[0006] The first aspect of the present invention provides a molecular marker substance for detecting the protein content of wheat grains, the substance being a set of primers or a reagent or a kit containing the set of primers for detecting that the 55th deoxyribonucleotide of the gene fragment shown in SEQ ID No.4 on chromosome 1B in the wheat genome is TT, AA or TA. Wherein, the gene fragment shown in SEQ ID No.4 is CATCTCCCTGGTTTATCCTCCTGAGCCGTTATGTAGTTTATTCCAAACTATCATRTTCGTTCTATTTGGACATTTTTCCCCCGCTAGTTTGGTTATAAAGCTAACAGTGTACAGGGACAGGGAAGATGTGCTAGGGTT, the 55th base R is a SNP site, which is [T / A]; "[T / A]" indicates two polymorphic single nucleotides T or A of the SNP marker, that is, the base at this position is T or A in the actual wheat material.

[0007] In certain embodiments, the set of primers contains two upstream primers and one downstream primer;

[0008] The upstream primer is designed according to the upstream sequence of the 55th deoxyribonucleotide of the gene fragment shown in SEQ ID No. 4 on chromosome 1B in the wheat genome, and the 3' terminal deoxyribonucleotide of one upstream primer is T, and the 3' terminal deoxyribonucleotide of the other upstream primer is A.

[0009] The downstream primer is designed according to the 55th deoxyribonucleotide of the gene fragment shown in SEQ ID No. 4 on chromosome 1B in the wheat genome and its downstream sequence.

[0010] In certain embodiments, the primer set is a primer set consisting of the single-stranded DNA molecule shown at positions 22-45 of SEQ ID No.1 or its derivatives, the single-stranded DNA molecule shown at positions 22-45 of SEQ ID No.2 or its derivatives, and the single-stranded DNA molecule of SEQ ID No.3.

[0011] In certain embodiments, the derivative of the single-stranded DNA molecule shown at positions 22-45 of SEQ ID No.1 is a single-stranded DNA molecule shown at positions 22-45 of SEQ ID No.1 with a specific fluorescent label sequence A connected to its 5' end; the derivative of the single-stranded DNA molecule shown at positions 22-45 of SEQ ID No.2 is a single-stranded DNA molecule shown at positions 22-45 of SEQ ID No.2 with a specific fluorescent label sequence B connected to its 5' end.

[0012] In certain embodiments, the specific fluorescent label sequence A is a fluorescent label sequence FAM, and the specific fluorescent label sequence B is a fluorescent label sequence HEX.

[0013] In certain embodiments, the sequence of the upstream primer is shown as SEQ ID No.1 and SEQ ID No.2, and the sequence of the downstream primer is shown as SEQ ID No.3.

[0014] In a second aspect, the present invention further provides the use of the substance described in the first aspect in any of the following:

[0015] (A) Identify or assist in identifying the high or low protein content of wheat grains;

[0016] (B) Comparing the protein content of the wheat grains to be tested;

[0017] (C) breeding or selecting wheat plants, strains, lines or varieties with relatively low wheat grain protein content;

[0018] (D) breeding or selecting wheat plants, strains, lines or varieties with relatively high wheat grain protein content;

[0019] (E) preparing a product for identifying or assisting in identifying or comparing the protein content of wheat grains to be tested;

[0020] (F) preparing a product for breeding or screening wheat plants, lines, strains or varieties with relatively low wheat grain protein content;

[0021] (G) preparing a product for breeding or screening wheat plants, lines, strains or varieties with relatively high wheat grain protein content.

[0022] In certain embodiments, the product is a detection reagent or a detection kit.

[0023] In a third aspect, the present invention further provides any of the following methods:

[0024] Method A: A method for detecting whether the 55th deoxyribonucleotide of the gene fragment shown in SEQ ID No. 4 on chromosome 1B in the wheat genome is TT, AA, or T and A, comprising the following steps (A1) or (A2):

[0025] (A1) Direct sequencing;

[0026] (A2) using the substance described in the first aspect of the present invention to perform PCR amplification on the wheat genomic DNA to be tested, scanning the amplified product for fluorescence signals, analyzing the scanned data, and then determining whether the 55th deoxyribonucleotide of the gene fragment shown in SEQ ID No. 4 on chromosome 1B in the wheat gene to be tested is T or A according to the following method:

