Methods for determining the presence of intestinal parasites

Abstract

The present invention relates to the field of detection of intestinal parasites from patients, food or environmental samples, preferably from fecal samples. In particular, the present invention provides a polymerase chain reaction (PCR) based assay for detecting intestinal parasitic infections, in particular infections with parasitic species selected from the group consisting of: Hymenolepis nana, Hymenolepis diminuta, Fasciolopsis buski, Encephalitozoon spp (such as E. intestinalis, E. cuniculi and E. hellem), Enterocytozoon bieneusi, Enterobius vermicularis, Diphyllobothrium latum, Diphyllobothrium nihonkaiense, Schistosoma mansoni mansoni, Blastocystis hominis, Ancylostoma duodenale and liver worms (such as Clonorchis sinensis, Opisthorchis spp. and Metorchis spp.). The present invention further provides materials for the methods of the present invention, such as primers, primer pairs and probes. Preferably, the methods of the present invention are multiplex real-time fluorescence quantitative PCR assays for rapid determination of clinically important intestinal parasites.

Description

Technical Field

[0001] The present invention relates to the field of detection of intestinal parasites from patients, food or environmental samples, preferably from fecal samples. In particular, the present invention provides an assay based on polymerase chain reaction (PCR) for detecting intestinal parasite infections, in particular infections with parasite species selected from the group consisting of: Hymenolepisnana, Hymenolepis diminuta, Fasciolopsis buski, Encephalitozoon spp (such as E. intestinalis, E. cuniculi and E. hellem), Enterocytozoon bieneusi, Enterobius vermicularis, Diphyllobothrium latum, Diphyllobothrium japonicum, Diphyllobothrium spp. nihonkaiense), Schistosoma mansoni, Blastocystis hominis, Ancylostoma duodenale, and liver worms (such as Clonorchis sinensis, Opisthorchis spp., and Metorchis spp.). The present invention further provides materials for the methods of the present invention, such as primers, primer pairs, and probes. Preferably, the methods of the present invention are multiplex real-time fluorescence quantitative PCR assays for rapid determination of clinically important intestinal parasites. Background Art

[0002] Intestinal parasitic infections are a major health problem worldwide, causing morbidity and mortality, especially infant mortality in developing countries. Intestinal parasitic infections are also a problem reported by travelers and are often caused by contamination of food or water, infected soil, and inadequate hygiene. Intestinal parasitic infections may cause mild symptoms, but severe infections present with abdominal pain, bloody diarrhea, and vomiting. These symptoms negatively impact nutritional status, loss of appetite, weight loss, and intestinal blood loss that often results in anemia.

[0003] At present, there is no uniform standard for the identification of intestinal parasites (Garcia et al., 2018). Currently, the diagnosis of many parasites relies on microscopic examination of stool samples. It is well known that microscopic examination is time-consuming, inefficient, and requires high clinical experience of the examiner. In addition, intestinal parasites may exist in the form of cysts or eggs, which are similar in shape to a variety of parasite species and cannot be distinguished from each other by ordinary optical microscopy. Therefore, existing technical methods often lead to misdiagnosis. Immunodiagnosis has also been used for parasite detection, but although immunodiagnosis is more effective than microscopy, it is often limited by sensitivity and specificity.

[0004] Although many PCR-based assays for detecting intestinal parasite species have been disclosed, there is still a need in the art for further PCR assays that can provide high specificity and reliability for the detection of specific intestinal parasite species, for example in a multiplex assay. The inventors have now located DNA sequence regions in the parasite genome that are unexpectedly well suited to specifically and sensitively amplify markers in specific intestinal parasite species.

[0005] The sample matrix, which is typically stool or food samples in parasite diagnostics, may contain a large amount of PCR inhibitors. This will reduce the amplification efficiency of the PCR reaction, so even more careful optimization is expected from the amplicon design step to verify that all templates and copy numbers are amplified equally and efficiently enough. Therefore, oligonucleotide designs that can achieve high PCR efficiency (ideally as close to 100% as possible) are required. The detection method used may also affect the amplification efficiency and / or bias.

[0006] The inventors have now located DNA sequence regions that are very suitable for specifically and sensitively amplifying and quantifying intestinal parasite species. Amplicons are designed to be so specific that they can be combined with each other into any multiplex set. Of course, the prerequisite is that all disclosed amplicons are also designed to be amplified under the same reaction and circulation conditions. The purpose of the present invention is to replace antigen testing and microscopy as a screening test for intestinal parasites, thereby quickly providing process improvements for laboratories and clinical benefits in improving patient management by providing a rich set of information. In addition, infection control may benefit if clinical microbiology laboratories can easily distinguish intestinal parasite species. Summary of the invention

[0007] The number of intestinal parasites is large, and parasite testing methods should optimally identify as many as possible. Performing one PCR reaction per species can be cumbersome, as the number of samples tested is often large. Multiple species should optimally be tested in one reaction. In a PCR setting, the most obvious alternative is the 'multiplex' PCR amplification. In a multiplex PCR, several oligonucleotide sets are included in the same reaction vessel, each designed to amplify one species / species group, and each oligonucleotide set is used to amplify its respective pathogen DNA during the same PCR reaction. In the present invention, a PCR-based method for rapid detection of clinically important intestinal parasites using Diphyllobothrium latum is described, particularly Hymenolepis nivalis, Hymenolepis diminuta, Fasciola brasiliensis, Intracellular Protozoa (such as Microsporidia enterica, Intracellular Protozoa rabbits and Intracellular Protozoa), Enterospora bicinensis, Enterobacter vermicularis, Diphyllobothrium latum, Diphyllobothrium japonicum, Schistosoma mansoni, Blastocystis hominis, Ancylostoma duodenale and Liver worms (such as Clonorchis sinensis, Opisthorchis and Desorchis) are disclosed. The present invention discloses primers and probes designed for target sequences conserved in the intestinal parasites. These primers and probes are compatible with any multiplex qPCR for determining the presence of a variety of intestinal parasites.

[0008] Multiplex PCR poses a challenge to the quantification (qPCR) of pathogen DNA: different amplicons compete for the same PCR reaction components (e.g., DNA polymerase and MgCl2), which may affect the quantitative nature of the reaction between samples, and especially the quantitative comparison between samples. It is well known in the art that there is a bias in amplification efficiency between different template amounts or lengths, so that, for example, short amplicons are favored at the expense of longer amplicons.

[0009] At the same time, undesired cross-reactions of the multiplex pool oligonucleotide combinations must be avoided. One must also remember to check for mispriming to any other sequences present in the sample.

[0010] Finding appropriate primer and probe sequences for detecting multiple pathogenic microorganisms is far from easy, especially when designing a multiplex setup where all amplicons and templates should be amplified with equal efficiency. Many species are relatively closely related, making it challenging to locate sequences unique to each species. Some genes have complex, repetitive, closely related elements, which is challenging from an amplicon design perspective, especially when designing amplicons for multiplex PCR.

[0011] The sample matrix, which is usually stool or food samples in intestinal parasite diagnosis, may contain a large amount of PCR inhibitors. This will reduce the amplification efficiency of the PCR reaction, so even more careful optimization is expected by the amplicon design step to verify that all templates and copy numbers are amplified equally and efficiently enough. Therefore, oligonucleotide designs that can achieve high PCR efficiency (preferably as close to 100% as possible) are required. The detection method used may also affect the amplification efficiency and / or bias.

[0012] In one aspect, the present invention relates to a method for determining the presence of one or more intestinal parasites in a biological sample, comprising the following steps:

[0013] i) contacting the sample or nucleic acid isolated from the sample with oligonucleotide primers in an amplification assay to provide a reaction mixture for nucleic acid amplification;

[0014] ii) performing a nucleic acid amplification reaction using the reaction mixture obtained in step i) comprising the DNA from the biological sample as a template, so that as long as the target sequence of the one or more intestinal parasites is present in the sample, the sequence is specifically amplified; and

[0015] iii) detecting the presence of the amplified target sequence in the reaction mixture, wherein the presence of the target sequence indicates the presence of an intestinal parasite in the sample;

[0016] wherein the one or more intestinal parasites are selected from the group consisting of: Hymenolepis nivalis, Hymenolepis diminuta, Fasciola brasiliensis, Encephalic protozoa (such as Encephalicis enterica, Encephalicis rabbidus and Encephalicis cerebri), Enterospora biei, Enterobius vermicularis, Diphyllobothrium latum, Diphyllobothrium japonicum, Schistosoma mansoni, Blastocystis hominis, Ancylostoma duodenale and liver worms such as Clonorchis sinensis, Opisthorchis spp. and Pararchis spp.;

[0017] wherein the target sequence is selected from the group consisting of sequences as defined by SEQ ID No: 1-16 and 46-47, wherein the oligonucleotide primers comprise a primer pair that binds to one of the target sequences as defined by SEQ ID No: 1-16 and 46-47 and allows amplification of at least part of the target sequence in step ii). BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1. Amplification curves of PCR reactions using primers from H. brachyura and H. diminuta.

