Antibodies that bind to adenosine a2a receptors and methods of using the same to treat cancer and neurological diseases

Abstract

This document provides methods and compositions related to adenosine A2A receptor libraries having nucleic acids encoding a scaffold comprising an adenosine A2A binding domain. The adenosine A2A receptor libraries described herein encode immunoglobulins, including antibodies and single-domain antibodies. The libraries described herein comprise diverse libraries containing nucleic acids, each nucleic acid encoding at least one predetermined variant of a predetermined reference nucleic acid sequence. This document further describes protein libraries generated when the nucleic acid libraries are translated. This document further describes cellular libraries expressing the diverse nucleic acid libraries described herein.

Description

[0001] Cross-references

[0002] This application claims the benefit of U.S. Provisional Patent Application No. 62 / 945,818, filed December 9, 2019, which is incorporated herein by reference in its entirety. Background Technology

[0003] G protein-coupled receptors (GPCRs), such as adenosine receptors, are associated with a variety of diseases. Generating antibodies against GPCRs has been challenging due to difficulties in obtaining suitable antigens, as GPCRs are typically expressed at low levels in cells and are highly unstable during purification. Therefore, there is a need for improved agents targeting GPCRs for therapeutic interventions.

[0004] Incorporation

[0005] All publications, patents and patent applications mentioned in this specification are incorporated herein by reference to the extent that each individual publication, patent or patent application is specifically and individually cited and incorporated herein by reference. Summary of the Invention

[0006] This document provides a method for generating a nucleic acid library encoding an adenosine A2A receptor antibody or an antibody fragment thereof, the method comprising: (a) providing a predetermined sequence encoding: i. a first plurality of polynucleotides, wherein each of the first plurality of polynucleotides encodes a variant sequence encoding CDR1 on the heavy chain; ii. a second plurality of polynucleotides, wherein each of the second plurality of polynucleotides encodes a variant sequence encoding CDR2 on the heavy chain; iii. a third plurality of polynucleotides, wherein each of the third plurality of polynucleotides encodes a variant sequence encoding CDR3 on the heavy chain; and (b) mixing the first plurality of polynucleotides, the second plurality of polynucleotides, and the third plurality of polynucleotides to form a nucleic acid library encoding the adenosine A2A receptor antibody or an antibody fragment thereof. This document further provides a method for generating a nucleic acid library encoding an adenosine A2A receptor antibody or an antibody fragment thereof, wherein the adenosine A2A receptor antibody or an antibody fragment thereof is a single-domain antibody. This document further provides a method for generating a nucleic acid library encoding an adenosine A2A receptor antibody or an antibody fragment thereof, wherein the single-domain antibody comprises a heavy chain variable domain. This article further provides methods for generating nucleic acid libraries encoding adenosine A2A receptor antibodies or antibody fragments thereof, wherein the single-domain antibody is a VHH antibody. This article further provides methods for generating nucleic acid libraries encoding adenosine A2A receptor antibodies or antibody fragments thereof, wherein the nucleic acid library contains at least 50,000 variant sequences. This article further provides methods for generating nucleic acid libraries encoding adenosine A2A receptor antibodies or antibody fragments thereof, wherein the nucleic acid library contains at least 100,000 variant sequences. This article further provides methods for generating nucleic acid libraries encoding adenosine A2A receptor antibodies or antibody fragments thereof, wherein the nucleic acid library contains at least 10 5 These are distinct nucleic acids. This article further provides a method for generating a nucleic acid library encoding an adenosine A2A receptor antibody or an antibody fragment thereof, wherein the nucleic acid library contains at least one sequence encoding an adenosine A2A receptor antibody or antibody fragment, said adenosine A2A receptor antibody or antibody fragment being in K+ of less than 100 nM. D Binding to the adenosine A2A receptor. This document further provides a method for generating a nucleic acid library encoding an antibody or antibody fragment of the adenosine A2A receptor, wherein the nucleic acid library contains at least one sequence encoding an adenosine A2A receptor antibody or antibody fragment, said adenosine A2A receptor antibody or antibody fragment being in K+ of less than 50 nM. D Binding to the adenosine A2A receptor. This document further provides a method for generating a nucleic acid library encoding an antibody or antibody fragment of the adenosine A2A receptor, wherein the nucleic acid library contains at least one sequence encoding an antibody or antibody fragment of the adenosine A2A receptor, said antibody or antibody fragment being in a Kc of less than 10 nM. DBinding to the adenosine A2A receptor. This document further provides a method for generating a nucleic acid library encoding an antibody or antibody fragment of the adenosine A2A receptor, wherein the nucleic acid library contains at least 500 variant sequences. This document further provides a method for generating a nucleic acid library encoding an antibody or antibody fragment of the adenosine A2A receptor, wherein the nucleic acid library contains at least five sequences encoding an adenosine A2A receptor antibody or antibody fragment, said adenosine A2A receptor antibody or antibody fragment being in K+ of less than 100 nM. D It binds to the adenosine A2A receptor. This article further provides a method for generating a nucleic acid library encoding an antibody or antibody fragment of the adenosine A2A receptor, wherein the nucleic acid library contains at least 500 variant sequences.

[0007] This document provides nucleic acid libraries comprising multiple nucleic acids, wherein each of the multiple nucleic acids encodes a sequence that, when translated, encodes an antibody or an antibody fragment thereof, wherein the antibody or antibody fragment thereof comprises a heavy chain variable region (VH), the heavy chain variable region comprising an adenosine A2A receptor-binding domain, and wherein each of the multiple nucleic acids comprises a sequence encoding a sequence variant of the adenosine A2A receptor-binding domain. This document further provides nucleic acid libraries comprising multiple nucleic acids, wherein the VH is about 90 to about 100 amino acids in length. This document further provides nucleic acid libraries comprising multiple nucleic acids, wherein the VH is about 100 to about 400 amino acids in length. This document further provides nucleic acid libraries comprising multiple nucleic acids, wherein the VH is about 270 to about 300 base pairs in length. This document further provides nucleic acid libraries comprising multiple nucleic acids, wherein the VH is about 300 to about 1200 base pairs in length. This document further provides nucleic acid libraries comprising multiple nucleic acids, wherein the library contains at least 10 5 Different nucleic acids.

[0008] This document provides protein libraries containing multiple proteins, each of which includes a heavy chain variable region (VH) containing a sequence variant of an adenosine A2A receptor-binding domain. This document further provides protein libraries containing multiple proteins, wherein the VH is approximately 90 to approximately 100 amino acids in length. This document further provides protein libraries containing multiple proteins, wherein the VH is approximately 100 to approximately 400 amino acids in length. This document further provides protein libraries containing multiple proteins, wherein the VH is approximately 270 to approximately 300 base pairs in length. This document further provides protein libraries containing multiple proteins, wherein the VH is approximately 300 to approximately 1200 base pairs in length. This document further provides protein libraries containing multiple proteins, wherein the library contains at least 10... 5This paper further provides protein libraries containing multiple proteins, wherein said multiple proteins are used to generate peptide-like libraries. This paper further provides protein libraries containing multiple proteins, wherein said protein libraries contain antibodies. This paper further provides protein libraries containing multiple proteins, wherein said protein libraries contain at least 500 variant sequences. This paper further provides protein libraries containing multiple proteins, wherein said protein libraries contain at least 5000 variant sequences. This paper further provides protein libraries containing multiple proteins, wherein said protein libraries contain at least 10000 variant sequences.

[0009] This document provides protein libraries containing multiple proteins, wherein the multiple proteins contain sequences encoding different adenosine A2A receptor-binding domains, and wherein each adenosine A2A receptor-binding domain is about 100 to about 400 amino acids in length. This document further provides protein libraries containing multiple proteins, wherein the protein libraries contain peptides. This document further provides protein libraries containing multiple proteins, wherein the protein libraries contain immunoglobulins. This document further provides protein libraries containing multiple proteins, wherein the protein libraries contain antibodies. This document further provides protein libraries containing multiple proteins, wherein the protein libraries contain single-domain antibodies. This document further provides protein libraries containing multiple proteins, wherein the multiple proteins are used to generate peptide-like libraries. This document further provides protein libraries containing multiple proteins, wherein the protein libraries contain at least 500 variant sequences. This document further provides protein libraries containing multiple proteins, wherein the protein libraries contain at least 5000 variant sequences. This document further provides protein libraries containing multiple proteins, wherein the protein libraries contain at least 10000 variant sequences.

[0010] This article provides a nucleic acid library comprising: multiple nucleic acids, wherein each nucleic acid encodes a sequence that, when translated, encodes an adenosine A2A receptor-binding immunoglobulin, wherein the adenosine A2A receptor-binding immunoglobulin comprises a variant of an adenosine A2A receptor-binding domain, wherein the adenosine A2A receptor-binding domain is a ligand of an adenosine A2A receptor, and wherein the nucleic acid library comprises at least 10,000 variant immunoglobulin heavy chains and at least 10,000 variant immunoglobulin light chains. This article further provides a nucleic acid library comprising: multiple nucleic acids, wherein the nucleic acid library comprises at least 50,000 variant immunoglobulin heavy chains and at least 50,000 variant immunoglobulin light chains. This article further provides a nucleic acid library comprising: multiple nucleic acids, wherein the nucleic acid library comprises at least 10...5 This paper further provides a nucleic acid library containing: multiple nucleic acids, wherein the immunoglobulin heavy chain is approximately 90 to approximately 100 amino acids in length when translated. This paper further provides a nucleic acid library containing: multiple nucleic acids, wherein the immunoglobulin heavy chain is approximately 100 to approximately 400 amino acids in length when translated.

[0011] This document provides a nucleic acid library comprising: a plurality of nucleic acids, wherein each nucleic acid encodes a sequence encoding an adenosine A2A receptor single-domain antibody when translated, wherein each of the plurality of sequences comprises a variant sequence encoding at least one of CDR1, CDR2, and CDR3 on the heavy chain variable region (VH); wherein the library contains at least 30,000 variant sequences; and wherein the antibody or antibody fragment is in Kc of less than 100 nM. D It binds to its antigen. This article further provides a nucleic acid library containing: multiple nucleic acids, wherein the VH, when translated, is approximately 90 to approximately 100 amino acids in length. This article further provides a nucleic acid library containing: multiple nucleic acids, wherein the VH, when translated, is approximately 100 to approximately 400 amino acids in length. This article further provides a nucleic acid library containing: multiple nucleic acids, wherein the VH is approximately 270 to approximately 300 base pairs in length. This article further provides a nucleic acid library containing: multiple nucleic acids, wherein the VH is approximately 300 to approximately 1200 base pairs in length.

[0012] This article provides vector libraries containing nucleic acid libraries as described herein. This article provides cell libraries containing nucleic acid libraries as described herein. This article provides cell libraries containing protein libraries as described herein.

[0013] This document provides a nucleic acid library comprising: a plurality of nucleic acids, wherein each nucleic acid encodes a sequence encoding, when translated, adenosine A2A receptor-binding immunoglobulin, wherein the adenosine A2A receptor-binding immunoglobulin comprises a variant of an adenosine A2A receptor-binding domain, wherein the adenosine A2A receptor-binding domain is a ligand of an adenosine A2A receptor, and wherein the nucleic acid library comprises at least 10,000 variant immunoglobulin heavy chains and at least 10,000 variant immunoglobulin light chains. This document further provides a nucleic acid library comprising at least 50,000 variant immunoglobulin heavy chains and at least 50,000 variant immunoglobulin light chains. This document further provides a nucleic acid library comprising at least 10,000 variant immunoglobulin heavy chains and at least 100,000 variant immunoglobulin light chains. This document further provides a nucleic acid library comprising at least 10 5This document further provides nucleic acid libraries in which the length of the immunoglobulin heavy chain, when translated, is approximately 90 to approximately 100 amino acids. This document further provides nucleic acid libraries in which the length of the immunoglobulin heavy chain, when translated, is approximately 100 to approximately 400 amino acids. This document further provides nucleic acid libraries in which, when translated, the variant immunoglobulin heavy chain contains at least approximately 90% sequence identity with any one of SEQ ID NO:540-628. This document further provides nucleic acid libraries in which, when translated, the variant immunoglobulin light chain contains at least approximately 90% sequence identity with any one of SEQ ID NO:629-717. This document further provides nucleic acid libraries in which, when translated, the variant immunoglobulin heavy chain contains any one of SEQ ID NO:540-628. This document further provides nucleic acid libraries in which, when translated, the variant immunoglobulin light chain contains any one of SEQ ID NO:629-717.

[0014] This document provides a nucleic acid library containing multiple nucleic acids, each of which encodes a sequence that, when translated, encodes an antibody or an antibody fragment thereof, wherein the antibody or antibody fragment thereof comprises a heavy chain variable region (VH), the heavy chain variable region comprising an adenosine A2A receptor-binding domain, each of the multiple nucleic acids comprising a sequence variant encoding the adenosine A2A receptor-binding domain, and wherein the antibody or antibody fragment is at a Kc of less than 100 nM. D It binds to its antigen. This article further provides nucleic acid libraries in which the VH length is approximately 90 to approximately 100 amino acids. This article further provides nucleic acid libraries in which the VH length is approximately 100 to approximately 400 amino acids. This article further provides nucleic acid libraries in which the VH length is approximately 270 to approximately 300 base pairs. This article further provides nucleic acid libraries in which the VH length is approximately 300 to approximately 1200 base pairs. This article further provides nucleic acid libraries in which the library contains at least 10 5 Different nucleic acids.

[0015] This article provides a nucleic acid library containing: multiple nucleic acids, each encoding a sequence that, when translated, encodes a single-domain antibody against the adenosine A2A receptor, wherein each of the multiple sequences contains a variant sequence encoding CDR1, CDR2, or CDR3 on the heavy chain variable region (VH); wherein the library contains at least 30,000 variant sequences; and wherein the single-domain antibody against the adenosine A2A receptor is expressed at a Kc concentration of less than 100 nM. DIt binds to its antigen. This article further provides nucleic acid libraries in which the length of VH when translated is about 90 to about 100 amino acids. This article further provides nucleic acid libraries in which the length of VH when translated is about 100 to about 400 amino acids. This article further provides nucleic acid libraries in which the length of VH is about 270 to about 300 base pairs. This article further provides nucleic acid libraries in which the length of VH is about 300 to about 1200 base pairs. This article further provides nucleic acid libraries in which the variant libraries contain variant sequences encoding CDR1, CDR2, and CDR3. This article further provides nucleic acid libraries in which VH, when translated, contains at least 90% sequence identity with any one of SEQ ID NO:540-628. This article further provides nucleic acid libraries in which VH, when translated, contains any one of SEQ ID NO:540-628.

[0016] This document provides antibodies or antibody fragments that bind to the adenosine A2A receptor, said antibodies or antibody fragments comprising an immunoglobulin heavy chain and an immunoglobulin light chain: wherein the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in any one of SEQ ID NO:540-628; and wherein the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in any one of SEQ ID NO:629-717. This document further provides antibodies or antibody fragments wherein the immunoglobulin heavy chain comprises an amino acid sequence having at least about 95% identity with the amino acid sequence shown in any one of SEQ ID NO:540-628; and wherein the immunoglobulin light chain comprises an amino acid sequence having at least about 95% identity with the amino acid sequence shown in any one of SEQ ID NO:629-717. This document further provides antibodies or antibody fragments wherein the immunoglobulin heavy chain comprises an amino acid sequence as shown in any one of SEQ ID NO:540-628; and wherein the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with an amino acid sequence shown in any one of SEQ ID NO:629-717. This document further provides antibodies or antibody fragments wherein the antibody is a monoclonal antibody, polyclonal antibody, bispecific antibody, multispecific antibody, transplanted antibody, human antibody, humanized antibody, synthetic antibody, chimeric antibody, camelified antibody, single-chain Fv (scFv), single-chain antibody, Fab fragment, F(ab')2 fragment, Fd fragment, Fv fragment, single-domain antibody, isolated complementarity-determining region (CDR), diabody antibody, fragment consisting only of a single monomeric variable domain, disulfide-linked Fv (sdFv), intracellular antibody, anti-idiotypic (anti-Id) antibody, or an ab antigen-binding fragment thereof. This document further provides antibodies or antibody fragments wherein the antibody or antibody fragment thereof is chimeric or humanized. This article further provides antibodies or antibody fragments wherein, in a cAMP assay, the antibody has an EC50 of less than about 25 nanomoles. This article further provides antibodies or antibody fragments wherein, in a cAMP assay, the antibody has an EC50 of less than about 20 nanomoles. This article further provides antibodies or antibody fragments wherein, in a cAMP assay, the antibody has an EC50 of less than about 10 nanomoles.

[0017] This document provides antibodies or antibody fragments comprising a complementarity-determining region (CDR) having at least about 90% identity with an amino acid sequence shown in any of SEQ ID NO:6-539.

[0018] This document provides antibodies or antibody fragments comprising a variable heavy chain complementarity-determining region (CDRH) containing an amino acid sequence having at least about 90% identity with the amino acid sequence shown in any one of SEQ ID NO:6-272.

[0019] This document provides antibodies or antibody fragments comprising a variable light chain complementarity-determining region (CDRH) containing an amino acid sequence having at least about 90% identity with the amino acid sequence shown in any one of SEQ ID NO:273-539.

[0020] This document provides antibodies or antibody fragments comprising the sequence of any one of SEQ ID NO: 6-539, and wherein the antibody is a monoclonal antibody, polyclonal antibody, bispecific antibody, multispecific antibody, transplanted antibody, human antibody, humanized antibody, synthetic antibody, chimeric antibody, camelified antibody, single-chain Fv (scFv), single-chain antibody, Fab fragment, F(ab')2 fragment, Fd fragment, Fv fragment, single-domain antibody, isolated complementarity-determining region (CDR), bisomatic antibody, fragment consisting of only a single monomeric variable domain, disulfide-linked Fv (sdFv), intracellular antibody, anti-idiotype (anti-Id) antibody, or an ab antigen-binding fragment thereof.

[0021] This article provides a method for treating cancer, which includes administering the antibodies or antibody fragments described herein.

[0022] This article provides methods for treating neurological diseases or conditions, including the administration of antibodies or antibody fragments described herein.

[0023] This document provides a method for generating a nucleic acid library encoding an adenosine A2A receptor antibody or an antibody fragment thereof, the method comprising: (a) providing a predetermined sequence encoding: i. a first plurality of polynucleotides, wherein each of the first plurality of polynucleotides encodes at least 1000 variant sequences encoding CDR1 on the heavy strand; ii. a second plurality of polynucleotides, wherein each of the second plurality of polynucleotides encodes at least 1000 variant sequences encoding CDR2 on the heavy strand; iii. a third plurality of polynucleotides, wherein each of the third plurality of polynucleotides encodes at least 1000 variant sequences encoding CDR3 on the heavy strand; and (b) mixing the first plurality of polynucleotides, the second plurality of polynucleotides, and the third plurality of polynucleotides to form a nucleic acid library encoding a variant nucleic acid of the adenosine A2A receptor antibody or an antibody fragment thereof, wherein at least about 70% of the variant nucleic acid encodes a K+ of less than 100 nM. DAntibodies or antibody fragments that bind to adenosine A2A receptors. This document further provides methods wherein the adenosine A2A receptor antibody or antibody fragment thereof is a single-domain antibody. This document further provides methods wherein the single-domain antibody comprises a heavy chain variable domain. This document further provides methods wherein the single-domain antibody is a VHH antibody. This document further provides methods wherein the nucleic acid library contains at least 50,000 variant sequences. This document further provides methods wherein the nucleic acid library contains at least 100,000 variant sequences. This document further provides methods wherein the nucleic acid library contains at least 10... 5 These are distinct nucleic acids. This paper further provides a method in which the nucleic acid library contains K encoding at a concentration of less than 75 nM. D At least one sequence of an adenosine A2A receptor antibody or antibody fragment that binds to the adenosine A2A receptor. This article further provides a method in which the nucleic acid library contains K encoded in less than 50 nM. D At least one sequence of an adenosine A2A receptor antibody or antibody fragment that binds to the adenosine A2A receptor. This article further provides a method in which the nucleic acid library contains K encoded in less than 10 nM. D At least one sequence of an adenosine A2A receptor antibody or antibody fragment that binds to the adenosine A2A receptor. This document further provides a method wherein the nucleic acid library contains at least 500 variant sequences. This document further provides a method wherein the nucleic acid library contains at least five sequences encoding an adenosine A2A receptor antibody or antibody fragment, said adenosine A2A receptor antibody or antibody fragment having a Kc of less than 75 nM. D It binds to the adenosine A2A receptor.

[0024] This document provides protein libraries encoded by nucleic acid libraries described herein, wherein said protein libraries contain peptides. This document further provides protein libraries containing immunoglobulins. This document further provides protein libraries containing antibodies. This document further provides protein libraries that are peptide-mimicking libraries.

[0025] This article provides vector libraries containing the nucleic acid libraries described herein.

[0026] This article provides cell libraries containing the nucleic acid libraries described herein.

[0027] This article provides a cell library containing the protein library described herein. Attached Figure Description

[0028] Figure 1A A first schematic diagram of an immunoglobulin scaffold is depicted.

[0029] Figure 1B A second schematic diagram of the immunoglobulin scaffold is depicted.

[0030] Figure 2 A schematic diagram is depicted for placing the sequence in the support.

[0031] Figure 3 A step-by-step diagram illustrating an exemplary process workflow for gene synthesis as disclosed herein is presented.

[0032] Figure 4 An example of a computer system is shown.

[0033] Figure 5 It is a block diagram illustrating the architecture of a computer system.

[0034] Figure 6 This is a diagram illustrating a network configured to incorporate multiple computer systems, multiple cellular phones and personal data assistants, and network attached storage (NAS).

[0035] Figure 7 It is a block diagram of a multiprocessor computer system that uses a shared virtual address space.

[0036] Figure 8A A schematic diagram of an immunoglobulin scaffold comprising a VH domain connected to a VL domain using a linker is depicted.

[0037] Figure 8B A schematic diagram of the full-domain architecture of an immunoglobulin scaffold is depicted, which includes a VH domain connected to the VL domain using a linker, a leader sequence, and a pIII sequence.

[0038] Figure 8C A schematic diagram depicts four frame elements (FW1, FW2, FW3, FW4) and three variable CDR elements (L1, L2, L3) of a VL or VH structural domain.

[0039] Figure 9A The structure of glucagon-like peptide-1 (GLP-1, cyan) complexed with the GLP-1 receptor (GLP-1R, gray) is depicted in PDB entry 5VAI.

[0040] Figure 9B The crystal structure of the CXCR4 chemokine receptor (grey) complexed with the cyclic peptide antagonist CVX15 (blue) was depicted, PDB entry 3OR0.