[0027] If the fluorescent signal data of the amplified product of the wheat to be tested is displayed in blue, the 55th deoxyribonucleotide of the gene fragment shown by SEQ ID No. 4 on chromosome 1B in the genome of the wheat to be tested is a homozygous T;

[0028] If the fluorescent signal data of the amplified product of the wheat to be tested is displayed as red, the 55th deoxyribonucleotide of the gene fragment shown by SEQ ID No. 4 on chromosome 1B in the genome of the wheat to be tested is a homozygous A;

[0029] If the fluorescent signal data of the amplified product of the wheat to be tested is displayed as green, the 55th deoxyribonucleotide of the gene fragment shown in SEQ ID No.4 on chromosome 1B in the wheat genome to be tested is a hybrid of T and A;

[0030] Method B: A method for comparing the protein content of wheat grains to be tested, comprising the following steps:

[0031] (B1) detecting whether the 55th deoxyribonucleotide of the gene fragment shown by SEQ ID No. 4 on chromosome 1B in the wheat genome is TT, AA, or T and A;

[0032] (B2) determining the protein content of the wheat grains to be tested as follows: if the 55th deoxyribonucleotide of the gene fragment shown by SEQ ID No. 4 on chromosome 1B of the genome is a homozygous T, the protein content of the wheat grains to be tested is lower than that of the wheat grains to be tested if the 55th deoxyribonucleotide of the gene fragment shown by SEQ ID No. 4 on chromosome 1B of the genome is a homozygous A or a heterozygous T and A;

[0033] Method C: A method for breeding or screening wheat plants or lines or strains or varieties with relatively low wheat grain protein content, comprising the following steps:

[0034] (C1) detecting whether the 55th deoxyribonucleotide of the gene fragment shown by SEQ ID No. 4 on chromosome 1B in the wheat genome is TT, AA, or T and A;

[0035] (C2) selecting a test wheat plant in which the 55th deoxyribonucleotide of the gene fragment shown in SEQ ID No. 4 on chromosome 1B of the genome is homozygous for T as a parent for breeding, and selecting wheat plants in which the 55th deoxyribonucleotide of the gene fragment shown in SEQ ID No. 4 on chromosome 1B of the genome is homozygous for T in each breeding generation, and finally obtaining wheat plants, strains, lines or varieties with relatively low grain protein content;

[0036] Method D: A method for breeding or screening wheat plants or lines or strains or varieties with relatively high grain protein content, comprising the following steps:

[0037] (D1) detecting whether the 55th deoxyribonucleotide of the gene fragment shown in SEQ ID No. 4 on chromosome 1B in the wheat genome is AA, TT, or A and T;

[0038] (D2) selecting a wheat plant to be tested in which the 55th deoxyribonucleotide of the gene fragment shown in SEQ ID No. 4 on chromosome 1B of the genome is homozygous for A as a parent for breeding, and selecting wheat plants in which the 55th deoxyribonucleotide of the gene fragment shown in SEQ ID No. 4 on chromosome 1B of the genome is homozygous for A in each breeding generation, and finally obtaining wheat plants, strains, lines or varieties with relatively high grain protein content.

[0039] In certain embodiments, in the method B, the method C and the method D, the method for detecting whether the 55th deoxyribonucleotide of the gene fragment shown in SEQ ID No. 4 on chromosome 1B in the wheat genome is TT, AA, or T and A is the method A.

[0040] Compared with the prior art, the present invention detects a SNP site significantly associated with the protein content of wheat grains Qgpc.1BL , whose tightly linked marker is AX-111712993, and a KASP marker primer set KASP-Qgpc.1BL was developed based on it. Using this KASP primer set as primers and the wheat genome to be tested as a template, PCR amplification is performed. If the amplification result shows that the genotype of the wheat to be tested is the same as that of Yangmai No. 5, then the wheat to be tested contains the allele T of the site; otherwise, the wheat to be tested contains the allele A; the protein content of wheat grains containing the allele T is significantly lower than that of wheat containing the allele A; this detection method can quickly and intuitively obtain the results of the high and low protein content of wheat varieties, and is suitable for large-scale breeding screening. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] In order to more clearly illustrate the specific implementation manner of the present invention or the technical solution in the prior art, the drawings required for describing the specific implementation manner are briefly introduced below.

