A recombinant genetic engineering bacterium producing (-)-α-bisabolol and its preparation method and use

Abstract

The present invention relates to a recombinant genetic engineering bacterium for producing (‑)‑α‑bisabolol, which comprises a recombinant Escherichia coli comprising a (‑)‑α‑bisabolol synthase MrBBS gene, a farnesyl diphosphate synthase ispA gene, and an MVA pathway gene; the (‑)‑α‑bisabolol synthase MrBBS gene and the farnesyl diphosphate synthase ispA gene are connected by a nucleotide sequence shown in SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10 or SEQ ID NO.11. The present invention recombines a specific gene into Escherichia coli, connects the MrBBS gene and the ispA gene by a short peptide coding sequence in the recombinant Escherichia coli, and overexpresses related genes, so that the yield is as high as 6.8 g / L in the shaking bottle stage of the production process, and is suitable for practical promotion and application.

Description

Technical Field

[0001] The invention belongs to the technical field of gene recombination fermentation, and specifically relates to a recombinant genetic engineering bacterium producing (-)-α-bisabolol, and a preparation method and application thereof. Background Art

[0002] Bisabolol is an organic compound with the molecular formula C 15 H 26 O is a non-toxic sesquiterpene alcohol found in natural essential oils; it exists in nature in two structural forms: β and α. β-Bisabolol is harvested from corn and cotton and is mainly used as a flavoring agent. (-)-α-Bisabolol is mainly found in chamomile essential oil, with a content of 17%. Its right-handed isomorph is found in poplar essential oil and some spathiphyllum and salvia essential oils. It has anti-inflammatory, sterilizing, ulcer healing, gallstone dissolving and other medicinal effects, so it is widely used in the pharmaceutical industry.

[0003] (-)-α-bisabolol can protect and heal the skin, protect it from the effects of daily tension, and accelerate the healing process of the skin. It is especially suitable for sensitive skin and body. It is widely used in the formulation of personal skin care (skin and body care lotions, aftershaves and aftersun care products). Its anti-inflammatory, natural and safe properties make it a common active ingredient for skin care. The annual demand for personal care products alone in the world has reached more than 400 tons, and it has gradually become a new favorite raw material for personal skin care products. In addition, (-)-α-bisabolol has a light and pleasant aroma and is also a stable fixative. Its application in fragrances and flavors is also increasingly valued. However, as a secondary metabolite, the amount of (-)-α-bisabolol extracted from plants is not enough to meet the market demand. Because it is subject to various factors such as biological growth cycle and environment, expanding the scale of production will lead to the destruction of the ecological environment and even species extinction. If chemical synthesis is used, the complex chiral chemical structure of α-bisabolol makes direct chemical synthesis difficult, and has disadvantages such as low biological activity and low purity. Therefore, the most promising approach is to use synthetic biology to construct engineered bacteria to produce (-)-α-bisabolol with high added value using cheap carbon sources and culture media.

[0004] According to the current literature reports, the production of (-)-α-bisabolol by genetically engineered bacteria has achieved certain results in fermentation tanks, but the yield in shake flasks is not ideal. In 2016, Gui Hwan Han et al. used Escherichia coli as host cells, overexpressed the (-)-α-bisabolol synthase MrBBS from German chamomile, ispA from Escherichia coli, and the exogenous MVA pathway through plasmids, thereby obtaining the final (-)-α-bisabolol-producing genetically engineered bacteria. The yield after 48 hours of fermentation was only 0.08 g / L. CN110016458A discloses a method for producing (-)-α-bisabolol by genetically engineered bacteria. Although the shake flask yield reaches 4.15 g / L, there is still room for further improvement, so that the yield after scale-up production in the fermentation tank can be increased by multiples. Summary of the invention

[0005] In order to solve the above problems, the present invention provides a recombinant genetically engineered bacterium for producing (-)-α-bisabolol, which is a recombinant Escherichia coli comprising a (-)-α-bisabolol synthase MrBBS gene, a farnesyl diphosphate synthase ispA gene, and an MVA pathway gene; the (-)-α-bisabolol synthase MrBBS gene and the farnesyl diphosphate synthase ispA gene are connected via a nucleotide sequence shown in SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10 or SEQ ID NO.11.

