Method for preparing refined glufosinate-ammonium from 4-(methylhydroxyphosphoryl)-2-carbonylbutyric acid

Abstract

The present invention provides a method for preparing refined glufosinate from 4-(methylhydroxyphosphoryl)-2-carbonylbutyric acid, using diethyl methylphosphite, vinyl acetate and glycine as raw materials, and utilizing a chemical-enzymatic method to synthesize the key intermediates of refined glufosinate, 4-(methylhydroxyphosphoryl)-2-carbonylbutyric acid (PPO) and refined glufosinate. Coryne bacter ium glutamicum Under the catalytic action of L-glutamine dehydrogenase CgGDH (preservation number CCTCC NO: M 2019118) or its mutant Q113E and glucose dehydrogenase of B1, refined glufosinate ammonium salt can be produced. The product and the enzyme after enzymatic synthesis are separated by ultrafiltration equipment, and the product is purified by D318 anion exchange resin adsorption and ammonia elution. The optical purity reaches more than 99% and the total yield is greater than 80%.

Description

Technical Field

[0001] The invention belongs to the fields of fine chemicals, genetic engineering and enzyme engineering, and relates to a method for preparing 4-(methylhydroxyphosphoryl)-2-carbonylbutyric acid by a chemical-enzymatic method and application of the method in the synthesis of refined glufosinate ammonium. Background Art

[0002] The structural formula of 4-(methylhydroxyphosphroryl)-2-carbonylbutyric acid (PPO) is shown below. It is a key intermediate in the synthesis of the new herbicide glufosinate (L-glufosinate). Therefore, the low-cost and efficient synthesis of PPO is crucial for the industrialization of glufosinate.

[0003]

[0004] There are many methods for synthesizing PPO. Jin Zhudan of Southeast University conducted a comprehensive review under the guidance of Professor Wang Mingliang. There are five main methods: (1) Synthesis using cyclic phosphoric anhydride, oxalic acid diester, and sodium cyanide as raw materials. This method requires the use of highly toxic sodium cyanide, which is very dangerous (Starkov Vitalij Y, Freger Boris I, et al. Sodium salts as semiproduct for producing phosphine acid displaying herbicidal activity [P]. European Patent Office, 1583424. 1990-08-07.). (2) Claisen condensation of 3-(hydroxymethylethoxy)propionitrile and diethyl oxalate, followed by alkaline hydrolysis and acidification, to obtain an intermediate, which is reacted with N,N-disubstituted (trimethylsilyl) secondary amine to generate a product, which does not need to be separated and is directly hydrolyzed to obtain the product PPO. This method produces two cis- and trans-isomers of encyanamide, which seriously affect the yield of PPO (Kazakov PV, Odinets IL, Antipin MY, et al. Synthesis of 2-keto-4-phosphorylbutyric acids and their derivatives [J]. Division of chemical science, 1990, 39 (9): 1931-1937.).(3) Liu Shanhe et al. (Liu Shanhe, Zeng Hui, Gao Zhenghua et al. A method for synthesizing glufosinate [P]. Chinese patent CN105837624.2018-11-16.) reported that methyl phosphorus dichloride was slowly added to a 2-carbonyl-3-butenoate compound at low temperature, and Michael addition occurred under stirring, followed by alkaline hydrolysis and reflux acidification to obtain PPO. However, this method has been protected by a US patent (Lothar Wilms, Hofheim. ETHOD FOR PRODUCING GLUFOSINATES AND INTERMEDIATE PRODUCTS FOR THESAMEUS 6,359,162 B1, 2002-3-19); (4) Tanaka et al. published a patent (Tanaka M, Sakakura T, Takigawa S, et al. Preparation of phosphinyl-2-oxobutyric acids as intermediates for herbicides [J]. Jpn Kokai Tokkyo Koho JP, 1989, 89(10): 658-672.), using 2-(methylphosphonylchloroethoxy)ethyl chloride as a raw material, and carbon monoxide under the catalytic action of cobalt carbonyl and calcium hydroxide to prepare the chlorinated product of PPO, and then reducing and hydrogenating to obtain PPO. This method has the problems of a long route, the use of a noble metal catalyst, and the need for hydrogenation. (5) In 1991, Hoechst reported the synthesis of PPO by the addition reaction of diethyl methylphosphite and acrylate, followed by reaction with diethyl oxalate in the presence of sodium methoxide, with a total yield of 65% (Zeiss HJ. Enantioselective synthesis of both enantiomers of phosphinothricin via asymmetric hydrogenation of-acylamidoacrylates [J]. J. Org. Chem., 1991, 56 (5): 1783-1788.); Anhui Guoxing Biochemical Co., Ltd. in my country made appropriate improvements to its method, and the total yield was increased to 85% (Wang Hongwei, Zeng Hui, et al. A new method for the synthesis of key intermediates of glufosinate ammonium [J]. Zhejiang Chemical Industry, 2017, 48 (2): 3-5).(6) Academician Zheng Yuguo of Zhejiang University of Technology and Professor Yang Lirong of Zhejiang University applied for relevant patents (Xue Yaping, Cheng Feng, Cao Chenghao, Zheng Yuguo. A method for preparing L-glufosinate by bioenzymatic deracemization, glufosinate dehydrogenase mutants and applications [P]. CN 111363775A, 2020-03-18; Yang Lirong, Wang Ziyuan, Zhou Haisheng, et al. An application of ω-transaminase and a method for preparing L-glufosinate by bioenzymatic deracemization [P]. CN 112553285 A, 2021-03-26.). DL-racemic glufosinate is used to oxidize D-glufosinate by D-amino acid oxidase or ω-transaminase to obtain PPO. Although this method is simple, the raw materials are restricted by the racemic glufosinate production enterprises and PPO cannot be prepared on a large scale. The main process is as follows:

[0005]

[0006] Since the above methods are difficult to realize industrialization, the present invention uses glycine, vinyl acetate and dimethyl methyl phosphite as raw materials, adopts a two-step chemical method and a two-step enzymatic method to synthesize 4-(methylhydroxyphosphoryl)-2-carbonylbutyric acid PPO, which has the advantages of easy availability of raw materials, no need for a low-temperature cold source below 0°C, mild reaction conditions, etc., and the yield can reach more than 86%, and has good application prospects. Summary of the invention

[0007] In order to solve the problems of the above-mentioned chemical synthesis raw materials being difficult to obtain, harsh reaction conditions, patent restrictions, etc., the present invention provides a method for preparing refined glufosinate ammonium from 4-(methylhydroxyphosphoryl)-2-carbonylbutyric acid PPO.

[0008] The technical solution of the present invention comprises the following steps:

[0009] (1) mixing a substrate 4-(methylhydroxyphosphoryl)-2-carbonylbutyrate, L-glutamine dehydrogenase, an auxiliary substrate glucose, and glucose dehydrogenase, and injecting the mixture into a tubular reactor for reaction. After the reaction is completed, separation is performed by an ultrafiltration system to obtain a mixed solution;

[0010] (2) The mixed solution obtained in step (1) is subjected to ultrafiltration, resin adsorption, screen filtration, ultrapure water washing, and desorption with dilute ammonia water, the desorbed solution is concentrated by a thin film evaporator, the concentrated solution is decolorized by activated carbon, filtered, and the filtrate is dried by a spray dryer to obtain refined glufosinate ammonium.

[0011] The L-glutamine dehydrogenase is a recombinant enzyme CgGDH, and its amino acid sequence is SEQ ID NO:6.

[0012] The L-glutamine dehydrogenase can also be replaced by L-glutamine dehydrogenase mutant enzyme Q113E, with the amino acid sequence of SEQ ID NO:7.

[0013] The glucose dehydrogenase is provided by the enzyme preparation division of Angel Yeast Co., Ltd., with the authorized patent CN107779459A. The strain is Escherichia coli A149-170, which is deposited in the China Center for Type Culture Collection with the deposit number CCTCC M2016102. The amino acid sequence is SEQID NO.18 and the DNA sequence is SEQID NO.19.

[0014] In step (1), the concentration of 4-(methylhydroxyphosphoryl)-2-carbonylbutyric acid is 150-200 g / L, and the concentration of glucose is 30-150 g / L.

[0015] In step (1), the amount of L-glutamine dehydrogenase or L-glutamine dehydrogenase mutant enzyme Q113E added is 2-6% of the mass of 4-(methylhydroxyphosphoryl)-2-carbonylbutyric acid.

[0016] In step (1), the amount of glucose dehydrogenase added is 1-5% of the mass of 4-(methylhydroxyphosphoryl)-2-carbonylbutyric acid.

[0017] In step (1), 4-(methylhydroxyphosphoryl)-2-carbonylbutyric acid, L-glutamine dehydrogenase, auxiliary substrate glucose, and glucose dehydrogenase are mixed and fed into a tubular reactor at a feed rate of 100-200 g / h. In the tubular reactor, the reaction temperature is 25-55° C. and the reaction pH is 6.5-8.5.

[0018] The ultrafiltration conditions of the mixed solution obtained in step (2) are: at an inlet pressure of 0.1-1.0 MPa, a reflux pressure of 0.05-0.1 MPa, and an average membrane flux of 80-120 L / (m 2 h);

[0019] The static adsorption conditions are as follows: using D318 anion exchange resin for static adsorption at 20-40° C. and pH 4-7; the mass concentration of the dilute ammonia water during the desorption process is 10-15%.