[0019] Figure 2. Amplification curve of PCR reaction using primers of Fasciola brucei.

[0020] Figure 3. Amplification curves of PCR reactions using primers for A. intracellular parasites of rabbits and B. enteric encephalitis.

[0021] Figure 4. Amplification curves of PCR reactions using primers for A. E. cerebralis and B. enterospora.

[0022] Figure 5. Amplification curves of PCR reactions using primers from A. vermicularis and B. Diphyllobothrium spp.

[0023] Fig. 6. Amplification curves of PCR reactions using primers of A. Diphyllobothrium japonicum and B. Diphyllobothrium klebanovskii.

[0024] Figure 7. Amplification curves of PCR reactions using primers for A. mansoni and B. hominis.

[0025] Figure 8. Amplification curves of PCR reactions using primers of the liver worms Clonorchis sinensis, Opisthorchis and Mesorchis.

[0026] Figure 9. Preferred PCR protocols of the present invention. DETAILED DESCRIPTION

[0027] The present invention provides a method for detecting intestinal parasites based on nucleic acid amplification, wherein the intestinal parasites are particularly selected from one or more intestinal parasites of the group consisting of: short tapeworm, reduced tapeworm, Fasciola brasiliensis, brain intracellular protozoa (such as enteric encephalitis microsporidia, rabbit brain intracellular protozoa and brain cell protozoa), enterosporidium bii, Enterobius vermicularis, Diphyllobothrium latum, Diphyllobothrium japonicum, Schistosoma mansoni, Blastocystis hominis, duodenal hookworm and liver worms (such as Clonorchis sinensis, Opisthorchis and Desorchis). The present invention further provides materials for the method of the present invention, such as primers, primer pairs (i.e., a pair of forward primers and reverse primers) and probes. Specifically, the present invention provides a method for determining the presence of intestinal parasites in a biological sample, comprising the following steps: i) contacting a sample or a nucleic acid separated from the sample with an oligonucleotide primer in an amplification assay to provide a reaction mixture for nucleic acid amplification;

[0028] ii) performing a nucleic acid amplification reaction using the reaction mixture obtained in step i) comprising the DNA from the biological sample as a template, so that as long as the target sequence of the one or more intestinal parasites is present in the sample, the sequence is specifically amplified; and

[0029] iii) detecting the presence of the amplified target sequence in the reaction mixture, wherein the presence of the target sequence indicates the presence of an intestinal parasite in the sample;

[0030] wherein the target sequence is selected from the group consisting of sequences as defined by SEQ ID No: 1-16 and 46-47, wherein the oligonucleotide primers comprise a primer pair that binds to one of the target sequences as defined by SEQ ID No: 1-16 and 46-47 and allows amplification of at least part of the target sequence in step ii).

[0031] The biological sample may be a stool sample, a food sample (eg a meat sample) or any environmental sample. The sample may be enriched prior to step i).

[0032] Preferably, the nucleic acid amplification reaction is a polymerase chain reaction (PCR). As is well known in the art, PCR is a method in which a limited fragment of a nucleic acid molecule (i.e., a target sequence) is repeatedly amplified to produce a large number of DNA molecules consisting only of the fragment. The program relies on a large number of guides and transcription cycles. In each cycle, two oligonucleotide primers (i.e., a forward primer and a reverse primer) bind to the fragment and define the boundaries of the fragment. Then, a primer-dependent DNA polymerase transcribes or replicates the chain bound to the primer. The PCR product produced is called an amplicon. In a specific embodiment, the method disclosed herein includes the step of PCR amplification of a portion of an intestinal parasite genome.

[0033] "Target sequence" as defined herein is a nucleic acid fragment present in the genome of an intestinal parasite, which is intended to detect, quantitatively, qualitatively or by a combination thereof. For example, a target sequence is a specific nucleic acid in the genome of an intestinal parasite, which is intended to amplify. If desired, purification or separation of the template molecule for initiating an amplification reaction can be performed by methods known to those skilled in the art. For example, separation of the template can be achieved by using a commercially available purification kit, etc.

[0034] Preferred target sequences (or amplicons) for amplification in the target organism are listed in Table 1. However, the skilled person will appreciate that these target sequences vary naturally among related strains. Such minor variations can be taken into account when designing primers suitable for amplifying the amplicons in the method of the invention. Preferably, a sequence of at least 20, 25, 30, 35, 40, 50, 60, 70, 80, 90 100 or 125 nucleotides in length of each of the target sequences selected from the group consisting of SEQ ID NOs: 1-16 and 46-47 is amplified in the method.

[0035] Table 1. Target sequences amplified in target organisms (5'->3'). Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood to be included in any reference to the strand shown.

[0036] Hymenolepis cox1

[0037] AATTCCTGATGCTTTTGGGTTTTATGGTTTATTATTTGCTATGTTTTCTATAGTGTGCTTAGGTTGTAGTGTGTGGGCTCATATGTTTACTGTTGGTTTGGATGTTAAGACGGCTGTATTTT(SEQ ID NO:1)

[0038] Hymenolepis cox1, v2

[0039] AATTCCTGATGCTTTTGGGTTTTATGGGCTCTTGTTTGCCATGTTTTCTATTGTTTGTTTAGGTAGAAGTGTTTGAGGGCATATGTTTACTGTTGGTTTAGATGTAAAGACGGCAGTGTTCT (SEQ ID NO: 2)

[0040] Fasciola brasiliensis ITS1

[0041] CACTGTTCAAGTGGTATTGATTGGGTTCGCCCATTCTTTGCCATTGCCCTCGCATGCACCTGGTCCTTGTGGCCGGACTGCACGTACGTCGCCCGGCGGTGCCTATCCCGGGTAGGACTGATAACCTGG (SEQ ID NO: 3)

[0042] Brain protozoa 18S

[0043] GACGAAGATCGGAAGGTCTGAGTCCTGAGTGTTAGATAAGATATAAGTCGTAACATGGCTGCTGTTGGAGAACCAGCAGCAGGATCAGTATGTTGTTGTGTTTTGATGGATGTTTGTTTGTTTGTTTGGTGGTTTCTCTGTTCACGGGATTGATTGGCATTAGCG (SEQ ID NO: 4)

[0044] Brain protozoa 18S v2

[0045] GACGAAGATTGGAAGGTCTGAGTCCTTCGTGTTAGATAAGATATAAGTCGTAACGCGGCTGCTGTTGGAGAACCAGCAGCAGGATCAGTATTTGAGAGATTGGGGGGAATTTTTTTGATTTGAGGATCCACGGGATTGATAGGCATTAGCA(SEQ ID NO:5)

[0046] Brain protozoa 18S v3

[0047] GACGAAGATTGAGAGGTCTGAGTCTTTCGTGTTAGATAAGATATAAGTCGTAACATGGCTGCTGTTGGAGAACCAGCAGCAGGATCAGTATGTTGATTTGATTGATTTGTGGGGATTTTTAGTTTTTTAGTTTTTCTTTCTCTATCCATGGGATTGATTGGCATTATCT(SEQ ID NO:6)

[0048] Enterospora bicinata 18S

[0049] GAGTGTAGTATAGACTGGCGAAGAATGAAATCTCAAGACCCAGTTTGGACTAACGGAGGCGAAGGCGACACTCTTAGACGTATCTTAGGATCAAGGACGA(SEQ ID NO:7)

[0050] Enterobius vermicularis ITS

[0051] GCAGAGCTTTTCCAAAATTTATTTCCAAGCCACAGACTCACTGATGTTCATGTCTGAGCCGGAACGAGAAATTACCTCAAACTTGGG(SEQ ID NO:8)

[0052] Diphyllobothrium latifolium / Diphyllobothrium japanense cox1

[0053] CCAGTTATTACAGGTGTGAGATTGAATAAGTATTTATTACAATGTCATTGTATAGTTTCTAATGTTGGTTTCAATTTATGTTTTTTCCCTATGCATTACTTTGGTGTGTGCGGTTTACCACGTCGTGTGTGTGTGTACGAGTCGGGTTATGCTTGA(SEQ ID NO:9)