[0006] Furthermore, the stop codon TAA in the (-)-α-bisabolol synthase MrBBS gene is replaced by the nucleotide sequence shown in SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10 or SEQ ID NO.11, and is connected to the farnesyl diphosphate synthase ispA gene without the start codon ATG.

[0007] Furthermore, the 5' end of the (-)-α-bisabolol synthase MrBBS gene carries the nucleotide sequence SEQ ID NO.1.

[0008] Furthermore, the (-)-α-bisabolol synthase MrBBS gene is from chamomile; and the farnesyl diphosphate synthase ispA gene is from Escherichia coli.

[0009] Furthermore, the nucleotide sequence of the (-)-α-bisabolol synthase MrBBS gene is shown in SEQ ID NO.12; the nucleotide sequence of the farnesyl diphosphate synthase ispA gene is shown in SEQ ID NO.13.

[0010] Furthermore, the nucleotide sequence after the (-)-α-bisabolol synthase MrBBS gene is connected to the farnesyl diphosphate synthase ispA gene is shown as SEQ ID NO.52, SEQ ID NO.53, SEQ ID NO.54, SEQ ID NO.55 or SEQ ID NO.56.

[0011] Further, the MVA pathway genes include mevalonate kinase mvaKmm gene, mevalonate 5-pyrophosphate decarboxylase mvaD gene, phosphomevalonate kinase mvaK2 gene, isopentenyl diphosphate δ-isomerase idi gene, 3-hydroxy-3-methylglutaryl CoA synthase mvaS gene, acetoacetyl CoA thiolase / 3-hydroxy-3-methylglutaryl CoA reductase mvaE gene and / or mevalonate kinase mvaK1 gene.

[0012] Furthermore, the mevalonate kinase mvaKmm gene is from Methanosarcinamazei;

[0013] The mevalonate 5-pyrophosphate decarboxylase mvaD gene, the phosphomevalonate kinase mvaK2 gene and the mevalonate kinase mvaK1 gene are from Streptococcus pneumoniae;

[0014] The isopentenyl diphosphate delta isomerase idi gene is from Escherichia coli;

[0015] The 3-hydroxy-3-methylglutaryl-CoA synthase mvaS gene and the acetoacetyl-CoA thiolase / 3-hydroxy-3-methylglutaryl-CoA reductase mvaE gene are from Enterococcus faecalis.

[0016] Furthermore, the nucleotide sequence of the mevalonate kinase mvaKmm gene is shown in SEQ ID NO.14, the nucleotide sequence of the mevalonate 5-pyrophosphate decarboxylase mvaD gene is shown in SEQ ID NO.15, the nucleotide sequence of the phosphomevalonate kinase mvaK2 gene is shown in SEQ ID NO.16, the nucleotide sequence of the isopentenyl diphosphate delta isomerase idi gene is shown in SEQ ID NO.17, the nucleotide sequence of the 3-hydroxy-3-methylglutaryl CoA synthase mvaS gene is shown in SEQ ID NO.18, the nucleotide sequence of the acetoacetyl CoA thiolase / 3-hydroxy-3-methylglutaryl CoA reductase mvaE gene is shown in SEQ ID NO.19, and the nucleotide sequence of the mevalonate kinase mvaK1 gene is shown in SEQ ID NO.20.