[0020] For 4-(methylhydroxyphosphoryl)-2-carbonylbutyric acid PPO in the above technical scheme, the present invention uses methyl phosphite and vinyl acetate as raw materials, adds an appropriate amount of hydroquinone, reacts at 0-10°C, and acid hydrolyzes to obtain 2-(ethoxy-methylphosphoryl)-ethanol, and then oxidizes it through a copper catalyst supported by silica to synthesize 2-(ethoxy-methylphosphoryl)-acetaldehyde, which is then mixed with glycine, and a key intermediate 4-(methylhydroxyphosphoryl)-2-carbonylbutyric acid PPO is prepared by a double enzyme method of L-threonine aldolase and L-threonine deaminase; finally, L-glutamate dehydrogenase and glucose dehydrogenase are used to enzymatically transform and prepare refined glufosinate, wherein the substrate can be added in batches or at one time. The entire chemical reaction adopts intermittent reaction batch feeding, and the enzymatic reaction adopts multi-stage tubular reaction continuous preparation, which can avoid the cross-influence of enzyme and substrate. Refined glufosinate ammonium salt is obtained by adsorption of D318 anion exchange resin and elution with ammonia water.

[0021] The technical route is as follows:

[0022]

[0023] The technical solutions of the present invention include the following:

[0024] The present invention provides a method for preparing 4-(methylhydroxyphosphoryl)-2-carbonylbutyric acid by chemical-enzymatic method, comprising the following steps:

[0025] (1) In a vinyl acetate anhydrous ethanol reactor, hydroquinone is added, and then diethyl methyl phosphite is added dropwise, and an addition rearrangement reaction is carried out at a temperature of 0-10° C. After the reaction, the reaction is hydrolyzed in hydrochloric acid (mass concentration 20-36%), and the obtained product is subjected to reduced pressure distillation to obtain 2-(ethoxy-methylphosphoryl)-ethanol;

[0026] (2) placing the 2-(ethoxy-methylphosphoryl)-ethanol obtained in step (1) in a fixed bed reactor, using silica as a carrier, dispersing copper oxide in the silica carrier (Shanghai Xunkai New Materials Technology Co., Ltd., model CuCAT-2508T, main component Cu-Si, cylinder 5*3 mm), introducing oxygen, reacting at a temperature of 50-120° C. and a pressure of 0.05-0.15 MPa to obtain 2-(ethoxy-methylphosphoryl)-acetaldehyde;

[0027] (3) introducing the 2-(ethoxy-methylphosphoryl)-acetaldehyde and glycine obtained in step (2) into a tubular reactor, adding L-threonine aldolase, coenzyme pyridoxal phosphate, MnCl2, and adding a buffer to form an aldolase conversion reaction system, reacting at a temperature of 30-50° C. (preferably 35° C.), and after the reaction is completed, ultrafiltration is performed to obtain 4-(methylhydroxyphosphoryl)-threonine; the substrate can be added in batches or all at once in this step;

[0028] (4) introducing the 4-(methylhydroxyphosphoryl)-threonine and L-threonine deaminase obtained in step (3) into a tubular reactor, reacting in a buffer at a temperature of 20-45° C. (preferably 40° C.), and obtaining 4-(methylhydroxyphosphoryl)-2-carbonylbutyric acid by ultrafiltration after the reaction is completed. In this step, the substrate can be added in batches or all at once.

[0029] In step (1), the molar ratio of vinyl acetate to diethyl methyl phosphite is (1.0-1.3):1;

[0030] The added amount of hydroquinone is 1 / 10000 to 3 / 10000 of the total mass of the raw materials of vinyl acetate and diethyl methyl phosphite.

[0031] In step (3), the concentration of 2-(ethoxy-methylphosphoryl)-acetaldehyde is 100-200 g / L; the concentration of glycine is 50-100 g / L; the concentration of L-threonine aldolase is 2-5% of the mass of glycine; the concentration of coenzyme pyridoxal phosphate is 50-100 μmol / L; the concentration of MnCl2 is 50-100 μmol / L; in the reaction system, 0.05-0.3 mol / L Tris-HCl is used to control the pH to 6-9 (preferably the concentration of the buffer is 0.1 mol / L, and the pH is controlled to 8.0).

[0032] The L-threonine acetalase described in step (3) is the recombinant enzyme ScTA, the amino acid sequence of the recombinant enzyme ScTA is SEQ ID NO: 1, and the DNA sequence is SEQ ID NO: 2.

[0033] L-Threonine Aldolase: The recombinant bacteria E. coli BL21 (DE3) / pet28a-L-ScTA was constructed to express the L-threonine aldolase from Saccharomyces cerevisiae TSHP with a histidine tag, Saccharomyces cerevisiae TSHP, classification name: Saccharomyces cerevisiae TSHP, deposit number CCTCC NO: M 2022499, deposit unit: China Center for Type Culture Collection, deposit address: Wuhan University, Wuhan, China, deposit date: April 27, 2022. The recombinant enzyme ScTA was separated and purified by Ni-Agarose affinity chromatography. The gene sequence of the recombinant enzyme ScTA is 1164bp long, contains 387 amino acids, has a molecular weight of 42.815kD, and a specific enzyme activity of 2.5U / mg. After crushing and purification, the liquid enzyme was obtained, and its enzyme activity was 3500U / L. The liquid enzyme product in the solution of the present invention can be used as liquid enzyme after being crushed and purified. In industry, a storage stabilizer is generally added to extend its practical use time).

[0034] The L-threonine aldolase is replaced by the L-threonine aldolase variant enzyme N294R, and the amino acid sequence of the L-threonine aldolase variant enzyme N294R is SEQ ID NO:3.

[0035] The L-threonine aldolase mutant N294R was synthesized by Shanghai Bioengineering Co., Ltd. with self-designed primers N294R 2-f: F: gcagacaccaggtttgtctttattaacctgaaggccgctagaatg and N294R 2-r: R: taaagacaaacctggtgtctgctggagactctagcgggatg. The site-directed mutagenesis kit Mut Express II Fast Mutagenesis Kit V2 of Nanjing Novogene Biotech Co., Ltd. was used for site-directed mutagenesis to construct the mutant enzyme N294R. After fragmentation and purification, the liquid enzyme was obtained, and the enzyme activity was increased by 2 times, reaching 7000U / L.

[0036] In the step (4), the concentration of 4-(methylhydroxyphosphoryl)-threonine is 100-300 g / L, and the amount of L-threonine deaminase added is 1-3% of the mass of 4-(methylhydroxyphosphoryl)-threonine; in the reaction system, 0.05-0.3 mol / L Tris-HCl is used to control the pH to 6-9 (preferably the concentration of the buffer is 0.1 mol / L, and the pH is controlled to 7.5).

[0037] The L-threonine deaminase is a recombinant enzyme Kt-TDH, the amino acid sequence of the recombinant enzyme Kt-TDH is SEQ ID NO: 4, and the DNA sequence is SEQ ID NO: 5.

[0038] L-Threonine deaminase: The recombinant bacteria E.coliBL21(DE3) / pet28a–Kt-TDH were constructed to express the Kluyveromyces thermotolerans TDH threonine deaminase gene with a histidine tag, and the recombinant enzyme Kt-TDH was separated and purified by Ni-Agarose affinity chromatography. The gene sequence of the recombinant enzyme KtTDH is 1722bp long, contains 573 amino acids, has a molecular weight of 63.199kD, and a specific enzyme activity of 3.5U / mg. After crushing and purification, the liquid enzyme was obtained, and its enzyme activity was 3800U / L.

[0039] The technical solution of the present invention also provides L-glutamine dehydrogenase: by constructing recombinant bacteria E.coliBL21 (DE3) / pet28a-GDH, expressing the L-glutamine dehydrogenase GDH gene of Corynebacterium glutamicumB1 (Corynebacterium glutamicumB1 is taken from public patent 109971676A, deposit number CCTCC NO: M 2019118) with a histidine tag, and using Ni-Agarose affinity chromatography to separate and purify the recombinant enzyme CgGDH. The recombinant enzyme CgGDH gene sequence is 1344bp in length, 447 amino acids, and has a molecular weight of 48.988kD. After crushing and purification, a liquid enzyme is obtained, and its enzyme activity is 10300U / L, and the amino acid sequence is SEQ ID NO: 6.

[0040] L-Glutamine dehydrogenase mutant Q113E

[0041] Primers Q113E 2-f: TTTGAATTCatgacagttgatgag caggtc and E218D 2-r: TTTCTCG AG ttagat gacgccctg tgcca were synthesized and designed by Shanghai Bioengineering Co., Ltd. The site-directed mutagenesis kit Mut Express II Fast Mutagenesis Kit V2 of Nanjing Novogene Biotech Co., Ltd. was used for site-directed mutagenesis to construct the mutant enzyme E218D. After fragmentation and purification, the liquid enzyme was obtained, and the enzyme activity was increased to 18500U / L. The amino acid sequence is SEQ ID NO: 7.

[0042] Glucose dehydrogenase is provided by the Enzyme Division of Angel Yeast Co., Ltd., with the authorized patent being CN107779459 A. The strain is Escherichia coli A149-170, which is deposited in the China Center for Type Culture Collection with the deposit number CCTCC M2016102. The molecular weight is about 30 kD, and the enzyme activity of the liquid enzyme preparation (provided by Angel Yeast Co., Ltd.) is 5000 U / L.

[0043] The reactor used in the reaction process of the present invention: the multi-enzyme cascade reaction adopts continuous tubular reaction or intermittent reaction. In order to avoid the feedback inhibition of substrate and product on enzyme, the effect of using a continuously operated tubular reactor is better than that of intermittent reaction; chemical addition and oxidation reactions adopt intermittent reaction.