[0041] Figure 9C The human crystal structure, smoothed with transmembrane domains (grey) and extracellular domains (ECDs) (orange), is depicted in PDB entry 5L7D. The ECD contacts the TMD via extracellular loop 3 (ECL3).

[0042] Figure 9DThe structure of GLP-1R (grey) in combination with Fab (magenta) is depicted, PDB entry 6LN2.

[0043] Figure 9E The crystal structure of CXCR4 (gray) complexed with the viral chemokine antagonist viral macrophage inflammatory protein 2 (vMIP-II, green) was depicted in PDB entry 4RWS.

[0044] Figure 10 The design pattern of GPCR-focused libraries was described. Two germline heavy chains, VH1-69 and VH3-30; and four germline light chains, IGKV1-39 and IGKV3-15, and IGLV1-51 and IGLV2-14.

[0045] Figure 11 The HCDR3 length distribution in the GPCR-focused library was plotted in comparison with the HCDR3 length distribution in B cell populations from three healthy adult donors. A total of 2,444,718 unique VH sequences from the GPCR library and 2,481,511 unique VH sequences from the human B cell repertoire were analyzed to generate the length distribution map.

[0046] Figure 12 The clones, ELISA values, libraries, ProA values, and K values ​​of VHH-Fc were described. D value.

[0047] Figure 13 A schematic diagram of the design of the hyperimmune library generated by bacteriophages in this paper is depicted.

[0048] Figures 14A-14B A dose curve for A2AR-90-007 was plotted. Figure 14A ) and FACS analysis chart ( Figure 14B ).

[0049] Figure 15A A schematic diagram of the heavy chain IGHV3-23 design is depicted.

[0050] Figure 15B A schematic diagram of the heavy chain IGHV1-69 design is depicted.

[0051] Figure 15C A schematic diagram of the design of the light chain IGKV 2-28 and IGLV 1-51 is depicted.

[0052] Figure 15D A schematic diagram depicting the theoretical and ultimate diversity of GPCR libraries is presented.

[0053] Figure 16A-16O Depicting the use of variant A2A receptor immunoglobulin ( Figure 16A-16N ) and control ( Figure 16O Flow cytometry data.

[0054] Figures 17A-17H Binding curves were plotted. The binding curves were plotted against IgG concentrations and MFI (mean fluorescence intensity).

[0055] Figure 18A-18O The use of variants from mouse immune libraries was described. Figure 18A-18N ) and use control ( Figure 18O The combined curve graph.

[0056] Figure 19A-19G The binding of cells to adenosine A2aR monoclonal (MAB9497) and selected variants was plotted. The binding curves were plotted against IgG concentrations and MFI (mean fluorescence intensity).

[0057] Figure 20A-20G Cell binding maps were plotted in titration assays starting from 100 nM.

[0058] Figure 21 Data from agonist dose-response assays measured using the cAMP assay are depicted.

[0059] Figure 22 Data from antagonist dose-response assays measured using the cAMP assay are depicted.

[0060] Figure 23 The results from the cAMP antagonist titration assay are described.

[0061] Figure 24 Data from variants A2A-1 and A2A-9 obtained from cAMP assays are depicted.

[0062] Figure 25 Data for variant A2A9, determined using cAMP, are depicted.

[0063] Figure 26 Data for variant A2A9, determined using cAMP antagonist titration, are depicted.

[0064] Figures 27A-27C Data on variant A2A receptor immunoglobulin in antagonistic cAMP assays were depicted.

[0065] Figures 28A-28C Data on variant A2A receptor immunoglobulin in allosteric cAMP assays were depicted.

[0066] Figures 29A-29C Data on variant A2A receptor immunoglobulin in antagonistic cAMP assays were depicted.

[0067] Figures 30A-30C Data on variant A2A receptor immunoglobulin in antagonistic cAMP assays were depicted. Detailed Implementation

[0068] Unless otherwise stated, this disclosure employs conventional molecular biology techniques within the scope of the art. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0069] definition

[0070] Throughout this disclosure, various embodiments are given in a range format. It should be understood that the range format is for convenience and brevity only and should not be construed as a rigid limitation on the range of any embodiment. Therefore, unless the context explicitly specifies otherwise, a description of a range should be considered to explicitly disclose all possible subranges and the individual values ​​within that range accurate to one-tenth of the lower limit unit. For example, a description of a range such as 1 to 6 should be considered to explicitly disclose subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., and the individual values ​​within that range, such as 1.1, 2, 2.3, 5, and 5.9. This applies regardless of the width of the range. The upper and lower limits of these intermediate ranges may be independently included in smaller ranges and are also covered in this disclosure, subject to any specifically excluded limits within the range. Unless the context explicitly specifies otherwise, where the range includes one or both limits, ranges excluding any or both of those included limits are also included in this disclosure.

[0071] The terminology used herein is for the purpose of describing a particular embodiment only and is not intended to limit any embodiment. Unless the context clearly specifies otherwise, the singular forms “a,” “an,” and “the” as used herein are intended to include the plural forms as well. It should further be understood that, as used herein, the terms “comprising” and / or “including” refer to the presence of the stated features, integers, steps, operations, elements, and / or components, but do not exclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof. As used herein, the term “and / or” includes any and all combinations of one or more of the associated items shown.

[0072] Unless specifically stated or obvious from the context, as used herein, the term “about” with respect to numbers or ranges of numbers shall be understood to mean the number and numbers plus or minus 10% thereof, or for values ​​listed in the range, to mean 10% below the lower limit shown and 10% above the upper limit shown.

[0073] Unless otherwise specified, as used herein, the term "nucleic acid" encompasses both double-stranded and triple-stranded nucleic acids as well as single-stranded molecules. In double-stranded or triple-stranded nucleic acids, the nucleic acid strands do not necessarily extend together (i.e., a double-stranded nucleic acid does not necessarily have to be double-stranded along its entire length). When provided, unless otherwise specified, nucleic acid sequences are listed in a 5' to 3' orientation. The methods described herein provide for the generation of isolated nucleic acids. The methods described herein further provide for the generation of isolated and purified nucleic acids. The “nucleic acid” mentioned in this article may contain at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, 2000 or more bases. Furthermore, this paper provides methods for synthesizing nucleotide sequences encoding any number of polypeptide segments, including sequences encoding non-ribosomal peptides (NRPs), sequences encoding non-ribosomal peptide synthase (NRPS) modules and synthetic variants, polypeptide segments of other modular proteins such as antibodies, polypeptide segments from other protein families, including non-coding DNA or RNA, such as regulatory sequences, such as promoters, transcription factors, enhancers, siRNA, shRNA, RNAi, miRNA, small nucleolar RNA derived from microRNA, or any functional or structural DNA or RNA unit of interest. The following are non-limiting examples of polynucleotides: coding or non-coding regions of genes or gene fragments, intergenic DNA, loci (multiple loci) defined by linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), micronucleolar RNA, ribozymes, complementary DNA (cDNA) (which is the DNA representation of mRNA, usually obtained by reverse transcription of messenger RNA (mRNA) or by amplification); synthetic or amplified DNA molecules, genomic DNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. cDNA encoding the genes or gene fragments mentioned herein may contain at least one region that encodes an exon sequence and does not contain intercalated intron sequences in genomically equivalent sequences.

[0074] Adenosine A2A receptor library

[0075] This document provides methods and compositions relating to G protein-coupled receptor (GPCR) binding libraries targeting the adenosine A2A receptor (ADORA2), said libraries comprising nucleic acids encoding a scaffold containing an adenosine A2A receptor-binding domain. The scaffolds described herein stably support the adenosine A2A receptor-binding domain. The adenosine A2A receptor-binding domain can be designed based on surface interactions between the adenosine A2A receptor ligand and the adenosine A2A receptor. The libraries described herein can be further diversified to provide variant libraries containing nucleic acids, each nucleic acid encoding at least one predetermined variant of a predetermined reference nucleic acid sequence. This document further describes protein libraries that can be generated during the translation of nucleic acid libraries. In some cases, nucleic acid libraries described herein are transferred into cells to generate cellular libraries. This document also provides downstream applications of libraries synthesized using the methods described herein. Downstream applications include the identification of variant nucleic acid or protein sequences with enhanced biologically relevant functions, such as improved stability, affinity, binding, functional activity, and for the treatment or prevention of disease states associated with adenosine A2A receptor signaling.

[0076] The methods, compositions, and systems described herein for optimizing adenosine A2A receptor immunoglobulins or antibodies include ratio variation methods that reflect the natural diversity of antibody sequences. In some cases, the optimized adenosine A2A receptor immunoglobulin or antibody library contains variant adenosine A2A receptor immunoglobulin or antibody sequences. In some cases, the variant adenosine A2A receptor immunoglobulin or antibody sequences are engineered to contain variant CDR regions. In some cases, variant adenosine A2A receptor immunoglobulin or antibody sequences containing variant CDR regions are generated by refactoring natural CDR sequences in llamas, humanized frames, or chimeric frames. In some cases, such libraries are synthesized, cloned into expression vectors, and the activity of the translational products (antibodies) is evaluated. In some cases, fragments of the synthesized sequences are subsequently assembled. In some cases, the expression vector is used to display and enrich the desired antibody, such as phage display. In some cases, the phage vector is a Fab phageparticle vector. In some cases, the selection pressures used in the enrichment process include binding affinity, toxicity, immune tolerance, stability, or other factors. These expression vectors allow for the screening (“panning”) of antibodies with specific characteristics, and subsequent propagation or amplification of such sequences enriches libraries containing these sequences. Panning rounds can be repeated any number of times, such as 1, 2, 3, 4, 5, 6, 7, or more than 7 rounds. In some cases, each panning round involves multiple washes. In some cases, each panning round involves at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or more than 16 washes.

[0077] This document describes methods and systems for designing computer-aided libraries. In some cases, the libraries described herein are designed based on databases containing multiple antibody sequences. In some cases, the database contains multiple variant antibody sequences targeting various targets. In some cases, the database contains at least 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, or more than 5000 antibody sequences. An exemplary database is the iCAN database. In some cases, the database contains naïve and memory B-cell receptor sequences. In some cases, the naïve and memory B-cell receptor sequences are human, mouse, or primate sequences. In some cases, the naïve and memory B-cell receptor sequences are human sequences. In some cases, the database is analyzed for position-specific variations. In some cases, the antibodies described herein contain position-specific variations in the CDR region. In some cases, the CDR region contains multiple variant sites.

[0078] Scaffold Library

[0079] This document provides libraries of nucleic acids encoding scaffolds, wherein sequences of adenosine A2A receptor-binding domains are contained within the scaffolds. Compared to unmodified scaffolds, the scaffolds described herein allow for enhanced stability of a range of adenosine A2A receptor-binding domain-coding sequences when inserted into the scaffold. Exemplary scaffolds include, but are not limited to, proteins, peptides, immunoglobulins, derivatives thereof, or combinations thereof. In some cases, the scaffold is an immunoglobulin. Scaffolds as described herein include enhanced functional activity, structural stability, expression, specificity, or combinations thereof. In some cases, the scaffold includes long regions for supporting the adenosine A2A receptor-binding domain.

[0080] This document provides libraries containing nucleic acids encoding a scaffold, wherein the scaffold is an immunoglobulin. In some cases, the immunoglobulin is an antibody. As used herein, the term antibody will be understood to include a protein having the characteristic two-armed Y-shape of a typical antibody molecule and one or more fragments of an antibody that retains the ability to bind specifically to an antigen. Exemplary antibodies include, but are not limited to, monoclonal antibodies, polyclonal antibodies, bispecific antibodies, multispecific antibodies, transplanted antibodies, human antibodies, humanized antibodies, synthetic antibodies, chimeric antibodies, camelified antibodies, single-chain Fv (scFv) (including fragments in which VL and VH are linked by a synthetic or natural linker using a recombinant method, the linker enabling them to be single protein chains, wherein the VL and VH regions are paired in monovalent form, including single-chain Fab and scFab), single-chain antibodies, Fab fragments (including monovalent fragments containing VL, VH, CL, and CH1 domains), F(ab')2 fragments (including fragments containing the hinge region via a synthetic or natural linker), and F(ab')2 fragments (including fragments containing the hinge region via a synthetic or natural linker). Divalent fragments of two Fab fragments linked by disulfide bonds, Fd fragments (including fragments containing VH and CH1 fragments), Fv fragments (including fragments containing VL and VH domains of an antibody single arm), single-domain antibodies (dAb or sdAb) (including fragments containing a VH domain), separate complementarity-determining regions (CDRs), bimeric antibodies (including fragments containing two VL and VH domains of a divalent dimer that bind to each other and recognize two different antigens), fragments consisting only of a single monomeric variable domain, disulfide-linked Fv (sdFv), intracellular antibodies, anti-idiotypic (anti-Id) antibodies, or their antigen-binding fragments. In some cases, the libraries disclosed herein contain nucleic acids encoding a scaffold, wherein the scaffold is an Fv antibody, including Fv antibodies consisting of minimal antibody fragments containing complete antigen recognition and antigen-binding sites. In some embodiments, the Fv antibody consists of a tightly, non-covalently associated dimer of a heavy chain variable domain and a light chain variable domain, and three hypervariable regions of each variable domain interact to define an antigen-binding site on the surface of the VH-VL dimer. In some embodiments, these six hypervariable regions confer antigen-binding specificity to the antibody. In some embodiments, a single variable domain (or half of an Fv containing only the three hypervariable regions specific to the antigen, including single-domain antibodies containing a heavy chain variable domain or a heavy chain variable domain isolated from camelids, such as VHH antibodies or nanobodies) has the ability to recognize and bind to the antigen. In some cases, the libraries disclosed herein contain nucleic acids encoding a scaffold, wherein the scaffold is a single-chain Fv or scFv comprising antibody fragments containing both VH, VL, or both VH and VL domains, wherein both domains are present in a single polypeptide chain. In some embodiments, the Fv polypeptide further includes a polypeptide linker between the VH and VL domains, thereby allowing the scFv to form the desired structure for antigen binding. In some cases, the scFv is linked to an Fc fragment or VHH is linked to an Fc fragment (including small antibodies).In some cases, the antibody comprises immunoglobulin molecules and immunologically active fragments of immunoglobulin molecules, such as molecules containing antigen-binding sites. Immunoglobulin molecules can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or subclass.

[0081] In some implementations, the library contains immunoglobulins suitable for the intended therapeutic target. Typically, these methods involve “mammalianization” and include methods for transferring donor antigen-binding information to a less immunogenic mammalian antibody acceptor to generate a useful therapeutic treatment. In some cases, the mammal is a mouse, rat, horse, sheep, cattle, primates (e.g., chimpanzee, baboon, gorilla, orangutan, monkey), dog, cat, pig, donkey, rabbit, and human. In some cases, this document provides libraries and methods for feline and canine antibody facilitation.

[0082] A “humanized” form of a nonhuman antibody can be a chimeric antibody containing a minimal sequence derived from a nonhuman antibody. Humanized antibodies are typically human antibodies (acceptor antibodies) in which residues from one or more CDRs are replaced with residues from one or more CDRs of a nonhuman antibody (donor antibody). The donor antibody can be any suitable nonhuman antibody, such as mouse, rat, rabbit, chicken, or nonhuman primate antibodies with the desired specificity, affinity, or biological effect. In some cases, selected frame region residues of the acceptor antibody are replaced with corresponding frame region residues from the donor antibody. Humanized antibodies may also contain residues not found in either the acceptor or donor antibody. In some cases, these modifications are made to further improve antibody performance.

[0083] "Canidification" may include methods of transferring non-canine antigen-binding information from a donor antibody to a less immunogenic canine antibody acceptor to generate a treatment that can be used as a therapeutic agent in dogs. In some cases, the canidified form of the non-canine antibody provided herein is a chimeric antibody containing a minimal sequence derived from the non-canine antibody. In some cases, the canidified antibody is a canine antibody sequence ("acceptor" or "receptor" antibody) in which hypervariable residues of the acceptor are replaced with hypervariable residues from a non-canine species ("donor" antibody) such as mouse, rat, rabbit, cat, dog, goat, chicken, cow, horse, llama, camel, dromedary, shark, non-human primate, human, humanized, recombinant sequence, or engineered sequence with the desired properties. In some cases, the frame region (FR) residues of the canine antibody are replaced with corresponding non-canine FR residues. In some cases, the canidified antibody includes residues not found in the acceptor antibody or donor antibody. In some cases, these modifications are made to further improve antibody performance. Canine-derived antibodies may also contain at least a portion of the immunoglobulin constant region (Fc) of canine antibodies.

[0084] "Felization" can include methods of transferring non-feline antigen-binding information from a donor antibody to a less immunogenic feline antibody acceptor to generate a treatment that can be used as a therapeutic agent in cats. In some cases, the feline-modified form of the non-feline antibody provided herein is a chimeric antibody containing a minimal sequence derived from the non-feline antibody. In some cases, the feline-modified antibody is a feline antibody sequence ("acceptor" or "receptor" antibody) in which hypervariable residues of the acceptor are replaced with hypervariable residues from a non-feline species ("donor" antibody) such as mouse, rat, rabbit, cat, dog, goat, chicken, cow, horse, llama, camel, dromedary, shark, non-human primate, human, humanized, recombinant, or engineered sequence with the desired properties. In some cases, frame region (FR) residues of the feline antibody are replaced with corresponding non-feline FR residues. In some cases, the feline-modified antibody includes residues not found in the acceptor or donor antibody. In some cases, these modifications are made to further improve antibody performance. Feline antibodies may also contain at least a portion of the immunoglobulin constant region (Fc) of a feline antibody.

[0085] This article provides libraries containing nucleic acids encoding scaffolds, wherein the scaffold is a non-immunoglobulin. In some cases, the scaffold is a non-immunoglobulin binding domain. For example, the scaffold is an antibody mimic. Exemplary antibody mimics include, but are not limited to, anticalins, affilins, affibody molecules, affimers, affitins, alphabodies, avimers, atrimers, DARPins, fynomers, Kunitz domain-based proteins, monobodies, anticalins, knottins, armadillo repeat protein-based proteins, and bicyclic peptides.

[0086] The library of nucleic acids encoding a scaffold (where the scaffold is an immunoglobulin) described herein contains variations in at least one region of the immunoglobulin. Exemplary regions for variation of antibodies include, but are not limited to, complementarity-determining regions (CDRs), variable domains, or constant domains. In some cases, the CDR is CDR1, CDR2, or CDR3. In some cases, the CDR is a heavy domain, including but not limited to CDRH1, CDRH2, and CDRH3. In some cases, the CDR is a light domain, including but not limited to CDRL1, CDRL2, and CDRL3. In some cases, the variable domain is a variable domain light chain (VL) or a heavy chain variable domain (VH). In some cases, the VL domain contains a κ or λ chain. In some cases, the constant domain is a constant domain light chain (CL) or a constant domain heavy chain (CH).

[0087] The methods described herein provide for synthesizing libraries containing nucleic acids encoding a scaffold, wherein each nucleic acid encodes a predetermined variant of at least one predetermined reference nucleic acid sequence. In some cases, the predetermined reference sequence is a nucleic acid sequence encoding a protein, and the variant library contains sequences encoding at least a single codon variation, such that multiple different variants of a single residue in a subsequent protein encoded by the synthesized nucleic acid are generated by a standard translation process. In some cases, the scaffold library contains variable nucleic acids that co-encode variations at multiple positions. In some cases, the variant library contains sequences encoding at least a single codon variation of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, or VH domains. In some cases, the variant library contains sequences encoding multiple codon variations of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, or VH domains. In some cases, the variant library contains sequences encoding multiple codon variations of frame element 1 (FW1), frame element 2 (FW2), frame element 3 (FW3), or frame element 4 (FW4). Exemplary numbers of codons used for variation include, but are not limited to, at least or about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300 or more codons.

[0088] In some cases, at least one region of the immunoglobulin used for the variation originates from the heavy chain V gene family, heavy chain D gene family, heavy chain J gene family, light chain V gene family, or light chain J gene family. In some cases, the light chain V gene family includes the immunoglobulin κ (IGK) gene or immunoglobulin λ (IGL) gene. Exemplary genes include, but are not limited to, IGHV1-18, IGHV1-69, IGHV1-8, IGHV3-21, IGHV3-23, IGHV3-30 / 33rn, IGHV3-28, IGHV1-69, IGHV3-74, IGHV4-39, IGHV4-59 / 61, IGKV1-39, IGKV1-9, IGKV2-28, IGKV3-11, IGKV3-15, IGKV3-20, IGKV4-1, IGLV1-51, IGLV2-14, IGLV1-40, and IGLV3-1. In some cases, the gene is IGHV1-69, IGHV3-30, IGHV3-23, IGHV3, IGHV1-46, IGHV3-7, IGHV1, or IGHV1-8. In some cases, the gene is IGHV1-69 and IGHV3-30. In other cases, the gene is IGHJ3, IGHJ6, IGHJ, IGHJ4, IGHJ5, IGHJ2, or IGH1. In still other cases, the gene is IGHJ3, IGHJ6, IGHJ, or IGHJ4.

[0089] This document provides libraries containing nucleic acids encoding immunoglobulin scaffolds, wherein the libraries are synthesized using various numbers of fragments. In some cases, the fragments contain CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, or VH domains. In some cases, the fragments contain framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4). In some cases, the scaffold library is synthesized using at least or about two, three, four, five, or more fragments. The length of each nucleic acid fragment, or the average length of the synthesized nucleic acid, can be at least, or about 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, or more than 600 base pairs. In some cases, the length is about 50 to 600, 75 to 575, 100 to 550, 125 to 525, 150 to 500, 175 to 475, 200 to 450, 225 to 425, 250 to 400, 275 to 375, or 300 to 350 base pairs.

[0090] When translated, libraries containing nucleic acids encoding immunoglobulin scaffolds, as described herein, contain amino acids of various lengths. In some cases, the length of each amino acid fragment or the average length of the synthesized amino acids can be at least or about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, or more than 150 amino acids. In other cases, the length of the amino acid is about 15 to 150, 20 to 145, 25 to 140, 30 to 135, 35 to 130, 40 to 125, 45 to 120, 50 to 115, 55 to 110, 60 to 110, 65 to 105, 70 to 100, or 75 to 95 amino acids. In some cases, the length of this amino acid is from about 22 amino acids to about 75 amino acids. In some cases, the immunoglobulin scaffold contains at least or about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000 or more 5000 amino acids.