[0054] Diphyllobothrium latifolium / Diphyllobothrium japanense cox1 v2

[0055] CCAGTTATTACTGGTGTAAGATTGAATAAGTATTTACTACAATGTCATTGTATAGTTTCTAATGTTGGTTTCAATTTATGTTTTTTTCCCATGCATTATTTTGGTGTGTGCGGTTTACCACGTCGTGTGTGCGTATATGAGTCAGGTTATGCTTGA(SEQ ID NO:10)

[0056] Diphyllobothrium latifolium / Diphyllobothrium japanense cox1 v3

[0057] CCAGTTATTACTGGTGTAAGATTGAATAAGTATTTACTACAATGTCATTGTATAGTTTCTAATGTTGGTTTCAATTTATGTTTTTTTCCTATGCATTATTTTGGTGTGTGCGGTTTACCACGTCGTGTGTGTGTATATGAGTCAGGTTATGCTTGA(SEQ ID NO:11)

[0058] Diphyllobothrium latifolium / Diphyllobothrium japanense cox1 v4

[0059] CCAGTTATTACTGGTGTGAGATTGAATAAGTATTTACTACAATGTCATTGTATAGTTTCTAATGTTGGTTTCAATTTATGTTTTTTTCCTATGCATTATTTTGGTGTGTGCGGTTTACCACGTCGTGTGTGCGTATATGAGTCAGGTTATGCTTGA(SEQ ID NO:12)

[0060] Schistosoma mansoni cox1

[0061] AGGTGTTTTCATGACTTTATATGTTGAATAGTTGCGGTATGCGGGTTTTAGATCCCATAGTATGGTGATTAGTCGGTTTTATATTTTTATTTACGGTTGGTGGTGTCACAGGGGTGGCTTTATCTGCATCTGCT(SEQ ID NO:13)

[0062] Blastocystis hominis 18S

[0063] TCAGCTTTCGATGGTAGTGTATTGGACTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTTCGATTTCGGAGAGGGAGCC(SEQ ID NO:14)

[0064] Blastocystis hominis 18S v2

[0065] TCAGCTTTCGATGGTAGTATATGGGCCTACCATGGCAGTAACGGGTAACGAAGAATTTGGGTTCGATTTCGGAGAGGGAGCC(SEQ ID NO:15)

[0066] Clonorchis / Metorchis / Metorchis 18S

[0067] AGCTCGTAGTTGGATCTGGGTCGCATGGCTACATGCCGTTGCTCGTATTCCTGGCCTGGTTCACACCGGGACGGGTTTGTGAGTCGGTGTCGTGG(SEQ ID NO:16)

[0068] Ancylostoma duodenale ITS_gB_1

[0069] CCCATGAGACATACAAAAAGGTAATGCCGCCGTCTGGTTCAGGGTTGTTTATATCTACTACAGTGTAGCTTGTGGCACTGTTTGTCGAACGGCACTTGCTTTTAGCGATTCCCGTTCTAGATCAGAATATATTGCAACATGTACGTTAGCTGGCTAGTTTGCTAACGTGCGCTGAATGACAGCAAACTCGTTGTTGCTGCTGAATCGTTCACCGACTTTAGAACGTTTCGGGTCTCGACTATACGCCCGTTTTCGGATC(SEQ ID NO:46)

[0070] Ancylostoma duodenale ITS_gB_2

[0071] CCCATGAGACATACAAAAAGGTAATGCCGCCTATATCTACTACAGTGCAGCTTGTGGCACTGTTTGTCGAACGGCACTTGCTTTTAGCGATTCCCGTTCTAGATCAGAATATATTGCAACATGTACGTTGGCTGGCTAGTTTGCTAACGTGCGCTGAATGACAGCAAACTCGTTGTTGCTGCTGAATCGTTTACCGACTTTAGAACGTTTCGGGTCTCGACTATACGCCCGTTTTCGGATC(SEQ ID NO:47)

[0072] Primer pairs preferably used for amplifying target sequences in the method of the present invention are listed in Table 2.

[0073] Table 2. Examples of primer sequences (5′->3′) used to amplify the target sequences listed in Table 1.

[0074] Primer pair A), Hymenolepithecus cox1

[0075] Forward primer: AATTCCTGATGCTTTTGGGTTTTATG (SEQ ID NO: 17)

[0076] Reverse primer: AGAACACTGCCGTCTTTACATCTAA (SEQ ID NO: 18)

[0077] Primer pair B), Hymenolepithecus cox1, v2

[0078] Forward primer: AATTCCTGATGCTTTTGGGTTTTATG (SEQ ID NO: 17)

[0079] Reverse primer: AAATACAGCCGTCTTAACATCCAA (SEQ ID NO: 19)

[0080] Primer pair C), Fasciola buciliensis ITS1

[0081] Forward primer: CACTGTTCAAGTGGTATTGATTG (SEQ ID NO: 20)

[0082] Reverse primer: CCAGGTTATCAGTCCTACCC (SEQ ID NO: 21)

[0083] Primer pair D), Intracellular Protozoa 18S

[0084] Forward primer: CTGAGTCCTGAGTGTTAGATAAGA (SEQ ID NO: 22)

[0085] Reverse primer: CTAATGCCAATCAATCCCGTG (SEQ ID NO: 23)

[0086] Primer pair E), Intracellulare 18S v2

[0087] Forward primer: GTCCTTCGTGTTAGATAAGATATAAGTC (SEQ ID NO: 24)

[0088] Reverse primer: AGATAATGCCAATCAATCCCATG (SEQ ID NO: 25)

[0089] Primer pair F), Intracellulare 18S v3

[0090] Forward primer: GACGAAGATTGAGAGGTCTGA (SEQ ID NO: 26)

[0091] Reverse primer: CTAATGCCTATCAATCCCGTG (SEQ ID NO: 27)

[0092] Primer pair G), Enterospora bicinata 18S

[0093] Forward primer: GAGTGTAGTATAGACTGGCGAA (SEQ ID NO: 28)

[0094] Reverse primer: TCGTCCTTGATCCTAAGATACG (SEQ ID NO: 29)

[0095] Primer pair H), Enterobius vermicularis ITS

[0096] Forward primer: GCAGAGCTTTCCAAAATTTATTTCC (SEQ ID NO: 30)

[0097] Reverse primer: CCCAAGTTTGAGGGTAATTTCTCG (SEQ ID NO: 31)

[0098] Primer pair 1), Diphyllobothrium latum / Diphyllobothrium japanense cox1

[0099] Forward primer: CCAGTTATTACTGGTGTAAGATTGAA (SEQ ID NO: 32)

[0100] Reverse primer: TCAAGCATAACCTGACTCATATAC (SEQ ID NO: 33)

[0101] Primer pair J), Diphyllobothrium latum / Diphyllobothrium japanense cox1 v2

[0102] Forward primer: CCAGTTATTACTGGTGTAAGATTGAA (SEQ ID NO: 34)

[0103] Reverse primer: TCAAGCATAACCTGACTCATATAC (SEQ ID NO: 35)

[0104] Primer pair K), Diphyllobothrium latum / Diphyllobothrium japanense cox1 v3

[0105] Forward primer: CCAGTTATTACAGGTGTGAGATTG (SEQ ID NO: 36)

[0106] Reverse primer: CAAGCATAACCCGACTCGTA (SEQ ID NO: 37)

[0107] Primer pair L), Diphyllobothrium latum / Diphyllobothrium japanense cox1 v4

[0108] Forward primer: CCAGTTATTACAGGTGTGAGATTG (SEQ ID NO: 36)

[0109] Reverse primer: CAAGCATAACCCGACTCGTA (SEQ ID NO: 37)

[0110] Primer pair M), Schistosoma mansoni cox1

[0111] Forward primer: AGGTGTTTTCATGACTTTATATGTTGA (SEQ ID NO: 38)

[0112] Reverse primer: AGCAGATGCAGATAAAGCCA (SEQ ID NO: 39)

[0113] Primer pair N), Blastocystis hominis 18S

[0114] Forward primer: CAGCTTTCGATGGTAGTGTATTG (SEQ ID NO: 40)

[0115] Reverse primer: GGCTCCCTCTCCGAAATC (SEQ ID NO: 41)

[0116] Primer pair (2), Blastocystis hominis 18S v2

[0117] Forward primer: TCAGCTTTCGATGGTAGTATATGG (SEQ ID NO: 42)