[0044] In the steps of the present invention, ultrafiltration concentration is adopted after the enzyme catalytic reaction: after each stage of enzymatic reaction, an ultrafiltration device with a membrane pore size of 10-35kD can be selected to separate the enzyme and the small molecule product, and the product enters the next stage of enzyme reaction in the permeate, and the enzyme liquid can be recycled and reused. Generally, the enzyme can be recycled at least 5 times, and the enzyme activity is still more than 80%. The second continuous reaction system only needs to supplement about 20% of the liquid enzyme preparation.

[0045] In the process of preparing PPO by enzyme reaction of the present invention, the yield of the serial enzymatic reaction in the tubular reactor reaches more than 86%; and the yield of the intermittent reaction reaches more than 75%.

[0046] Beneficial effects of the present invention:

[0047] The invention uses three readily available raw materials, namely, diethyl methylphosphite, vinyl acetate and glycine, to perform chemical addition and oxidation reactions with high yields, and then performs two-stage enzymatic reactions of L-threonine acetalase and its mutant N294R and L-threonine deaminase to synthesize the key intermediate 4-(methylhydroxyphosphoryl)-2-carbonylbutyric acid PPO of refined glufosinate at low cost and high efficiency. Finally, L-glutamine dehydrogenase reductase and its mutant Q113E are used to perform a third-stage enzymatic reaction, and refined glufosinate is catalyzed and synthesized in a series of multi-stage tubular reactors (see the patent independently declared by this research group: Gong Dachun, Wang Delin, Zhang Shuyin, et al., Multi-enzyme cascade reaction separation coupling system and method, CN 113088443 A) or a batch reactor, wherein the coenzyme NADPH is regenerated by glucose dehydrogenase, and the enzyme after the reaction is concentrated and recycled by ultrafiltration technology to further reduce the cost. The process has the technical characteristics of readily available raw materials, low cost and high efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1Schematic diagram of the structure of the recombinant expression vector E. coli BL21 (DE3) / pet28a-ScTA for L-threonine aldolase, L-threonine deaminase and L-glutamine dehydrogenase.

[0049] Figure 2 Schematic diagram of the structure of the recombinant expression vector E.coliBL21 (DE3) / pet28a–KtTDH for L-threonine aldolase, L-threonine deaminase and L-glutamine dehydrogenase.

[0050] Figure 3 Schematic diagram of the structure of the recombinant expression vector E.coliBL21(DE3) / pet28a-CgLGDH for L-threonine aldolase, L-threonine deaminase and L-glutamine dehydrogenase. DETAILED DESCRIPTION

[0051] The present invention is further described below with reference to embodiments, but the scope of protection claimed by the present invention is not limited to the scope described in the embodiments.

[0052] Example 1

[0053] The invention discloses the expression and purification of L-threonine aldolase of mutant strain Saccharomyces cerevisiae, wherein the amino acid sequence thereof is SEQ ID NO: 1 and the DNA sequence thereof is SEQ ID NO: 2.

[0054] (1) Primer design

[0055] Primers were designed using SnapGene software and synthesized by Shanghai Bioengineering Co., Ltd.

[0056] SEQ ID NO: 8: F1:TTTGGATCCatgactgaattcgaattgcc

[0057] SEQ ID NO: 9: R1:TTTCTCGAGtcagtatttgtaggtttttatttcgc

[0058] (2) Gene amplification

[0059] The ScTA gene was amplified using the L-threonine aldolase of Saccharomyces cerevisiae TSHP (classification name: Saccharomyces cerevisiae TSHP, deposit number CCTCC NO: M 2022499, deposit unit: China Center for Type Culture Collection, deposit address: Wuhan University, Wuhan, China, deposit date: April 27, 2022) as a template and primer pair: SEQ ID NO: 8, SEQ ID NO: 9. The reaction system was: 0.5 μL genomic DNA template, 0.5 μL Phusion DNA polymerase, 10 μL Phusion GC Buffer (5X), 2.5 μL F / R (10 μmol / L), 1 μL dNTP (10 μmol / L), 1.5 μL DMSO, 1.5 μL Mg 2+ , 30 μL ddH2O. Amplification conditions: PCR reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 10 s; 64.7℃ annealing for 20 s; 72℃ extension for 45 s; 30 PCR cycles in total; and finally extension at 72℃ for 5 min.

[0060] (3) Construction of recombinant enzyme ScTA

[0061] The ScTA amplified product was double digested with restriction endonucleases EcoRI and XhoI and then cloned into an expression vector and transformed into E. coli BL21 (DE3) competent cells. After transformation, an appropriate amount of bacterial solution was spread on an LB plate containing 100 μg / mL chloramphenicol, cultured at 37°C in the dark, and positive transformants were screened. The plasmid was extracted and sequenced to obtain a cloning vector named pet28a-ScTA (e.g. Figure 1 ).

[0062] Pick a single colony containing the recombinant expression plasmid and culture it overnight in LB medium containing 100 μg / mL chloramphenicol. 600 The ratio of 4 was inoculated into 100 mL of induction medium (100 μg / mL chloramphenicol, 1 mmol / L Mg 2+ 、1mmol / L Zn 2+ ) and cultured at 23°C and 200 rpm until OD 600The concentration of IPTG was 0.6, and the final concentration was 0.4mmol / L. The cells were induced at 23℃ for 16h. The empty vector and uninduced E. coli were used as controls. The cells were collected by centrifugation, resuspended with an appropriate volume of Buffer A (20mmol / LTris, 500mmol / LNaCl, 5% glycerol, 0.5mmol / L PMSF, pH 7.5), and ultrasonically disrupted (working 2s, stopping 6s, 25min), and centrifuged (12 000rpm, 4℃, 10min) to obtain the supernatant.

[0063] The crude protein was separated and purified using a Ni-Agarose column. The supernatant of the target protein with a histidine tag was filtered through a 0.45 μm filter membrane and then loaded onto the column. The column was washed with 10 column volumes of Binding Buffer (20mmol / L Tris-HCl, 10mmol / L imidazole, 500mmol / L NaCl, pH 8.0), eluted with 20mL Elution Buffer (20mmol / L Tris-HCl, 500mmol / L imidazole, 500mmol / L NaCl, pH 8.0), and collected in separate tubes for each 1mL of effluent and stored at 4°C for use. The protein sample was detected by SDS-PAGE to obtain a recombinant enzyme ScTA with high specific enzyme activity. Its amino acid sequence is SEQ ID NO: 1. The gene sequence of the recombinant enzyme ScTA is 1164bp in length, the DNA sequence is SEQ ID NO: 2, contains 387 amino acids, has a molecular weight of 42.815kD, and has a specific enzyme activity of 2.5U / mg.

[0064] Example 2

[0065] The mutant enzyme is prepared by using site-directed mutagenesis technology to mutate the asparagine N at position 294 to arginine R, and its amino acid sequence is as shown in SEQ ID NO.3. The specific steps are as follows:

[0066] (1) Primer design

[0067] Primers were designed using SnapGene software and synthesized by Shanghai Bioengineering Co., Ltd.

[0068] SEQ ID NO: 10: N294R 2-F:gcagacaccaggtttgtctttattaacctgaaggccgctagaatg

[0069] SEQ ID NO: 11: N294R 2-R:taaagacaaacctggtgtctgctggagactctagcgggatg

[0070] (2) Mutant plasmid amplification

[0071] Phanta Max Super-Fidelity DNA Polymerase was used to amplify pet28a-ScTA. The reaction system was as follows: 1ng genomic DNA template, 1μL Phanta Max Super-Fidelity DNA Polymerase, 25μL Max Buffer (2X), 2μL F / R primer (10μmol / L), 1μL dNTP (10μmol / L), and ddH2O was added to 50μL. Amplification conditions: 95℃ pre-denaturation for 30s, 95℃ denaturation for 15s, 61℃ annealing for 15s, 72℃ extension for 60s, 30 cycles, and finally 75℃ incubation for 5min.

[0072] (3) Digestion of amplified product Dpn1

[0073] To prevent the original template plasmid from forming false positive transformants after transformation, Dpnl digestion is required before recombination circularization. The reaction system is as follows: 1 μL Dpnl, 50 μL amplified mutant plasmid. Treatment conditions: incubate at 37°C for 1 hour.

[0074] (4) Recombination reaction

[0075] The mutant plasmid after amplification is linear and needs to undergo homologous recombination under the catalysis of Exnase II enzyme to complete the circularization process.

[0076] (5) Construction of mutant enzyme N294R

[0077] The site-directed mutagenesis kit Mut Express II Fast Mutagenesis Kit V2 of Nanjing Novogene Biotech Co., Ltd. was used for site-directed mutagenesis to obtain the mutation point plasmid, which was then transformed into E. coli BL21 (DE3) competent cells to construct the mutant enzyme N294R genetic engineering bacteria. Store at -80°C.

[0078] A single colony containing the recombinant expression plasmid (recombinase ScTA) was picked and cultured overnight in LB medium containing 100 μg / mL chloramphenicol. 600 The ratio of 4 was inoculated into 100 mL of induction medium (100 μg / mL chloramphenicol, 1 mmol / L Mg 2+ 、1mmol / L Zn 2+ ) and cultured at 23°C and 200 rpm until OD 600The concentration of IPTG was 0.6, and the final concentration was 0.4mmol / L. The cells were induced at 23℃ for 16h. The empty vector and uninduced E. coli were used as controls. The cells were collected by centrifugation, resuspended with an appropriate volume of Buffer A (20mmol / L Tris, 500mmol / L NaCl, 5% glycerol, 0.5mmol / L PMSF, pH 7.5), and ultrasonically disrupted (working 2s, stopping 6s, 25min), and centrifuged (12 000rpm, 4℃, 10min) to obtain the supernatant.