[0017] Furthermore, the 5' end of the isopentenyl diphosphate δ-isomerase idi gene has a nucleotide sequence of SEQ ID NO.3, the 5' end of the acetoacetyl CoA thiolase / 3-hydroxy-3-methylglutaryl CoA reductase mvaE gene has a nucleotide sequence of SEQ ID NO.4, the 5' end of the 3-hydroxy-3-methylglutaryl CoA synthase mvaS gene has a nucleotide sequence of SEQ ID NO.5, and the 5' end of the mevalonate kinase mvaKmm gene has a nucleotide sequence of SEQ ID NO.6.

[0018] Furthermore, the MVA pathway gene is connected to the (-)-α-bisabolol synthase MrBBS gene and the farnesyl diphosphate synthase ispA gene on two plasmids, wherein the nucleotide sequence connected to one plasmid includes SEQ ID NO.52, SEQ ID NO.53, SEQ ID NO.54, SEQ ID NO.55 or SEQ ID NO.56, and SEQ ID NO.50, and the nucleotide sequence connected to the other plasmid includes SEQ ID NO.51.

[0019] Furthermore, the plasmid is preferably plasmid pSTV28 and plasmid pTrc99A.

[0020] Furthermore, the recombinant Escherichia coli is recombinant Escherichia coli E. coli DH5α or E. coli W3110.

[0021] The present invention also provides a method for preparing the aforementioned recombinant genetically engineered bacteria, which comprises the following steps:

[0022] 1) The (-)-α-bisabolol synthase MrBBS gene and the farnesyl diphosphate synthase ispA gene were fused, the fusion product was connected with a linearized expression vector, and then introduced into Escherichia coli to extract the recombinant expression vector;

[0023] The stop codon TAA in the (-)-α-bisabolol synthase MrBBS gene is replaced by a nucleotide sequence as shown in SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10 or SEQ ID NO.11;

[0024] The start codon ATG in the farnesyl diphosphate synthase ispA gene is replaced by a nucleotide sequence as shown in SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10 or SEQ ID NO.11;

[0025] 2) taking the MVA pathway gene for fusion, connecting the fusion product with the recombinant expression vector obtained in step 1) after enzyme digestion, and then introducing it into Escherichia coli to extract the recombinant expression vector;

[0026] 3) taking the mevalonate kinase mvaK1 gene, fusing it with a gene fragment comprising the mevalonate 5-pyrophosphate decarboxylase mvaD gene, the phosphomevalonate kinase mvaK2 gene and the isopentenyl diphosphate δ-isomerase idi gene, connecting the fusion product with a linearized expression vector, and then introducing it into Escherichia coli to extract the recombinant expression vector;

[0027] 4) The recombinant expression vector obtained in step 2) and the recombinant expression vector obtained in step 3) are introduced into Escherichia coli to obtain recombinant genetically engineered bacteria.

[0028] Furthermore, the expression vector in step 1) is plasmid pSTV28.

[0029] Furthermore, in step 2), the MVA pathway gene fusion is to fuse a gene fragment comprising the mevalonate kinase mvaKmm gene, the mevalonate 5-pyrophosphate decarboxylase mvaD gene, the phosphomevalonate kinase mvaK2 gene and the isopentenyl diphosphate δ-isomerase idi gene with a gene fragment comprising the 3-hydroxy-3-methylglutaryl CoA synthase mvaS gene and the acetoacetyl CoA thiolase / 3-hydroxy-3-methylglutaryl CoA reductase mvaE gene.

[0030] Furthermore, the expression vector in step 3) is plasmid pTrc99A.

[0031] The present invention also provides a use of the aforementioned recombinant genetic engineering bacteria in the preparation of (-)-α-bisabolol and its preparation.