[0042] Figure 1 Partial genetic linkage map of chromosome 1B and Qgpc.1BL Positioning diagram (GPC represents grain protein content, the left side of the chromosome is the genetic position, the right side is the linkage marker; the right side of the linkage map is the LOD value).

[0043] Figure 2 This is a schematic diagram of the amplification detection results of the KASP marker KASP-Qgpc.1BL in the natural wheat population in Example 2 (blue cluster points represent TT, red cluster points represent AA, and black dots represent blank controls).

[0044] Figure 3 Schematic diagram of the amplification detection results of the KASP marker KASP-Qgpc.1BL in some breeding generation lines in the wheat identification nursery in Example 3 (blue cluster points represent TT, red cluster points represent AA, green cluster points represent TA, and black dots represent blank controls). DETAILED DESCRIPTION

[0045] The embodiments of the technical solution of the present invention will be described in detail below in conjunction with the accompanying drawings. The following embodiments are only used to more clearly illustrate the technical solution of the present invention, and are therefore only used as examples, and the protection scope of the present invention cannot be limited by this. It should be noted that, unless otherwise specified, the technical terms or scientific terms used in this application should be the usual meanings understood by those skilled in the art to which the present invention belongs.

[0046] Example 1 Screening for stable SNP loci significantly associated with wheat grain protein content and designing KASP markers

[0047] In this example, 143 recombinant inbred lines (F 10 ) was used as the material. The recombinant inbred line and its parents were planted in the Wantou Experimental Base in the Lixiahe area of ​​Jiangsu Province for two consecutive growing seasons in 2017 and 2018. A randomized block design was adopted, with 5 rows planted in each line, 30 grains per row, 2.0m in row length, 0.25m in row spacing, and 2 replicates. Weeding, disease and insect prevention were carried out according to conventional field management methods. In June 2018 and 2019, when the wheat was mature, 40 disease-free plants were harvested from 5 rows of each family and the grain samples were cleaned, and no ear germination occurred. In order to reduce errors, equal amounts of cleaned seeds from 2 replicates were mixed as the final test grain samples. The grain protein content was determined in accordance with the national wheat variety classification standard GB / T 17320-2013. The grain protein content was detected using a Perten DA7200 near-infrared instrument according to AACC39-10, and the determination was carried out twice, and the average was taken.

[0048] Genomic DNA was extracted by CTAB method, and the genome of the experimental materials was scanned using wheat 55K SNP chip. IciMapping v4.1 software (http: / / www.isbreeding.net) was used to filter and remove redundant genotype data. JoinMap v4.0 was used to construct and correct the genetic map, and MapChart2.3 (https: / / www.wur.nl / en / show / Mapchart.htm) was used to draw the genetic map. The QTL significantly associated with wheat grain protein content was detected using the inclusive composite interval mapping (ICIM, Kosambi et al. 1944; Van et al. 2006) method of IciMapping v4.1, and the LOD threshold was set to 2.5. In order to compare with previous results, the linked markers or flanking sequences were aligned with the Chinese Spring Reference Genome Sequence v2.1 (International Wheat Genome Sequencing Consortium (IWGSC) Reference Sequence v2.1) database.

[0049] The experiment obtained a relatively stable locus significantly associated with wheat grain protein content Qgpc.1BL The source of the allele that reduces grain protein content is Yangmai 5, and the QTL peak position is on the long arm of chromosome 1B, corresponding to the marker interval AX-111712993-AX-89694598 (see Appendix Figure 1 , Table 1), LOD values ​​and phenotypic contribution rates are shown in Table 1.

[0050] Table 1 Qgpc.1BL Genetic effects on wheat grain protein content

[0051]