[0079] The crude protein was separated and purified using a Ni-Agarose column. The supernatant of the target protein with a histidine tag was filtered through a 0.45 μm filter membrane and then loaded onto the column. The column was washed with 10 column volumes of Binding Buffer (20mmol / L Tris-HCl, 10mmol / L imidazole, 500mmol / L NaCl, pH 8.0), eluted with 20mL Elution Buffer (20mmol / L Tris-HCl, 500mmol / L imidazole, 500mmol / L NaCl, pH 8.0), and each 1mL of the effluent was collected in separate tubes and stored at 4°C for later use. The L-threonine aldolase mutant enzyme N294R was obtained. Its amino acid sequence is SEQ ID NO.3, and the liquid enzyme activity is increased by 2 times to 7000U / L.

[0080] Example 3

[0081] The L-threonine deaminase is a recombinant enzyme Kt-TDH, the amino acid sequence of the recombinant enzyme Kt-TDH is SEQ ID NO: 4, and the DNA sequence is SEQ ID NO: 5.

[0082] (1) Primer design

[0083] Primers were designed using SnapGene software and synthesized by Shanghai Bioengineering Co., Ltd.

[0084] SEQ ID NO: 12: F2: ATTGGATCCcgtgagtcatgagatccttta

[0085] SEQ ID NO: 13: R2:ATTAAGCTTgcaacaccctaacaaagtgatt

[0086] (2) Gene amplification

[0087] L-Threonine deaminase: The Kt-TDH gene was amplified by constructing a recombinant bacterium E. coli BL21 (DE3) / pet28a-Kt-TDH, expressing the thermotolerant Kluyveromyces ST (classification name: Kluyveromyces thermotolerans ST, deposit number: CCTCC NO: M 2022498, deposit unit: China Center for Type Culture Collection, deposit address: Wuhan University, Wuhan, China, deposit date: April 27, 2022) TDH threonine deaminase gene with histidine tag as a template. The reaction system is: 0.5 μL genomic DNA template, 0.5 μL Phusion DNA polymerase, 10 μL Phusion GC Buffer (5X), 2.5 μL F / R (10 μmol / L), 1 μL dNTP (10 μmol / L), 1.5 μL DMSO, 1.5 μL Mg 2+ , 30μL ddH2O. Amplification conditions: PCR reaction conditions: 95℃ pre-denaturation for 3min; 95℃ denaturation for 10s; 64.7℃ annealing for 20s; 72℃ extension for 45s; 30 PCR cycles in total; and finally extension at 72℃ for 5min.

[0088] (3) Construction of recombinant enzyme Kt-TDH

[0089] The KtTDH amplified product was double digested with restriction endonucleases EcoRI and XhoI and cloned into an expression vector, and transformed into E. coli BL21 (DE3) competent cells. After transformation, an appropriate amount of bacterial solution was spread on an LB plate containing 100 μg / mL chloramphenicol, cultured at 37°C in the dark, and positive transformants were screened. The plasmid was extracted and sequenced to obtain a cloning vector named pet28a-KtTDH (such as Figure 2 ).

[0090] Pick a single colony containing the recombinant expression plasmid and culture it overnight in LB medium containing 100 μg / mL chloramphenicol. 600 The ratio of 4 was inoculated into 100 mL of induction medium (100 μg / mL chloramphenicol, 1 mmol / L Mg 2+ 、1mmol / L Zn 2+ ) and cultured at 23°C and 200 rpm until OD 600The concentration of IPTG was 0.6, and the final concentration was 0.4mmol / L. The cells were induced at 23℃ for 16h. The empty vector and uninduced E. coli were used as controls. The cells were collected by centrifugation, resuspended with an appropriate volume of Buffer A (20mmol / LTris, 500mmol / L NaCl, 5% glycerol, 0.5mmol / L PMSF, pH 7.5), and ultrasonically disrupted (working for 2s, stopping for 6s, 25min), and centrifuged (12 000rpm, 4℃, 10min) to obtain the supernatant.

[0091] The crude protein was separated and purified using a Ni-Agarose column. The supernatant of the target protein with a histidine tag was filtered through a 0.45 μm filter membrane and then loaded onto the column. The supernatant was washed with 10 column volumes of Binding Buffer (20mmol / L Tris-HCl, 10mmol / L imidazole, 500mmol / L NaCl, pH 8.0), eluted with 20mL Elution Buffer (20mmol / L Tris-HCl, 500mmol / L imidazole, 500mmol / L NaCl, pH 8.0), and collected in separate tubes for each 1mL of effluent and stored at 4°C for use. The protein sample was detected by SDS-PAGE to obtain a recombinant enzyme Kt-TDH with high specific enzyme activity. Its amino acid sequence is SEQ ID NO.4, and its DNA sequence is SEQ ID NO: 5. The gene sequence of the recombinant enzyme Kt-TDH is 1722bp in length, contains 573 amino acids, has a molecular weight of 63.199kD, and has a specific enzyme activity of 3.5U / mg.

[0092] Example 4

[0093] Expression, purification and amino acid sequence of L-glutamate dehydrogenase from strain Corynebacterium glutamicumB1 SEQ ID NO:6.

[0094] (1) Primer design

[0095] SEQ ID NO: 14: F3:TTTGGATCCatgactgaattcgaattgcc

[0096] SEQ ID NO: 15: R3:TTTCTC GAGtcagtatttgtaggtttttatttcgc

[0097] (2) Gene amplification

[0098] The CgGDH gene was amplified using Corynebacterium glutamicumB1 (Corynebacterium glutamicumB1 was taken from the patent publication 109971676A, accession number CCTCC NO: M 2019118) as a template. The reaction system was: 0.5 μL genomic DNA template, 0.5 μL Phusion DNA polymerase, 10 μL PhusionGC Buffer (5X), 2.5 μL F / R (10 μmol / L), 1 μL dNTP (10 μmol / L), 1.5 μL DMSO, 1.5 μL Mg 2+ , 30 μL ddH2O. Amplification conditions: PCR reaction conditions: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 10 s; 64.7℃ annealing for 20 s; 72℃ extension for 45 s; 30 PCR cycles in total; and finally extension at 72℃ for 5 min.

[0099] (3) Construction of recombinant enzyme CgGDH

[0100] The GDH amplified product was double-digested with restriction endonucleases EcoRI and XhoI and cloned into the expression vector, and transformed into E. coli BL21 (DE3) competent cells. After transformation, an appropriate amount of bacterial solution was spread on an LB plate containing 100 μg / mL chloramphenicol, cultured at 37°C in the dark, and positive transformants were screened. The plasmid was extracted and sequenced to obtain the cloning vector, which was named pet28a-GDH (such as Figure 3 ).

[0101] Pick a single colony containing the recombinant expression plasmid and culture it overnight in LB medium containing 100 μg / mL chloramphenicol. 600 The ratio of 4 was inoculated into 100 mL of induction medium (100 μg / mL chloramphenicol, 1 mmol / L Mg 2+ 、1mmol / L Zn 2+ ) and cultured at 23°C and 200 rpm until OD 600 The concentration of IPTG was 0.6, and the final concentration was 0.4mmol / L. The cells were induced at 23℃ for 16h. The empty vector and uninduced E. coli were used as controls. The cells were collected by centrifugation, resuspended with an appropriate volume of Buffer A (20mmol / LTris, 500mmol / L NaCl, 5% glycerol, 0.5mmol / L PMSF, pH 7.5), and ultrasonically disrupted (working for 2s, stopping for 6s, 25min), and centrifuged (12 000rpm, 4℃, 10min) to obtain the supernatant.

[0102] The crude protein was separated and purified using a Ni-Agarose column. The supernatant of the target protein with a histidine tag was filtered through a 0.45 μm filter membrane and then loaded onto the column. The supernatant was washed with 10 column volumes of Binding Buffer (20mmol / L Tris-HCl, 10mmol / L imidazole, 500mmol / L NaCl, pH 8.0), eluted with 20mL Elution Buffer (20mmol / L Tris-HCl, 500mmol / L imidazole, 500mmol / L NaCl, pH 8.0), and collected in separate tubes for each 1mL of effluent and stored at 4°C for later use. The protein sample was detected by SDS-PAGE to obtain a recombinant enzyme CgGDH with high enzyme activity. Its amino acid sequence is SEQ ID NO: 6. The recombinant enzyme CgGDH gene sequence is 1344bp in length, 447 amino acids, and has a molecular weight of 48.988kD.

[0103] Example 5

[0104] The mutant enzyme Q113E of L-glutamate dehydrogenase is prepared by site-directed mutagenesis, wherein the glutamine Q at position 113 is mutated to glutamate E, and its amino acid sequence is shown in SEQ ID NO: 7. The specific steps are as follows:

[0105] (1) Primer design

[0106] Primers were designed using SnapGene software and synthesized by Shanghai Bioengineering Co., Ltd.

[0107] SEQ ID NO: 16: Q113E 2-f: TTTGAATTCatg acagttgatgag caggtc

[0108] SEQ ID NO: 17: Q113E 2-r: TTTTCCG AG ttagat gacgccctg tgcca

[0109] (2) Mutant plasmid amplification

[0110] Phanta Max Super-Fidelity DNA Polymerase was used to amplify pet28a-ScTA. The reaction system was as follows: 1ng genomic DNA template, 1μL Phanta Max Super-Fidelity DNA Polymerase, 25μL Max Buffer (2X), 2μL F / R primer (10μmol / L), 1μL dNTP (10μmol / L), and ddH2O was added to 50μL. Amplification conditions: 95℃ pre-denaturation for 30s, 95℃ denaturation for 15s, 61℃ annealing for 15s, 72℃ extension for 60s, 30 cycles, and finally 75℃ incubation for 5min.