[0118] Reverse primer: GGCTCCCTCTCCGAAATC (SEQ ID NO: 43)

[0119] Primer pair P), Clonorchis sinensis / Opisthorchis / Mesorchis 18S

[0120] Forward primer: AGCTCGTAGTTGGATCTGG (SEQ ID NO: 44)

[0121] Reverse primer: CCACCAATCATGCTAACACC (SEQ ID NO: 45)

[0122] Primer pair Q), Ancylostoma duodenale ITS.3.1

[0123] Forward primer: CAGTGTAGCTTGTGGCAC (SEQ ID NO: 48)

[0124] Reverse primer: CAGCTAACGTACATGTTGCAATA (SEQ ID NO: 49)

[0125] Primer pair R), Ancylostoma duodenale ITS.3.2

[0126] Forward primer: ACAGTGCAGCTTGTGTGGCA (SEQ ID NO: 50)

[0127] Reverse primer: CAGCCAACGTACATGTTGCAATA (SEQ ID NO: 51)

[0128] The method of the present invention is characterized in that the presence of the amplified target sequence (i.e., product) of each primer pair in the PCR reaction of step iv) indicates the presence of intestinal parasites in the sample in the following manner:

[0129] - the product of primer pair A) or B) indicates the presence of Hymenolepis brevis or Hymenolepis diminuta;

[0130] - The product of primer pair C) indicates the presence of Fasciola buxi;

[0131] - the product of primer pair D), E) or F) indicates the presence of enteric encephalitis microsporidia, rabbit brain intracellular protozoa and brain intracellular protozoa;

[0132] - The product of primer pair G) indicates the presence of Enterospora bicinata;

[0133] - The product of primer pair F) indicates the presence of Enterobius vermicularis;

[0134] - the product of primer pair I), J), K) or L) indicates the presence of Diphyllobothrium latum or Diphyllobothrium japonicum;

[0135] - the product of primer pair M) indicates the presence of Schistosoma mansoni;

[0136] - the product of primer pair N) or O) indicates the presence of Blastocystis hominis;

[0137] - the product of primer pair P) indicates the presence of liver worms, such as Clonorchis sinensis, Metaptera spp. and Methoceras spp.; and

[0138] - The product of primer pair Q) or R) indicates the presence of Ancylostoma duodenale.

[0139] Preferably, each primer in the primer pair is less than 25, 30, 35, 40, 45, 50 or 55 nucleotides in length, and more preferably less than 50 nucleotides in length. Each of the primers of the present invention may also be defined as comprising or consisting of at least 10, 15, 16, 17 or 18 consecutive nucleotides present in at least one primer sequence selected from the group consisting of SEQ ID NOs: 17-45 and 48-51. Each of the primers of the present invention may be further defined as having at least 80%, 85% or 90% sequence identity with at least one primer sequence selected from the group consisting of SEQ ID NOs: 17-45 and 48-51.

[0140] A particular embodiment of the invention is to carry out the method as a real-time polymerase chain reaction and in this case a nucleic acid probe comprising or consisting of the following sequence is used in particular together with each of the primer pairs A) to T) in the following manner:

[0141] - Primer pair A) Probe:

[0142] 5'-AGTGTGCTTAGGTTGTAGTGTGTGGGCTCATC-3'(SEQ ID NO:52)

[0143] - Primer pair B) probe:

[0144] 5'-TGTTTTGCCATGTTTTCTATTGTTTGTTTAGG-3'(SEQ ID NO:53)

[0145] - Primer pair C) probe:

[0146] 5'-TTCGCCCATTCTTTGCCATTGCCC-3'(SEQ ID NO:54)

[0147] - Primer pair D) probe:

[0148] 5'-CTGATCCTGCTGCTGGTTCTCCAACAG-3'(SEQ ID NO:55)

[0149] - Primer pair E) probe:

[0150] 5'-ATGATCCTGCTAATGGTTCTCCAACAGCA-3'(SEQ ID NO:56)

[0151] - Primer pair F) probe:

[0152] 5'-ATGATCCTGCTAATGGTTCTCCAACAGCA-3'(SEQ ID NO:57)

[0153] - Primer pair G) probe:

[0154] 5'-AGTGTCGCCTTCGCCTCCGTTAG-3'(SEQ ID NO:58)

[0155] - Primer pair (P) probe:

[0156] 5'-TCCGGCTCAGACATGAACATCAGTGAGTCT-3'(SEQ ID NO:59)

[0157] - Primer pair 1) probe:

[0158] 5'-ACACGACGTGGTAAACCGCACACA-3'(SEQ ID NO:60)

[0159] - Primer pair J) probe:

[0160] 5'-ACACGACGTGGTAAACCGCACACA-3'(SEQ ID NO:61)

[0161] - Primer pair K) probe:

[0162] 5'-ACACGACGTGGTAAACCGCACACA-3'(SEQ ID NO:62)

[0163] - Primer pair L) probe:

[0164] 5'-ACACGACGTGGTAAACCGCACACA-3'(SEQ ID NO:63)

[0165] - Primer pair M) probe:

[0166] 5'-CCCCTGTGACACCACCAACCGT-3'(SEQ ID NO:64)

[0167] - Primer pair N) probe:

[0168] 5'-AAATTCTTCGTTACCCGTTACTGCCATGGT-3'(SEQ ID NO:65)

[0169] - Primer pair (2) probe:

[0170] 5'-AAATTCTTCGTTACCCGTTACTGCCATGGT-3'(SEQ ID NO:66)

[0171] - Primer pair P) probe:

[0172] 5'-TTGCTCGTATTCCTGGCCTGGTTCA-3'(SEQ ID NO:67)

[0173] The melting temperature Tm of some probes (e.g., probes of primer pairs G), H), K) and L) is preferably increased by at least 5°C by adding modified nucleotides. The number of modified nucleotides in one probe is 1, 2, 3 or preferably 4. The underlined nucleotides in the above table are modified nucleotides, each of which increases the Tm of the probe. The modified nucleotides can be LNA nucleotides (Exiqon A / S), minor groove binders (MGB TM ), superbases or peptide nucleic acids (PNA) or any other modification that increases the Tm of the probe.

[0174] Preferably, the above probes comprise a defined sequence and are less than 25, 30, 35, 40, 45, 50 or 55 nucleotides in length, and more preferably less than 50 nucleotides in length. Each of the probes of the present invention may also be defined as comprising or consisting of at least 10 or 15, 16, 17 or 18 consecutive nucleotides present in a probe sequence selected from the group consisting of SEQ ID NOs: 52-67 or their complements.

[0175] The probe preferably includes a detectable label, such as a fluorophore. An embodiment of a fluorophore is fluorescein and its derivatives, such as 6-carboxyfluorescein (FAM) and fluorescein isothiocyanate (FITC). Depending on the specific structure of the probe, the detectable label can produce a signal in the presence of a target amplifier, or cause a signal to weaken in the presence of a target amplifier.

[0176] The method of the present invention is based on the multiplex PCR technology for simultaneously analyzing nucleic acids of many templates from a sample, ie, the multiplex PCR reaction includes a set of primer pairs capable of simultaneously amplifying multiple target sequences.

[0177] In another embodiment, the present invention provides a nucleotide probe comprising or consisting of any probe sequence as defined above.

[0178] The present invention preferably relates to a method for determining the presence of intestinal parasites in a sample, wherein the presence of at least one of the following pathogens is detected: Hymenolepis shortissima, Hymenolepis diminuta, Fasciola brasiliensis, Intracellular protozoa (such as Enteroencephalitis microsporidia, Intracellular protozoa rabbits and Intracellular protozoa), Enterospora biei, Enterobius vermicularis, Diphyllobothrium latum, Diphyllobothrium japonicum, Schistosoma mansoni, Blastocystis hominis, Ancylostoma duodenale and Liver worms (such as Clonorchis sinensis, Opisthorchis and Desorchis). In a preferred embodiment, the presence of any combination of the intestinal parasites listed above is detected. Therefore, each combination of 2, 3, 4, 5, 6, 7, 8 or more of the intestinal parasites is a preferred embodiment of the present invention.

[0179] In a preferred embodiment, the presence of at least Hymenolepis shortissima and Hymenolepis diminuta is detected in the method, wherein the target sequence is at least as defined by SEQ ID NOs: 1 and 2. More preferably, the set of primer pairs allowing the amplification of at least part of the target sequence comprises or consists of at least 15 consecutive nucleotides of the sequences defined in SEQ ID NOs: 17, 18 and 19.