[0091] The methods described herein are used to de novo synthesize a large number of variant sequences for at least one region of the immunoglobulin used for mutation. In some cases, a large number of variant sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, VH, or combinations thereof are synthesized de novo. In some cases, a large number of variant sequences of frame element 1 (FW1), frame element 2 (FW2), frame element 3 (FW3), or frame element 4 (FW4) are synthesized de novo. The number of variant sequences can be at least or about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, or more than 500 sequences. In some cases, the number of variant sequences is at least, or about 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, or more than 8000 sequences. In other cases, the number of variant sequences is about 10 to 500, 25 to 475, 50 to 450, 75 to 425, 100 to 400, 125 to 375, 150 to 350, 175 to 325, 200 to 300, 225 to 375, 250 to 350, or 275 to 325 sequences.

[0092] In some cases, the variant sequence for at least one region of the immunoglobulin is different in length or sequence. In some cases, at least one region of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, VH, or combinations thereof is synthesized de novo. In some cases, at least one region of framework element 1 (FW1), framework element 2 (FW2), framework element 3 (FW3), or framework element 4 (FW4) is synthesized de novo. In some cases, the variant sequence contains at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, or more than 50 variant nucleotides or amino acids compared to the wild type. In some cases, the variant sequence contains at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 additional nucleotides or amino acids compared to the wild type. In some cases, the variant sequence contains at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 fewer nucleotides or amino acids compared to the wild type. In some cases, the library contains at least or about 10 1 10 2 10 3 10 4 10 5 10 6 10 7 10 8 10 9 10 10 One or more 10 10 A variant.

[0093] After synthesizing the scaffold library, the library can be used for screening and analysis. For example, the library's displayability and panning can be determined. In some cases, selective tags are used to analyze displayability. Exemplary tags include, but are not limited to, radioactive labels, fluorescent labels, enzymes, chemiluminescent labels, colorimetric labels, affinity labels, or other tags or labels known in the art. In some cases, the tag is histidine, polyhistidine, myc, hemagglutinin (HA), or FLAG. In some cases, the scaffold library is determined using sequencing methods, including but not limited to single-molecule real-time (SMRT) sequencing, polymerase cloning (Polony) sequencing, ligation sequencing, reversible terminator sequencing, proton detection sequencing, ion semiconductor sequencing, nanopore sequencing, electronic sequencing, pyrosequencing, Maxam-Gilbert sequencing, chain termination (e.g., Sanger) sequencing, +S sequencing, or synthetic sequencing.

[0094] In some cases, the functional activity, structural stability (e.g., thermal or pH stability), expression, specificity, or combinations thereof, of a scaffold library are measured. In other cases, the foldable scaffold within the scaffold library is measured. In still other cases, the functional activity, structural stability, expression, specificity, folding, or combinations thereof, of antibody regions are measured. For example, the functional activity, structural stability, expression, specificity, folding, or combinations thereof, of the VH or VL regions are measured.

[0095] Adenosine A2A receptor library

[0096] This article provides an adenosine A2A receptor-binding library containing nucleic acids encoding a scaffold, the scaffold containing a sequence of an adenosine A2A receptor-binding domain. In some cases, the scaffold is an immunoglobulin. In other cases, the scaffold containing the sequence of the adenosine A2A receptor-binding domain is determined by the interaction between the adenosine A2A receptor-binding domain and the adenosine A2A receptor.

[0097] This document provides a library of nucleic acids encoding a scaffold containing an adenosine A2A receptor-binding domain, wherein the adenosine A2A receptor-binding domain is designed based on surface interactions on the adenosine A2A receptor. In some cases, the adenosine A2A receptor-binding domain contains a sequence as defined in SEQ ID NO:1. In some cases, the adenosine A2A receptor-binding domain interacts with the N-terminus or C-terminus of the adenosine A2A receptor. In some cases, the adenosine A2A receptor-binding domain interacts with at least one transmembrane domain, including but not limited to transmembrane domain 1 (TM1), transmembrane domain 2 (TM2), transmembrane domain 3 (TM3), transmembrane domain 4 (TM4), transmembrane domain 5 (TM5), transmembrane domain 6 (TM6), and transmembrane domain 7 (TM7). In some cases, the adenosine A2A receptor-binding domain interacts with the intracellular surface of the adenosine A2A receptor. For example, the adenosine A2A receptor-binding domain interacts with at least one intracellular loop, including but not limited to intracellular loop 1 (ICL1), intracellular loop 2 (ICL2), and intracellular loop 3 (ICL3). In some cases, the adenosine A2A receptor-binding domain interacts with the extracellular surface of the adenosine A2A receptor. For example, the adenosine A2A receptor-binding domain interacts with at least one extracellular domain (ECD) or extracellular loop (ECL) of the adenosine A2A receptor. Extracellular loops include, but are not limited to, extracellular loop 1 (ECL1), extracellular loop 2 (ECL2), and extracellular loop 3 (ECL3).

[0098] This article describes an adenosine A2A receptor-binding domain designed based on surface interactions between an adenosine A2A receptor ligand and the adenosine A2A receptor. In some cases, the ligand is a peptide. In some cases, the ligand is an adenosine A2A receptor agonist. In some cases, the ligand is an adenosine A2A receptor antagonist. In some cases, the ligand is an adenosine A2A receptor allosteric modulator. In some cases, the allosteric modulator is a negative allosteric modulator. In some cases, the allosteric modulator is a positive allosteric modulator. Exemplary ligands for the adenosine A2A receptor include, but are not limited to, DU172, PSB36, ZM241385, XAC, caffeine, T4G, T4E, 6DY, 6DZ, 6DX, 6DV, 8D1b, theophylline, UK-432097, adenosine, NECA, and CGS21680.

[0099] The sequence of the adenosine A2A receptor binding domain is analyzed using various methods based on the surface interaction between the adenosine A2A receptor ligand and the adenosine A2A receptor. For example, multi-species computational analysis is performed. In some cases, structural analysis is performed. In others, sequence analysis is performed. Sequence analysis can be performed using databases known in the art. Non-limiting examples of databases include, but are not limited to, NCBIBLAST (blast.ncbi.nlm.nih.gov / Blast.cgi), UCSC GenomeBrowser (genome.ucsc.edu / ), UniProt (www.uniprot.org / ), and the IUPHAR / BPS Guide to Pharmacology (guidetopharmacology.org / ).

[0100] This article describes an adenosine A2A receptor binding domain designed based on sequence analysis across various organisms. For example, sequence analysis is performed to identify homologous sequences in different organisms. Exemplary organisms include, but are not limited to, mice, rats, horses, sheep, cattle, primates (e.g., chimpanzees, baboons, gorillas, orangutans, monkeys), dogs, cats, pigs, donkeys, rabbits, fish, flies, and humans.

[0101] After identifying the adenosine A2A receptor-binding domain, a library containing nucleic acids encoding the adenosine A2A receptor-binding domain can be generated. In some cases, the adenosine A2A receptor-binding domain library contains adenosine A2A receptor-binding domain sequences designed based on conformational ligand interactions, peptide-ligand interactions, small molecule ligand interactions, the extracellular domain of the adenosine A2A receptor, or antibodies targeting the adenosine A2A receptor. In some cases, the adenosine A2A receptor-binding domain library contains adenosine A2A receptor-binding domain sequences designed based on peptide-ligand interactions. In some cases, the ligand is not an antibody ligand. The adenosine A2A receptor-binding domain library can be translated to generate a protein library. In some cases, the adenosine A2A receptor-binding domain library is translated to generate a peptide library, an immunoglobulin library, its derivatives, or a combination thereof. In some cases, the adenosine A2A receptor-binding domain library is translated to generate a protein library, which is further modified to generate a peptide-like library. In some cases, a library of adenosine A2A receptor-binding domains is translated to generate a protein library, which is then used to generate small molecules.

[0102] The methods described herein provide for the synthesis of libraries of adenosine A2A receptor-binding domains, said libraries comprising nucleic acids, each encoding at least one predetermined reference nucleic acid sequence. In some cases, the predetermined reference sequence is a nucleic acid sequence encoding a protein, and the variant library comprises sequences encoding at least a single codon of variation, such that a standard translation process produces multiple distinct variants of a single residue in a subsequent protein encoded by the synthesized nucleic acid. In some cases, the adenosine A2A receptor-binding domain library comprises multiple nucleic acids that collectively encode variations at multiple positions. In some cases, the variant library comprises sequences encoding at least a single codon of variation in the adenosine A2A receptor-binding domain. In some cases, the variant library comprises sequences encoding variations of multiple codons in the adenosine A2A receptor-binding domain. Exemplary numbers of codons used for variation include, but are not limited to, at least or about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300 or more codons.

[0103] The methods described herein provide for the synthesis of libraries comprising nucleic acids encoding an adenosine A2A receptor-binding domain, wherein the libraries contain sequences encoding length variations of the adenosine A2A receptor-binding domain. In some cases, the libraries contain sequences encoding length variations of at least 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 codons fewer than a predetermined reference sequence. In some cases, the library contains sequences with length variations of at least 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, or more than 300 codons compared to a predetermined reference sequence.

[0104] After identifying the adenosine A2A receptor-binding domain, it can be placed in a scaffold as described herein. In some cases, the scaffold is an immunoglobulin. In some cases, the adenosine A2A receptor-binding domain is located in the CDRH3 region. The adenosine A2A receptor-binding domain that can be placed in the scaffold can also be referred to as a motif. Scaffolds containing the adenosine A2A receptor-binding domain can be designed based on binding, specificity, stability, expression, folding, or downstream activity. In some cases, scaffolds containing the adenosine A2A receptor-binding domain can achieve contact with the adenosine A2A receptor. In some cases, scaffolds containing the adenosine A2A receptor-binding domain can achieve high-affinity binding with the adenosine A2A receptor. Exemplary amino acid sequences of the adenosine A2A receptor-binding domain are described in Table 1.

[0105] Table 1. Amino acid sequence of adenosine A2A receptor binding domain

[0106]

[0107] This document provides scaffolds or immunoglobulins comprising an adenosine A2A receptor-binding domain, wherein the sequence of the adenosine A2A receptor-binding domain supports interaction with the adenosine A2A receptor. The sequence may be homologous to or identical to the sequence of an adenosine A2A receptor ligand. In some cases, the adenosine A2A receptor-binding domain sequence comprises at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO:1. In some cases, the adenosine A2A receptor-binding domain sequence comprises at least or about 95% homology with SEQ ID NO:1. In some cases, the adenosine A2A receptor-binding domain sequence comprises at least or about 97% homology with SEQ ID NO:1. In some cases, the adenosine A2A receptor-binding domain sequence comprises at least or about 99% homology with SEQ ID NO:1. In some cases, the adenosine A2A receptor-binding domain sequence shares at least or about 100% homology with SEQ ID NO:1. In some cases, the adenosine A2A receptor-binding domain sequence comprises at least a portion of at least or about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, or more than 400 amino acids having SEQ ID NO:1.

[0108] This document provides antibodies or immunoglobulins comprising a sequence having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO:540-717. In some cases, the antibody or immunoglobulin sequence has at least or about 95% sequence identity with any one of SEQ ID NO:540-717. In some cases, the antibody or immunoglobulin sequence has at least or about 97% sequence identity with any one of SEQ ID NO:540-717. In some cases, the antibody or immunoglobulin sequence has at least or about 99% sequence identity with any one of SEQ ID NO:540-717. In some cases, the antibody or immunoglobulin sequence has at least or about 100% sequence identity with any one of SEQ ID NO:540-717. In some cases, the antibody or immunoglobulin sequence comprises at least a portion of at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110 or more amino acids having any one of SEQ ID NO:540-717.

[0109] In some embodiments, the antibody or immunoglobulin sequence includes a complementarity-determining region (CDR) comprising the sequences listed in Tables 15-16. In some embodiments, the antibody or immunoglobulin sequence includes a complementarity-determining region (CDR) having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO:6-539. In some cases, the antibody or immunoglobulin sequence includes a complementarity-determining region (CDR) having at least or about 95% homology with any one of SEQ ID NO:6-539. In some cases, the antibody or immunoglobulin sequence includes a complementarity-determining region (CDR) having at least or about 97% homology with any one of SEQ ID NO:6-539. In some cases, the antibody or immunoglobulin sequence includes a complementarity-determining region (CDR) having at least or about 99% homology with any one of SEQ ID NO:6-539. In some cases, the antibody or immunoglobulin sequence includes a complementarity-determining region (CDR) having at least or about 100% homology with any one of SEQ ID NO:6-539. In some cases, the antibody or immunoglobulin sequence includes a complementarity-determining region (CDR) comprising at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids having any one of SEQ ID NO:6-539.

[0110] In some embodiments, the antibody or immunoglobulin sequence comprises CDR1, which has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO:6-94 or 273-361. In some cases, the antibody or immunoglobulin sequence comprises CDR1 having at least or about 95% homology with any one of SEQ ID NO:6-94 and 273-361. In some cases, the antibody or immunoglobulin sequence comprises CDR1 having at least or about 97% homology with any one of SEQ ID NO:6-94 or 273-361. In some cases, the antibody or immunoglobulin sequence comprises CDR1 having at least or about 99% homology with any one of SEQ ID NO:6-94 or 273-361. In some cases, the antibody or immunoglobulin sequence comprises CDR1 having at least or about 100% homology with any one of SEQ ID NO:6-270 or 273-537. In some cases, the antibody or immunoglobulin sequence comprises CDR1 having at least a portion of at least 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids having any one of SEQ ID NO:6-94 or 273-361.

[0111] In some embodiments, the antibody or immunoglobulin sequence comprises CDR2 with at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NO:95-183 and 362-450. In some cases, the antibody or immunoglobulin sequence comprises CDR2 with at least or about 95% homology to any one of SEQ ID NO:95-183 and 362-450. In some cases, the antibody or immunoglobulin sequence comprises CDR2 with at least or about 97% homology to any one of SEQ ID NO:795-183 and 362-450. In some cases, the antibody or immunoglobulin sequence comprises CDR2 with at least or about 99% homology to any one of SEQ ID NO:95-183 and 362-450. In some cases, the antibody or immunoglobulin sequence comprises a CDR2 that is at least or about 100% homologous to any one of SEQ ID NO:95-183 and 362-450. In some cases, the antibody or immunoglobulin sequence comprises a CDR2 that contains at least a portion of at least 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, or more than 16 amino acids having any one of SEQ ID NO:95-183 and 362-450.

[0112] In some embodiments, the antibody or immunoglobulin sequence comprises CDR3 with at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to any one of SEQ ID NO:184-272 and 451-539. In some cases, the antibody or immunoglobulin sequence comprises CDR3 with at least or about 95% homology to any one of SEQ ID NO:184-272 and 451-539. In some cases, the antibody or immunoglobulin sequence comprises CDR3 with at least or about 97% homology to any one of SEQ ID NO:184-272 and 451-539. In some cases, the antibody or immunoglobulin sequence comprises CDR3 with at least or about 99% homology to any one of SEQ ID NO:184-272 and 451-539. In some cases, the antibody or immunoglobulin sequence comprises a CDR3 that is at least or about 100% homologous to any one of SEQ ID NO:184-272 and 451-539. In some cases, the antibody or immunoglobulin sequence comprises a CDR3 that contains at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids having any one of SEQ ID NO:184-272 and 451-539.

[0113] In some embodiments, the antibody or immunoglobulin sequence comprises CDRH1, which has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO:6-94; CDRH2, which has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO:95-183; and CDRH2, which has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO:6-94 .... Any one of SEQ ID NO:184-272 includes CDRH3 with at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. In some cases, the antibody or immunoglobulin sequence contains CDRH1 with at least or about 95%, 97%, 99%, or 100% homology to any one of SEQ ID NO:6-94; CDRH2 with at least or about 95%, 97%, 99%, or 100% homology to any one of SEQ ID NO:95-183; and CDRH3 with at least or about 95%, 97%, 99%, or 100% homology to any one of SEQ ID NO:184-272. In some cases, the antibody or immunoglobulin sequence comprises CDRH1, which comprises at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids having SEQ ID NO: 6-94; CDRH2, which comprises at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids having SEQ ID NO: 95-183; and CDRH3, which comprises at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids having SEQ ID NO: 184-272.

[0114] In some embodiments, the antibody or immunoglobulin sequence comprises CDRL1, which has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO:273-361; CDRL2, which has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO:362-450; and CDRL2, which has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with SEQ ID NO:273-361 .... SEQ ID NO:451-539 includes CDRL3 with at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. In some cases, the antibody or immunoglobulin sequence contains CDRL1 with at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:273-361; CDRL2 with at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:362-450; and CDRL3 with at least or about 95%, 97%, 99%, or 100% homology to SEQ ID NO:451-539. In some cases, the antibody or immunoglobulin sequence comprises CDRL1, which comprises at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids having SEQ ID NO:273-361; CDRL2, which comprises at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids having SEQ ID NO:362-450; and CDRL3, which comprises at least a portion of at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more amino acids having SEQ ID NO:451-539.

[0115] In some embodiments, the antibody or immunoglobulin sequence comprises CDRH1, which has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO:6-94; CDRH2, which has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO:95-183; and CDRH2, which has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any one of SEQ ID NO:6-94 .... CDRH3, which has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any of SEQ ID NO: 184-272; CDRL1, which has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any of SEQ ID NO: 273-362; CDRL2, which has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any of SEQ ID NO: 362-450; and CDRL2, which has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any of SEQ ID NO: 184-272; and CDRL2, which has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any of SEQ ID NO: 362-450; and CDRL2, which has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any of Any CDRL3 in ID NO:451-539 that has at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity. In some cases, the antibody or immunoglobulin sequence comprises CDRH1 with at least or about 95%, 97%, 99%, or 100% homology to any one of SEQ ID NO:6-94; CDRH2 with at least or about 95%, 97%, 99%, or 100% homology to any one of SEQ ID NO:95-183; CDRH3 with at least or about 95%, 97%, 99%, or 100% homology to any one of SEQ ID NO:184-272; CDRL1 with at least or about 95%, 97%, 99%, or 100% homology to any one of SEQ ID NO:273-362; CDRL2 with at least or about 95%, 97%, 99%, or 100% homology to any one of SEQ ID NO:362-450; and CDRH3 with at least or about 95%, 97%, 99%, or 100% homology to any one of SEQ ID NO:6-94; and CDRH2 ... Any one of NO:451-539 includes CDRL3 which has at least or about 95%, 97%, 99% or 100% homology.In some cases, the antibody or immunoglobulin sequence comprises CDRH1, which comprises at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more 16 amino acids having any one of SEQ ID NO: 6-94; CDRH2, which comprises at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more 16 amino acids having any one of SEQ ID NO: 95-183; CDRH3, which comprises at least a portion having at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more 16 amino acids having any one of SEQ ID NO: 184-272; CDRL1, which comprises having SEQ ID NO: 95-183; CDRH2, which comprises at least a portion having ... The following are examples of SEQ ID NO: 273-362: at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more than 16 amino acids; CDRL2: at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more than 16 amino acids; and CDRL3: at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more than 16 amino acids; and CDRL3: at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more than 16 amino acids; and CDRL3: at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more than 16 amino acids; and CDRL4: at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more than 16 amino acids; and CDRL5: at least or about 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16 or more than 16 amino acids; and CDRL6 ...

[0116] In some embodiments, antibodies or immunoglobulins that bind to the adenosine A2A receptor are described herein. In some cases, the adenosine A2A receptor antibody or immunoglobulin sequence comprises a heavy chain variable domain having at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with any of SEQ ID NO:540-628. In some cases, the adenosine A2A receptor antibody or immunoglobulin sequence comprises a heavy chain variable domain having at least or about 95% sequence identity with any of SEQ ID NO:540-628. In some cases, the adenosine A2A receptor antibody or immunoglobulin sequence comprises a heavy chain variable domain having at least or about 97% sequence identity with any of SEQ ID NO:540-628. In some cases, the adenosine A2A receptor antibody or immunoglobulin sequence comprises a heavy chain variable domain having at least or about 99% sequence identity with any of SEQ ID NO:540-628. In some cases, the adenosine A2A receptor antibody or immunoglobulin sequence comprises a heavy chain variable domain having at least or about 100% sequence identity with any of SEQ ID NO:540-628. In some cases, the adenosine A2A receptor antibody or immunoglobulin sequence comprises a heavy chain variable domain having at least a portion of at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, or more than 110 amino acids of SEQ ID NO:540-628.

[0117] In some cases, the adenosine A2A receptor antibody or immunoglobulin sequence comprises a light chain variable domain that is at least or about 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identical to any one of SEQ ID NO:629-717. In some cases, the adenosine A2A receptor antibody or immunoglobulin sequence comprises a light chain variable domain that is at least or about 95% sequence identical to any one of SEQ ID NO:629-717. In some cases, the adenosine A2A receptor antibody or immunoglobulin sequence comprises a light chain variable domain that is at least or about 97% sequence identical to any one of SEQ ID NO:629-717. In some cases, the adenosine A2A receptor antibody or immunoglobulin sequence comprises a light chain variable domain that is at least or about 99% sequence identical to any one of SEQ ID NO:629-717. In some cases, the adenosine A2A receptor antibody or immunoglobulin sequence contains a light chain variable domain that is at least or about 100% sequence identical to any one of SEQ ID NO:629-717. In some cases, the adenosine A2A receptor antibody or immunoglobulin sequence comprises a light chain variable domain containing at least a portion of at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400 or more of 400 amino acids having SEQ ID NO:629-717.

[0118] In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:540; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:629. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:541; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:630. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:542; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:631. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:543; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:632. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:544; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:633. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:545; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:634. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:546; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:635. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:547; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:636. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:548; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:637.In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 549; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 638. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 550; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 639. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 551; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 640. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:552; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:641. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:553; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:642. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:554; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:643. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 555; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 644. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 556; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 645. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 557; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 646.In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:558; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:647. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:559; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:648. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:560; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:649. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:561; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:650. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:562; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:651. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:563; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:652. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:564; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:653. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:565; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:654. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:566; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:655.In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:567; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:656. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:568; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:657. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:569; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:658. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:570; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:659. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:571; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:660. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:572; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:661. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:573; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:662. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:574; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:663. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:575; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:664.In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:576; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:665. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:577; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:666. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:578; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:667. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 579; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 668. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 580; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 669. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 581; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 670. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:582; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:671. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:583; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:672. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:584; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:673.In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:585; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:674. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:586; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:675. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:587; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:676. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:588; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:677. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:589; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:678. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:590; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:679. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:591; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:680. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:592; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:681. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:593; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:682.In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:594; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:683. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:595; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:684. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:596; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:685. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:597; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:686. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:598; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:687. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:599; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:688. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 600; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 689. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 601; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 690. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 602; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 691.In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 603; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 692. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 604; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 693. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 605; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO: 694. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:606; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:695. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:607; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:696. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:608; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:697. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:609; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:698. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:610; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:699. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:611; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:700.In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:612; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:701. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:613; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:702. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:614; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:703. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:615; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:704. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:616; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:705. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:617; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:706. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:618; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:707. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:619; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:708. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:620; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:709.In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:621; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:710. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:622; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:711. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:623; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:712. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:624; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:713. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:625; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:714. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:626; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:715. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:627; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:716. In some embodiments, the immunoglobulin heavy chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:628; and the immunoglobulin light chain comprises an amino acid sequence having at least about 90% identity with the amino acid sequence shown in SEQ ID NO:717.