[0052] like Figure 1 As shown, the present application detected a locus significantly associated with wheat grain protein content through QTL mapping Qgpc.1BLThe source of the allele variation that reduces grain protein content is Yangmai 5. The QTL peak position is within the range of 46.58 cM-47.02 cM on the long arm of chromosome 1B. The corresponding marker intervals in the two-year environment are AX-111712993-AX-89694598. After comparison, it was found that the related loci of wheat grain protein content reported by previous researchers were inconsistent, and no loci of other wheat traits related to grain protein content have been reported near this physical location (the known molecular marker Glu-B3g corresponding to the low molecular weight glutenin subunit was located at 1.89 cM of this linkage group in this study). Therefore, it is inferred that Qgpc.1BL The locus is a new locus significantly associated with grain protein content. Further, based on the 660K SNP chip data of wheat parents, resequencing data and 55K SNP chip data of the population, markers were gradually encrypted from the target QTL interval and SNP markers linked to the locus were screened. The SNP markers with high specificity and the highest correlation with wheat grain protein content in the interval were selected for KASP marker conversion. It was determined that the AX-111712993 marker at 528869117bp had the best specificity, and its flanking sequence was SEQ ID NO.4. KASP primers were designed using Primer 3.0 (https: / / bioinfo.ut.ee / primer3-0.4.0 / ), and the primers were synthesized by Beijing Jiacheng Biotechnology Co., Ltd. Finally, the AX-111712993 marker was successfully converted into the KASP marker KASP-Qgpc.1BL according to the flanking sequence. The corresponding mutation site base is T / A, that is, the nucleotide sequence 5-'CATCTCCCTGGTTTATCCTCCTGAGCCGTTATGTAGTTTATTCCAAACTATCATRTTCGTTCTATTTGGACATTTTTCCCCCGCTAGTTTGGTTATAAAGCTAACAGTGTACAGGGACAGGGAAGATGTGCTAGGGTT–3' (SEQ ID NO.4), the 55th base R is the SNP site, which is [T / A]; "[T / A]" indicates the two polymorphic single nucleotides T or A of the SNP marker, that is, the base at this position in the actual wheat material is T or A. With respect to the breeding goal of weak-gluten wheat, the low grain protein content is the dominant allele variation. Yangmai No. 5 carries the dominant allele variation T. The grain protein content of wheat carrying allele T is lower than that of wheat containing allele A.

[0053] In this embodiment, a KASP-Qgpc.1BL primer set is designed for the SNP site, including an upstream primer 1: 5'-GAAGGTGACCAAGTTCATGCTTGTAGTTTATTCCAAACTATCATA-3', whose nucleotide sequence is shown in SEQ ID NO.1, and an upstream primer 2: 5'-GAAGGTCGGAGTCAACGGATTTGTAGTTTATTCCAAACTATCATT-3', whose nucleotide sequence is shown in SEQ ID NO.2. A common downstream primer 5'-AACCCTAGCACATCTTCCCTGTC-3' shown in SEQ ID NO.3, wherein the downstream primer ensures the 1B chromosome specificity of PCR amplification, and the 3' end of the upstream primer is the allelic variant base T / A of marker AX-111712993.

[0054] Preparation of KASP labeled primer working solution:

[0055] Take 12 μL (100 μM) of each upstream primer (nucleotide sequence as shown in SEQ ID NO.1 and SEQ ID NO.2) and 30 μL (100 μM) of downstream primer (nucleotide sequence as shown in SEQ ID NO.3), add sterile ultrapure water to 100 μL, mix thoroughly, and use as KASP-labeled primer working solution for later use.

[0056] PCR amplification reaction system: 2 μL of wheat DNA template to be tested (about 30 ng / μL), 0.08 μL of primer working solution, 2.5 μL of KASP Master Mix (LGC, KBS-1016-002), supplemented to 5 μL with sterile ultrapure water. PCR reaction program: first step, 95℃ pre-denaturation for 15 min; second step, 94℃ denaturation for 20 s, 64–55℃ (1℃ decrease per cycle) for 60 s, a total of 9 cycles; third step, 95℃ denaturation for 20 s, 59℃ renaturation for 1 min, 31 cycles; 4–10℃ storage. The experiment also set up a blank control (NTC) in which no template DNA was added to the reaction system, and one or more blank controls were set up for each plate.