[0111] (3) Digestion of amplified product Dpn1

[0112] To prevent the original template plasmid from forming false positive transformants after transformation, Dpnl digestion is required before recombination circularization. The reaction system is as follows: 1 μL Dpnl, 50 μL amplified mutant plasmid. Treatment conditions: incubate at 37°C for 1 hour.

[0113] (4) Recombination reaction

[0114] The mutant plasmid after amplification is linear and needs to undergo homologous recombination under the catalysis of Exnase II enzyme to complete the circularization process.

[0115] (5) Construction of mutant enzyme Q113E

[0116] The site-directed mutagenesis kit Mut Express II Fast Mutagenesis Kit V2 of Nanjing Novogene Biotech Co., Ltd. was used for site-directed mutagenesis to obtain the mutation point plasmid, which was then transformed into E. coli BL21 (DE3) competent cells to construct the mutant enzyme Q113E genetic engineering bacteria. Store at -80°C.

[0117] A single colony containing the recombinant expression plasmid (recombinase CgGDH genetic engineering bacteria) was picked and cultured overnight in LB medium containing 100 μg / mL chloramphenicol. 600 The ratio of 4 was inoculated into 100 mL of induction medium (100 μg / mL chloramphenicol, 1 mmol / L Mg 2+ 、1mmol / L Zn 2+ ) and cultured at 23°C and 200 rpm until OD 600The concentration of IPTG was 0.6, and the final concentration was 0.4mmol / L. The cells were induced at 23℃ for 16h. The empty vector and uninduced E. coli were used as controls. The cells were collected by centrifugation, resuspended with an appropriate volume of Buffer A (20mmol / L Tris, 500mmol / L NaCl, 5% glycerol, 0.5mmol / L PMSF, pH7.5), and ultrasonically disrupted (working for 2s, stopping for 6s, 25min), and centrifuged (12 000rpm, 4℃, 10min) to obtain the supernatant.

[0118] The crude protein was separated and purified using a Ni-Agarose column. The supernatant of the target protein with a histidine tag was filtered through a 0.45 μm filter membrane and then loaded onto the column. The column was washed with 10 column volumes of Binding Buffer (20mmol / L Tris-HCl, 10mmol / L imidazole, 500mmol / L NaCl, pH 8.0), eluted with 20mL Elution Buffer (20mmol / L Tris-HCl, 500mmol / L imidazole, 500mmol / L NaCl, pH 8.0), and each 1mL of the effluent was collected in a separate tube and stored at 4°C for use. The L-glutamine dehydrogenase mutant enzyme Q113E was obtained. Its amino acid sequence is SEQ ID NO.7, and the enzyme activity of the liquid enzyme preparation is increased by 2 times to 7000U / L.

[0119] Example 6

[0120] Glucose dehydrogenase: provided by the Enzyme Division of Angel Yeast Co., Ltd., with the authorized patent CN107779459 A. The strain is Escherichia coli A149-170, which is deposited in the China Center for Type Culture Collection with the deposit number CCTCC M2016102. The DNA molecule encodes an amino acid sequence such as SEQ ID NO.18, the DNA sequence is SEQ ID NO.19, the molecular weight is about 30kD, and the enzyme activity of the provided liquid enzyme preparation is 5000U / L.

[0121] Example 7

[0122] Synthesis of 2-(Ethoxy-methylphosphoryl)-ethanol

[0123] In an anhydrous ethanol reactor containing 100 g / L vinyl acetate, 0.02% of the total reaction mass of hydroquinone was added, the temperature was controlled at 5°C, diethyl methyl phosphite was added dropwise, and an addition rearrangement reaction was carried out for 3 hours, and then refluxed in 30% hydrochloric acid at normal pressure for 3 hours, and distilled under reduced pressure to obtain 2-(ethoxy-methylphosphoryl)-ethanol, with a yield of 96.5% and a product purity of more than 99.5%. 1HNMR(500MHz, DMSO),1.14(m,3H,-PCH3),1.56-1.69(m,3H,CH3CH2-O-),1.93(t, 2H,-PCH2CH2-OH),2.3(s,H,-PCH2CH2-OH),4.13(m,2H,-PCH2CH2-OH),4.38-4.49 (m,2H,CH3CH2-O-).

[0124] Because the solution of diethyl methyl phosphite decomposes when it comes into contact with water, an anhydrous environment is used. Since it is an addition rearrangement reaction, it is better to use anhydrous ethanol. If anhydrous methanol is used, side reactions may increase.

[0125] The mass concentration of hydrochloric acid is 30%. Because it is refluxed at normal pressure, the general temperature is around 100°C. The reaction that occurs is as follows:

[0126]

[0127] If the temperature is too low, such as -5°C, the reaction rate will be slow and the yield will decrease. If the reaction temperature is too high, exceeding 10 degrees, the reaction will release a lot of heat, which will lead to side reactions.

[0128] Example 8

[0129] Synthesis of 2-(Ethoxy-methylphosphoryl)-acetaldehyde

[0130] The liquid space velocity of 80 g / L 2-(ethoxy-methylphosphoryl)-ethanol prepared in Example 7 was controlled at 0.8-2 h -1 , added to a fixed bed reactor, the total amount of silica-supported copper oxide catalyst loaded in the reactor was 300 g / L, wherein the mass fraction of CuO was ≥19% (Shanghai Xunkai New Material Technology Co., Ltd.), 2.4 L / h of oxygen was introduced, the reaction temperature was controlled at 100°C, the reaction pressure was controlled at 0.10 MPa, and 2-(ethoxy-methylphosphoryl)-acetaldehyde was obtained with a yield of 98.4% and a product purity of 99.8%.

[0131] 1 HNMR(500MHz, DMSO),1.14(m,3H,-PCH3),1.56-1.69(m,3H,CH3CH2-O-),2.83(t,2H ,-PCH2CH2-CHO),4.13(m,2H,-PCH2CH2-OH),4.38-4.49(m,2H,CH3CH2-O-),10.2(m, H,-PCH2CH2-CHO).

[0132] Example 9

[0133] 4-(Methylhydroxyphosphoryl)-threonine

[0134] (1) In a tubular reactor, 150 g / L of 2-(ethoxy-methylphosphoryl)-acetaldehyde (prepared in Example 8) and 75 g / L of glycine, 2.25 g / L of L-threonine aldolase, 20 mg / L of coenzyme pyridoxal phosphate (PLP) (85 μmol / L), and 9.5 mg / L of MnCl2 (75 μmol / L) were introduced at a flow rate of 100 kg / h. The pH was controlled at 8 by 0.1 mol / L Tris-HCl to form an aldolase conversion system. The reaction temperature was 35° C. and the reaction was carried out for 10 hours. The reaction was then carried out by a 30 kD ultrafiltration system to separate the reactant product and the enzyme to obtain the 2-(ethoxy-methylphosphoryl)-ethanol product. The yield of the product was 98.1% and the purity was 98.8%.

[0135] (2) The L-threonine aldolase separated in the above step still retains 96.2% of its enzyme activity. The raw materials (including 2-(ethoxy-methylphosphoryl)-acetaldehyde, glycine, coenzyme pyridoxal phosphate, and MnCl2) are added in the same steps and process conditions as above. At the same time, the L-threonine aldolase separated and recovered is added, and 0.086 g / L of L-threonine aldolase is added to carry out enzymatic reaction to obtain 2-(ethoxy-methylphosphoryl)-ethanol product. The yield of the product is 97.3% and the purity is 98.6%.

[0136] (3) The L-threonine aldolase in step (2) was recovered again, and the enzyme activity was still retained at 91.5%. 0.19 g / L of L-threonine aldolase was added to carry out an enzymatic reaction to obtain a 2-(ethoxy-methylphosphoryl)-ethanol product with a yield of 95.2% and a purity of 98.6%.

[0137] (4) The L-threonine acetalase in step (3) was recovered again, and the enzyme activity was still retained at 87.6%. 0.28 g / L of L-threonine acetalase was added to carry out enzymatic reaction to obtain 2-(ethoxy-methylphosphoryl)-ethanol product. The yield of the product was 93.9% and the purity was 98.5%.

[0138] (5) The L-threonine acetalase in step (4) was recovered again, and the enzyme activity was still retained at 85.2%. 0.33 g / L of L-threonine acetalase was added to carry out enzymatic reaction to obtain 2-(ethoxy-methylphosphoryl)-ethanol product. The yield of the product was 92.6% and the purity was 97.8%.

[0139] (6) The L-threonine acetalase in step (5) was recovered again, and the enzyme activity was still 81.4%. 0.42 g / L of L-threonine acetalase was added to carry out enzymatic reaction to obtain 2-(ethoxy-methylphosphoryl)-ethanol product. The yield of the product was 92.1% and the purity was 97.3%.

[0140] Example 10

[0141] 4-(Methylhydroxyphosphoryl)-threonine

[0142] (1) In a tubular reactor, 150 g / L of 2-(ethoxy-methylphosphoryl)-acetaldehyde (prepared in Example 8) and 75 g / L of glycine, 1.2 / L of L-threonine aldolase mutant enzyme N294R, 20 mg / L of coenzyme pyridoxal phosphate (PLP) (85 μmol / L), and 9.5 mg / L of MnCl2 (75 μmol / L) were introduced at a flow rate of 100 kg / h. The pH was controlled to 8.2 using 0.1 mol / L Tris-HCl to form an aldolase conversion system. The reaction temperature was 35° C. and the reaction was carried out for 10 hours. The reaction was then introduced into a 30 kD ultrafiltration system to separate the reactant product and the enzyme to obtain a 2-(ethoxy-methylphosphoryl)-ethanol product. The yield of the product was 98.5% and the purity was 99.1%.