[0119] This article provides an adenosine A2A receptor-binding library comprising nucleic acids encoding a scaffold or immunoglobulins containing an adenosine A2A receptor-binding domain, wherein the domain includes variations in domain type, domain length, or residues. In some cases, the domain is a region within the scaffold containing an adenosine A2A receptor-binding domain. For example, the region is a VH, CDRH3, or VL domain. In some cases, the domain is an adenosine A2A receptor-binding domain.

[0120] The methods described herein provide for the synthesis of adenosine A2A receptor-binding nucleic acid libraries, each nucleic acid encoding a predetermined variant of at least one predetermined reference nucleic acid sequence. In some cases, the predetermined reference sequence is a nucleic acid sequence encoding a protein, and the variant library contains sequences encoding at least a single codon of variation, such that a standard translation process produces multiple distinct variants of a single residue in a subsequent protein encoded by the synthesized nucleic acid. In some cases, the adenosine A2A receptor-binding library contains distinct nucleic acids that co-encode variations at multiple positions. In some cases, the variant library contains sequences encoding at least a single codon of variation in the VH, CDRH3, or VL domain. In some cases, the variant library contains sequences encoding at least a single codon of variation in the adenosine A2A receptor-binding domain. For example, at least one single codon of the adenosine A2A receptor-binding domain listed in Table 1 is varied. In some cases, the variant library contains sequences encoding multiple codons of variation in the VH, CDRH3, or VL domain. In some cases, the variant library contains sequences encoding multiple codons of variation in the adenosine A2A receptor-binding domain. Exemplary numbers of codons used for variation include, but are not limited to, at least or about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300 or more codons.

[0121] The methods described herein provide for the synthesis of adenosine A2A receptor-binding nucleic acid libraries, each nucleic acid encoding at least one predetermined variant of a predetermined reference nucleic acid sequence, wherein the adenosine A2A receptor-binding library comprises sequences encoding domains of varying lengths. In some cases, the domain is a VH, CDRH3, or VL domain. In some cases, the domain is an adenosine A2A receptor-binding domain. In some cases, the library comprises sequences encoding length variations of at least 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 225, 250, 275, 300, or more than 300 codons fewer than the predetermined reference sequence. In some cases, the library contains sequences with length variations of at least 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, or more than 300 codons compared to a predetermined reference sequence.

[0122] This document provides an adenosine A2A receptor-binding library comprising nucleic acids encoding a scaffold containing an adenosine A2A receptor-binding domain, wherein the adenosine A2A receptor-binding library is synthesized with varying numbers of fragments. In some cases, the fragments contain VH, CDRH3, or VL domains. In some cases, the adenosine A2A receptor-binding library is synthesized with at least or about 2, 3, 4, 5, or more fragments. The length of each nucleic acid fragment or the average length of the synthesized nucleic acids can be at least or about 50, 75, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, or more than 600 base pairs. In some cases, the length is approximately 50 to 600, 75 to 575, 100 to 550, 125 to 525, 150 to 500, 175 to 475, 200 to 450, 225 to 425, 250 to 400, 275 to 375, or 300 to 350 base pairs.

[0123] Adenosine A2A receptor-binding libraries containing nucleic acids encoding a scaffold, when translated, contain amino acids of various lengths, the scaffold comprising the adenosine A2A receptor-binding domain described herein. In some cases, the length of each amino acid fragment or the average length of the synthesized amino acids may be at least or about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, or more than 150 amino acids. In some cases, the length of an amino acid is approximately 15 to 150, 20 to 145, 25 to 140, 30 to 135, 35 to 130, 40 to 125, 45 to 120, 50 to 115, 55 to 110, 60 to 110, 65 to 105, 70 to 100, or 75 to 95 amino acids. In other cases, the length of an amino acid is approximately 22 to approximately 75 amino acids.

[0124] A de novo adenosine A2A receptor-binding library containing de novo synthesized variant sequences encoding a scaffold comprising a plurality of variant sequences, wherein the scaffold comprises an adenosine A2A receptor-binding domain. In some cases, a plurality of variant sequences are de novo synthesized for CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, CDRL3, VL, VH, or combinations thereof. In some cases, a plurality of variant sequences are de novo synthesized for frame element 1 (FW1), frame element 2 (FW2), frame element 3 (FW3), or frame element 4 (FW4). In some cases, a plurality of variant sequences are de novo synthesized for the adenosine A2A receptor-binding domain. For example, the number of variant sequences for the VH domain is about 1 to about 10 sequences, and for the adenosine A2A receptor-binding domain it is about 10 sequences. 8 The number of sequences, for the VK domain, is approximately 1 to approximately 44. The number of variant sequences can be at least, or approximately 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, or more than 500 sequences. In some cases, the number of variant sequences is approximately 10 to 300, 25 to 275, 50 to 250, 75 to 225, 100 to 200, or 125 to 150 sequences.

[0125] Adenosine A2A receptor-binding libraries containing variant sequences of a de novo synthesized scaffold encoding an adenosine A2A receptor-binding domain include enhanced diversity. For example, variants are generated by placing a variant of the adenosine A2A receptor-binding domain within an immunoglobulin scaffold variant containing an N-terminal CDRH3 variant and a C-terminal CDRH3 variant. In some cases, variants include affinity maturation variants. Alternatively or in combination, variants include variants in other regions of the immunoglobulin, including but not limited to CDRH1, CDRH2, CDRL1, CDRL2, and CDRL3. In some cases, the number of variants in the adenosine A2A receptor-binding library is at least or about 10. 4 10 5 10 6 10 7 10 8 10 9 10 10 10 11 10 12 10 13 10 14 10 15 10 16 10 17 10 18 10 19 10 20 or more than 10 20 The library contains 10 different sequences. For example, a library containing approximately 10 variant sequences of the VH region, approximately 237 variant sequences of the CDRH3 region, and approximately 43 variant sequences of the VL and CDRL3 regions contains 10 different sequences. 5 10x237x43 distinct sequences.

[0126] This document provides libraries containing nucleic acids encoding adenosine A2A receptor antibodies, wherein the antibodies contain variations in at least one region of the antibody, wherein said region is a CDR region. In some cases, the adenosine A2A receptor antibody is a single-domain antibody containing a heavy chain variable domain, such as a VHH antibody. In some cases, the VHH antibody contains variations in one or more CDR regions. In some cases, the libraries described herein contain at least or about 1, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2400, 2600, 2800, 3000, or more than 3000 CDR1, CDR2, or CDR3 sequences. In some cases, the libraries described herein contain at least or about 10 4 10 5 10 6 107 10 8 10 9 10 10 10 11 10 12 10 13 10 14 10 15 10 16 10 17 10 18 10 19 10 20 or more than 10 20 There are at least 2000 CDR1, CDR2, or CDR3 sequences. For example, the library contains at least 2000 CDR1 sequences, at least 1200 CDR2 sequences, and at least 1600 CDR3 sequences. In some cases, each sequence is different.

[0127] In some cases, CDR1, CDR2, or CDR3 belongs to a light chain variable field (VL). The CDR1, CDR2, or CDR3 of a light chain variable field (VL) may be referred to as CDRL1, CDRL2, or CDRL3, respectively. In some cases, the library described herein contains at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2400, 2600, 2800, 3000, or more than 3000 sequences of CDR1, CDR2, or CDR3 of a VL. In some cases, the library described herein contains at least or about 10 CDR1, CDR2, or CDR3 of VL. 4 10 5 10 6 10 7 10 8 10 9 10 10 10 11 10 12 10 13 10 14 10 15 10 16 10 17 10 18 10 19 10 20 One or more 10 20The library contains at least 20 VL CDR1 sequences, at least 4 VL CDR2 sequences, and at least 140 VL CDR3 sequences. In some cases, the library contains at least 2 VL CDR1 sequences, at least 1 VL CDR2 sequence, and at least 3000 VL CDR3 sequences. In some cases, the VL is IGKV1-39, IGKV1-9, IGKV2-28, IGKV3-11, IGKV3-15, IGKV3-20, IGKV4-1, IGLV1-51, IGLV2-14, IGLV1-40, or IGLV3-1. In some cases, the VL is IGKV2-28. In some cases, the VL is IGLV1-51.

[0128] In some cases, CDR1, CDR2, or CDR3 belong to heavy chain variable domains (VHs). The CDR1, CDR2, or CDR3 of a heavy chain variable domain (VH) may be referred to as CDRH1, CDRH2, or CDRH3, respectively. In some cases, the libraries described herein contain at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1200, 1400, 1600, 1800, 2000, 2400, 2600, 2800, 3000, or more than 3000 CDR1, CDR2, or CDR3 sequences of VHs. In some cases, the libraries described herein contain at least or about 10 4 10 5 10 6 10 7 10 8 10 9 10 10 10 11 10 12 10 13 10 14 10 15 10 16 10 17 10 18 10 19 10 20 or more than 10 20 The library contains CDR1, CDR2, or CDR3 sequences of at least 30 VHs, at least 570 VHs' CDR2 sequences, and at least 10 CDR3 sequences of VHs. 8 The library contains CDR3 sequences of at least 30 VHs, CDR2 sequences of at least 860 VHs, and at least 10 CDR3 sequences of VHs. In some cases, the library contains CDR1 sequences of at least 30 VHs, CDR2 sequences of at least 860 VHs, and CDR3 sequences of at least 10 VHs.7 The CDR3 sequence of a VH. In some cases, the VH is IGHV1-18, IGHV1-69, IGHV1-8, IGHV3-21, IGHV3-23, IGHV3-30 / 33rn, IGHV3-28, IGHV3-74, IGHV4-39, or IGHV4-59 / 61. In some cases, the VH is IGHV1-69, IGHV3-30, IGHV3-23, IGHV3, IGHV1-46, IGHV3-7, IGHV1, or IGHV1-8. In some cases, the VH is both IGHV1-69 and IGHV3-30. In some cases, the VH is IGHV3-23.

[0129] In some implementations, the library described herein contains CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 of varying lengths. In some cases, the length of CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 contains at least or about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, or more than 90 amino acids. For example, CDRH3 may contain at least or about 12, 15, 16, 17, 20, 21, or 23 amino acids in length. In some cases, CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 contains amino acids in the range of about 1 to about 10, about 5 to about 15, about 10 to about 20, or about 15 to about 30 in length.

[0130] When translated, libraries containing nucleic acids encoding antibodies with variant CDR sequences, as described herein, contain amino acids of various lengths. In some cases, the length of each amino acid fragment or the average length of the synthesized amino acids can be at least or about 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150 or more amino acids. In some cases, the amino acid length is about 15 to 150, 20 to 145, 25 to 140, 30 to 135, 35 to 130, 40 to 125, 45 to 120, 50 to 115, 55 to 110, 60 to 110, 65 to 105, 70 to 100, or 75 to 95 amino acids. In some cases, the amino acid length is about 22 to about 75 amino acids. In some cases, the antibody contains at least or about 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, or more than 5000 amino acids.

[0131] The length ratio of CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 in the library described herein can vary. In some cases, CDRL1, CDRL2, CDRL3, CDRH1, CDRH2, or CDRH3 containing at least or about 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, or more than 90 amino acids in length constitute about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more of the library. For example, CDRH3 containing approximately 23 amino acids was present in 40% of the library, CDRH3 containing approximately 21 amino acids was present in 30%, CDRH3 containing approximately 17 amino acids was present in 20%, and CDRH3 containing approximately 12 amino acids was present in 10%. In some cases, CDRH3 containing approximately 20 amino acids was present in 40%, CDRH3 containing approximately 16 amino acids was present in 30%, CDRH3 containing approximately 15 amino acids was present in 20%, and CDRH3 containing approximately 12 amino acids was present in 10%.

[0132] The library encoding VHH antibodies described herein contains recombined components to generate antibodies with at least or about 10 7 10 8 10 9 10 10 10 11 10 12 10 13 10 14 10 15 10 16 10 17 10 18 10 19 10 20 or more than 10 20 The theoretical diversity of the library consists of variant CDR sequences. In some cases, the final library diversity is at least or about 10. 7 10 8 10 9 10 10 10 11 10 12 10 13 10 14 10 15 10 16 10 17 10 18 10 19 10 20 or more than 10 20 A sequence.

[0133] This article provides an adenosine A2A receptor-binding library encoding immunoglobulins. In some cases, adenosine A2A receptor immunoglobulins are antibodies. In some cases, adenosine A2A receptor immunoglobulins are VHH antibodies. In some cases, adenosine A2A receptor immunoglobulins contain binding affinity (e.g., KA) to the adenosine A2A receptor of less than 1 nM, less than 1.2 nM, less than 2 nM, less than 5 nM, less than 10 nM, less than 11 nM, less than 13.5 nM, less than 15 nM, less than 20 nM, less than 25 nM, or less than 30 nM. D In some cases, adenosine A2A receptor immunoglobulin includes less than 1 nM of K. D In some cases, adenosine A2A receptor immunoglobulin includes less than 1.2 nM of K+. D In some cases, adenosine A2A receptor immunoglobulin includes less than 2 nM of K+. D In some cases, adenosine A2A receptor immunoglobulin includes less than 5 nM of K+. D In some cases, adenosine A2A receptor immunoglobulin includes less than 10 nM of K+. DIn some cases, adenosine A2A receptor immunoglobulin includes K+ of less than 13.5 nM. D In some cases, adenosine A2A receptor immunoglobulin includes less than 15 nM of K+. D In some cases, adenosine A2A receptor immunoglobulin includes less than 20 nM of K+. D In some cases, adenosine A2A receptor immunoglobulin includes less than 25 nM of K+. D In some cases, adenosine A2A receptor immunoglobulin includes less than 30 nM of K+. D .

[0134] In some cases, adenosine A2A receptor immunoglobulin is an adenosine A2A receptor agonist. In some cases, it is an adenosine A2A receptor antagonist. In some cases, it is an adenosine A2A receptor allosteric regulator. In some cases, the allosteric regulator is a negative allosteric regulator. In some cases, it is a positive allosteric regulator. In some cases, adenosine A2A receptor immunoglobulin exhibits agonistic, antagonistic, or allosteric effects at concentrations of at least or about 1 nM, 2 nM, 4 nM, 6 nM, 8 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, 100 nM, 120 nM, 140 nM, 160 nM, 180 nM, 200 nM, 300 nM, 400 nM, 500 nM, 600 nM, 700 nM, 800 nM, 900 nM, 1000 nM, or more than 1000 nM. In some cases, adenosine A2A receptor immunoglobulin is a negative allosteric regulator. In some cases, adenosine A2A receptor immunoglobulin is a negative allosteric modulator at concentrations of at least or about 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1 nM, 2 nM, 4 nM, 6 nM, 8 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, 100 nM, or more than 100 nM. In other cases, adenosine A2A receptor immunoglobulin is a negative allosteric modulator at concentrations ranging from about 0.001 to about 100, 0.01 to about 90, about 0.1 to about 80, 1 to about 50, about 10 to about 40 nM, or about 1 to about 10 nM. In some cases, adenosine A2A receptor immunoglobulin contains at least or about 0.001, 0.0025, 0.005, 0.01, 0.025, 0.05, 0.06, 0.07, 0.08, 0.9, 0.1, 0.5, 1, 2, 3, 4, 5, 6, or more than 6 nM of EC50 or IC50. In other cases, adenosine A2A receptor immunoglobulin contains at least or about 1 nM, 2 nM, 4 nM, 6 nM, 8 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 60 nM, 70 nM, 80 nM, 90 nM, 100 nM, or more than 100 nM of EC50 or IC50.

[0135] The adenosine A2A receptor immunoglobulin described herein may include improved properties. In some cases, adenosine A2A receptor immunoglobulin is monomeric. In some cases, adenosine A2A receptor immunoglobulin does not readily aggregate. In some cases, at least or about 70%, 75%, 80%, 85%, 90%, 95%, or 99% of adenosine A2A receptor immunoglobulin is monomeric. In some cases, adenosine A2A receptor immunoglobulin is thermostable. In some cases, adenosine A2A receptor immunoglobulin leads to reduced nonspecific binding.

[0136] After synthesizing an adenosine A2A receptor-binding library containing a nucleic acid encoding a scaffold containing an adenosine A2A receptor-binding domain, the library can be used for screening and analysis. For example, library displayability and panning can be analyzed. In some cases, selectable tags are used to analyze displayability. Exemplary tags include, but are not limited to, radiolabels, fluorescent labels, enzymes, chemiluminescent tags, colorimetric tags, affinity tags, or other tags or labels known in the art. In some cases, the tags are histidine, multiple histidines, myc, hemagglutinin (HA), or FLAG. The adenosine A2A receptor-binding library may contain a nucleic acid encoding a scaffold containing an adenosine A2A receptor-binding domain having multiple tags (e.g., GFP, FLAG, and Lucy) and a DNA barcode. In some cases, libraries are analyzed by sequencing using various methods, including but not limited to single-molecule real-time (SMRT) sequencing, Polony sequencing, ligation sequencing, reversible terminator sequencing, proton detection sequencing, ion semiconductor sequencing, nanopore sequencing, electronic sequencing, pyrosequencing, Maxam-Gilbert sequencing, chain termination (e.g., Sanger) sequencing, +S sequencing, or synthetic sequencing.

[0137] Expression System

[0138] This article provides libraries containing nucleic acids encoding scaffolds containing adenosine A2A receptor-binding domains, wherein said libraries exhibit enhanced specificity, stability, expression, folding, or downstream activity. In some cases, the libraries described herein are used for screening and analysis.

[0139] This document provides libraries containing nucleic acids encoding scaffolds containing adenosine A2A receptor-binding domains, wherein said nucleic acid libraries are used for screening and analysis. In some cases, screening and analysis include in vitro, in vivo, or ex vivo assays. Cells used for screening include primary cells derived from living subjects or cell lines. Cells may be derived from prokaryotes (e.g., bacteria and fungi) or eukaryotes (e.g., animals and plants). Exemplary animal cells include, but are not limited to, those from mice, rabbits, primates, and insects. In some cases, cells used for screening include cell lines, including but not limited to the Chinese hamster ovary (CHO) cell line, the human embryonic kidney (HEK) cell line, or the young hamster kidney (BHK) cell line. In some cases, the nucleic acid libraries described herein may also be delivered to multicellular organisms. Exemplary multicellular organisms include, but are not limited to, plants, mice, rabbits, primates, and insects.

[0140] Nucleic acid libraries described herein or their encoded protein libraries can be screened for various pharmacological or pharmacokinetic properties. In some cases, in vitro, in vivo, or ex vivo assays are used to screen libraries. For example, the in vitro pharmacological or pharmacokinetic properties screened include, but are not limited to, binding affinity, binding specificity, and binding affinity. Exemplary in vivo pharmacological or pharmacokinetic properties of the screened libraries described herein include, but are not limited to, therapeutic efficacy, activity, preclinical toxicity, clinical efficacy, clinical toxicity, immunogenicity, potency, and clinical safety properties.

[0141] Pharmacological or pharmacokinetic properties that can be screened include, but are not limited to, cell binding affinity and cell activity. For example, cell binding affinity or cell activity assays are performed to determine the agonist, antagonist, or allosteric effects of the libraries described herein. In some cases, cell activity assays are cAMP assays. In some cases, cell binding or cell activity is compared between the libraries described herein and ligands of the adenosine A2A receptor.

[0142] The libraries described herein can be screened using either cell-based or non-cell-based assays. Examples of non-cell-based assays include, but are not limited to, the use of viral particles, the use of in vitro translated proteins, and the use of protein liposomes with adenosine A2A receptors.

[0143] Nucleic acid libraries as described herein can be screened through sequencing. In some cases, next-generation sequencing is used to determine sequence enrichment of adenosine A2A receptor-binding variants. In some cases, it is used to determine V gene distribution, J gene distribution, V gene family, CDR3 count per length, or combinations thereof. In some cases, it is used to determine clonal frequency, clonal accumulation, lineage accumulation, or combinations thereof. In some cases, it is used to determine the number of sequences, sequences with VH clones, clones, clones greater than 1, clonoids, clonoids greater than 1, lineages, simpsons, or combinations thereof. In some cases, it is used to determine the percentage of dissimilar CDR3s. For example, the percentage of dissimilar CDR3s is calculated by dividing the number of dissimilar CDR3s in the sample by the total number of sequences with CDR3s in the sample.

[0144] This document provides nucleic acid libraries that can be expressed in vectors. Expression vectors used for inserting the nucleic acid libraries disclosed herein may include eukaryotic or prokaryotic expression vectors. Exemplary expression vectors include, but are not limited to, mammalian expression vectors:

[0145] pSF-CMV-NEO-NH2-PPT-3XFLAG, pSF-CMV-NEO-COOH-3XFLAG, pSF-CMV-PURO-NH2-GST-TEV,

[0146] The vectors used for expression include: pSF-OXB20-COOH-TEV-FLAG(R)-6His, pCEP4, pDEST27, pSF-CMV-Ub-KrYFP, pSF-CMV-FMDV-daGFP, pEF1a-mCherry-N1, pEF1a-tdTomato, pSF-CMV-FMDV-Hygro, pSF-CMV-PGK-Puro, pMCP-tag(m), and pSF-CMV-PURO-NH2-CMYC; bacterial expression vectors: pSF-OXB20-BetaGal, pSF-OXB20-Fluc, pSF-OXB20, and pSF-Tac; plant expression vectors: pRI 101-AN DNA and pCambia2301; yeast expression vectors: pTYB21 and pKLAC2; and insect vectors: pAc5.1 / V5-His A and pDEST8. In some cases, the vector is pcDNA3 or pcDNA3.1.