[0180] In a preferred embodiment, the presence of at least Fasciola brasiliensis is detected in the method, wherein the target sequence is at least as defined by SEQ ID NO: 3. More preferably, the set of primer pairs allowing the amplification of at least part of the target sequence comprises or consists of at least 15 consecutive nucleotides of the sequences defined in SEQ ID NOs: 20 and 21.

[0181] In a preferred embodiment, the presence of at least a species of the genus Encephalothrix (such as Encephalitozoon enterica, Encephalothrix rabbidus and Encephalothrix cerebralis) is detected in the method, wherein the target sequence is at least as defined by SEQ ID NOs: 4 to 6. More preferably, the set of primer pairs allowing the amplification of at least part of the target sequence comprises or consists of at least 15 consecutive nucleotides of the sequence defined in SEQ ID NOs: 22 to 27.

[0182] In a preferred embodiment, the presence of at least Enterospora bieneusi is detected in the method, wherein the target sequence is at least as defined by SEQ ID NO: 7. More preferably, the set of primer pairs allowing the amplification of at least part of the target sequence comprises or consists of at least 15 consecutive nucleotides of the sequences defined in SEQ ID NOs: 28 and 29.

[0183] In a preferred embodiment, the presence of at least Enterobius vermicularis is detected in the method, wherein the target sequence is at least as defined by SEQ ID NO: 8. More preferably, the set of primer pairs allowing the amplification of at least part of the target sequence comprises or consists of at least 15 consecutive nucleotides of the sequences defined in SEQ ID NOs: 30 and 31.

[0184] In a preferred embodiment, the presence of at least Diphyllobothrium latum and Diphyllobothrium japonicum is detected in the method, wherein the target sequence is at least as defined by SEQ ID NOs: 9 to 12. More preferably, the set of primer pairs allowing the amplification of at least part of the target sequence comprises or consists of at least 15 consecutive nucleotides of the sequences defined in SEQ ID NOs: 32 to 37.

[0185] In a preferred embodiment, the presence of at least Schistosoma mansoni is detected in said method, wherein the target sequence is at least as defined by SEQ ID NO: 13. More preferably, the set of primer pairs allowing the amplification of at least part of said target sequence comprises or consists of at least 15 consecutive nucleotides of the sequences defined in SEQ ID NOs: 38 and 39.

[0186] In a preferred embodiment, the presence of at least Blastocystis hominis is detected in said method, wherein the target sequence is at least as defined by SEQ ID NOs: 14 and 15. More preferably, the set of primer pairs allowing the amplification of at least part of said target sequence comprises or consists of at least 15 consecutive nucleotides of the sequence defined in SEQ ID NOs: 40-43.

[0187] In a preferred embodiment, the presence of at least liver helminths such as Clonorchis sinensis, Opisthorchis spp. and Mesorchis spp. is detected in the method, wherein the target sequence is at least as defined by SEQ ID NO: 16. More preferably, the set of primer pairs allowing the amplification of at least part of the target sequence comprises or consists of at least 15 consecutive nucleotides of the sequences defined in SEQ ID NOs: 44 and 45.

[0188] In a preferred embodiment, the presence of at least Hymenolepis nivalis, Hymenolepis diminuta liver worms such as Clonorchis sinensis, Opisthorchis spp. and Mesorchis spp. is detected in the method, wherein the target sequence is at least as defined by SEQ ID NOs: 1, 2 and 16. More preferably, the set of primer pairs allowing the amplification of at least part of the target sequence comprises or consists of at least 15 consecutive nucleotides of the sequences defined in SEQ ID NOs: 17, 18, 19, 44 and 45.

[0189] In another preferred embodiment, the presence of at least Enterospora bicinata, Enterobius vermicularis and Schistosoma mansoni is detected in the method, wherein the target sequence is at least as defined by SEQ ID NOs: 7, 8 and 13. More preferably, the set of primer pairs allowing the amplification of at least part of the target sequence comprises or consists of at least 15 consecutive nucleotides of the sequences defined in SEQ ID NOs: 28, 29, 30, 31, 38 and 39.

[0190] In a preferred embodiment, the presence of at least Ancylostoma duodenalis is detected in the method, wherein the target sequence is at least as defined by SEQ ID NOs: 46 and 47. More preferably, the set of primer pairs allowing the amplification of at least part of the target sequence comprises or consists of at least 15 consecutive nucleotides of the sequences defined in SEQ ID NOs: 48-51.

[0191] The invention also relates to the use of a nucleotide primer, primer pair or probe as defined above for determining the presence of an intestinal parasite in a sample.

[0192] The present invention also provides a test kit for detecting the presence of intestinal parasites in a sample. Such a test kit comprises a primer pair selected from the group consisting of a primer pair as defined above. The test kit may also comprise a probe selected from the probe as defined above. The purposes of primer pairs and probes are described above and in the following examples. Preferably, the test kit comprises an instrument for real-time polymerase chain reaction, such as a labeled probe, a polymerase, a buffer and nucleotides.

[0193] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present disclosure belongs. Although methods and materials similar or equivalent to those described herein may be used in the practice or testing of the present disclosure, suitable methods and materials are described below. The materials, methods, and examples are illustrative only and not restrictive.

[0194] Example 1

[0195] This example describes the results of a proof-of-concept study for the detection of Hymenolepis nivalis, Hymenolepis diminuta, Fasciola brasiliensis, Encephalic protozoa (such as Encephalitozoon enterica, Encephalic protozoa rabbids, and Encephalic protozoa), Enterospora bicinata, Enterobacter vermicularis, Diphyllobothrium latum, Diphyllobothrium japonicum, Schistosoma mansoni, Blastocystis hominis, and liver worms (such as Clonorchis sinensis, Opisthorchis, and Mesorchis) in a dedicated multiplex qPCR assay. The sample material used for this designed assay was a spiked stool sample.

[0196] Materials and methods

[0197] qPCR Reagents:

[0198] Mobidiag's qPCR Mastermix(MM)

[0199] The assay mix consisted of parasite target specific primers as defined in Table 2 and probes as defined above.

[0200] Device:

[0201] BIO-RAD CFX96

[0202] PCR setup

[0203] In React:

[0204] 10 μl 2 x MM

[0205] 5 μl 4 x primer mix

[0206] Compound

[0207] 2 μl sample / H2O

[0208] 20μl

[0209] PCR protocol:

[0210]

[0211] Two-step qPCR with detection by labeled probes.

[0212] sample:

[0213] Samples were spiked in a fecal background, representing the pathogens listed above. Samples had been collected from commercial biobanks (e.g. ATCC) or the Mobidiag sample storage facility and analyzed in a series of ten-fold sample dilutions.

[0214] result

[0215] Under highly multiplexed conditions, all targets were detected in all sample concentrations (Figures 1-8).

[0216] Example 2

[0217] This embodiment describes the results of a study of potential false positive results due to cross reactions in intestinal parasite qPCR assays. The sample material for the assay designed is preferably a fecal sample. Therefore, pathogens other than parasites (bacteria and viruses) associated with gastrointestinal infections (not covered by the test panel) may cause potential cross reactions. In addition, other eukaryotic microorganisms may cross react.

[0218] Materials and methods

[0219] qPCR Reagents:

[0220] Mobidiag's qPCR Mastermix(MM)

[0221] The assay mix consisted of parasite target specific primers as defined in Table 2 and probes as defined above.

[0222] Device:

[0223] BIO-RAD CFX96

[0224] PCR setup

[0225] In React:

[0226] 10 μl 2 x MM

[0227] 5 μl 4 x primer mix

[0228] Compound

[0229] 2 μl sample / H2O

[0230] 20μl

[0231] PCR protocol

[0232] Two-step qPCR with detection by labeled probes:

[0233]

[0234] sample:

[0235] A total of 61 live or attenuated microorganisms or DNA samples extracted from different microorganisms were collected (Table 3). The strains were mainly collected from commercial biobanks (ATCC, DSMZ, Microbiologics Qnostics and Vircell). All samples were isolated at high concentrations (>10 8 CFU / mL).

[0236] Table 3. Cross-reactivity results.

[0237]

[0238]

[0239]

[0240] result

[0241] Cross-reactivity testing showed no false positives (see Table 3 above).

[0242] Example 3

[0243] For the experiment, two sets of samples were used: one set (n=8) of known intracellular protozoa-positive samples from clinical sources (one per patient) and one set (n=104) of intracellular protozoa-negative stool samples. (See Table 4). Positive samples were prepared by spiking known strains into a negative stool background at clinically relevant concentrations. A total of 120 Novodiag columns (Mobidiag, Finland) were run.