[0057] Wheat seedlings were taken and the genomic DNA of the wheat to be tested was extracted by the CTAB method (reference: Stacey J, IsaacP G. Isolation of DNA from plants. Methods Mol. Biol. 1994, 28: 9–15.). The genomic DNA of the wheat to be tested was used as a template, and the above KASP primer set and PCR reagent were used for PCR amplification to obtain the PCR amplification product. The PCR reaction was carried out on a S1000™ Thermal Cycler PCR instrument (Bio-Rad Laboratories Inc.), and the PCR amplification product was scanned and read with a multifunctional microplate reader (PHERAstar Plus, BMG LABTECH, Germany). The excitation wavelength of FAM was 485 nm and the emission wavelength was 520 nm; the excitation wavelength of VIC was 535 nm and the emission wavelength was 556 nm, and the excitation wavelength of the system reference fluorescence ROX was 575 nm and the emission wavelength was 610 nm. Kluster Caller software (KBioscience) was used for genotyping, and the genotype of the SNP marker AX-111712993 linked to the locus associated with high and low protein content in wheat grains was determined based on the analysis results.

[0058] 143 copies of "Yangmai 5×Yanzhan 1 recombinant inbred lines" were amplified together with the two parents according to the above method. The fluorescence signal data of the amplified products were analyzed by Kluster Caller software and clustered near the X-axis position (blue) in the typing result fluorescence signal coordinate system, which is the same as Yangmai 5, which proves that the genotype of these wheats at the 55th base (SNP site) of the molecular marker AX-111712993 flanking nucleotide sequence (such as SEQ ID NO.4) is T; and the fluorescence signal data of the amplified products were analyzed by Kluster Caller software and clustered near the Y-axis position (red) in the coordinate system, which is different from the typing of Yangmai 5, which proves that the genotype of these wheats at the SNP site is not T. Table 2 is Qgpc.1BL T test results of genotype and phenotype in some RIL populations.

[0059] Table 2 Carrying Qgpc.1BL T test results of grain protein content in RIL families with different genotypes

[0060]

[0061] Table 2 shows the genotypes and phenotypes of 143 RIL families using a two-sample T test in Excel 2019. The results show that the genotype of Yangmai 5 is TT, and the genotype of Yanzhan 1 is AA. In 2018, the protein content of the grains of the families with the genotype of TT was 4.92% lower than that of the families with the genotype of AA, and the t value was 3.03. p<0.01 There was a significant difference in the level. In 2019, the grain protein content of the genotype TT family was 4.56% lower than that of the genotype AA family, and the t value was 3.72. p<0.01 There was a significant difference in the level of protein content. The average value of the two years showed that the grain protein content of the genotype TT family was 4.67% lower than that of the genotype AA family. The t value was 3.87. p<0.01 There was a significant difference in the level of KASP marker KASP-Qgpc.1BL, indicating that the primer set and genotype detection system of the KASP marker KASP-Qgpc.1BL can be applied to molecular marker-assisted breeding of wheat grain protein content. The material typing data was completely consistent with the chip detection data, indicating that the KASP marker was successfully developed and can be further used for breeding material detection.

[0062] Example 2: Verification of the effect of KASP primer set in natural populations

[0063] Field test: In this embodiment, 118 wheat varieties from all over the country were planted in the wheat identification field of the Wantou Experimental Base of the Agricultural Science Institute in Lixiahe District, Jiangsu Province in 2019 and 2020. A randomized block design was adopted, and each variety (line) was planted in 5 rows, 30 grains per row, 2.0m long, and 0.25m apart. The rows were repeated twice, and weeding, disease prevention and insect prevention were carried out according to conventional field management methods. There was no natural disaster during the growth period, and the crops matured normally. In 2020 and 2021, the 5-row area was harvested, threshed and the grain samples were cleaned, and no ear germination occurred. The grain protein content was detected by Perten DA7200 near-infrared instrument according to AACC39-10, and the determination was carried out twice to take the average.

[0064] Genotype detection: The KASP primer set obtained in Example 1 was used to perform genotyping on 118 wheat varieties (lines). The average values ​​of grain protein content measured in 2020 and 2021 and the KASP test results are shown in Table 3 and Appendix. Figure 2As shown. The fluorescence signal data of the amplified products are analyzed by Kluster Caller software and clustered at a position close to the X-axis in the fluorescence signal coordinate system of the typing results (blue), which is the same as Yangmai No. 5, which proves that the genotype of these wheat varieties (lines) at the 55th base (SNP site) of the molecular marker AX-111712993 flanking nucleotide sequence (such as SEQ ID NO. 4) is T; if the fluorescence signal data of the amplified products of the wheat lines are analyzed by Kluster Caller software and clustered at a position close to the Y-axis in the fluorescence signal coordinate system of the typing results (red), which is different from the typing of Yangmai No. 5, it proves that the genotype of these wheat varieties (lines) at the 55th base (SNP site) of the molecular marker AX-111712993 flanking nucleotide sequence (such as SEQ ID NO. 4) is not T, and the sample displayed in black in the lower left corner is the blank control.