[0147] This article describes the expression in a vector to generate a nucleic acid library containing a scaffold comprising a sequence of an adenosine A2A receptor-binding domain. In some cases, the size of the construct varies. In some cases, the construct contains at least or about 500, 600, 700, 800, 900, 1000, 1100, 1300, 1400, 1500, 1600, 1700, 1800, 2000, 2400, 2600, 2800, 3000, 3200, 3400, 3600, 3800, 4000, 4200, 4400, 4600, 4800, 5000, 6000, 7000, 8000, 9000, 10000, or more than 10000 bases. In some cases, the construct contains approximately 300 to 1,000, 300 to 2,000, 300 to 3,000, 300 to 4,000, 300 to 5,000, 300 to 6,000, 300 to 7,000, 300 to 8,000, 300 to 9,000, 300 to 10,000, 1,000 to 2,000, 1,000 to 3,000, 1,000 to 4,000, 1,000 to 5,000, 1,000, 1,000, 2,000, 3,000, 4,000, 1,000 to 5,000, 1,000, 2,000, 3,000, 3,000, 4,000, 1,000, 3,000, 4,000, 5,000, 1,000, 3 ... 0 to 6,000, 1,000 to 7,000, 1,000 to 8,000, 1,000 to 9,000, 1,000 to 10,000, 2,000 to 3,000, 2,000 to 4,000, 2,000 to 5,000, 2,000 to 6,000, 2,000 to 7,000, 2,000 to 8,000, 2,000 to 9,000, 2,000 to 10,000, 3,000 to 4,000, 3 ,000 to 5,000, 3,000 to 6,000, 3,000 to 7,000, 3,000 to 8,000, 3,000 to 9,000, 3,000 to 10,000, 4,000 to 5,000, 4,000 to 6,000, 4,000 to 7,000, 4,000 to 8,000, 4,000 to 9,000, 4,000 to 10,000, 5,000 to 6,000, 5,000 to 7,000 0, 5,000 to 8,000, 5,000 to 9,000, 5,000 to 10,000, 6,000 to 7,000, 6,000 to 8,000, 6,000 to 9,000, 6,000 to 10,000, 7,000 to 8,000, 7,000 to 9,000, 7,000 to 10,000, 8,000 to 9,000, 8,000 to 10,000, or 9,000 to 10,000 bases.

[0148] This document provides libraries comprising nucleic acids encoding scaffolds containing adenosine A2A receptor-binding domains, wherein the nucleic acid libraries are expressed in cells. In some cases, the libraries are synthesized to express reporter genes. Exemplary reporter genes include, but are not limited to, acetylhydroxylase (AHAS), alkaline phosphatase (AP), β-galactosidase (LacZ), β-glucuronidase (GUS), chloramphenicol acetyltransferase (CAT), green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP), cyan fluorescent protein (CFP), sky blue fluorescent protein, lemon fluorescent protein, orange fluorescent protein, cherry fluorescent protein, blue-green fluorescent protein, blue fluorescent protein, horseradish peroxidase (HRP), luciferase (Luc), carmine base synthase (NOS), octopus base synthase (OCS), luciferase, and derivatives thereof. Methods for determining reporter gene regulation are well known in the art and include, but are not limited to, fluorescence assays (e.g., fluorescence spectroscopy, fluorescence-activated cell sorting (FACS), fluorescence microscopy) and antibiotic resistance assays.

[0149] Diseases and symptoms

[0150] This document provides an adenosine A2A receptor-binding library containing nucleic acids encoding a scaffold that includes an adenosine A2A receptor-binding domain capable of therapeutic effects. In some cases, the adenosine A2A receptor-binding library, when translated, produces a protein for treating a disease or condition. In some cases, the protein is an immunoglobulin. In some cases, the protein is a peptide. Exemplary diseases include, but are not limited to, cancer, inflammatory diseases or conditions, metabolic diseases or conditions, cardiovascular diseases or conditions, respiratory diseases or conditions, pain, digestive diseases or conditions, reproductive diseases or conditions, endocrine diseases or conditions, or neurological diseases or conditions. In some cases, the neurological disease or condition is a neurodegenerative disease or condition. In some cases, the neurological disease or condition is Parkinson's disease, Alzheimer's disease, or multiple sclerosis. In some cases, the cancer is a solid tumor or a blood cancer. In some cases, the A2AR immunoglobulin described herein is used as a monotherapy for treating cancer. In some cases, the A2AR immunoglobulin described herein is used in combination with other therapeutic agents for treating cancer. In some cases, the A2AR immunoglobulins described herein enhance tumor vaccines, checkpoint blockade, and adoptive T-cell therapy. In some cases, the adenosine A2A receptor inhibitors described herein are used to treat diseases or conditions of the central nervous system, kidneys, intestines, lungs, hair, skin, bone, or cartilage. In some cases, the adenosine A2A receptor inhibitors described herein are used for sleep regulation, angiogenesis, or immune system regulation. In some cases, the subjects are mammals. In some cases, the subjects are mice, rabbits, dogs, or humans. Subjects treated by the methods described herein may be infants, adults, or children. Pharmaceutical compositions comprising antibodies or antibody fragments as described herein can be administered intravenously or subcutaneously.

[0151] Variant Library

[0152] Codon mutation

[0153] The variant nucleic acid library described herein may contain multiple nucleic acids, each encoding a variant codon sequence compared to a reference nucleic acid sequence. In some cases, each nucleic acid in the first nucleic acid group contains a variant at a single variant site. In some cases, the first nucleic acid group contains multiple variants at a single variant site, such that the first nucleic acid group contains more than one variant at the same variant site. The first nucleic acid group may contain nucleic acids that co-encode multiple codon variants at the same variant site. The first nucleic acid group may contain nucleic acids that co-encode up to 19 or more codons at the same position. The first nucleic acid group may contain nucleic acids that co-encode up to 60 variant triplets at the same position, or the first nucleic acid group may contain nucleic acids that co-encode up to 61 different codon triplets at the same position. Each variant may encode a codon that produces a different amino acid during translation. Table 3 provides a list of each possible codon (and representative amino acid) for each variant site.

[0154] Table 2. List of codons and amino acids

[0155]

[0156]

[0157] A nucleic acid population can contain different nucleic acids that co-encode up to 20 codon variations at multiple positions. In such cases, each nucleic acid in the population contains codon variations at more than one position in the same nucleic acid. In some cases, each nucleic acid in the population contains codon variations at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more codon variations in a single nucleic acid. In some cases, each variant long nucleic acid contains codon variations at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more codon variations in a single long nucleic acid. In some cases, this group of variant nucleic acids contains codon variations at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more codon variations in a single long nucleic acid. In other cases, this group of variant nucleic acids contains codon variations at at least about 10, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more codon variations in a single long nucleic acid.

[0158] Highly parallel nucleic acid synthesis

[0159] This paper presents a platform approach for creating a revolutionary synthesis platform by miniaturizing, parallelizing, and vertically integrating an end-to-end process from polynucleotide synthesis within nanopores on silicon to gene assembly. The device described herein provides a footprint similar to a 96-well plate, and this silicon synthesis platform can increase throughput by up to 1,000 times or more compared to conventional synthesis methods, generating up to approximately 1,000,000 or more polynucleotides or 10,000 or more genes in a single highly parallelized run.

[0160] With the advent of next-generation sequencing, high-resolution genomic data has become a crucial factor in in-depth research into the biological roles of various genes in normal biology and disease pathogenesis. The core of this study is the central dogma of molecular biology and the concept of "residue-by-residue transfer of continuous information." This involves transcribing the genomic information encoded in DNA into proteins, which are then translated into active products within a given biological pathway.

[0161] Another exciting area of ​​research concerns the discovery, development, and fabrication of therapeutic molecules targeting highly specific cellular targets. Highly diverse DNA sequence libraries are central to the development pipeline for targeted therapies. Using gene mutants to express proteins in the design, construction, and testing cycle of protein engineering ideally yields optimized genes with high expression of proteins that have high affinity for their therapeutic targets. Consider, for example, the binding pocket of a receptor. The ability to simultaneously test all sequence arrangements of all residues within the binding pocket allows for in-depth exploration, increasing the likelihood of success. Saturation mutagenesis (where researchers attempt to generate all possible mutations at specific sites within the receptor) represents one approach to this development challenge. While costly, time-consuming, and labor-intensive, it allows for the introduction of every variant to every site. Conversely, combinatorial mutagenesis (where several selected sites or short DNA segments can be extensively modified) generates an incomplete repertoire of variants with biased representation.

[0162] To accelerate the drug development process, libraries containing desired variants available at the correct locations and expected frequencies for testing (in other words, precise libraries) enable reduced costs and screening turnaround times. This article presents a method for synthesizing nucleic acid synthetic variant libraries that allows for the precise introduction of each desired variant at the desired frequency. For end users, this means not only thorough sampling of the sequence space but also the ability to efficiently query these hypotheses, thereby reducing costs and screening time. Whole-genome editing can elucidate important pathways where each variant and sequence arrangement can be detected to obtain libraries with optimal functionality, and entire pathways and genomes can be reconstructed using thousands of genes to remodel biological systems for drug discovery.

[0163] In the first example, the drug itself can be optimized using the methods described herein. For example, to improve a specific function of an antibody, a library of variant polynucleotides encoding a portion of the antibody is designed and synthesized. The variant nucleic acid library of the antibody can then be generated using the processes described herein (e.g., insertion into a vector after PCR mutagenesis). The antibody is then expressed in a production cell line and screened for enhanced activity. Example screenings include examining the regulation of binding affinity to antigens, stability, or effector function (e.g., ADCC, complement, or apoptosis). Exemplary regions used to optimize the antibody include, but are not limited to, the Fc region, the Fab region, the variable region of the Fab region, the constant region of the Fab region, and the variable domain (V) of the heavy or light chain. H or V L ) and V H or V L Specific complementarity determination regions (CDRs).

[0164] The nucleic acid libraries synthesized using the methods described herein can be expressed in a variety of cells associated with disease states. Cells associated with disease states include cell lines, tissue samples, primary cells from a subject, cultured cells expanded from a subject, or cells in model systems. Exemplary model systems include, but are not limited to, plant and animal models of disease states.

[0165] To identify variant molecules associated with the prevention, mitigation, or treatment of disease states, the variant nucleic acid libraries described herein are expressed in cells associated with the disease state or in cells capable of inducing cellular disease states. In some cases, agents are used to induce disease states in cells. Exemplary tools for inducing disease states include, but are not limited to, the Cre / Lox recombination system, LPS-induced inflammation, and streptozotocin for inducing hypoglycemia. Cells associated with the disease state can be cells from model systems or cultured cells, as well as cells from subjects with specific disease states. Exemplary disease states include bacterial, fungal, viral, autoimmune, or proliferative conditions (e.g., cancer). In some cases, the variant nucleic acid libraries are expressed in model systems, cell lines, or primary cells derived from subjects and screened for changes in at least one cellular activity. Exemplary cellular activities include, but are not limited to, proliferation, cell cycle progression, cell death, adhesion, migration, replication, cell signaling, energy production, oxygen utilization, metabolic activity and aging, response to free radical damage, or any combination thereof.

[0166] base

[0167] Devices used as surfaces for polynucleotide synthesis can be in the form of substrates, including but not limited to homogeneous array surfaces, patterned array surfaces, channels, beads, gels, etc. This document provides substrates comprising multiple clusters, each cluster containing multiple seats supporting polynucleotide attachment and synthesis. In some cases, the substrate comprises a homogeneous array surface. For example, the homogeneous array surface is a homogeneous plate. As used herein, the term "seat" refers to a structurally discrete region that provides support for the extension of a polynucleotide encoding a single predetermined sequence from that surface. In some cases, the seat is on a two-dimensional surface (e.g., a substantially planar surface). In some cases, the seat is on a three-dimensional surface (e.g., a pore, micropore, channel, or pillar). In some cases, the surface of the seat comprises material activated and functionalized to attach at least one nucleotide for polynucleotide synthesis or preferably a group of the same nucleotides for the synthesis of a group of polynucleotides. In some cases, a polynucleotide refers to a group of polynucleotides encoding the same nucleic acid sequence. In some cases, the surface of the substrate comprises one or more surfaces of the substrate. The average error rate of polynucleotides synthesized in the libraries described herein using the provided systems and methods is typically less than 1 / 1000, less than about 1 / 2000, less than about 1 / 3000 or lower, and usually no error correction is required.

[0168] This article provides a surface that supports the parallel synthesis of multiple polynucleotides with different predetermined sequences at addressable sites on a common support. In some cases, the substrate is suitable for synthesizing more than 50, 100, 200, 400, 600, 800, 1000, 1200, 1400, 1600, 1800, 2,000, 5,000, 10,000, 20,000, 50,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000 Supported by 0, 900,000, 1,000,000, 1,200,000, 1,400,000, 1,600,000, 1,800,000, 2,000,000, 2,500,000, 3,000,000, 3,500,000, 4,000,000, 4,500,000, 5,000,000, 10,000,000 or more different polynucleotides. In some cases, the surface is synthesized to exceed 50, 100, 200, 400, 600, 800, 1000, 1200, 1400, 1600, 1800, 2,000, 5,000, 10,000, 20,000, 50,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000 Support is provided by 900,000, 1,000,000, 1,200,000, 1,400,000, 1,600,000, 1,800,000, 2,000,000, 2,500,000, 3,000,000, 3,500,000, 4,000,000, 4,500,000, 5,000,000, 10,000,000 or more polynucleotides encoding different sequences. In some cases, at least some polynucleotides have the same sequence or are configured to be synthesized with the same sequence. In some cases, the substrate provides a surface environment for the growth of polynucleotides having at least 80, 90, 100, 120, 150, 175, 200, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 or more bases.

[0169] This article provides methods for synthesizing polynucleotides at different loci on a substrate, where each locus supports the synthesis of a polynucleotide population. In some cases, each locus supports the synthesis of a polynucleotide population with a different sequence from that grown at another locus. In some cases, each polynucleotide sequence is synthesized with 1, 2, 3, 4, 5, 6, 7, 8, 9 or more redundancies at different loci within the same locus cluster on the surface used for polynucleotide synthesis. In some cases, the loci of the substrate are located within multiple clusters. In some cases, the substrate contains at least 10, 500, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000, 14000, 15000, 20000, 30000, 40000, 50000 or more clusters. In some cases, the substrate contains more than 2,000, 5,000, 10,000, 100,000, 200,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, 1,000,000, 1,100,000, 1,200,000, 1,300,000, 1,400,000, 1,500,000, 1,600,000, 1,700,000, 1,800,000, 1,900,000, 2 The number of distinct seats can be 1,000,000, 300,000, 400,000, 500,000, 600,000, 700,000, 800,000, 900,000, 1,000,000, 1,200,000, 1,400,000, 1,600,000, 1,800,000, 2,000,000, 2,500,000, 3,000,000, 3,500,000, 4,000,000, 4,500,000, 5,000,000, or 10,000,000 or more. In some cases, the base contains approximately 10,000 distinct seats. The number of seats within a single cluster varies depending on the circumstances. In some cases, each cluster contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 130, 150, 200, 300, 400, 500 or more seats. In some cases, each cluster contains approximately 50-500 seats. In some cases, each cluster contains approximately 100-200 seats. In some cases, each cluster contains approximately 100-150 seats. In some cases, each cluster contains approximately 109, 121, 130 or 137 seats. In some cases, each cluster contains approximately 19, 20, 61, 64 or more seats.Alternatively or in combination, polynucleotide synthesis is carried out on a uniform array surface.

[0170] In some cases, the number of different polynucleotides synthesized on the substrate depends on the number of different loci available in the substrate. In some cases, the locus density within the clusters or surface of the substrate is at least or about 1, 10, 25, 50, 65, 75, 100, 130, 150, 175, 200, 300, 400, 500, 1,000 or more loci / mm². 2 In some cases, the substrate includes 10-500, 25-400, 50-500, 100-500, 150-500, 10-250, 50-250, 10-200, or 50-200 mm. 2 In some cases, the distance between the centers of two adjacent seats within a cluster or surface is approximately 10-500, 10-200, or 10-100 μm. In some cases, the distance between the centers of two adjacent seats is greater than approximately 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 μm. In some cases, the distance between the centers of two adjacent seats is less than approximately 200, 150, 100, 80, 70, 60, 40, 30, 20, or 10 μm. In some cases, each seat has a width of approximately 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 μm. In some cases, each seat has a width of approximately 0.5-100, 0.5-50, 10-75, or 0.5-50 μm.

[0171] In some cases, the density of clusters within the substrate is at least or about 1 cluster / 100 mm. 2 1 cluster / 10mm 2 1 cluster / 5mm 2 1 cluster / 4mm 2 1 cluster / 3mm 2 1 cluster / 2mm 2 1 cluster / 1mm 2 2 clusters / 1mm 2 3 clusters / 1mm 2 4 clusters / 1mm 2 5 clusters / 1mm 2 10 clusters / 1mm 2 50 clusters / 1mm 2 Or higher. In some cases, the substrate contains approximately 1 cluster / 10 mm. 2 Approximately 10 clusters / 1mm 2In some cases, the distance between the centers of two adjacent clusters is at least or about 50, 100, 200, 500, 1000, 2000, or 5000 μm. In some cases, the distance between the centers of two adjacent clusters is about 50-100, 50-200, 50-300, 50-500, and 100-2000 μm. In some cases, the distance between the centers of two adjacent clusters is about 0.05-50, 0.05-10, 0.05-5, 0.05-4, 0.05-3, 0.05-2, 0.1-10, 0.2-10, 0.3-10, 0.4-10, 0.5-10, 0.5-5, or 0.5-2 mm. In some cases, each cluster has a cross-section of about 0.5 to about 2, about 0.5 to about 1, or about 1 to about 2 mm. In some cases, each cluster has a cross-sectional area of ​​approximately 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2 mm. In other cases, each cluster has an internal cross-sectional area of ​​approximately 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.15, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2 mm.

[0172] In some cases, the substrate is approximately the size of a standard 96-well plate, for example, approximately 100 to approximately 200 mm by approximately 50 to approximately 150 mm. In some cases, the substrate has a diameter less than or equal to approximately 1000, 500, 450, 400, 300, 250, 200, 150, 100, or 50 mm. In some cases, the substrate diameter is approximately 25-1000, 25-800, 25-600, 25-500, 25-400, 25-300, or 25-200 mm. In some cases, the substrate has a diameter of at least approximately 100, 200, 500, 1,000, 2,000, 5,000, 10,000, 12,000, 15,000, 20,000, 30,000, 40,000, or 50,000 mm. 2 Or a larger planar surface area. In some cases, the thickness of the substrate is approximately 50-2000, 50-1000, 100-1000, 200-1000, or 250-1000 mm.

[0173] Surface materials

[0174] The substrates, apparatuses, and reactors provided herein are made of any kind of material suitable for the methods, compositions, and systems described herein. In some cases, the substrate material is manufactured to exhibit low levels of nucleotide binding. In some cases, the substrate material is modified to create different surfaces exhibiting high levels of nucleotide binding. In some cases, the substrate material is transparent to visible light and / or ultraviolet light. In some cases, the substrate material has sufficient conductivity, for example, to form a uniform electric field across the entire substrate or a portion thereof. In some cases, the conductive material is electrically grounded. In some cases, the substrate is thermally conductive or thermally insulating. In some cases, the material is chemically and thermally resistant to support chemical or biochemical reactions, such as polynucleotide synthesis processes. In some cases, the substrate comprises a flexible material. For flexible materials, the material may include, but is not limited to, modified and unmodified nylon, nitrocellulose, polypropylene, etc. In some cases, the substrate comprises a rigid material. For rigid materials, the material may include, but is not limited to, glass; fused silica; silicon; plastics (e.g., polytetrafluoroethylene, polypropylene, polystyrene, polycarbonate, and mixtures thereof); metals (e.g., gold, platinum, etc.). The substrate, solid support, or reactor may be made of a material selected from silicon, polystyrene, agarose, dextran, cellulose polymers, polyacrylamide, polydimethylsiloxane (PDMS), and glass. The substrate / solid support, or the microstructures therein, or the reactor may be made of a combination of the materials shown herein or any other suitable materials known in the art.

[0175] Surface architecture

[0176] This document provides substrates for the methods, compositions, and systems described herein, wherein the substrates have a surface architecture suitable for the methods, compositions, and systems described herein. In some cases, the substrates contain protrusions and / or depressions. One advantage of having such features is the increased surface area used to support polynucleotide synthesis. In some cases, substrates with protrusions and / or depressions are referred to as three-dimensional substrates. In some cases, three-dimensional substrates contain one or more channels. In some cases, one or more sites contain channels. In some cases, channels can be deposited with reagents using a deposition apparatus such as a material deposition apparatus. In some cases, reagents and / or fluids are collected in a larger pore that is in fluid communication with one or more channels. For example, the substrate contains multiple channels corresponding to multiple sites having clusters, and said multiple channels are in fluid communication with a pore of the cluster. In some methods, a polynucleotide library is synthesized at multiple sites of a cluster.

[0177] This document provides a substrate for use in the methods, compositions, and systems described herein, wherein the substrate is configured for polynucleotide synthesis. In some cases, the structure is configured to allow controlled flow and mass transfer pathways for polynucleotide synthesis on the surface. In some cases, the substrate configuration allows for controlled and uniform distribution of mass transfer pathways, chemical exposures, and / or washing efficiencies during polynucleotide synthesis. In some cases, the substrate configuration allows for improved scanning efficiency, for example, by providing sufficient volume for polynucleotide growth such that the volume excluded by the grown polynucleotide constitutes no more than 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less of the initial available volume for polynucleotide growth. In some cases, the three-dimensional structure allows for controlled flow of fluids, thereby allowing for rapid exchange of chemical exposures.

[0178] This document provides substrates for the methods, compositions, and systems described herein, wherein the substrates contain structures suitable for the methods, compositions, and systems described herein. In some cases, isolation is achieved through physical structure. In others, isolation is achieved through differential functionalization of the surface to create activating and passivating regions for polynucleotide synthesis. In still others, differential functionalization produces a water contact angle effect that can cause reagent beading or wetting, resulting in deposits, by alternating hydrophobicity across the entire substrate surface. Larger structures reduce splashing and cross-contamination of reagents from adjacent spots at different polynucleotide synthesis sites. In some cases, devices such as material deposition apparatuses are used to deposit reagents at different polynucleotide synthesis sites. Substrates with three-dimensional features are configured to allow the synthesis of large quantities of polynucleotides (e.g., more than about 10,000) with low error rates (e.g., less than about 1:500, 1:1000, 1:1500, 1:2,000; 1:3,000; 1:5,000; or 1:10,000). In some cases, the substrate contains a density of approximately 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 300, 400, or 500 features / mm. 2 Its characteristics.