[0244] Sample quantification

[0245] Known brain intracellular protozoa samples from a commercial biobank (ATCC) were quantified in a CFX96 qPCR instrument relative to known standard DNA samples of the same target diluted in a 10-fold manner. The standard series ranged from 200 to 200 000 c / μL. Final "clinical" samples were prepared by spiking primary brain intracellular protozoa samples into eSwab-feces-suspension at clinically relevant concentrations (ranging from 100 to 80 000 cells / mL).

[0246] Sample analysis

[0247] Each sample (positive and negative) was pre-processed and run in the Novodiag instrument.

[0248] Table 4. Samples

[0249]

[0250] Oligonucleotides

[0251] The Brain Intracellular Protozoa Assay Mix contains the following oligonucleotides:

[0252] Brain protozoa 18S_F3.1 (SEQ ID NO: 22)

[0253] Brain protozoa 18S_F3.2 (SEQ ID NO: 24)

[0254] Brain protozoa 18S_F3.3 (SEQ ID NO: 26)

[0255] Brain intracellular protozoa 18S_P2.1as

[0256] Brain intracellular protozoa 18S_P2.2as

[0257] Brain protozoa 18S_R2.1 (SEQ ID NO: 23)

[0258] Brain protozoa 18S_R2.2 (SEQ ID NO: 25)

[0259] Brain protozoa 18S_R2.3 (SEQ ID NO: 27)

[0260] result

[0261] The results of the positive samples with similar cell counts are presented in Table 5 below:

[0262]

[0263]

[0264] 1 The conversion factor 11 is derived from the copy number of the 18S gene found in the nucleus of Encephalitozoon. Biderre C, Peyretaillade E, Duffieux F, Peyret P, Méténier G, Vivarès C. The rDNA Unit of Encephalitozooncuniculi (Microsporidia): Complete 23S Sequence and Copy Number. J Eukaryot Microbiol. 1997 Nov-Dec;44(6):76S.

[0265] 2 Graczyk TK, Johansson MA, Tamang L, Visvesvara GS, Moura LS, DaSilva AJ, Girouard AS, Matos O. Retrospective Species Identification of Microsporidian Spores in Diarrheic Fecal Samples from Human ImmunodeficiencyVirus / AIDS Patients by Multiplexed Fluorescence In Situ Hybridization. J Clin Microbiol. 2007 Apr;45(4):1255-60.

[0266] 3 Kahler AM, Thurston-Enriquez JA. Human pathogenic microsporidia detection in agricultural samples: method development and assessment. Parasitol Res. 2007 Feb;100(3):529-38.

[0267] The final results are summarized in Table 6 below:

[0268]

[0269]

[0270] The overall sensitivity and specificity of the assay for detecting I. cerebelloides spp. with spiked samples and I. cerebelloides spp. negative stool samples were 100% (95% CI 63.1–100%) and 100% (95% CI 96.5–100%), respectively.

[0271] The overall positive predictive value (PPV) and negative predictive value (NPV) were 100% (95% CI 63.1–100%) and 100% (95% CI 96.5–100%), respectively.

[0272] Example 4

[0273] The experiment was performed using A. duodenalis primers as described in SEQ ID NOs: 48-51 and the results were compared to a reference O&P microscopy method.

[0274] The final result is:

[0275]

[0276] PLR = Positive likelihood ratio. Since no clinical data were obtained in this study, the likelihood ratio and accuracy are only estimates.

[0277] NLR = negative likelihood ratio. Since no clinical data were obtained in this study, the likelihood ratio and accuracy are only estimates.

[0278] N / A = cannot be calculated as sensitivity and specificity are 100%.

[0279] The overall sensitivity and specificity of the NVD SP assay for detecting A. duodenalis from unpreserved stool samples were 100% (95% CI 29.2–100%) and 100% (95% CI 96.1–100%), respectively.

[0280] The overall PPV and NPV were 100% (95% CI 29.2–100%) and 100% (95% CI 96.1–100%), respectively.

[0281] One invalid run was observed from the sample set (1 / 96), yielding an inefficiency of 1%.