[0065] Table 3 Grain protein content and genotype detection results of natural wheat populations

[0066]

[0067] Table 4 Carry Qgpc.1BL T test results of grain protein content of tested varieties with different genotypes

[0068]

[0069] The results in Tables 3 and 4 show that in 2020, the grain protein content of varieties (lines) with genotype TT was 6.06% lower than that of varieties (lines) with genotype AA, and the T test result was t=4.06. p<0.01 There is a very significant difference in the level; in 2021, the grain protein content of varieties (lines) with genotype TT is 8.77% lower than that of varieties (lines) with genotype AA, and the T test result is t=7.35. p< 0.01 There were extremely significant differences in the levels; the average value of the two years showed that the grain protein content of the varieties with genotype TT was 7.46% lower than that of the varieties (lines) with genotype AA, and the T test result was t=6.09. p<0.01 The above analysis showed that the grain protein content of varieties (lines) with genotype TT was significantly lower than that of varieties (lines) with genotype AA. Figure 2This is a schematic diagram of the amplification detection typing results of the KASP marker KASP-Qgpc.1BL in the natural wheat population in Example 2, which shows that the typing results of the material are good, indicating that the primer set and genotype detection system of the above-mentioned KASP marker KASP-Qgpc.1BL can be applied to molecular marker-assisted selection breeding for judging the high and low protein content of wheat grains.

[0070] Example 3 Application of KASP primer set in breeding

[0071] Field test: This example uses 106 lines derived from 6 wheat combinations planted in the yield identification garden of Yangzhou Baytou Experimental Base in 2021 as the research object, adopts a randomized block design, and plants 5 rows per line, 30 grains per row, 2.0m long, 0.25m between rows, and repeated twice. Weeding and disease and insect prevention are carried out according to conventional field management methods. There was no natural disaster during the growth period, and it matured normally. In 2020 and 2021, the grain samples were harvested, threshed, and cleaned according to the 5-row area, and no ear germination occurred. The grain protein content was detected by Perten DA7200 near-infrared instrument according to AACC39-10, and the determination was carried out twice to take the average.

[0072] Genotype detection: The KASP primer set obtained in Example 1 was used to perform genotyping on 106 wheat lines. The average value of grain protein content measured in 2021 and the KASP test results are shown in Table 5 and Appendix. Figure 3 As shown. The fluorescence signal data of the amplified products are clustered on the X-axis after being analyzed by the Kluster Caller software, which is the same as Yangmai No. 5. The fluorescence signal data of the amplified products of the wheat to be tested are displayed in blue, which proves that the genotype of these wheat lines at the molecular marker AX-111712993 is TT; if the fluorescence signal data of the amplified products of the wheat lines are clustered on the Y-axis after being analyzed by the Kluster Caller software, which is different from the typing of Yangmai No. 5, the fluorescence signal data of the amplified products of the wheat to be tested are displayed in red, which proves that the genotype of these wheat lines at the SNP site is AA; if the fluorescence signal data of the amplified products of the wheat to be tested are displayed in green, it proves that the genotype of these wheat lines at the SNP site is TA. Attached Figure 3 It shows that the material typing results are good.

[0073] Table 5 Grain protein content and genotype detection results of 106 wheat lines

[0074]

[0075] Table 6 Carry Qgpc.1BLT test results of grain protein content of tested lines with different genotypes

[0076]

[0077] The results showed that in 2021, the protein content of the grains of the genotype TT was 8.05% lower than that of the genotype AA. The T test result was t=7.21. p<0.01 There were extremely significant differences in the levels. The grain protein content of wheat lines carrying T homozygous was significantly lower than that of homozygous or heterozygous wheat lines carrying A allele variation. The grain protein content of lines carrying TA genotype was between TT and AA genotypes and significantly lower than that of AA genotype (T test result: t=3.17, p =0.001), but further generations of screening of genotypes and phenotypes are needed to obtain lines with a homozygous and stable genotype TT and low grain protein content.