[0179] The apertures in the substrate may have the same or different width, height, and / or volume as another aperture in the substrate. The channels in the substrate may have the same or different width, height, and / or volume as another channel in the substrate. In some cases, the diameter of the cluster or the diameter of the aperture containing the cluster, or both, is about 0.05-50, 0.05-10, 0.05-5, 0.05-4, 0.05-3, 0.05-2, 0.05-1, 0.05-0.5, 0.05-0.1, 0.1-10, 0.2-10, 0.3-10, 0.4-10, 0.5-10, 0.5-5, or 0.5-2 mm. In some cases, the diameter of the cluster or aperture, or both, is less than or about 5, 4, 3, 2, 1, 0.5, 0.1, 0.09, 0.08, 0.07, 0.06, or 0.05 mm. In some cases, the diameter of the cluster or aperture, or both, is approximately 1.0 mm to 1.3 mm. In some cases, the diameter of the cluster or aperture, or both, is approximately 1.150 mm. In some cases, the diameter of the cluster or aperture, or both, is approximately 0.08 mm. The diameter of the cluster refers to the cluster within a two-dimensional or three-dimensional substrate.

[0180] In some cases, the hole height is approximately 20-1000, 50-1000, 100-1000, 200-1000, 300-1000, 400-1000, or 500-1000 μm. In other cases, the hole height is less than approximately 1000, 900, 800, 700, or 600 μm.

[0181] In some cases, the substrate contains multiple channels corresponding to multiple seats within the cluster, wherein the height or depth of the channels is 5-500, 5-400, 5-300, 5-200, 5-100, 5-50, or 10-50 μm. In other cases, the height of the channels is less than 100, 80, 60, 40, or 20 μm.

[0182] In some cases, the diameter of the channel, seat (e.g., in a substantially flat substrate), or both the channel and seat (e.g., in a three-dimensional substrate in which the seat corresponds to the channel) is about 1-1000, 1-500, 1-200, 1-100, 5-100, or 10-100 μm, for example, about 90, 80, 70, 60, 50, 40, 30, 20, or 10 μm. In some cases, the diameter of the channel, seat, or both the channel and seat is less than about 100, 90, 80, 70, 60, 50, 40, 30, 20, or 10 μm. In some cases, the distance between the centers of two adjacent channels, seats, or channels and seats is about 1-500, 1-200, 1-100, 5-200, 5-100, 5-50, or 5-30, for example, about 20 μm.

[0183] Surface finishing

[0184] This document provides methods for synthesizing polynucleotides on surfaces containing various surface modifications. In some cases, surface modifications are employed to chemically and / or physically alter a surface through addition or subtraction processes to change one or more chemical and / or physical properties of a substrate surface or selected sites or regions of a substrate surface. For example, surface modifications include, but are not limited to: (1) altering the wetting properties of a surface; (2) functionalizing a surface, i.e., providing, modifying, or substituting surface functional groups; (3) defunctionalizing a surface, i.e., removing surface functional groups; (4) otherwise altering the chemical composition of a surface, such as by etching; (5) increasing or decreasing surface roughness; (6) providing a coating on a surface, e.g., a coating exhibiting wetting properties different from those of the surface; and / or (7) depositing microparticles on a surface.

[0185] In some cases, adding a chemical layer (referred to as an adhesion promoter) on top of a surface facilitates the structured patterning of a seat on the substrate surface. Exemplary surfaces for applying the adhesion promoter include, but are not limited to, glass, silicon, silicon dioxide, and silicon nitride. In some cases, the adhesion promoter is a chemical with high surface energy. In some cases, a second chemical layer is deposited on the surface of the substrate. In some cases, the second chemical layer has low surface energy. In some cases, the surface energy of the chemical layer coated on the surface supports the positioning of small droplets on the surface. Depending on the selected patterning arrangement, the proximity of the seat and / or the fluid contact area at the seat can be varied.

[0186] In some cases (e.g., for polynucleotide synthesis), the substrate surface or resolution site to which nucleic acids or other components are deposited is smooth or substantially planar (e.g., two-dimensional) or has irregularities, such as raised or recessed features (e.g., three-dimensional features). In some cases, the substrate surface is modified with one or more different layers of compounds. Such modifying layers of interest include, but are not limited to, inorganic and organic layers, such as metals, metal oxides, polymers, small organic molecules, etc.

[0187] In some cases, the resolution sites of a substrate are functionalized using one or more portions that increase and / or decrease surface energy. In some cases, the portions are chemically inert. In some cases, the portions are configured to support desired chemical reactions, such as one or more processes in a polynucleotide synthesis reaction. The surface energy or hydrophobicity of a surface is a factor determining the affinity of nucleotides for attachment to that surface. In some cases, substrate functionalization methods include: (a) providing a substrate having a surface comprising silica; and (b) silanizing the surface using a suitable silanizing agent (e.g., an organofunctionalized alkoxysilane molecule) described herein or known in the art. The methods and functionalizing agents are described in U.S. Patent 5,474,796, which is incorporated herein by reference in its entirety.

[0188] In some cases, the substrate surface is functionalized by contacting a derivatized composition containing a mixture of silanes with a reactive hydrophilic portion present on the substrate surface, under reaction conditions that effectively couple silanes to the substrate surface. Silanization generally involves covering the surface using the self-assembly of organofunctional alkoxysilane molecules. A variety of siloxane functionalizing agents currently known in the art can also be used, for example, to reduce or increase surface energy. Organofunctional alkoxysilanes are classified according to their organic functionality.

[0189] Polynucleotide synthesis

[0190] The methods disclosed herein for polynucleotide synthesis may include processes involving phosphorus amide chemistry. In some cases, polynucleotide synthesis includes coupling a base to phosphorus amide. Polynucleotide synthesis may include coupling a base by depositing phosphorus amide under coupling conditions, wherein the same base is optionally deposited with phosphorus amide more than once, i.e., double coupling. Polynucleotide synthesis may include capping unreacted sites. In some cases, capping is optional. Polynucleotide synthesis may also include oxidation or oxidation steps or multiple oxidation steps. Polynucleotide synthesis may include unblocking, detriphenylmethylation, and sulfidation. In some cases, polynucleotide synthesis includes oxidation or sulfidation. In some cases, the apparatus is washed, for example, with tetrazolium or acetonitrile, during or between steps of the polynucleotide synthesis reaction. The frame of any step in the phosphorus amide synthesis method may be less than about 2 min, 1 min, 50 s, 40 s, 30 s, 20 s, and 10 s.

[0191] Polynucleotide synthesis using the phosphoramidite method may include the subsequent addition of a phosphoramidite component (e.g., nucleoside phosphoramidite) to a growing polynucleotide chain to form a phosphotriester bond. Phosphoside polynucleotide synthesis is carried out along the 3' to 5' direction. Phosphoside polynucleotide synthesis allows for the controlled addition of one nucleotide to a growing nucleic acid chain in each synthesis cycle. In some cases, each synthesis cycle includes a coupling step. Phosphoside coupling includes forming a phosphotriester bond between an activated nucleoside phosphoramidite and a nucleoside bound to the substrate (e.g., via a linker). In some cases, the activated nucleoside phosphoramidite is provided to the apparatus. In some cases, the nucleoside phosphoramidite is provided to the apparatus along with an activator. In some cases, nucleoside phosphoramide is provided to the device in an excess of 1.5, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100 or more times relative to the nucleoside bound to the substrate. In some cases, the addition of nucleoside phosphoramide is carried out in an anhydrous environment (e.g., in anhydrous acetonitrile). Optionally, the device is washed after the addition of nucleoside phosphoramide. In some cases, the coupling step is repeated one or more times, optionally with washing steps between additions of nucleoside phosphoramide to the substrate. In some cases, the polynucleotide synthesis methods used herein include one, two, three or more consecutive coupling steps. In many cases, prior to coupling, the nucleoside bound to the device is deprotected by removing a protecting group, which acts to prevent polymerization. The most common protecting group is 4,4'-dimethoxytriphenylmethyl (DMT).

[0192] Following coupling, the phosphoramidite polynucleotide synthesis method optionally includes a capping step. In the capping step, the grown polynucleotide is treated with a capping agent. The capping step can be used to block unreacted 5'-OH groups bound to the substrate after coupling to prevent further chain extension, thereby preventing the formation of polynucleotides with internal base deletions. Furthermore, phosphoramidite activated with 1H-tetrazole can react to a small extent with the O6 position of guanosine. Unbound by theory, this byproduct (possibly migrating via O6-N7) can undergo depurination after oxidation with I2 / water. The apurinolite site can terminate cleavage during the final deprotection of the polynucleotide, thus reducing the yield of the full-length product. O6 modification can be removed by treatment with a capping agent prior to oxidation with I2 / water. In some cases, including a capping step in the polynucleotide synthesis process reduces the error rate compared to synthesis without capping. As an example, the capping step includes treating the substrate-bound polynucleotide with a mixture of acetic anhydride and 1-methylimidazole. Optionally, the apparatus is washed after the capping step.

[0193] In some cases, the grown nucleic acid bound to the device is oxidized after the addition of nucleoside phosphoramide, and optionally after capping and one or more washing steps. The oxidation step involves oxidizing the phosphite triester to a four-coordinate phosphotriester—a protected precursor of naturally occurring phosphodiester nucleoside linkages. In some cases, the oxidation of the grown polynucleotide is achieved by treatment with iodine and water, optionally in the presence of a weak base (e.g., pyridine, dimethylpyridine, trimethylpyridine). Oxidation can be carried out under anhydrous conditions using, for example, tert-butyl hydroperoxide or (1S)-(+)-(10-camphorsulfonyl)-oxaprodione (CSO). In some methods, a capping step is performed after oxidation. This second capping step allows the device to dry, as any residual water from oxidation that may persist can inhibit subsequent coupling. After oxidation, the device and the grown polynucleotide are optionally washed. In some cases, the oxidation step is replaced by a sulfidation step to obtain polynucleotide thiophosphate, wherein any capping step may be performed after sulfidation. Many reagents are capable of efficient sulfur transfer, including but not limited to 3-(dimethylaminomethylene)amino)-3H-1,2,4-dithiazolyl-3-thione, DDTT, 3H-1,2-benzodithiapentane-3-one 1,1-dioxide (also known as Beaucage reagent), and N,N,N'N'-tetraethylthiuram disulfide (TETD).

[0194] To enable subsequent nucleoside incorporation cycles to occur via coupling, the protected 5' end of the grown polynucleotide bound to the device is removed, allowing the primary hydroxyl group to react with the next nucleoside phosphoramidite. In some cases, the protecting group is DMT, and deblocking is performed using trichloroacetic acid in dichloromethane. Prolonged detrimethylation or detrimethylation using a stronger acid solution than recommended can lead to increased depurination of the polynucleotide bound to the solid support, thus reducing the yield of the desired full-length product. The methods and compositions of this disclosure provide controlled deblocking conditions, thereby limiting undesirable depurination reactions. In some cases, the polynucleotide bound to the device is washed after deblocking. In some cases, effective washing after deblocking contributes to the synthesis of polynucleotides with a low error rate.

[0195] Polynucleotide synthesis methods generally include an iterative sequence of the following steps: applying a protected monomer to an activated functionalized surface (e.g., a seat) for linkage with the activated surface, a linker, or a pre-deprotected monomer; deprotecting the applied monomer so that it can react with subsequently applied protected monomers; and applying another protected monomer for linkage. One or more intermediate steps include oxidation or sulfidation. In some cases, one or more washing steps are performed before or after one or all of these steps.

[0196] Phosphoramide-based polynucleotide synthesis methods comprise a series of chemical steps. In some cases, one or more steps of the synthesis method involve reagent cycling, where one or more steps of the method involve applying a reagent useful to that step to the apparatus. For example, reagents are cycled through a series of liquid-phase deposition and vacuum drying steps. For substrates containing three-dimensional features such as pores, micropores, and channels, reagents optionally pass through one or more regions of the apparatus via pores and / or channels.

[0197] The methods and systems described herein relate to a polynucleotide synthesis apparatus for synthesizing polynucleotides. The synthesis can be parallel. For example, at least or about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 1000, 10000, 50000, 75000, 100000 or more polynucleotides can be synthesized in parallel. The total number of polynucleotides that can be synthesized in parallel can be 2-100,000, 3-50,000, 4-10,000, 5-1,000, 6-900, 7-850, 8-800, 9-750, 10-700, 11-650, 12-600, 13-550, 14-500, 15-450, 16-400, 17-350, 18-300, 19-250, 20-200, 21-150, 22-100, 23-50, 24-45, 25-40, or 30-35. Those skilled in the art will understand that the total number of polynucleotides synthesized in parallel can fall within any range defined by any of these values, for example, 25-100. The total number of polynucleotides synthesized in parallel can fall within any range defined by any value acting as an endpoint of the range. The total molar mass of the polynucleotides synthesized in the device, or the molar mass of each polynucleotide, may be at least or at least about 10, 20, 30, 40, 50, 100, 250, 500, 750, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 25000, 50000, 75000, 100000 picomoles or greater. The length of each polynucleotide, or the average length of the polynucleotides in the device, may be at least or at least at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 100, 150, 200, 300, 400, 500 or more nucleotides. The length of each polynucleotide or the average length of polynucleotides within the device can be up to or approximately up to 500, 400, 300, 200, 150, 100, 50, 45, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10 or fewer nucleotides. The length of each polynucleotide or the average length of polynucleotides within the device can fall into the range of 10-500, 9-400, 11-300, 12-200, 13-150, 14-100, 15-50, 16-45, 17-40, 18-35, 19-25.Those skilled in the art will understand that the length of each polynucleotide or the average length of polynucleotides within a device can be within any range defined by any of these values, for example, 100-300. The length of each polynucleotide or the average length of polynucleotides within a device can be within any range defined by any value serving as an endpoint of the range.

[0198] The method for synthesizing polynucleotides on a surface provided herein allows for rapid synthesis. As an example, at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 125, 150, 175, 200 or more nucleotides can be synthesized per hour. Nucleotides include adenine, guanine, thymine, cytosine, uridine constructs, or their analogues / modified forms. In some cases, polynucleotide libraries are synthesized in parallel on the substrate. For example, a device containing about or at least about 100, 1,000, 10,000, 30,000, 75,000, 100,000, 1,000,000, 2,000,000, 3,000,000, 4,000,000, or 5,000,000 resolver loci can support the synthesis of at least the same number of different polynucleotides, wherein polynucleotides encoding different sequences are synthesized at resolver loci. In some cases, polynucleotide libraries can be synthesized on the device with the low error rate described herein within a timeframe of less than about three months, two months, one month, three weeks, 15 days, 14 days, 13 days, 12 days, 11 days, 10 days, 9 days, 8 days, 7 days, 6 days, 5 days, 4 days, 3 days, 2 days, 24 hours, or less. In some cases, larger nucleic acids assembled from polynucleotide libraries synthesized with low error rates using the substrates and methods described herein can be prepared in less than approximately three months, two months, one month, three weeks, 15 days, 14 days, 13 days, 12 days, 11 days, 10 days, 9 days, 8 days, 7 days, 6 days, 5 days, 4 days, 3 days, 2 days, 24 hours, or less.

[0199] In some cases, the methods described herein provide a way to generate nucleic acid libraries containing variant nucleic acids that differ at multiple codon sites. In some cases, the nucleic acid may have 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 30, 40, 50, or more variant codon sites.

[0200] In some cases, one or more of the variant codon sites can be adjacent. In other cases, one or more of the variant codon sites can be non-adjacent and separated by 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more codons.

[0201] In some cases, nucleic acids may contain multiple sites of variant codon sites, where all variant codon sites are adjacent to each other, forming a segment of variant codon sites. In other cases, nucleic acids may contain multiple sites of variant codon sites, where none of the variant codon sites are adjacent to each other. In still other cases, nucleic acids may contain multiple sites of variant codon sites, where some variant codon sites are adjacent to each other, forming a segment of variant codon sites, while others are not adjacent to each other.

[0202] See attached diagram. Figure 3 An exemplary processing workflow for synthesizing nucleic acids (e.g., genes) from shorter nucleic acids is shown. The workflow is broadly divided into the following stages: (1) de novo synthesis of a single-stranded nucleic acid library, (2) ligation of nucleic acids to form larger fragments, (3) error correction, (4) quality control, and (5) transport. Prior to de novo synthesis, a desired nucleic acid sequence or a set of nucleic acid sequences is pre-selected. For example, a set of genes is pre-selected for generation.

[0203] Once a large nucleic acid is selected for generation, a predetermined nucleic acid library is designed for de novo synthesis. Various suitable methods for generating high-density polynucleotide arrays are known. In this workflow example, a device surface layer is provided. In this example, the chemical properties of the surface are modified to improve the polynucleotide synthesis process. Low surface energy regions are generated to repel liquids, while high surface energy regions are generated to attract liquids. The surface itself can be in the form of a planar surface or include variations in shape, such as protrusions or micropores that increase surface area. In this workflow example, as disclosed in International Patent Application Publication WO / 2015 / 021080, which is incorporated herein by reference in its entirety, the selected high surface energy molecules perform a dual function supporting the DNA chemical process.

[0204] In-situ preparation of polynucleotide arrays is performed on a solid support, utilizing a single-nucleotide extension process to extend multiple oligomers in parallel. Deposition apparatuses, such as material deposition apparatuses, are designed to release reagents in a stepwise manner, allowing multiple polynucleotides to extend one residue at a time in parallel to generate oligomers 302 with a predetermined nucleic acid sequence. In some cases, the polynucleotides are cleaved from the surface at this stage. Cleavage includes, for example, gaseous cleavage using ammonia or methylamine.

[0205] The generated polynucleotide library is placed in a reaction chamber. In this exemplary workflow, the reaction chamber (also referred to as a “nanoreactor”) is a silica-coated pore containing PCR reagents that descend onto the polynucleotide library 303. Reagents are added before or after the polynucleotide sealing 304 to release the polynucleotides from the substrate. In this exemplary workflow, the polynucleotides are released after the nanoreactor sealing 305. Once released, fragments of the single-stranded polynucleotide hybridize to span the entire long-range DNA sequence. Partial hybridization 305 is possible because each synthesized polynucleotide is designed to have a small portion overlapping with at least one other polynucleotide in the pool.

[0206] After hybridization, the PCA reaction begins. During the polymerase cycle, polynucleotides anneal with complementary fragments, and gaps are filled by polymerase. The length of each fragment is randomly increased each cycle based on which polynucleotides find each other. The complementarity between fragments allows for the formation of complete, large-span double-stranded DNA 306.

[0207] After PCA is completed, the nanoreactor is separated from the device 307 and positioned to interact with the device containing PCR primers 308. After sealing, the nanoreactor undergoes PCR 309 and amplifies larger nucleic acids. After PCR 310, the nanochamber 311 is opened, error correction reagent is added 312, the chamber is sealed 313, and an error correction reaction is performed to remove mismatched base pairs and / or strands with poor complementarity from the double-stranded PCR amplification product 314. The nanoreactor is then opened and separated 315. The error-corrected product then undergoes further processing steps, such as PCR and molecular barcoding, and is subsequently packaged 322 for transport 323.

[0208] In some cases, quality control measures are implemented. Following error correction, the quality control steps include, for example, interacting with a wafer containing sequencing primers for amplifying the error-corrected product 316, sealing the wafer into a chamber containing the error-corrected amplification product 317, and performing another round of amplification 318. The nanoreactor is then opened 319, the products are combined 320, and sequencing is performed 321. After obtaining acceptable quality control results, the packaged product is permitted for shipment 322 323.

[0209] In some cases, through such Figure 3 The nucleic acids generated in the workflow are mutagenized using overlapping primers disclosed herein. In some cases, primer libraries are generated by in-situ preparation on a solid support, and multiple oligomers are extended in parallel using a single nucleotide extension process. Deposition devices, such as material deposition devices, are designed to release reagents in a stepwise manner, allowing multiple polynucleotides to extend one residue at a time in parallel to generate oligomers 302 with a predetermined nucleic acid sequence.

[0210] Computer System

[0211] Any system described herein is operably connectable to a computer and can be automated locally or remotely via a computer. In various cases, the methods and systems of this disclosure may further include software programs on a computer system and their use. Therefore, computerized control of the synchronization of dispensing / vacuuming / refilling functions (such as orchestrating and synchronizing the movement of the material deposition apparatus, dispensing actions, and vacuum actuation) is within the scope of this disclosure. The computer system can be programmed to interface between a user-specified base sequence and the location of the material deposition apparatus to deliver the correct reagent to a designated area of ​​the substrate.

[0212] Figure 4 The computer system 400 shown can be understood as a logical device capable of reading instructions from medium 411 and / or network port 405, which may optionally be connected to a server 409 having fixed medium 412. Such as Figure 4 The illustrated system may include a CPU 401, a disk drive 403, optional input devices such as a keyboard 415 and / or a mouse 416, and an optional monitor 407. Data communication with a server at a local or remote location can be achieved via the illustrated communication medium. The communication medium may include any means of transmitting and / or receiving data. For example, the communication medium may be a network connection, a wireless connection, or an Internet connection. Such a connection can provide communication via the World Wide Web. It is conceivable that data relating to this disclosure may be transmitted via such a network or connection so that... Figure 4 The user side 422 shown receives and / or reviews the document.

[0213] like Figure 5As shown, cache memory 504 may be connected to or incorporated into processor 502 to provide high-speed memory for recently or frequently used instructions or data by processor 502. Processor 502 is connected to northbridge 506 via processor bus 508. Northbridge 506 is connected to random access memory (RAM) 510 via memory bus 512 and manages processor 502's access to RAM 510. Northbridge 506 is also connected to southbridge 514 via chipset bus 516. Southbridge 514 is in turn connected to peripheral bus 518. Peripheral bus may be, for example, PCI, PCI-X, PCI Express, or other peripheral buses. Northbridge and southbridge are commonly referred to as processor chipsets and manage data transfer between the processor, RAM, and peripheral components on peripheral bus 518. In some alternative architectures, northbridge functionality may be incorporated into the processor instead of using a separate northbridge chip. In some cases, system 500 may include accelerator card 522 attached to peripheral bus 518. Accelerators may include field-programmable gate arrays (FPGAs) or other hardware used to accelerate a process. For example, accelerators can be used for adaptive data reconstruction or to evaluate algebraic expressions used in extended set processing.

[0214] Software and data are stored in external memory 524 and can be loaded into RAM 510 and / or cache memory 504 for processor use. System 500 includes an operating system for managing system resources; non-limiting examples of the operating system include Linux, Windows™, MACOSTM, BlackBerry OS™, iOS™, and other functionally equivalent operating systems, as well as application software running on top of the operating system for managing and optimizing data storage according to the example scenarios of this disclosure. In this example, system 500 also includes network interface cards (NICs) 520 and 521 connected to a peripheral bus to provide a network interface with external storage such as network attached storage (NAS) and other computer systems that can be used for distributed parallel processing.