[0143] (2) The L-threonine aldolase separated in the above step still retains 97.3% of its enzyme activity. The same steps and process conditions as above are followed to add various raw materials (raw materials include 2-(ethoxy-methylphosphoryl)-acetaldehyde, glycine, coenzyme pyridoxal phosphate, and MnCl2), and at the same time add the L-threonine aldolase separated and recovered as above, supplemented with 0.03 g / L of the L-threonine aldolase mutant enzyme N294R, and perform enzymatic reaction to obtain 2-(ethoxy-methylphosphoryl)-ethanol product. The yield of the product is 98.1% and the purity is 98.7%.

[0144] (3) The L-threonine acetalase in step (2) was recovered again, and the enzyme activity was still retained at 91.5%. 0.1 g / L of the L-threonine acetalase mutant enzyme N294R was added to carry out an enzymatic reaction to obtain a 2-(ethoxy-methylphosphoryl)-ethanol product with a yield of 97.5% and a purity of 98.3%.

[0145] (4) The L-threonine acetalase in step (3) was recovered again, and the enzyme activity was still retained at 87.6%. 0.15 g / L of the L-threonine acetalase mutant enzyme N294R was added to carry out an enzymatic reaction to obtain a 2-(ethoxy-methylphosphoryl)-ethanol product with a yield of 97.1% and a purity of 98.1%.

[0146] (5) The L-threonine acetalase in step (4) was recovered again, and the enzyme activity was still retained at 85.2%. 0.18 g / L of the L-threonine acetalase mutant enzyme N294R was added to carry out an enzymatic reaction to obtain a 2-(ethoxy-methylphosphoryl)-ethanol product. The yield of the product was 96.5% and the purity was 97.8%.

[0147] (6) The L-threonine aldolase in step (5) was recovered again, and the enzyme activity was still retained at 81.4%. 0.22 g / L of L-threonine aldolase mutant enzyme N294R was added to carry out enzymatic reaction to obtain 2-(ethoxy-methylphosphoryl)-ethanol product. The yield of the product was 95.3% and the purity was 97.5%.

[0148] Embodiment 11

[0149] Preparation of 4-(Methylhydroxyphosphoryl)-2-oxobutyric acid PPO

[0150] The feed flow rate of 2-(ethoxy-methylphosphoryl)-acetaldehyde, glycine, and L-threonine deaminase was controlled at 80 kg / h, wherein the concentrations of 2-(ethoxy-methylphosphoryl)-acetaldehyde and glycine substrates were 197 g / L and 80 g / L, respectively. 3.94 g / L of L-threonine deaminase prepared in Example 3 (2% of the mass of the substrate) was added. The reaction temperature was 40°C, the reaction pH was 7.5, the reaction was continued for 10 hours, and then the mixture was fed into an ultrafiltration system. The pore size of the membrane material was 30 kD. The permeate containing PPO was concentrated under reduced pressure and crystallized to obtain PPO. The product purity was 99.5% and the yield was 92.5%. 1 HNMR(500MHz, DMSO),1.32(d,J=21.8,13.5,3H,-PCH3),1.85-1.78(m,2H,-PCH2CH2CO-),2.52(d,J-9.8,7.5Hz,2H, -PCH2CH2 CO-),10.91(s,2H,OH).

[0151] The L-threonine deaminase with an enzyme recovery rate of 98.1% in the ultrafiltration system was returned to the tubular reactor, and the same mass of 2-(ethoxy-methylphosphoryl)-ethanol in the above step was added again. When the L-threonine deaminase was recycled for 6 times, the enzyme activity of the L-threonine deaminase was still 86.3%, and the PPO yield was 91.9%.

[0152] Example 12 Preparation of refined glufosinate (L-glufosinate)

[0153] In a tubular enzymatic reactor, at a feed rate of 150 g / h, the feed liquid contains 180 g / L of substrate PPO (prepared in Example 11), 9 g / L of L-glutamine dehydrogenase mutant Q113E (5% of the mass of PPO), 100 g / L of auxiliary substrate glucose, 2 g / L of glucose dehydrogenase (2% of the mass of glucose), the reaction temperature is 30°C, the reaction pH is 8, the reaction is continued for 7 hours, and then enters the ultrafiltration system. The pore size of the membrane material is 30 kD to obtain refined glufosinate (L-glufosinate), and the tubular reaction conversion rate reaches 95.6%. After the reaction is completed, the mixed solution is subjected to a 20 kD ultrafiltration to separate the residual enzyme and small molecular substances. The inlet pressure is controlled at 0.1-1.0 MPa, the reflux pressure is controlled at 0.05-0.1 MPa, and the average membrane flux reaches 80-120 L / (m 2 h), collect the small molecule permeate containing the product, reduce pressure and concentrate, feed concentration is 100g / L on the ion exchange column, adjust pH to 6, use D318 anion exchange resin, static adsorption at 25°C, separate other liquids through a 30-60 mesh screen, remove impurities from the saturated resin with ultrapure water, wash the resin and place it in a desorption column to desorb with dilute ammonia water, concentrate with a thin film evaporator, add activated carbon to decolorize the concentrate, filter, and dry the filtrate with a spray dryer to obtain the refined glufosinate ammonium product. The yield is 98%, and the optical purity of the product is 99.6%. After nuclear magnetic detection, 1 HNMR (300MHz, D2O) δ: 1.12 (d, J=13.50Hz, 3H); 1.86-1.94 (m, 2H); 1.34-1.58 (m, 2H), 3.64 (t, J=5.9Hz, 1H). mp 208.5-211℃, [α] D 19.5 =+16.02°C (c=0.70, H2O), ee>99.6%.

[0154] The L-glutamine dehydrogenase mutant Q113E was recovered by an ultrafiltration system with an enzyme recovery rate of 97.6%. The product was returned to the tubular reactor, and the same mass of PPO, glucose, and glucose dehydrogenase in the above steps were added again. After recycling for 6 times, refined glufosinate (L-glufosinate) was obtained with a product yield of more than 87.8% and a purity of 99.6%.

[0155] Example 13 Preparation of refined glufosinate (L-glufosinate)

[0156] In a tubular enzymatic reactor, at a feed rate of 150 g / h, the feed solution contains 180 g / L of substrate PPO (prepared in Example 11), 5.4 g / L of L-glutamine dehydrogenase, 100 g / L of auxiliary substrate glucose, 2 g / L of glucose dehydrogenase (2% by mass of glucose), the reaction temperature is 30°C, the reaction pH is 8.2, the reaction is continued for 7 hours, and then enters the ultrafiltration system. The pore size of the membrane material is 30 kD to obtain refined glufosinate (L-glufosinate). After the reaction is completed, the mixed solution is subjected to a 20 kD ultrafiltration to separate the residual enzyme and small molecular substances. The inlet pressure is controlled at 0.1-1.0 MPa, the reflux pressure is controlled at 0.05-0.1 MPa, and the average membrane flux reaches 80-120 L / (m 2 h), collect the small molecule permeate containing the product, concentrate under reduced pressure, and on the ion exchange column, the feed concentration is 100g / L, the pH is adjusted to 6, and D318 anion exchange resin is used for static adsorption at 25°C. Other liquids are separated through a 30-60 mesh screen. The saturated resin is decontaminated with ultrapure water. After washing, the resin is placed in a desorption column and desorbed with dilute ammonia water. The desorbed liquid is concentrated with a thin film evaporator, and the concentrated liquid is decolorized with activated carbon and filtered. The filtrate is dried with a spray dryer to obtain the refined glufosinate ammonium product. The yield is 97.5%, and the optical purity of the product is 99.4%. After nuclear magnetic detection, 1 HNMR (300MHz, D2O) δ: 1.12 (d, J=13.50Hz, 3H); 1.86-1.94 (m, 2H); 1.34-1.58 (m, 2H), 3.64 (t, J=5.9Hz, 1H). mp 208.5-211℃,[α] D 19.5 =+16.02°C (c=0.70, H2O), ee>99.6%.

[0157] An ultrafiltration system is used, and the L-glutamine dehydrogenase with an enzyme recovery rate of more than 96.5% (enzyme activity) each time is returned to the tubular reactor, and the same mass of PPO, glucose, and glucose dehydrogenase in the above steps are added again. When it is recycled for 6 times, refined glufosinate (L-glufosinate) is obtained, and the product yield is 86.5% and the purity is 99.5%.