[0078] Attached Figure 3 This is a schematic diagram of the marker amplification detection typing results of the KASP marker KASP-Qgpc.1BL in the wheat breeding generation lines in Example 3, which shows that the material typing results are good, indicating that the primer set and genotype detection system of the above-mentioned KASP marker KASP-Qgpc.1BL can be used in molecular marker-assisted selection breeding for judging the high and low protein content of wheat grains in the breeding generation.

[0079] It can be concluded from the above experimental results that: by using the primer set of the present invention to perform PCR amplification on wheat genomic DNA, it is possible to directly determine whether the wheat carries the allele variation of Yangmai No. 5 that reduces the grain protein content through KASP typing. The detection method is simple to operate, the detection result is very intuitive, and the detection effect is obvious and effective. Using the molecular marker for screening can greatly improve the efficiency of wheat breeding for molecular marker-assisted selection of grain protein content, laying a foundation for wheat quality breeding.

[0080] Unless otherwise specifically stated, the numerical value set forth in these embodiments does not limit the scope of the present invention. In all examples shown and described here, unless otherwise specified, any specific value should be interpreted as merely exemplary, rather than as restriction, and therefore, other examples of exemplary embodiments may have different values. SEQUENCE LISTING <110> Jiangsu Lixiahe Region Agricultural Science Research Institute <120> Molecular marker primer set for detecting protein content in wheat grains and its application <130> 202206 <160> 4 <170> PatentIn version 3.3 <210> 1 <211> 45 <212> DNA <213> Artificial sequence <400> 1 gaaggtgacc aagttcatgc ttgtagttta ttccaaacta tcata 45 <210> 2 <211> 45 <212> DNA <213> Artificial sequence <400> 2 gaaggtcgga gtcaacggat ttgtagttta ttccaaacta tcatt 45 <210> 3 <211> twenty three <212> DNA <213> Artificial sequence <400> 3 aaccctagca catcttccct gtc 23 <210> 4 <211> 138 <212> DNA <213> Wheat (Triticum aestivum L.) <220> <221> misc_feature <222> (55)..(55) <223> R represents the base is T or A <400> 4 catctccctg gtttatcctc ctgagccgtt atgtagttta ttccaaacta tcatrttcgt 60 tctatttgga catttttccc ccgctagttt ggttataaag ctaacagtgt acagggacag 120 ggaagatgtg ctagggtt 138

Claims

1. A substance related to a molecular marker for detecting the protein content of wheat grains, It is characterized in that The substance is a set of primers for detecting that the 55th deoxyribonucleotide of the gene fragment shown in SEQ ID No.4 on the long arm of chromosome 1B in the wheat genome is TT, AA or TA, or a reagent or a kit containing the set of primers, the set of primers consisting of the following primers: (1) an upstream primer: a single-stranded DNA molecule shown in SEQ ID No.1 at positions 22 to 45 or a single-stranded DNA molecule shown in SEQ ID No.1 at positions 22 to 45 connected to a fluorescent label sequence FAM at the 5' end; (2) an upstream primer: a single-stranded DNA molecule shown in SEQ ID No.2 at positions 22 to 45 or a single-stranded DNA molecule shown in SEQ ID No.2 at positions 22 to 45 connected to a fluorescent label sequence HEX at the 5' end; and (3) a downstream primer: a single-stranded DNA molecule of SEQ ID No.

3.

2. The substance according to claim 1, It is characterized in that The upstream primer is designed according to the upstream sequence of the 55th deoxyribonucleotide of the gene fragment shown in SEQ ID No. 4 on chromosome 1B in the wheat genome, and the 3' terminal deoxyribonucleotide of one of the upstream primers is T, and the 3' terminal deoxyribonucleotide of the other upstream primer is A; The downstream primer is designed according to the 55th deoxyribonucleotide of the gene fragment shown in SEQ ID No. 4 on chromosome 1B in the wheat genome and its downstream sequence.

3. Use of the substance according to claim 1 or 2 in any of the following: (A) Identify or assist in identifying the high or low protein content of wheat grains; (B) Comparing the protein content of the wheat grains to be tested; (C) breeding or selecting wheat plants, lines, strains or varieties with relatively high grain protein content; (D) Breeding or selecting wheat plants, strains, lines or varieties with relatively low grain protein content; (E) preparing a product for identifying or assisting in identifying or comparing the protein content of wheat grains to be tested; (F) preparing a product for breeding or screening wheat plants, lines, strains or varieties with relatively low grain protein content; (G) preparing a product for breeding or screening wheat plants, lines, strains or varieties with relatively high grain protein content.