[0215] Figure 6This diagram illustrates a network 600 with multiple computer systems 602a and 602b, multiple cellular phones and personal data assistants 602c, and network attached storage (NAS) 604a and 604b. In this example instance, systems 602a, 602b, and 602c manage data storage and optimize data access to data stored in NAS 604a and 604b. Mathematical models can be used for this data and evaluated using distributed parallel processing across computer systems 602a and 602b and the cellular phones and NAS system 602c. Computer systems 602a and 602b and the cellular phones and NAS system 602c can also provide parallel processing for adaptive data reconstruction of data stored in NAS 604a and 604b. Figure 6 Only one example is shown, and a wide variety of other computer architectures and systems can be used with many of the examples disclosed herein. For instance, blade servers can be used to provide parallel processing. Processor blades can be connected via a backplane to provide parallel processing. Storage can also be connected to the backplane via a separate network interface or as Network Attached Storage (NAS). In some example instances, processors may maintain separate storage spaces and transfer data via network interfaces, backplanes, or other connectors for parallel processing by other processors. In other cases, some or all processors may use a shared virtual address storage space.

[0216] Figure 7 This is a block diagram of a multiprocessor computer system using a shared virtual address memory space, based on an example scenario. The system includes multiple processors 702a-f that can access a shared memory subsystem 704. Multiple programmable hardware memory algorithm processors (MAPs) 706a-f are incorporated into the memory subsystem 704. Each MAP 706a-f may contain memory 708a-f and one or more field-programmable gate arrays (FPGAs) 710a-f. MAPs provide configurable functional units and can provide specific algorithms or portions of algorithms to the FPGAs 710a-f for processing in close coordination with the corresponding processors. For example, in the example scenario, a MAP can be used to evaluate algebraic expressions associated with a data model and for adaptive data reconstruction. In this example, each MAP can be used for global access by all processors for these purposes. In one configuration, each MAP can use direct memory access (DMA) to access its associated memory 708a-f, allowing it to perform tasks independently and asynchronously from its respective microprocessor 702a-f. In this configuration, the results of a MAP can be directly fed to another MAP for pipelined processing and parallel execution of algorithms.

[0217] The computer architectures and systems described above are merely examples, and a wide variety of other computer, cellular phone, and personal data assistant architectures and systems can be used in conjunction with these examples. These include systems using any combination of general-purpose processors, coprocessors, FPGAs and other programmable logic devices, systems-on-a-chip (SoCs), application-specific integrated circuits (ASICs), and other processing and logic elements. In some cases, all or part of the computer system may be implemented using software or hardware. Any type of data storage medium can be used in conjunction with these examples, including random access memory, hard disk drives, flash memory, tape drives, disk arrays, network-attached storage (NAS), and other local or distributed data storage devices and systems.

[0218] In the exemplary case, the computer system may be implemented using software modules that execute on any of the above-described or other computer architectures and systems. In other instances, the functionality of the system may be partially or entirely implemented in firmware, programmable logic devices, etc. Figure 5 This is implemented in Field Programmable Gate Arrays (FPGAs), System-on-Chip (SoCs), Application-Specific Integrated Circuits (ASICs), or other processing and logic elements. For example, set processors and optimizers can be implemented using hardware accelerator cards. Figure 5 The accelerator card 522 shown is implemented using hardware acceleration.

[0219] The following embodiments are provided to illustrate the principles and practice of the embodiments disclosed herein more clearly to those skilled in the art, and should not be construed as limiting the scope of any claimed embodiments. Unless otherwise stated, all parts and percentages are by weight.

[0220] Example

[0221] The following examples are given to illustrate various embodiments of this disclosure and are not intended to limit the invention in any way. These examples, as well as the methods described herein that represent preferred embodiments, are exemplary and not intended to limit the scope of this disclosure. Variations and other uses within the spirit of this disclosure as defined by the claims will be apparent to those skilled in the art.

[0222] Example 1: Functionalization of the device surface

[0223] The device was functionalized to support the attachment and synthesis of polynucleotide libraries. First, the device surface was wetted and cleaned for 20 minutes using a piranha solution containing 90% H₂SO₄ and 10% H₂O₂. The device was then rinsed in several beakers containing DI water, held under a DI water gooseneck stopcock for 5 minutes, and dried with N₂. Subsequently, the device was immersed in NH₄OH (1:60; 3 mL:300 mL) for 5 minutes, rinsed with DI water using a handgun, and then immersed in three consecutive beakers containing DI water for 1 minute each, followed by rinsing with DI water using a handgun. The device was then plasma-cleaned by exposing its surface to O₂. O₂ plasma etching was performed for 1 minute in downstream mode using a SAMCO PC-300 instrument at 250 watts.

[0224] Using a YES-1224P vapor deposition oven system with the following parameters, the cleaned apparatus surface was activated and functionalized with a solution containing N-(3-triethoxysilylpropyl)-4-hydroxybutyramide: 0.5 to 1 Torr, 60 min, 70 °C, 135 °C vaporizer. Resist was then applied to the apparatus surface using a Brewer Science 200X spin coater. SPR... TM 3612 photoresist was spin-coated onto the device at 2500 rpm for 40 seconds. The device was pre-baked on a Brewer hot plate at 90°C for 30 minutes. The device was then photolithographically aligned using a Karl Suss MA6 mask aligner. The device was exposed for 2.2 seconds and developed in MSF 26A for 1 minute. Residual developer was rinsed with a handheld spray gun, and the device was immersed in water for 5 minutes. The device was then baked in an oven at 60°C for 30 minutes, followed by visual inspection for lithographic defects using a Nikon L200. Residual resist was removed using a descum process with O2 plasma etching at 250 watts for 1 minute on a SAMCO PC-300 instrument.

[0225] The device surface was passivated and functionalized using a 100 μL perfluorooctyltrichlorosilane solution mixed with 10 μL of light mineral oil. The device was placed in a chamber, pumped for 10 min, then the valve to the pump was closed and the device was allowed to stand for 10 min. The chamber was then vented. The resist was stripped by two 5-min immersions in 500 mL of NMP at 70 °C, simultaneously sonicated at maximum power (9 on the Crest system). The device was then immersed in 500 mL of isopropanol at room temperature for 5 min, simultaneously sonicated at maximum power. The device was then immersed in 300 mL of 200% ethanol (proof) and dried with N2. This functionalized surface was activated to serve as a support for polynucleotide synthesis.

[0226] Example 2: Synthesis of 50-mer sequences on an oligonucleotide synthesis apparatus

[0227] A two-dimensional oligonucleotide synthesis apparatus was assembled into a flow cell and connected to the flow cell (Applied Biosystems (ABI 394 DNA Synthesizer)). This two-dimensional oligonucleotide synthesis apparatus was uniformly functionalized with N-(3-triethoxysilylpropyl)-4-hydroxybutyramide (Gelest) and used to synthesize an exemplary 50 bp polynucleotide (“50-mer polynucleotide”) using the polynucleotide synthesis method described herein.

[0228] The sequence of the 50-mer is shown in SEQ ID NO.:2.

[0229] 5'AGACAATCAACCATTTGGGGTGGACAGCCTTGACCTCTAGACT TCGGCAT##TTTTTTTTTT3' (SEQ ID NO.:2), where # represents thymidine-succinylhexamide CED phosphoramidite (CLP-2244 from ChemGenes), which is a cleavable linker that allows the release of polynucleotides from the surface during deprotection.

[0230] The synthesis was completed using standard DNA synthesis chemistry methods (coupling, capping, oxidation, and deblocking) according to the scheme in Table 3 and the ABI synthesizer.

[0231] Table 3: Synthesis Scheme

[0232]

[0233]

[0234]

[0235] The phosphorusamide / activator combination is delivered in a manner similar to that of the main reagent via flow cell delivery. No drying step is performed while the environment is kept "wet" by the reagent for the entire duration.

[0236] Remove the current limiter from the ABI 394 synthesizer to allow for faster flow. Without a flow restrictor, the flow rates of amides (0.1 M in ACN), activator (0.25 M benzoylthiotetrazole (“BTT”; 30-3070-xx from Glen Research) in ACN) and Ox (0.02 M in 20% pyridine, 10% water and 70% THF) were approximately ~100 μL / s, the flow rates of acetonitrile (“ACN”) and capping reagent (a 1:1 mixture of cap A and cap B, where cap A is acetic anhydride in THF / pyridine and cap B is 16% 1-methylimidizole in THF) were approximately ~200 μL / s, and the flow rate of unblocking agent (3% dichloroacetic acid in toluene) was approximately ~300 μL / s (in contrast, with a flow restrictor, the flow rates of all reagents were approximately ~50 μL / s). The time required for complete oxidant removal was observed, and the timing of chemical flow times was adjusted accordingly, with additional ACN washes introduced between different chemicals. After polynucleotide synthesis, the chip was deprotected overnight in gaseous ammonia at 75 psi. Five drops of water were applied to the surface to recover the polynucleotides. The recovered polynucleotides were then analyzed on a BioAnalyzer small RNA chip.

[0237] Example 3: Synthesis of 100-mer sequences on an oligonucleotide synthesis apparatus

[0238] Using the same procedure described in Example 2 for synthesizing the 50-mer sequence, 100-mer polynucleotides (“100-mer polynucleotides”; 5'CGGGATCCTTATCGTCATCGTCGTACAGATCCCGACCCATTTGC TGTCCACCAGTCATGCTAGCCATACCATGATGATGATGATGATG AGAACCCCGCAT##TTTTTTTTTT3', where # represents thymidine-succinylhexanoamide CED phosphoramide (CLP-2244 from ChemGenes); SEQ ID NO.:3) were synthesized on two different silicon chips. The first chip was uniformly functionalized with N-(3-triethoxysilylpropyl)-4-hydroxybutyramide, while the second chip was functionalized with a 5 / 95 mixture of 11-acetoxyundecyltriethoxysilane and n-decyltriethoxysilane. The polynucleotides extracted from the surface were analyzed on a BioAnalyzer instrument.

[0239] Using the following thermal cycling program, all ten samples from two chips were further amplified by PCR in a 50 μL PCR mixture (25 μL NEB Q5 master mixture, 2.5 μL 10 μM forward primer, 2.5 μL 10 μM reverse primer, 1 μL surface-extracted polynucleotides, water added to 50 μL) using forward primer (5'ATGCGGGGTTCTCATCATC3'; SEQ ID NO.:4) and reverse primer (5'CGGGATCCTTATCGTCATCG3'; SEQ ID NO.:5).

[0240] 98℃, 30 seconds

[0241] 98℃, 10 seconds; 63℃, 10 seconds; 72℃, 10 seconds; repeat 12 cycles.

[0242] 72℃, 2min

[0243] The PCR products were then run on BioAnalyzer, showing a sharp peak at the 100-mer position. The PCR-amplified samples were then cloned and subjected to Sanger sequencing. Table 4 summarizes the Sanger sequencing results for samples collected from points 1-5 of chip 1 and from points 6-10 of chip 2.

[0244] Table 4: Sequencing Results

[0245] point Error rate Cycle efficiency 1 1 / 763bp 99.87％ 2 1 / 824bp 99.88％ 3 1 / 780bp 99.87％ 4 1 / 429bp 99.77％ 5 1 / 1525bp 99.93％ 6 1 / 1615bp 99.94％ 7 1 / 531bp 99.81％ 8 1 / 1769bp 99.94％ 9 1 / 854bp 99.88％ 10 1 / 1451bp 99.93％

[0246] Therefore, the high quality and uniformity of the synthesized polynucleotides were reproduced on two chips with different surface chemistry. Overall, 89% of the sequenced 60-mers were error-free perfect sequences, corresponding to 233 out of 262.

[0247] Table 5 summarizes the error characteristics of sequences obtained from polynucleotide samples from points 1-10.

[0248] Table 5: Error Characteristics

[0249]

[0250]

[0251] Example 4: Design of Antibody Scaffold

[0252] To generate the scaffolds, structural analysis, heavy chain library sequencing analysis, and specificity analysis of the heterodimer high-throughput sequencing dataset were performed. Each heavy chain was associated with each light chain scaffold. Each heavy chain scaffold was assigned five different long CDRH3 loop options. Each light chain scaffold was assigned five different L3 scaffolds. The heavy chain CDRH3 stem was selected from the frequently observed long H3 loop stem (10 amino acids at the N-terminus and C-terminus) found in both individual and V gene segments. The light chain scaffold L3 was selected from heterodimers containing long H3. Direct heterodimers based on information from the Protein Database (PDB) and deep sequencing datasets were used, with CDR H1, H2, L1, L2, L3, and CDRH3 stems fixed. The various scaffolds were then formatted for display on phages to evaluate expression.

[0253] Structural Analysis

[0254] Approximately 2,017 antibody structures were analyzed, and 22 CDRH3 structures with a length of at least 25 amino acids were observed. Heavy chains included IGHV1-69, IGHV3-30, IGHV4-49, and IGHV3-21. Light chains identified included IGLV3-21, IGKV3-11, IGKV2-28, IGKV1-5, IGLV1-51, IGLV1-44, and IGKV1-13. Four heterodimeric combinations were observed multiple times during the analysis, including: IGHV4-59 / 61-IGLV3-21, IGHV3-21-IGKV2-28, IGHV1-69-IGKV3-11, and IGHV1-69-IGKV1-5. Sequence and structural analyses identified internal disulfide bonds within CDRH3 in some structures, with bulky side chains, such as tyrosine residues, packed into the stem, thus supporting long-term H3 stability. Secondary structures, including β-turn-β-sheets and "hammerhead" subdomains, were also observed.

[0255] Group analysis

[0256] Repertoire analysis was performed on 1,083,875 IgM+ / CD27-naïve B-cell receptor (BCR) sequences and 1,433,011 CD27+ sequences obtained from 12 healthy controls via unbiased 5' RACE. These 12 healthy controls comprised an equal number of males and females, consisting of 4 White, 4 Asian, and 4 Hispanic individuals. Repertoire analysis revealed that less than 1% of the repertoire contained BCRs with CDRH3 sequences longer than 21 amino acids. V gene bias was observed in the long CDR3 sub-repertoire, with IGHV1-69, IGHV4-34, IGHV1-18, and IGHV1-8 showing preferential enrichment in BCRs with long H3 loops. A bias away from the long ring was observed for IGHV3-23, IGHV4-59 / 61, IGHV5-51, IGHV3-48, IGHV3-53 / 66, IGHV3-15, IGHV3-74, IGHV3-73, IGHV3-72, and IGHV2-70. The IGHV4-34 stent was shown to be self-reactive and has a short half-life.

[0257] Feasible N-terminal and C-terminal CDRH3 scaffold variants for long loops were also designed based on the 5'RACE reference library. Approximately 81,065 CDRH3 variants with a length of 22 amino acids or longer were observed. By comparing within the V gene scaffold, scaffold-specific H3 stem variants were avoided, thus allowing scaffold diversity to be cloned into multiple scaffold references.

[0258] Heterodimer analysis

[0259] Heterodimer analysis was performed on the scaffold. Variant sequences and lengths of the scaffold were analyzed.

[0260] Structural Analysis

[0261] Structural analysis was performed using GPCR scaffolds with variant sequences, and their lengths were determined.

[0262] Example 5: Generation of GPCR antibody library

[0263] Based on GPCR-ligand interaction surfaces and scaffold alignment, libraries were designed and synthesized de novo. See Example 4. Ten variant sequences were designed for the heavy chain variable domain, 237 variant sequences for the heavy chain complementarity-determining region 3, and 44 variant sequences for the light chain variable domain. The fragments were synthesized into three fragments using a method similar to that described in Examples 1-3.

[0264] Following de novo synthesis, 10 variant sequences were generated for the heavy chain variable domain, 236 variant sequences for the heavy chain complementarity-determining region 3, and 43 variant sequences were designed for regions including the light chain variable domain and CDRL3, of which 9 variants were designed for the light chain variable domain. This yielded approximately 10 variants. 5 A diverse library (10x236x43). This was confirmed using next-generation sequencing (NGS) with 16 million reads.

[0265] The expression and protein folding of various light and heavy chains were then tested. Ten variant sequences targeting the heavy chain variable domain were identified: IGHV1-18, IGHV1-69, IGHV1-8, IGHV3-21, IGHV3-23, IGHV3-30 / 33rn, IGHV3-28, IGHV3-74, IGHV4-39, and IGHV4-59 / 61. Among these ten variant sequences, IGHV1-18, IGHV1-69, and IGHV3-30 / 33rn exhibited improved properties, such as improved thermal stability. Nine variant sequences targeting the light chain variable domain were identified: IGKV1-39, IGKV1-9, IGKV2-28, IGKV3-11, IGKV3-15, IGKV3-20, IGKV4-1, IGLV1-51, and IGLV2-14. Of these nine variant sequences, IGKV1-39, IGKV3-15, IGLV1-51, and IGLV2-14 exhibited improved properties, such as improved thermal stability.

[0266] Example 6: GPCR library

[0267] This example describes the generation of GPCR libraries.

[0268] Materials and methods

[0269] Stable cell lines and phage library generation

[0270] A full-length human GLP-1R gene (UniProt-P43220) cloned into the pCDNA3.1(+) vector (Thermo Fisher) with an N-terminal FLAG tag and a C-terminal GFP tag was transfected into suspension Chinese hamster ovary (CHO) cells to generate stable cell lines expressing GLP-1R. Target expression was confirmed by FACS. Cells expressing >80% GLP-1R with GFP were then used directly for cell-based selection.

[0271] The GPCR-focused phage display library used a combination of germline heavy chain IGHV1-69, IGHV3-30 and germline light chain IGKV1-39, IGKV3-15, IGLV1-51, and IGLV2-14 frames, and the diversity of all six CDRs was encoded by oligonucleotide pools similar to those synthesized in Examples 1-3 above. CDRs were also screened to ensure they did not contain manufacturability disadvantages, cryptic splicing sites, or commonly used nucleotide restriction sites. Heavy chain variable regions (VH) and light chain variable regions (VL) were linked via (G4S)3 adapters. The resulting scFv (VH-adapter-VL) gene library was cloned into the pADL 22-2c (Antibody Design Labs) phage display vector via NotI restriction digestion and electroporated into TG1 electrocompetent *E. coli* cells (Lucigen). The final library had an NGS-validated size of 1.1 x 10⁻⁶. 10 Variety of sizes.

[0272] Panning and screening strategies for isolating agonist GLP-1R scFv clones

[0273] Before panning CHO cells expressing GLP-1R, phage particles were blocked with 5% BSA / PBS and nonspecific binders were depleted on the CHO parent cells. For CHO parent cell depletion, phage aliquots were introduced at room temperature (RT) with 1 x 10⁻⁶ ppm. 8 The CHO parental cells were rotated together at 14 rpm / min for 1 hour. The cells were then pelleted by centrifugation at 1,200 rpm for 10 minutes in a benchtop Eppendorf 5920RS / 4x1000 rotor to deplete the nonspecific CHO cell binder. The CHO cell binder-depleted phage supernatant was then transferred to 1x10⁻⁶ cells / mL. 8GLP-1R-expressing CHO cells were selected. Phage supernatant and GLP-1R-expressing CHO cells were rotated at 14 rpm / min for 1 hour at RT for screening against GLP-1R binding agents. After incubation, cells were washed several times with 1x PBS / 0.5% Tween to remove non-binding clones. To elute phages bound to GLP-1R cells, cells were incubated with trypsin in PBS buffer at 37°C for 30 minutes. Cell pelleting was achieved by centrifugation at 1,200 rpm for 10 minutes. The output supernatant rich in GLP-1R-binding clones was amplified in TG1 *E. coli* cells and used as input phages for the next round of screening. This screening strategy was repeated five times. Each round depleted the CHO parental background. The amplified output phages from one round were used as input phages for the next round, and in each subsequent round of screening, the stringency of the washing increased with each additional wash. After five rounds of screening, 500 clones from each of rounds 4 and 5 were subjected to Sanger sequencing to identify unique clones.

[0274] Next-generation sequencing analysis

[0275] Phagemid DNA was prepared in small quantities from the output bacterial stock solution from all panning rounds. Variable heavy chains (VH) were amplified from the phagemid DNA by PCR using the forward primer ACAGAATTCATTAAAGAGGAGAAATTAACC and the reverse primer TGAACCGCCTCCACCGCTAG. The PCR products were used directly for library preparation using the KAPA HyperPlus Library Preparation Kit (Kapa Biosystems, product #KK8514). To increase the diversity of the library, samples were supplemented with materials purchased from Illumina, Inc. (product #KK8514).

[0276] A 15% PhiX control (FC-110-3001) was used. The library was then loaded onto an Illumina 600 Cyclic MiSeqReagent Kit v3 (Illumina, product #MS-102-3003) and run on the MiSeq instrument.

[0277] Rearrangement and High-Throughput (HT) IgG Purification

[0278] Expi293 cells were transfected with heavy and light chain DNA at a 2:1 ratio using Expifectamine (Thermo Fisher, A14524), and the supernatant was harvested 4 days post-transfection before cell viability dropped below 80%. Purification was performed using King Fisher (Thermo Fisher) or Phynexus Protein A column tips (Hamilton) with protein A magnetic beads. For large-scale production of IgG clones evaluated in in vivo mouse studies, the Akta HPLC purification system (GE) was used.

[0279] IgG characterization and quality control. Purity characterization was performed on purified IgG (hit) against a positive GLP-1R binder using a LabChip GXII Touch HT protein expression high-sensitivity assay. Dithiothreitol (DTT) was used to reduce IgG to VH and VL. IgG concentrations were measured using Lunatic (UnChain). IgG for in vivo mouse studies was further characterized by HPLC and endotoxin levels were tested at doses less than 5 EU / kg. nexgen-PTS TM Endotoxin test (Charles River).

[0280] Combining assays and flow cytometry

[0281] The following assay, combining flow cytometry analysis, was used to test GLP-1R IgG clones: CHO cells expressing FLAG-GLP-1R-GFP (CHO-GLP-1R) and CHO parental cells were incubated with 100 nM IgG on ice for 1 h, washed three times, and incubated on ice for 30 min with Alexa 647-conjugated goat anti-human antibody (1:200) (Jackson Immuno Research Laboratories, 109-605-044), followed by three washes, with centrifugation between each wash to pellet the cells. All incubations and washes were performed in buffer containing PBS + 1% BSA. For titration, IgG was serially diluted 1:3 from 100 nM to 0.046 nM. Cells were analyzed by flow cytometry, and hits (hit being IgG that specifically binds to CHO-GLP-1R) were identified by measuring the GFP signal against the Alexa 647 signal. Flow cytometry data from the binding assay using 100 nM IgG are presented as a dot plot. The analysis of binding assays using IgG titration was used to plot the binding curve relationship between IgG concentration and MFI (mean fluorescence intensity).