[0158] The above examples only express the preferred embodiments of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the present invention. It should be pointed out that, for those of ordinary skill in the art, several modifications, improvements and substitutions can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the attached claims. Sequence Listing <110> Hubei Taisheng Chemical Co., Ltd. <120> 4-(Methylhydroxyphosphoryl)-2-oxobutyric acid, a key intermediate of L-phosphinothricin <160> Total number 19 <210> 1 <211> 387 <212> PRT <213> Artificial sequence <223> Recombinase ScTA <400> 1 MTEFELPPKY ITAANDLRSD TFTTPTAEMM EAALEASIGD AVYGEDVDTV RLEQTVARMA GKEAGLFCVS GTLSNQIAIR THLMQPPYSI LCDYRAHVYT HEAAGLAILS QAMVVPVVPS NGDYLTLEDI KSHYVPDDGD IHGAPTRLIS LENTLHGIVY PLEELVRIKA WCMENGLKLH CDGARIWNAA AQSGVPLKQY GEIFDSISIC LSKSMGAPIG SVLVGNLKFV KKATHFRKQQ GGGIRQSGMM ARMALVNINN DWKSQLLYSH SLAHELAEYC EAKGIPLESP ADTNFVFINL KAARMDPDVL VKKGLKYNVK LMGGRVSFHY QVTRDTLEKV KLAISEAFDY AKEHPFDCNG PTQIYRSEST EVDVDGNAIR EIKTYKY <210> 2 <211> 1164 <212> DNA <213> Artificial sequence <223> DNA sequence of the recombinase ScTA <400> 2 atgactgaat tcgaattgcc tccaaaatat atcaccgctg ctaacgactt gcggtcagac 60 acattcacca ctccaactgc agagatgatg gaggccgctt tagaggcctc tatcggtgac 120 gctgtctacg gtgaagatgt tgacaccgtt aggctcgaac agaccgttgc ccgcatggct 180 ggcaaagaag caggtttgtt ctgtgtctct gggactttgt ccaaccagat tgccatcaga 240 actcacttga tgcaacctcc atactctatt ctatgtgatt acagggctca cgtttacact 300 cacgaagccg ctggactggc gatcttgtct caagcgatgg tggttcctgt ggttccttcc 360 aacggtgact acttgacctt ggaagacatc aagtcacact acgtcccaga cgacggtgat 420 attcacggtg cccccaccag attgatttct ctggaaaaca ctttacacgg tattgtttat 480 ccattggaag aactggtccg catcaaagct tggtgtatgg aaaatggtct caaactacat 540 tgtgacggtg ccagaatctg gaatgccgct gcacaatctg gcgtgccatt aaagcaatat 600 ggggaaatct tcgactccat ctccatctgt ctatccaagt ctatgggtgc tcctattggg 660 tccgtcttgg ttgggaacct taagtttgtc aagaaggcca cccatttcag aaaacaacaa 720 ggtggtggta ttagacaatc tggtatgatg gctagaatgg ctcttgtaaa catcaacaac 780 gattggaagt cccaattgct gtactcgcac tctttggctc atgaattagc cgaatattgt 840 gaggcaaagg gcatcccgct agagtctcca gcagacacca actttgtctt tattaacctg 900 aaggccgcta gaatggaccc agatgtcctt gttaagaagg gtttgaagta caacgttaag 960 ctaatgggtg gtagagtctc gttccactat caagtcacca gagatacttt ggaaaaagtc 1020 aaattggcca tctccgaggc cttcgactat gctaaagaac atcctttcga ctgtaacgga 1080 cctacccaga tttaccgtag tgaatccacc gaggtcgacg ttgatggcaa cgctatccgc 1140 gaaataaaaa cctacaaata ctga 1164 <210>3 <211>387 <212>PRT <213>Artificial Sequence <223>L-Threonine Aldolase Mutant Enzyme N294R <400>3 MTEFELPPKY ITAANDLRSD TFTTPTAEMM EAALEASIGD AVYGEDVDTV RLEQTVARMA GKEAGLFCVS GTLSNQIAIR THLMQPPYSI LCDYRAHVYT HEAAGLAILS QAMVVPVVPS NGDYLTLEDI KSHYVPDDGD IHGAPTRLIS LENTLHGIVY PLEELVRIKA WCMENGLKLH CDGARIWNAA AQSGVPLKQY GEIFDSISIC LSKSMGAPIG SVLVGNLKFV KKATHFRKQQ GGGIRQSGMM ARMALVNINN DWKSQLLYSH SLAHELAEYC EAKGIPLESP ADTRFVFINL KAARMDPDVL VKKGLKYNVK LMGGRVSFHY QVTRDTLEKV KLAISEAFDY AKEHPFDCNG PTQIYRSEST EVDVDGNAIR EIKTYKY <210>4 <211>573 <212>PRT <213>Artificial Sequence <223>Recombinase Kt-TDH <400>4 MASKISSQEL KMSSTLLTRT RPALVSRFLL RYQSSAVANL QKLHAKLNPD ELLPDSTPDY VRLILRSSVY DVIEESPITR GVGLSSRLNT NVQLKREDLL PVFSFKLRGA YNMMAKLSEA QKNQGVIACS AGNHAQGVAF ASRHLNIPAI IVMPVNTPSI KYQNVSRLGG QVVLYGNDFD EAKTECTRIS EERGLTNIPP FDHPYVIAGQ GTVAMEILRQ VHNAAKIGAV FVPVGGGGLV AGVAAYLKRI APHIKIIGVE TYDSATLKTS LEAGTRTPLS TVGTFADGTS VRMIGEETFR ICQDLVDDVI LVNTDEICAA VKDIFEDTRS IVEPSGALAV AGLKKYVTQV HPDVDHSKKT YVPILSGANM NFDRLRFVSE RAVLGEGKEV FMLVTIPDVP GSFKQLQRVI HPRAVTEFSY RYNEHRHSSA SDVPKAYIYT SFSVVDREKE IKQVLQQLHG LGFDAVDISD NEMAKSHGRY LVGGASKVPN EKIVSFEFPE RPGALTKFLD GMSDSWNLTL FHYRNHGSDV GKVLAGVSVS AEDNEGFQKF LDDLGYKYQD ETNNMVYQKF LKF <210>5 <211>1722 <212>DNA <213>Artificial sequence <223>DNA sequence of recombinase Kt-TDH <400>5 atggcatcaa agatctcgtc acaagagctc aagatgtctt cgacactgct gactcgcacg 60 aggcctgccc tcgtctcaag gttcttgcta cgctatcaat ctagcgccgt cgcaaacctt 120 caaaagttgc atgctaaact caaccctgat gagcttttgc ccgacagcac gccagactat 180 gtgcggttga tcttgaggtc ctcggtgtac gatgtcatag aagagtcacc aataacccgc 240 ggtgttggat tatcgtctcg cctcaacact aatgtccagc tcaaaagaga ggacttgctg 300 ccagttttct cgttcaagct gcgtggagca tacaacatga tggccaagct gtcagaagct 360 caaaaaaacc agggtgttat agcttgttct gccggtaacc atgcccaggg tgttgctttt 420 gcatccaggc atctaaacat acccgctatt atcgtcatgc ctgttaacac accttccatc 480 aagtaccaga atgtctccag acttggaggc caggtggtgc tgtacggtaa cgacttcgat 540 gaagccaaga ctgaatgcac cagaatctct gaagaaagag ggctgacaaa catccctcct 600 ttcgaccatc catatgtcat tgcgggacag ggcactgtcg ccatggaaat tttgagacag 660 gtccacaatg cggcaaagat cggcgcagtt ttcgtgccag ttggcggtgg cggtttagtc 720 gctggtgttg ctgcttactt gaagagaatt gcaccacaca tcaagatcat cggcgttgag 780 acttacgact ctgcaactct taagacatcg cttgaagctg gtactcgcac cccattgagc 840 actgttggaa cttttgctga tggtacttcc gttcgcatga tcggtgaaga gactttccgt 900 atctgccagg atcttgttga cgatgttatt ttggtgaaca cagacgaaat ctgcgctgca 960 gtaaaggata tcttcgaaga cactagaagc attgtcgagc catcaggcgc tctagctgtt 1020 gctggtctca aaaagtacgt tacacaagtg caccctgatg ttgaccactc caagaaaacc 1080 tatgtgccaa tcctgtcagg tgccaacatg aactttgaca gattgagatt cgtatccgag 1140 cgtgctgtgc ttggtgaggg taaggaagtc ttcatgcttg tcaccatccc agatgtccca 1200 ggttctttca agcagctgca gcgtgttatc cacccaagag ctgtcactga attctcctac 1260 cgttacaacg aacatcgtca cagcagcgca tctgatgtgc ccaaagccta catctacact 1320 tctttcagcg ttgtggaccg tgagaaggaa atcaagcagg ttttgcagca gcttcatggc 1380 ctcggatttg atgctgtgga catttccgac aatgagatgg ccaagagtca tggaaggtat 1440 ctcgttggag gcgcctccaa ggtcccaaac gagaagattg tgtcttttga attcccagag 1500 agacccggtg ctctaacgaa gtttctggat ggaatgagcg actcctggaa cctcacgctg 1560 ttccactaca gaaaccatgg ctccgatgtg ggcaaggtct tggctggtgt ttcggtatcg 1620 gcagaggaca atgaagggtt ccaaaagttt ttggatgacc tgggatacaa gtaccaggac 1680 gagaccaaca acatggttta ccagaaattc ttgaagtttt aa 1722 <210>6 <211>447 <212>PRT <213>Artificial Sequence <223>Recombinase CgGDH <400>6 MTVDEQVSNY YDMLLKRNAG EPEFHQAVAE VLESLKIVLE KDPHYADYGL IQRLCEPERQ LIFRVPWVDD QGQVHVNRGF RVQFNSALGP YKGGLRFHPS VNLGIVKFLG FEQIFKNSLT GLPIGGGKGG SDFDPKGKSD LEIMRFCQSF MTELHRHIGE YRDVPAGDIG VGGREIGYLF GHYRRMANQH ESGVLTGKGL TWGGSLVRTE ATGYGCVYFV SEMIKAKGES ISGQKIIVSG SGNVATYAIE KAQELGATVI GFSDSSGWVH TPNGVDVAKL REIKEVRRAR VSVYADEVEG ATYHTDGSIW DLKCDIALPC ATQNELNGEN AKTLADNGCR FVAEGANMPS TPEAVEVFRE RDIRFGPGKA ANAGGVATSA LEMQQNASRD SWSFEYTDER LQVIMKNIFK TCAETAAEYG HENDYVVGAN IAGFKKVADA MLAQGVI <210>7 <211>447 <212>PRT <213>Artificial Sequence <223>L-Glutamine Dehydrogenase Mutant Enzyme Q113E <400>7 MTVDEQVSNY YDMLLKRNAG EPEFHQAVAE VLESLKIVLE KDPHYADYGL IQRLCEPERQ LIFRVPWVDD QGQVHVNRGF RVQFNSALGP YKGGLRFHPS VNLGIVKFLG FEEIFKNSLT GLPIGGGKGG SDFDPKGKSD LEIMRFCQSF MTELHRHIGE YRDVPAGDIG VGGREIGYLF GHYRRMANQH ESGVLTGKGL TWGGSLVRTE ATGYGCVYFV SEMIKAKGES ISGQKIIVSG SGNVATYAIE KAQELGATVI GFSDSSGWVH TPNGVDVAKL REIKEVRRAR VSVYADEVEG ATYHTDGSIW DLKCDIALPC ATQNELNGEN AKTLADNGCR FVAEGANMPS TPEAVEVFRE RDIRFGPGKA ANAGGVATSA LEMQQNASRD SWSFEYTDER LQVIMKNIFK TCAETAAEYG HENDYVVGAN IAGFKKVADA MLAQV <210> 8 <211> 29 <212> DNA <213> Artificial sequence <223> Primer F1 <400> 8 TTTGGATCCatgactgaattcgaattgcc <210> 9 <211> 35 <212> DNA <213> Artificial sequence <223> Primer R1 <400> 9 TTTTCCGAGtcagtatttgtaggtttttatttcgc <210> 10 <211> 45 <212> DNA <213> Artificial sequence <223> N294R 2-F <400> 10 gcagacaccaggtttgtctttattaacctgaaggccgctagaatg <210> 11 <211> 41 <212> DNA <213> Artificial sequence <223> N294R 2-R <400> 11 taaagacaaacctggtgtctgctggagactctagcgggatg <210> 12 <211> 30 <212> DNA <213> Artificial sequence <223> F2 <400> 12 ATTGGATCCcgtgagtcatgagatccttta <210> 13 <211> 30 <212> DNA <213> Artificial sequence <223> R2 <400> 13 ATTAAGCTTgcaacaccctaacaaagtgatt <210> 14 <211> 29 <212> DNA <213> Artificial sequence <223> F3 <400> 14 TTTGGATCCatgactgaattcgaattgcc <210> 15 <211> 35 <212> DNA <213> Artificial sequence <223> R3 <400> 15 TTTCTC GAGtcagtatttgtaggtttttatttcgc <210> 16 <211> 30 <212> DNA <213> Artificial sequence <223> Q113E 2-f <400> 16 TTTGAA TTCatg acagttgatgag caggtc <210> 17 <211> 29 <212> DNA <213> Artificial sequence <223> Q113E 2-r <400> 17 TTTCTCG AG ttagat gacgccctg tgcca <210> 18 <211> 261 <212> PRT <213> Artificial sequence <223>Amino acid sequence encoded by glucose dehydrogenase DNA molecule <400>18 Met Tyr Pro Asp Leu Lys Gly Lys Val Val Ala Ile Thr Gly Ala Ala Ser Gly Leu Gly Lys Ala Met Ala Ile Arg Phe Gly Lys Glu Gln Ala Lys Val Val Ile Asn Tyr Tyr Ser Asn Lys Gln Asp Pro Asn Glu Val Lys Glu Glu Val Ile Lys Ala Gly Gly Glu Ala Val Val Val Gln Gly Asp Val Thr Lys Glu Glu Asp Val Lys Asn Ile Val Gln Thr Ala Ile Lys Glu Phe Gly Thr Leu Asp Ile Met Ile Asn Asn Ala Gly Leu Glu Asn Pro Val Pro Ser His Glu Met Pro Leu Lys Asp Trp Asp Lys Val Ile Gly Thr Asn Leu Thr Gly Ala Phe Leu Gly Ser Arg Glu Ala Ile Lys Tyr Phe Val Glu Asn Asp Ile Lys Gly Asn Val Ile Asn Met Ser Ser Val His Glu Leu Ile Pro Trp Pro Leu Phe Val His Tyr Ala Ala Ser Lys Gly Gly Ile Lys Leu Met Thr Lys Thr Leu Ala Leu Glu Tyr Ala Pro Lys Gly Ile Arg Val Asn Asn Ile Gly Pro Gly Ala Ile Asn Thr Pro Ile Asn Ala Glu Lys Phe Ala Asp Pro Lys Gln Lys Ala Asp Val Glu Ser Met Ile Pro Met Gly Tyr Ile Gly Glu Pro Glu Glu Ile Ala Ala Val Ala Ala Trp Leu Ala Ser Lys Glu Ala Ser Tyr Val Thr Gly Ile Thr Leu Phe Ala Asp Gly Cys Met Thr Leu Tyr Pro Ser Phe Gln Ala Gly Arg Gly <210>19 <211>786 <212>DNA <213>Artificial Sequence <223>DNA sequence of glucose dehydrogenase <400>18 atgtatccgg atttaaaagg aaaagtcgtc gctattacag gagctgcttc agggctcgga 60 aaggcgatgg ccattcgctt cggcaaggag caggcaaaag tggttatcaa ctattatagt 120 aataaacaag atccgaacga ggtaaaagaa gaggtcatca aggcgggcgg tgaagctgtt 180 gtcgtccaag gagatgtcac gaaagaggaa gatgtaaaaa atatcgtgca aacggcaatt 240 aaggagttcg gcacactcga tattatgatt aataatgccg gtcttgaaaa tcctgtgcca 300 tctcacgaaa tgccgctcaa ggattgggat aaagtcatcg gcacgaactt aacgggtgcc 360 tttttaggaa gccgtgaagc gattaaatat ttcgtagaaa acgatatcaa gggaaatgtc 420 attaacatgt ccagtgtgca cgaactaatt ccttggccgt tatttgtcca ctatgcggca 480 agtaaaggcg ggataaagct gatgacaaag acattagcgt tggaatacgc gccgaagggc 540 attcgcgtca ataatattgg gccaggtgcg atcaacacgc caatcaatgc tgaaaaattc 600 gctgacccta aacagaaagc tgatgtagaa agcatgattc caatgggata tatcggcgaa 660 ccggaggaga tcgccgcagt agcagcctgg cttgcttcga aggaagccag ctacgtcaca 720 ggcatcacgt tattcgcgga cggctgtatg acactatatc cttcattcca ggcaggccgc 780 ggttaa 786