4. The use according to claim 3, It is characterized in that The product is a detection reagent or a detection kit.

5. Any of the following methods: Method A: A method for detecting whether the 55th deoxyribonucleotide of the gene fragment shown in SEQ ID No. 4 on chromosome 1B in the wheat genome is TT, AA or TA, comprising the following steps (A1) or (A2): (A1) Direct sequencing; (A2) using the substance of claim 1 or 2 to perform PCR amplification on the wheat genomic DNA to be tested, performing fluorescence signal scanning on the amplified product, analyzing the scanning data, and then determining whether the 55th deoxyribonucleotide of the gene fragment shown by SEQ ID No. 4 on chromosome 1B in the wheat gene to be tested is T or A according to the following method: If the fluorescent signal data of the amplified product of the wheat to be tested is displayed in blue, the 55th deoxyribonucleotide of the gene fragment shown by SEQ ID No. 4 on chromosome 1B in the genome of the wheat to be tested is a homozygous T; If the fluorescent signal data of the amplified product of the wheat to be tested is displayed as red, the 55th deoxyribonucleotide of the gene fragment shown by SEQ ID No. 4 on chromosome 1B in the genome of the wheat to be tested is a homozygous A; If the fluorescent signal data of the amplified product of the wheat to be tested is displayed as green, the 55th deoxyribonucleotide of the gene fragment shown in SEQ ID No.4 on chromosome 1B in the wheat genome to be tested is a hybrid of T and A; Method B: A method for comparing the protein content of wheat grains to be tested, comprising the following steps: (B1) detecting whether the 55th deoxyribonucleotide of the gene fragment shown by SEQ ID No. 4 on chromosome 1B in the wheat genome is TT, AA or TA; (B2) determining the protein content of the wheat grains to be tested as follows: if the 55th deoxyribonucleotide of the gene fragment shown by SEQ ID No. 4 on chromosome 1B in the genome is a homozygous form of T, then the protein content of the wheat grains to be tested is lower than that of the wheat grains to be tested if the 55th deoxyribonucleotide of the gene fragment shown by SEQ ID No. 4 on chromosome 1B in the genome is a homozygous form of A or a heterozygous form of A and T; Method C: A method for breeding or screening wheat plants or lines or strains or varieties with relatively low grain protein content, comprising the following steps: (C1) detecting whether the 55th deoxyribonucleotide of the gene fragment shown by SEQ ID No. 4 on chromosome 1B in the wheat genome is TT, AA, or T and A; (C2) selecting a test wheat plant in which the 55th deoxyribonucleotide of the gene fragment shown in SEQ ID No. 4 on chromosome 1B of the genome is homozygous for T as a parent for breeding, and selecting wheat plants in which the 55th deoxyribonucleotide of the gene fragment shown in SEQ ID No. 4 on chromosome 1B of the genome is homozygous for T in each breeding generation, and finally obtaining wheat plants, strains, lines or varieties with relatively low grain protein content; Method D: A method for breeding or screening wheat plants or lines or strains or varieties with relatively high grain protein content, comprising the following steps: (D1) detecting whether the 55th deoxyribonucleotide of the gene fragment shown in SEQ ID No. 4 on chromosome 1B in the wheat genome is AA, TT, or A and T; (D2) selecting a wheat plant to be tested in which the 55th deoxyribonucleotide of the gene fragment shown in SEQ ID No. 4 on chromosome 1B of the genome is homozygous for A as a parent for breeding, and selecting wheat plants in which the 55th deoxyribonucleotide of the gene fragment shown in SEQ ID No. 4 on chromosome 1B of the genome is homozygous for A in each breeding generation, and finally obtaining wheat plants, strains, lines or varieties with relatively high grain protein content.

6. The method according to claim 5, Features: In the method B, the method C and the method D, the method for detecting whether the 55th deoxyribonucleotide of the gene fragment shown in SEQ ID No. 4 on chromosome 1B in the wheat genome is TT or AA, or T and A is the method A.

Images