[0282] Ligand competition assay

[0283] The ligand competition assay involved co-incubating primary IgG with 1 μM GLP-1 (7-36). For each data point, IgG (600 nM) was prepared in flow buffer (PBS + 1% BSA) and diluted 1:3 for 8 titration points. Peptide GLP-1 7-36 (2 μM) was similarly prepared in flow buffer (PBS + 1% BSA). Each well contained 100,000 cells, to which 50 μL of IgG and 50 μL of peptide (= plus) or peptide-free buffer alone (= minus) were added. The cells and IgG / peptide mixture were incubated on ice for 1 h, washed, and then a 1:200 dilution of secondary antibody (goat anti-human APC, Jackson Immuno Research Laboratories, product #109-605-044) in PBS + 1% BSA was added. This was incubated on ice for 30 min (50 μL per well), then washed and resuspended in 60 μL buffer. Finally, in… The readings were measured at a rate of 4 seconds per well on the IQue3Screener.

[0284] result

[0285] Design of GPCR-focused antibody libraries based on GPCR binding motifs and GPCR antibodies

[0286] All known GPCR interactions, including those between GPCRs and ligands, peptides, antibodies, endogenous extracellular loops, and small molecules, were analyzed to map GPCR binding molecular determinants. Crystal structures of nearly 150 peptides, ligands, or antibodies binding to the ECDs of approximately 50 GPCRs (http: / / www.gpcrdb.org) were used to identify GPCR binding motifs. Over 1000 GPCR binding motifs were extracted from this analysis. Furthermore, over 2000 binding motifs from endogenous extracellular loops of GPCRs were identified by analyzing all resolved GPCR structures (zhanglab.ccmb.med.umich.edu / GPCR-EXP / ). Finally, a reduced amino acid library of five amino acids (Tyr, Phe, His, Pro, and Gly) was identified by analyzing the structures of over 100 small molecule ligands binding to GPCRs. This library likely encompasses many structural contacts of these ligands. Sublibraries exhibiting this reduced amino acid diversity were placed in CxxxxxC motifs. More than 5,000 GPCR binding motifs were identified in total. Figures 9A-9E These binding motifs were placed in one of five different stem regions: CARDLRELECEEWTxxxxxSRGPCVDPRGVAGSFDVW, CARDMYYDFxxxxxEVVPADDAFDIW,

[0287] CARDGRGSLPRPKGGPxxxxxYDSSEDSGGAFDIW, CARANQHFxxxxxGYHYYGMDVW,

[0288] CAKHMSMQxxxxxRADLVGDAFDVW.

[0289] These stem regions were selected from structural antibodies with ultra-long HCDR3. Antibody lines were specifically selected to tolerate these ultra-long HCDR3. Structural and sequence analysis of human antibodies longer than 21 amino acids revealed V gene bias in antibodies with long CDR3. Finally, based on this analysis, lines were selected for IGHV (IGHV1-69 and IGHV3-30), IGKV (IGKV1-39 and IGKV3-15), and IGLV (IGLV1-51 and IGLV2-14) genes.

[0290] Besides HCDR3 diversity, limited diversity was introduced in the other five CDRs. The IGHV1-69 domain contains 416 HCDR1 variants and 258 HCDR2 variants; the IGHV3-30 domain contains 535 HCDR1 variants and 416 HCDR2 variants; the IGKV1-39 domain contains 490 LCDR1 variants, 420 LCDR2 variants, and 824 LCDR3 variants; the IGKV3-15 domain contains 490 LCDR1 variants, 265 LCDR2 variants, and 907 LCDR3 variants; the IGLV1-51 domain contains 184 LCDR1 variants, 151 LCDR2 variants, and 824 LCDR3 variants; and the IGLV2-14 domain contains 967 LCDR1 variants, 535 LCDR2 variants, and 922 LCDR3 variants. Figure 10 These CDR variants were screened by comparing germline CDRs with near-germline spaces of single, double, and triple mutations observed in CDRs from at least two V genome libraries from 12 human donors. All CDRs were pre-screened to eliminate manufacturability disadvantages, cryptic splicing sites, or nucleotide restriction sites. CDRs were synthesized into oligonucleotide pools and integrated into selected antibody scaffolds. Heavy chain (VH) and light chain (VL) genes were linked via (G4S)3 adapters. The resulting scFv (VH-adapter-VL) gene pools were cloned into the N-terminus of the M13 gene 3 minor coat protein of the phage display vector. The final size of the GPCR library in scFv format was 1x10⁻¹. 10Next-generation sequencing (NGS) was performed on the final phage library to analyze the HCDR3 length distribution in the library for comparison with the HCDR3 length distribution in B cell populations from three healthy adult donors. The HCDR3 sequences from the three healthy donors used were derived from a publicly available database containing over 37 million B cell receptor sequences. 31 The HCDR3 length in GPCR libraries is significantly longer than that observed in B-cell repertoire sequences. On average, the median HCDR3 length in GPCR libraries (showing a biphasic distribution pattern) is two to three times (33 to 44 amino acids) longer than the median length (15 to 17 amino acids) observed in native B-cell repertoire sequences. Figure 11 The biphasic length distribution of HCDR3 in the GPCR library was mainly caused by two sets of stems (8aa, 9aaxxxxx10aa, 12aa) and (14aa, 16aaxxxxx18aa, 14aa) used to present the HCDR3 inner motif.

[0291] Example 7: VHH Library

[0292] Synthetic VHH libraries were developed. For “VHH ratio” libraries with customized CDR diversity, 2391 VHH sequences (iCAN database) were aligned using ClustalOmega to identify the common sequence at each position, and the frames were derived from the common sequence at each position. Position-specific variation analysis was performed on the CDRs of all 2391 sequences, and this diversity was incorporated into the library design. For “VHH shuffling” libraries with shuffling CDR diversity, unique CDRs were searched for in nanobody sequences in the iCAN database. 1239 unique CDR1, 1600 unique CDR2, and 1608 unique CDR3 were identified, and the frames were derived from the common sequence at each frame position in the 2391 sequences in the iCAN database. Each unique CDR was synthesized and shuffled individually within a common frame to generate a library with a theoretical diversity of 3.2 x 10^9. The library was then cloned into a phage vector using restriction enzyme digestion. For the “VHH h shuffled” library (a synthesized “human” VHH library with shuffled CDR diversity), unique CDRs were searched for in nanobody sequences in the iCAN database. 1239 unique CDR1, 1600 unique CDR2, and 1608 unique CDR3 were identified, with frames 1, 3, and 4 derived from the human germline DP-47 frame. Frame 2 was derived from the common sequence at each frame position in 2391 sequences from the iCAN database. Each unique CDR was individually synthesized and shuffled within a partially humanized frame using the NUGE tool to generate a library with a theoretical diversity of 3.2 x 10^9. This library was then cloned into a phage vector using the NUGE tool.

[0293] The Carterra SPR system was used to evaluate the binding affinity and affinity profile of the VHH-Fc variants. VHH-Fc exhibited a range of affinities for TIGIT, with the low end being 12 nM K. D The high-end version is 1685nm K. D (Data not displayed) Figure 12 ELISA, protein A (mg / ml), and K were provided for the VHH-Fc clone. D The specific value of (nM).

[0294] Example 8. Hyperimmune immunoglobulin library of A2A receptor

[0295] A hyperimmune immunoglobulin (IgG) library was created using a method similar to that described in Example 7. In short, the hyperimmune IgG library was generated through analysis of a database of human initial and memory B cell receptor sequences, consisting of over 37 million unique IgH sequences from each of three healthy donors. Over 2 million CDRH3 sequences were collected from the analysis and constructed individually using a method similar to that described in Examples 1-3. The CDRH3 sequences were integrated into the VHH h shuffle library described in Example 9. The final library diversity was determined to be 1.3 x 10⁻⁶. 10 A schematic diagram of the design can be seen in... Figure 13 middle.

[0296] Of the 88 unique clones, 73 had target cell MFI values ​​that were twice that of parental cells. Of the 88 unique clones, 15 had target cell MFI values ​​that were 20 times that of parental cells. Data for the adenosine A2A receptor variant A2AR-90-007 can be found in […]. Figures 14A-14B middle.

[0297] This embodiment demonstrates K with high affinity and a sub-nanomolar range. D Generation of VHH libraries for A2AR values.

[0298] Example 9. GPCR libraries with different CDRs

[0299] GPCR libraries were created using the CDR randomization protocol.

[0300] In short, GPCR libraries were designed based on GPCR antibody sequences. More than 60 different GPCR antibodies were analyzed, and sequences from these GPCRs were modified using a CDR randomization protocol.

[0301] Heavy chain IGHV3-23 design (see) Figure 15A .like Figure 15A As shown, IGHV3-23 CDRH3 has four different lengths: 23 amino acids, 21 amino acids, 17 amino acids, and 12 amino acids, each with its own residue diversity. The proportions of the four lengths are as follows: 40% for the 23-amino acid CDRH3 length, 30% for the 21-amino acid CDRH3 length, 20% for the 17-amino acid CDRH3 length, and 10% for the 12-amino acid CDRH3 length. The CDRH3 diversity was determined to be 9.3 × 10⁻⁶. 8 The diversity of the full heavy chain IGHV3-23 was 1.9 x 10⁻⁶. 13 .

[0302] Heavy chain IGHV1-69 design (see) Figure 15B .like Figure 15BAs shown, IGHV1-69 CDRH3 has four different lengths: 20 amino acids, 16 amino acids, 15 amino acids, and 12 amino acids, each with its own residue diversity. The proportions of the four lengths are as follows: 40% for the 20-amino acid CDRH3 length, 30% for the 16-amino acid CDRH3 length, 20% for the 15-amino acid CDRH3 length, and 10% for the 12-amino acid CDRH3 length. The CDRH3 diversity was determined to be 9 × 10⁻⁶. 7 The diversity of the full heavy chain IGHV-69 was 4.1 x 10⁻⁶. 12 .

[0303] The designs for the light chain IGKV 2-28 and IGLV 1-51 are shown below. Figure 15C The position-specific variations of the antibody light chain CDR sequence were analyzed. Two light chain frameworks with fixed CDR lengths were selected. The theoretical diversity of the κ chain and light chain was determined to be 13800 and 5180, respectively.

[0304] The final theoretical diversity was determined to be 4.7 x 10^6. 17 The resulting Fab library has a diversity of 6x10. 9 See also Figure 15D .

[0305] Example 10. Adenosine A2A receptor library with different CDRs

[0306] An adenosine A2A receptor library was created using a CDR randomization scheme similar to that described in Example 9.

[0307] In summary, the adenosine A2A receptor library was designed based on GPCR antibody sequences. More than 60 different GPCR antibodies were analyzed, and sequences from these GPCRs were modified using a CDR randomization protocol. Adenosine A2A receptor variant IgG designed using the CDR randomization protocol was purified and analyzed to determine cell-based affinity measurements and for functional analysis.

[0308] Example 11. A2A variant immunoglobulin

[0309] The A2AR variant immunoglobulin produced was measured in various functional assays.

[0310] First, A2AR immunoglobulin scFv phage libraries were panned on cells and fixed A2a protein and then screened. The number of phages output in each round of screening is shown in Table 7-8.

[0311] Table 7.

[0312]

[0313]

[0314] Table 8.

[0315]

[0316] Example 12. Screening for antibody binding

[0317] The binding of A2AR immunoglobulins screened from the groups listed in Tables 15-18 to the targets listed in the table was determined.

[0318] HEK293-A2a cells

[0319] Flow cytometry data showing binding of immunoglobulins from a variant library to HEK293-A2a cells using 100 nM IgG were generated and compared with binding detected in parental cells. Binding using variants from the immune library was shown... Figure 16A-16N In the middle. The comparison is shown. Figure 16O The image shows the binding of cells to a single human adenosine A2aR clone (MAB9497). Binding was assessed in screening variants at concentrations titrated from 100 nM. The resulting curves are shown in the image. Figures 17A-17H In the middle. Binding curves were plotted using IgG concentrations compared to MFI (mean fluorescence intensity). Binding of variants from mouse immune libraries was shown. Figure 18A-18N In the middle. The comparison is shown. Figure 18O The binding of cells to a single human adenosine A2aR clone (MAB9497) is shown in the figure. The binding of the screened variants was evaluated at concentrations titrated from 100 nM. The resulting curves are shown in the figure. Figure 19A-19G The binding curve was plotted using IgG concentration as a ratio to MFI (mean fluorescence intensity).

[0320] protein binding

[0321] Binding was determined by titration starting at 100 nM with purified A2a immunoglobulins from Tables 15-18. Results of the screened variants were shown... Figure 20A-20G middle.

[0322] Example 13. Agonist response in cAMP assay

[0323] According to the manufacturer's instructions, use the 384-hole format. cAMP assays were performed using 2500 cells / well for agonist dose-response assays. Cells were stimulated for 30 minutes at room temperature with NECA and CGS 21680. Readings were taken on an EnVision microplate reader in laser mode. Data are shown below. Figure 21 In the middle, the Z' factor (Z' = 0.80) was calculated for NECA with at least 16 backgrounds and 16 maximum signal points. For the EC calculated by NECA...50 (M) = 2.7 x 10 -7 For the EC calculated by CGS21680 50 (M) = 4.3 x 10 -7 .

[0324] Example 14. Antagonist response in cAMP assay

[0325] According to the manufacturer's instructions, use the 384-hole format. The cAMP assay used 2500 cells / well and 1 μM NECA (reference agonist) for antagonist dose-response determination. Cells were stimulated with ZM241385 for 30 min at room temperature. Readings were taken on an EnVision microplate reader in laser mode. Data are shown below. Figure 22 In the middle. For the IC calculated by ZM241385 50 (M) = 1.25 x 10 -5 .

[0326] Example 15. Titration of A2A cAMP antagonist

[0327] Cells were seeded at 3000 cells / well and pre-incubated for 1 hour at room temperature with fixed 100 nM IgG, followed by stimulation with NECA titration for 30 minutes at room temperature according to the manufacturer's instructions. The buffer was PBS + 0.1% BSA + 0.5 mM IBMX. Results were shown... Figure 23 The absolute IC50 values ​​are shown in Table 9, indicating that A2A-1 is a negative allosteric modifier.

[0328] Table 9.

[0329] +No antibodies A2A–1 R&D control antibody IC50 0.03040 0.2816 2.253

[0330] Example 16. Allosteric cAMP assay

[0331] Allosteric regulation of A2A-1 and A2A-9 was determined. Cells were pre-incubated with titrated IgG at room temperature for 1 hour, followed by stimulation with a fixed concentration of NECA. Results are shown in... Figure 24 The IC50 values ​​are shown in Table 10, indicating that A2A-1 is a negative allosteric modifier.

[0332] Table 10.

[0333] A2A–1 A2A–9 R&D control antibody Absolute IC50 1.833 4.106 9.432

[0334] Example 17. cAMP allosteric A2A Perkin Elmer

[0335] As described in Example 15, A2A-9 was measured. The resulting response curve is shown in... Figure 25 The calculated IC50 values ​​for A2A–9 are shown in Table 11.

[0336] Table 11.

[0337] A2A–9 R&D control antibody No antibodies Absolute IC50 ～0.4513 ～0.5126 ～0.2556

[0338] Example 18. Titration of A2A cAMP antagonist

[0339] As described in Example 16, A2A-9 was measured. The resulting response curve is shown in... Figure 26 The calculated IC50 values ​​are shown in Table 12. The results indicate that A2A-9 is an antagonist.

[0340] Table 12.

[0341] A2A–9 R&D control antibody 20 Absolute IC50 4.106 9.432

[0342] Example 19. A2A antagonistic cAMP assay

[0343] The binding of the screened variants to the target was determined. Immunoglobulins were titrated in triplicate and incubated on cells for 1 hour, followed by incubation with 0.5 μM NECA for 30 minutes. Figures 27A-27C The binding curves are shown, displaying the relative fluorescence units (RFU) ratio at 665 nm / 615 nm compared to nM IgG on a logarithmic scale. The final binding studies identified functional antibodies in the generated libraries as listed in Tables 13 and 14.

[0344] Table 13.

[0345]

[0346] Table 14.

[0347]

[0348] Example 20. A2AR Cell Functional cAMP Detection

[0349] Allosteric and antagonistic cAMP assays using the A2A cell line

[0350] In short, cells were pre-incubated with 100 nM anti-A2AR antibody, followed by NECA stimulation and 3X titration starting at 100 μM. Data from the functional allosteric cAMP assay are available in [link to relevant documentation]. Figures 28A-28C In this formulation, ZM241385 acts as an antagonist. "Ab-free" only acts as an agonist.

[0351] For the functional antagonistic cAMP assay, cells were pre-incubated with 3X titration of anti-A2AR antibody starting at 100 nM, followed by NECA stimulation with 0.5 μM. Data are available in [link to data]. Figures 29A-29C Cells were also pre-incubated with anti-A2AR antibody 3X titrated from 100 nM, followed by NECA stimulation at 10 μM. Data are available in […]. Figures 30A-30C middle.

[0352] Based on the data, A2AR variants A2A-17, A2A-19, A2A-24, A2A-26, and A2A-27 showed improved function in cAMP assays for NECA titration, IgG titration (NECA 0.5 uM), and IgG titration (NECA 10 uM).

[0353] Example 21. Exemplary Sequence

[0354] Table 15. Variable Heavy Chain CDR

[0355]

[0356]

[0357]

[0358]

[0359]

[0360] Table 16. Variable Light Chain CDR

[0361]

[0362]

[0363]

[0364]

[0365]

[0366] Table 17. Variable Heavy Chain Sequences

[0367]

[0368]

[0369]

[0370]

[0371]

[0372]

[0373]

[0374]

[0375]

[0376] Table 18. Variable Light Chains

[0377]

[0378]

[0379]

[0380]

[0381]

[0382]

[0383]

[0384]

[0385]

[0386] While preferred embodiments of this disclosure have been shown and described herein, it will be apparent to those skilled in the art that these embodiments are provided by way of example only. Many variations, modifications, and substitutions will occur to those skilled in the art without departing from the scope of this disclosure. It should be understood that various alternatives to the embodiments of this disclosure described herein may be employed in carrying out this disclosure. The scope of this disclosure is intended to be defined by the appended claims, and thereby to cover the methods and structures within the scope of those claims and their equivalents.

Claims

1. An antibody or antibody fragment thereof that binds to an adenosine A2A receptor, said antibody or antibody fragment comprising an immunoglobulin heavy chain and an immunoglobulin light chain, said immunoglobulin heavy chain comprising a heavy chain variable region (VH), and said immunoglobulin light chain comprising a light chain variable region (VL), wherein: a. The VH comprises CDRH1, CDRH2, and CDRH3, wherein the amino acid sequence of CDRH1 is SEQ ID NO: 82, the amino acid sequence of CDRH2 is SEQ ID NO: 171, and the amino acid sequence of CDRH3 is SEQ ID NO: 260, and wherein the VL comprises CDRL1, CDRL2, and CDRL3, wherein the amino acid sequence of CDRL1 is SEQ ID NO: 349, the amino acid sequence of CDRL2 is SEQ ID NO: 438, and the amino acid sequence of CDRL3 is SEQ ID NO: 527; b. The VH comprises CDRH1, CDRH2, and CDRH3, wherein the amino acid sequence of CDRH1 is SEQ ID NO: 56, the amino acid sequence of CDRH2 is SEQ ID NO: 145, and the amino acid sequence of CDRH3 is SEQ ID NO: 234, and wherein the VL comprises CDRL1, CDRL2, and CDRL3, wherein the amino acid sequence of CDRL1 is SEQ ID NO: 323, the amino acid sequence of CDRL2 is SEQ ID NO: 412, and the amino acid sequence of CDRL3 is SEQ ID NO: 501; or c. The VH comprises CDRH1, CDRH2, and CDRH3, wherein the amino acid sequence of CDRH1 is SEQ ID NO: 86, the amino acid sequence of CDRH2 is SEQ ID NO: 175, and the amino acid sequence of CDRH3 is SEQ ID NO: 264, and wherein the VL comprises CDRL1, CDRL2, and CDRL3, wherein the amino acid sequence of CDRL1 is SEQ ID NO: 353, the amino acid sequence of CDRL2 is SEQ ID NO: 442, and the amino acid sequence of CDRL3 is SEQ ID NO:

531.

2. The antibody or antibody fragment thereof as described in claim 1, wherein: a. The VH contains the amino acid sequence of SEQ ID NO: 616, and the VL contains the amino acid sequence of SEQ ID NO: 705; b. The VH contains the amino acid sequence of SEQ ID NO: 590, and the VL contains the amino acid sequence of SEQ ID NO: 679; or c. The VH contains the amino acid sequence of SEQ ID NO: 620, and the VL contains the amino acid sequence of SEQ ID NO:

709.

3. The antibody or antibody fragment thereof as described in claim 1 or 2, wherein the antibody is a monoclonal antibody, a bispecific antibody, a multispecific antibody, a transplanted antibody, a humanized antibody, a synthetic antibody, a chimeric antibody, a single-chain antibody, a Fab fragment, an F(ab')2 fragment, an Fv fragment, a disulfide-linked Fv (sdFv), an intracellular antibody, or an ab antigen-binding fragment thereof.

4. The antibody or antibody fragment thereof as claimed in claim 1 or 2, wherein the antibody or antibody fragment thereof is chimeric or humanized.

5. The antibody or antibody fragment thereof as claimed in claim 1 or 2, wherein, in a cAMP assay, the antibody has an EC50 of less than 25 nM.

6. The antibody or antibody fragment thereof as claimed in claim 1 or 2, wherein, in a cAMP assay, the antibody has an EC50 of less than 20 nM.

7. The antibody or antibody fragment thereof as claimed in claim 1 or 2, wherein, in a cAMP assay, the antibody has an EC50 of less than 10 nM.

8. A pharmaceutical composition comprising the antibody or an antibody fragment thereof as described in claim 1 or claim 2.

9. An isolated nucleic acid, said isolated nucleic acid encoding an antibody or an antibody fragment thereof as described in claim 1 or claim 2.

10. A vector comprising the isolated nucleic acid as described in claim 9.

11. A cell comprising the isolated nucleic acid as described in claim 9 or the vector as described in claim 10.

12. A cell expressing the antibody of claim 1 or claim 2 or an antibody fragment thereof.

13. Use of the antibody or antibody fragment thereof as claimed in claim 1 or claim 2 in the preparation of a medicament for treating cancer in subjects with a corresponding need.

Images