Claims

1. A method for preparing refined glufosinate-ammonium from 4-(methylhydroxyphosphoryl)-2-carbonylbutyric acid, characterized in that: The steps include: (1) A substrate 4-(methylhydroxyphosphoryl)-2-carbonylbutyrate, L-glutamine dehydrogenase, an auxiliary substrate glucose, and glucose dehydrogenase are mixed and introduced into a tubular reactor for reaction. After the reaction is completed, a mixed solution is obtained by separation through an ultrafiltration system. The concentration of 4-(methylhydroxyphosphoryl)-2-carbonylbutyrate is 150-200 g / L, the concentration of glucose is 30-150 g / L, and the L-glutamine dehydrogenase is an L-glutamine dehydrogenase mutant enzyme Q113E, with an amino acid sequence of SEQ ID NO: 7; (2) The mixed solution obtained in step (1) is subjected to ultrafiltration, resin adsorption, screen filtration, washing with ultrapure water, and then desorbed with dilute ammonia water. The desorbed solution is concentrated by a thin film evaporator, the concentrated solution is decolorized by activated carbon, filtered, and the filtrate is dried by a spray dryer to obtain refined glufosinate ammonium.

2. The method for preparing refined glufosinate-ammonium from 4-(methylhydroxyphosphoryl)-2-carbonylbutyric acid according to claim 1, characterized in that: The glucose dehydrogenase is provided by the enzyme preparation division of Angel Yeast Co., Ltd. The strain is Escherichia coli A149-170, which is deposited in the China Center for Type Culture Collection with a deposit number of CCTCCM2016102, an amino acid sequence of SEQID NO.18, and a DNA sequence of SEQID NO.

19.

3. The method for preparing refined glufosinate-ammonium from 4-(methylhydroxyphosphoryl)-2-carbonylbutyric acid according to claim 1, characterized in that: In step (1), the amount of L-glutamine dehydrogenase added is 2-6% of the mass of 4-(methylhydroxyphosphoryl)-2-carbonylbutyric acid.

4. The method for preparing refined glufosinate-ammonium from 4-(methylhydroxyphosphoryl)-2-carbonylbutyric acid according to claim 3, characterized in that: In step (1), the amount of L-glutamine dehydrogenase added is 1-5% of the mass of 4-(methylhydroxyphosphoryl)-2-carbonylbutyric acid.

5. The method for preparing refined glufosinate-ammonium from 4-(methylhydroxyphosphoryl)-2-carbonylbutyric acid according to claim 4, characterized in that: In step (1), 4-(methylhydroxyphosphoryl)-2-carbonylbutyrate, L-glutamine dehydrogenase, auxiliary substrate glucose, and glucose dehydrogenase are mixed and fed into a tubular reactor at a feed rate of 100-200 g / h.

6. The method for preparing refined glufosinate-ammonium from 4-(methylhydroxyphosphoryl)-2-carbonylbutyric acid according to claim 5, characterized in that: In step (1), the reaction temperature is 25-55° C. and the reaction pH is 6.5-8.

5.

7. The method for preparing refined glufosinate-ammonium from 4-(methylhydroxyphosphoryl)-2-carbonylbutyric acid according to claim 1, characterized in that: The ultrafiltration conditions of the mixed solution obtained in step (2) are: at an inlet pressure of 0.1-1.0 MPa, a reflux pressure of 0.05-0.1 MPa, and an average membrane flux of 80-120 L / (m 2 h); The static adsorption conditions are: using D318 anion exchange resin for static adsorption at 20-40°C and pH 4-7; the mass concentration of dilute ammonia water during the desorption process is 10-15%.

Images