[0282] References

[0283] Garcia,Lynne S.,Michael Arrowood,Evelyne Kokoskin,Graeme P.Paltridge,Dylan R.Pillai,Gary W.Procop,Norbert Ryan,Robyn Y.Shimizu,and GovindaVisvesvarab,Laboratory Diagnosis of Parasites from the GastrointestinalTract,Clinical Microbiology Reviews,January 2018,Volume 31,Issue 1,e00025-17. Sequence Listing <110> Mobitiago <120> Methods for determining the presence of intestinal parasites <130> MOBID3PCT <150> FI20195975 <151> 2019-11-15 <160> 67 <170> PatentIn Version 3.5 <210> 1 <211> 125 <212> DNA <213> Hymenolepis <400> 1 aattcctgat gcttttgggt tttatggttt attatttgct atgttttcta tagtgtgctt 60 aggttgtagt gtgtgggctc atcatatgtt tactgttggt ttggatgtta agacggctgt 120 atttt 125 <210> 2 <211> 125 <212> DNA <213> Domestic animal(Hymenolepis) <400> 2 aattcctgat gctttttgggt tttatgggct cttgtttgcc atgttttcta ttgttttgttt aggtagaagt gtttgagggc atcatatgtt tactgttggt ttagatgtaa agacggcagt gttct 125 <210> 3 <211> 129 <212> DNA <213> Mammalian species(Fasciolopsis buski) <400> 3 60. cactgttcaa gtggtattga ttggggttcgc ccattctttg ccattgccct cgcatgcacc tggtccttgt ggccggactg cacgtacgtc gcccggcggt gcctatcccg ggtaggactg 120 atacctgg 129 <210> 4 <211> 164 <212> DNA <213> Insect species(Encephalitozoon sp) <400> 4 gacgaagatc ggaaggtctg agtcctgagt gttagataag atataagtcg taacatggct gctgttggag aaccagcagc aggatcagta tgttgttgtg ttttgatgga tgtttgtttg 120 tttgtttgtg gtttctctgt tcacgggatt gattggcatt agcg 164 <210> 5 <211> 151 <212> DNA <213> Encephalitozoon sp <400> 5 gacgaagatt ggaaggtctg agtccttcgt gttagataag atataagtcg taacgcggct 60 gctgttggag aaccagcagc aggatcagta tttgagagat tggggggaat ttttttgatt 120 tgaggatcca cgggattgat aggcattagc a 151 <210> 6 <211> 169 <212> DNA <213> Encephalitozoon_sp_ <400> 6 gacgaagatt gagaggtctg agtctttcgt gttagataag atataagtcg taacatggct 60 gctgttggag aaccagcagc aggatcagta tgttgatttg attgatttgt ggggattttt 120 agttttttag tttttctttc tctatccatg ggattgattg gcattatct 169 <210> 7 <211> 100 <212> DNA <213> Enterocytozoon bieneusi <400> 7 gagtgtagta tagactggcg aagaatgaaa tctcaagacc cagtttggac taacggaggc 60 gaaggcgaca ctcttagacg tatcttagga tcaaggacga 100 <210> 8 <211> 87 <212> DNA <213> Enterobius vermicularis <400> 8 gcagagcttt tccaaaattt atttccaagc cacagactca ctgatgttca tgtctgagcc 60 ggaacgagaa attacctcaa acttggg 87 <210> 9 <211> 156 <212> DNA <213> Diphyllobothrium latum / Japan Sea Diphyllobothrium (Diphyllobothrium latum / nihonkaiense) <400> 9 ccagttatta caggtgtgag attgaataag tatttattac aatgtcattg tatagtttct 60 aatgttggtt tcaatttatg ttttttccct atgcattact ttggtgtgtg cggtttacca 120 cgtcgtgtgt gtgtgtacga gtcgggttat gcttga 156 <210> 10 <211> 156 <212> DNA <213> Diphyllobothrium latum / Japan Sea Diphyllobothrium (Diphyllobothrium latum / nihonkaiense) <400> 10 ccagttatta ctggtgtaag attgaataag tatttactac aatgtcattg tatagtttct 60 aatgttggtt tcaatttatg tttttttccc atgcattatt ttggtgtgtg cggtttacca 120 cgtcgtgtgt gcgtatatga gtcaggttat gcttga 156 <210> 11 <211> 156 <212> DNA <213> Diphyllobothrium latum / Japan Sea Diphyllobothrium (Diphyllobothrium latum / nihonkaiense) <400> 11 ccagttatta ctggtgtaag attgaataag tatttactac aatgtcattg tatagtttct 60 aatgttggtt tcaatttatg tttttttcct atgcattatt ttggtgtgtg cggtttacca 120 cgtcgtgtgt gtgtatatga gtcaggttat gcttga 156 <210> 12 <211> 156 <212> DNA <213> Diphyllobothrium latum / Japan Sea Diphyllobothrium (Diphyllobothrium latum / nihonkaiense) <400> 12 ccagttatta ctggtgtgag attgaataag tatttactac aatgtcattg tatagtttct 60 aatgttggtt tcaatttatg tttttttcct atgcattatt ttggtgtgtg cggtttacca 120 cgtcgtgtgt gcgtatatga gtcaggttat gcttga 156 <210> 13 <211> 134 <212> DNA <213> Schistosoma mansoni <400> 13 aggtgttttc atgactttat atgttgaata gttgcggtat gcgggtttta gatcccatag 60 tatggtgatt agtcggtttt atatttttat ttacggttgg tggtgtcaca ggggtggctt 120 tatctgcatc tgct 134 <210> 14 <211> 82 <212> DNA <213> Blastocystis hominis <400> 14 tcagctttcg atggtagtgt attggactac catggcagta acgggtaacg aagaatttgg 60 gttcgatttc ggagagggag cc 82 <210> 15 <211> 82 <212> DNA <213> Blastocystis hominis <400> 15 tcagctttcg atggtagtat atgggcctac catggcagta acgggtaacg aagaatttgg 60 gttcgatttc ggagagggag cc 82 <210> 16 <211> 95 <212> DNA <213> Clonorchis sinensis / Opistothorchis sp. / Metorchis sp. <400> 16 agctcgtagt tggatctggg tcgcatggct acatgccgtt gctcgtattc ctggcctggt 60 tcacaccggg acgggtttgt gagtcggtgt cgtgg 95 <210> 17 <211> 26 <212> DNA <213> Hymenolepis <400> 17 aattcctgat gcttttgggt tttatg 26 <210> 18 <211> 25 <212> DNA <213> Hymenolepis <400> 18 agaacactgc cgtctttaca tctaa 25 <210> 19 <211> twenty four <212> DNA <213> Hymenolepis <400> 19 aaatacagcc gtcttaacat ccaa 24 <210> 20 <211> twenty three <212> DNA <213> Fasciolopsis buski <400> 20 cactgttcaa gtggtattga ttg 23 <210> twenty one <211> 20 <212> DNA <213> Fasciolopsis buski <400> twenty one ccaggttatc agtcctaccc 20 <210> twenty two <211> twenty four <212> DNA <213> Encephalitozoon sp. <400> twenty two ctgagtcctg agtgttagat aaga 24 <210> twenty three <211> twenty one <212> DNA <213> Encephalitozoon sp. <400> twenty three ctaatgccaa tcaatcccgt g 21 <210> twenty four <211> 28 <212> DNA <213> Encephalitozoon sp. <400> twenty four gtccttcgtg ttagataaga tataagtc 28 <210> 25 <211> twenty three <212> DNA <213> Encephalitozoon sp. <400> 25 agataatgcc aatcaatccc atg 23 <210> 26 <211> twenty one <212> DNA <213> Encephalitozoon sp. <400> 26 gacgaagatt gagaggtctg a 21 <210> 27 <211> twenty one <212> DNA <213> Encephalitozoon sp. <400> 27 ctaatgccta tcaatcccgt g 21 <210> 28 <211> twenty two <212> DNA <213> Enterocytozoon bieneusi <400> 28 gagtgtagta tagactggcg aa 22 <210> 29 <211> twenty two <212> DNA <213> Enterocytozoon bieneusi <400> 29 tcgtccttga tcctaagata cg 22 <210> 30 <211> 26 <212> DNA <213> Enterobius vermicularis <400> 30 gcagagcttt tccaaaattt atttcc 26 <210> 31 <211> twenty three <212> DNA <213> Enterobius vermicularis <400> 31 cccaagtttg aggtaatttc tcg 23 <210> 32 <211> 26 <212> DNA <213> Diphyllobothrium latum / Japan Sea Diphyllobothrium (Diphyllobothrium latum / nihonkaiense) <400> 32 ccagttatta ctggtgtaag attgaa 26 <210> 33 <211> twenty four <212> DNA <213> Diphyllobothrium latum / Japan Sea Diphyllobothrium (Diphyllobothrium latum / nihonkaiense) <400> 33 tcaagcataa cctgactcat atac 24 <210> 34 <211> 26 <212> DNA <213> Diphyllobothrium latum / Japan Sea Diphyllobothrium (Diphyllobothrium latum / nihonkaiense) <400> 34 ccagttatta ctggtgtaag attgaa 26 <210> 35 <211> twenty four <212> DNA <213> Diphyllobothrium latum / Japan Sea Diphyllobothrium (Diphyllobothrium latum / nihonkaiense) <400> 35 tcaagcataa cctgactcat atac 24 <210> 36 <211> twenty four <212> DNA <213> Diphyllobothrium latum / Japan Sea Diphyllobothrium (Diphyllobothrium latum / nihonkaiense) <400> 36 ccagttatta caggtgtgag attg 24 <210> 37 <211> 20 <212> DNA <213> Diphyllobothrium latum / Japan Sea Diphyllobothrium (Diphyllobothrium latum / nihonkaiense) <400> 37 caagcataac ccgactcgta 20 <210> 38 <211> 27 <212> DNA <213> Schistosoma mansoni <400> 38 aggtgttttc atgactttat atgttga 27 <210> 39 <211> 20 <212> DNA <213> Schistosoma mansoni <400> 39 agcagatgca gataaagcca 20 <210> 40 <211> twenty three <212> DNA <213> Blastocystis hominis <400> 40 cagctttcga tggtagtgta ttg 23 <210> 41 <211> 18 <212> DNA <213> Blastocystis hominis <400> 41 ggctccctct ccgaaatc 18 <210> 42 <211> twenty four <212> DNA <213> Blastocystis hominis <400> 42 tcagctttcg atggtagtat atgg 24 <210> 43 <211> 18 <212> DNA <213> Blastocystis hominis <400> 43 ggctccctct ccgaaatc 18 <210> 44 <211> 19 <212> DNA <213> Clonorchis sinensis / Opistothorchis sp. / Metorchis sp. <400> 44 agctcgtagt tggatctgg 19 <210> 45 <211> 20 <212> DNA <213> Clonorchis sinensis / Opistothorchis sp. / Metorchis sp. <400> 45 ccaccaatca tgctaacacc 20 <210> 46 <211> 259 <212> DNA <213> Duodenal hookworm (Ancylostoma duodenale) <400> 46 cccatgagac atacaaaaag gtaatgccgc cgtctggttc agggttgttt atatctacta 60 cagtgtagct tgtggcactg tttgtcgaac ggcacttgct tttagcgatt cccgttctag 120 atcagaatat attgcaacat gtacgttagc tggctagttt gctaacgtgc gctgaatgac 180 agcaaactcg ttgttgctgc tgaatcgttc accgacttta gaacgtttcg ggtctcgact 240 atacgcccgt tttcggatc 259 <210> 47 <211> 241 <212> DNA <213> Duodenal hookworm (Ancylostoma duodenale) <400> 47 cccatgagac atacaaaaag gtaatgccgc ctatatctac tacagtgcag cttgtggcac 60 tgtttgtcga acggcacttg cttttagcga ttcccgttct agatcagaat atattgcaac 120 atgtacgttg gctggctagt ttgctaacgt gcgctgaatg acagcaaact cgttgttgct 180 gctgaatcgt ttaccgactt tagaacgttt cgggtctcga ctatacgccc gttttcggat 240 c 241 <210> 48 <211> 18 <212> DNA <213> Duodenal hookworm (Ancylostoma duodenale) <400> 48 cagtgtagct tgtggcac 18 <210> 49 <211> twenty three <212> DNA <213> Duodenal hookworm (Ancylostoma duodenale) <400> 49 cagctaacgt acatgttgca ata 23 <210> 50 <211> 18 <212> DNA <213> Duodenal hookworm (Ancylostoma duodenale) <400> 50 acagtgcagc ttgtggca 18 <210> 51 <211> twenty three <212> DNA <213> Duodenal hookworm (Ancylostoma duodenale) <400> 51 cagccaacgt acatgttgca ata 23 <210> 52 <211> 32 <212> DNA <213> Hymenolepis nana <400> 52 agtgtgctta ggttgtagtg tgtgggctca tc 32 <210> 53 <211> 31 <212> DNA <213> Hymenolepis diminuta <400> 53 tgtttgccat gttttctatt gtttgtttag g 31 <210> 54 <211> twenty four <212> DNA <213> Fasciolopsis buski <400> 54 ttcgcccatt ctttgccatt gccc 24 <210> 55 <211> 27 <212> DNA <213> Enteric encephalitis microsporidia (E. intestinalis) <400> 55 ctgatcctgc tgctggttct ccaacag 27 <210> 56 <211> 29 <212> DNA <213> E. cuniculi <400> 56 atgatcctgc taatggttct ccaacagca 29 <210> 57 <211> 29 <212> DNA <213> E. hellem <400> 57 atgatcctgc taatggttct ccaacagca 29 <210> 58 <211> twenty three <212> DNA <213> Enterocytozoon bieneusi <400> 58 agtgtcgcct tcgcctccgt tag 23 <210> 59 <211> 30 <212> DNA <213> Enterobius vermicularis <400> 59 tccggctcag acatgaacat cagtgagtct 30 <210> 60 <211> twenty four <212> DNA <213> Diphyllobothrium latum <400> 60 acacgacgtg gtaaaccgca caca 24 <210> 61 <211> twenty four <212> DNA <213> Diphyllobothrium latum <400> 61 acacgacgtg gtaaaccgca caca 24 <210> 62 <211> twenty four <212> DNA <213> Diphyllobothrium latum <400> 62 acacgacgtg gtaaaccgca caca 24 <210> 63 <211> twenty four <212> DNA <213> Japan Sea tapeworm (Diphyllobothrium nihonkaiense) <400> 63 acacgacgtg gtaaaccgca caca 24 <210> 64 <211> twenty two <212> DNA <213> Schistosoma mansoni <400> 64 cccctgtgac accaccaacc gt 22 <210> 65 <211> 30 <212> DNA <213> Blastocystis hominis <400> 65 aaattcttcg ttacccgtta ctgccatggt 30 <210> 66 <211> 30 <212> DNA <213> Blastocystis hominis <400> 66 aaattcttcg ttacccgtta ctgccatggt 30 <210> 67 <211> 25 <212> DNA <213> Clonorchis sinensis <400> 67 ttgctcgtat tcctggcctg gttca 25

Claims

1. Use of a primer pair for an intestinal parasite to prepare a kit for use in a method for determining the presence or absence of an intestinal parasite in a biological sample, the method The following steps are involved: i) contacting the sample with a primer pair for each of the intestinal parasites to provide a reaction mixture for nucleic acid amplification of an intestinal parasite target sequence corresponding to each of the intestinal parasites, wherein the primer members of the primer pair hybridize to the intestinal parasite target sequence or its reverse complement; ii) performing a nucleic acid amplification reaction using said reaction mixture obtained in step i), wherein intestinal parasite target sequences corresponding to each of said intestinal parasites, if present in said sample, are used as templates to generate amplicons; Wherein, in step i), Primer pair A consists of SEQ ID NO: 17 and SEQ ID NO: 18 and is directed against an intestinal parasite comprising a target sequence of SEQ ID NO: 1; Primer pair B consists of SEQ ID NO: 17 and SEQ ID NO: 19 and is directed against an intestinal parasite comprising a target sequence of SEQ ID NO: 2; Primer pair C consists of SEQ ID NO:20 and SEQ ID NO:21 and is directed against an intestinal parasite comprising a target sequence of SEQ ID NO:3; Primer pair D consists of SEQ ID NO:22 and SEQ ID NO:23 and is directed against an intestinal parasite comprising a target sequence of SEQ ID NO:4; Primer pair E consists of SEQ ID NO:24 and SEQ ID NO:25 and is directed against an intestinal parasite comprising a target sequence of SEQ ID NO:5; Primer pair F consists of SEQ ID NO:26 and SEQ ID NO:27 and is directed against an intestinal parasite comprising a target sequence of SEQ ID NO:6; Primer pair G consists of SEQ ID NO:28 and SEQ ID NO:29 and is directed against an intestinal parasite comprising a target sequence of SEQ ID NO:7; Primer pair H consists of SEQ ID NO:30 and SEQ ID NO:31 and is directed against an intestinal parasite comprising a target sequence of SEQ ID NO:8; Primer pair 1 consists of SEQ ID NO:32 and SEQ ID NO:33 and is directed against an intestinal parasite comprising a target sequence of SEQ ID NO:9; Primer pair J consists of SEQ ID NO:34 and SEQ ID NO:35 and is directed against an intestinal parasite comprising a target sequence of SEQ ID NO:10; Primer pair K consists of SEQ ID NO:36 and SEQ ID NO:37 and is directed against an intestinal parasite comprising a target sequence of SEQ ID NO:11; Primer pair L consists of SEQ ID NO:36 and SEQ ID NO:37 and is directed against an intestinal parasite comprising a target sequence of SEQ ID NO:12; Primer pair M consists of SEQ ID NO:38 and SEQ ID NO:39 and is directed against an intestinal parasite comprising a target sequence of SEQ ID NO:13; Primer pair N consists of SEQ ID NO:40 and SEQ ID NO:41 and is directed against an intestinal parasite comprising a target sequence of SEQ ID NO:14; Primer pair O consists of SEQ ID NO:42 and SEQ ID NO:43 and is directed against an intestinal parasite comprising a target sequence of SEQ ID NO:15; Primer pair P consists of SEQ ID NO:44 and SEQ ID NO:45 and is directed against an intestinal parasite comprising a target sequence of SEQ ID NO:16; Primer pair Q consists of SEQ ID NO:48 and SEQ ID NO:49 and is directed against an intestinal parasite comprising a target sequence of SEQ ID NO:46; and Primer pair R consists of SEQ ID NO:50 and SEQ ID NO:51 and is directed against an intestinal parasite comprising a target sequence of SEQ ID NO:47, and iii) determining the presence or absence of the amplicon, wherein the presence of the amplicon indicates the presence of the corresponding intestinal parasite in the sample.

2. The method according to claim 1, wherein the nucleic acid amplification reaction is a multiplex real-time PCR assay.

3. The use according to claim 1 or 2, wherein in step iii) the presence or absence of each amplicon is determined using a probe, wherein The probe used to determine the presence of the amplicon generated using primer pair A is SEQ ID NO: 52; The probe used to determine the presence of the amplicon generated using primer pair B is SEQ ID NO: 53; The probe used to determine the presence of the amplicon produced using primer pair C is SEQ ID NO: 54; The probe used to determine the presence of the amplicon produced using primer pair D is SEQ ID NO: 55; The probe used to determine the presence of the amplicon produced using primer pair E is SEQ ID NO: 56; The probe used to determine the presence of the amplicon produced using primer pair F is SEQ ID NO: 57; The probe used to determine the presence of the amplicon produced using primer pair G is SEQ ID NO: 58; The probe used to determine the presence of the amplicon produced using primer pair H is SEQ ID NO: 59; The probe used to determine the presence of the amplicon produced using primer pair 1 is SEQ ID NO: 60; The probe used to determine the presence of the amplicon produced using primer pair J is SEQ ID NO: 61; The probe used to determine the presence of the amplicon produced using primer pair K is SEQ ID NO: 62; The probe used to determine the presence of the amplicon produced using primer pair L is SEQ ID NO: 63; The probe used to determine the presence of the amplicon produced using primer pair M is SEQ ID NO: 64; The probe used to determine the presence of the amplicon produced using primer pair N is SEQ ID NO: 65; The probe used to determine the presence of the amplicon produced using primer pair 0 is SEQ ID NO: 66; and The probe used to determine the presence of the amplicon produced using primer pair P is SEQ ID NO:

67.

4. An oligonucleotide primer pair set, consisting of the primer pair described in claim 1.

5. A kit for determining the presence of intestinal parasites in a sample, comprising an oligonucleotide primer pair set consisting of the primer pair described in claim 1 and an oligonucleotide probe set consisting of the probe described in claim 3.

6. The kit according to claim 5, comprising other PCR reagent components selected from the group consisting of: polymerase, nucleotides, buffers, salts and / or detergents.

7. The kit according to claim 5 or 6, further comprising one or more control primer pairs or control probes.

Images