[0032] Finally, the present invention provides a method for producing (-)-α-bisabolol, which comprises the following steps:

[0033] The aforementioned recombinant genetically engineered bacteria are inoculated into a seed culture medium, cultured for 8 to 10 hours, the seed solution is inoculated into a fermentation culture medium, n-dodecane is added, fermented and cultured for 30 to 60 hours, and separated and purified to obtain the product;

[0034] The formula of the seed culture medium is: 5-15 g / L tryptone, 2-8 g / L yeast powder, 5-15 g / L sodium chloride, 50-150 mg / L ampicillin final concentration and 30-40 mg / L chloramphenicol final concentration;

[0035] The formula of the fermentation medium is: 5-15 g / L of glucose or glycerol, 2-3 g / L of potassium dihydrogen phosphate, 2.5-3.0 g / L of dipotassium hydrogen phosphate, 20-28 g / L of yeast powder, 10-20 g / L of yeast peptone, 0.1-0.2 mM of IPTG, a final concentration of 50-150 mg / L of ampicillin, and a final concentration of 30-38 mg / L of chloramphenicol.

[0036] Furthermore, the volume ratio of the seed solution, the fermentation medium and n-dodecane is 2:25:5; the culture is a shaking culture, the temperature is 30°C, and the rotation speed is 200 rpm; after the fermentation culture reaches 3h, the culture container with a capacity of 4 to 8×10 -4 0.25MIPTG.

[0037] Further, the formula of the seed culture medium is: tryptone 10g / L, yeast powder 5g / L, sodium chloride 10g / L, ampicillin final concentration 100mg / L and chloramphenicol final concentration 34mg / L;

[0038] The formula of the fermentation medium is 10 g / L glucose or glycerol, 2.2 g / L potassium dihydrogen phosphate, 2.9 g / L dipotassium hydrogen phosphate, 24 g / L yeast powder, 12 g / L yeast peptone, 0.1 mM IPTG, a final concentration of ampicillin of 100 mg / L and a final concentration of chloramphenicol of 34 mg / L.

[0039] The invention discloses a genetically engineered bacterium for producing (-)-α-bisabolol. The bacterium is prepared by recombining specific genes such as mvaKmm and other MVA pathway genes into Escherichia coli, and connecting MrBBS gene and ispA gene in the recombinant Escherichia coli through a short peptide coding sequence, and overexpressing genes such as mvaK2, mvaD, idi, etc., so that the yield in the shaking bottle stage of the production process is as high as 6.8 g / L. The yield after amplification in a fermenter further breaks a new high compared with the yield currently publicly reported, and is suitable for practical promotion and application.

[0040] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0041] The above contents of the present invention are further described in detail below through specific implementation modes in the form of examples, but it should not be understood that the scope of the above subject matter of the present invention is limited to the following examples. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 pSTV28-2 Plasmid Map

[0043] Figure 2pTrc99A-1 plasmid map

[0044] Figure 3 pSTV28-24 Plasmid Map

[0045] Figure 4 Metabolism of (-)-α-bisabolol in E. coli

[0046] Figure 5 GC-MS analysis of (-)-α-bisabolol synthesized by the engineered Escherichia coli strain (A, GC-MS graph, B, yield bar graph)

[0047] Figure 6 The accumulation of (-)-α-bisabolol in recombinant E. coli after 50 h of culture in shake flasks

[0048] Figure 7 Effects of different short peptides on the synthesis of (-)-α-bisabolol DETAILED DESCRIPTION

[0049] Nucleotide sequence information involved in the present invention

[0050] (1) RBS sequence:

[0051] RBS at the 5' end of MrBBS gene (SEQ ID NO.1): GGTTAAACC

[0052] RBS at the 5' end of ispA gene (SEQ ID NO.2): aaggaggttacggaaa

[0053] RBS at the 5' end of the idi gene (SEQ ID NO.3): aggagagaaatt

[0054] RBS at the 5' end of the mvaE gene (SEQ ID NO. 4): AGGAGCATTTAG

[0055] RBS at the 5' end of the mvaS gene (SEQ ID NO. 5): AGGAGAAACCTT

[0056] (ii) Promoter sequence

[0057] pLac (SEQ ID NO.6) at the 5' end of the mvaKmm gene:

[0058] TAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGAATTCGAGCTCGGTACCCGGGGATCC

[0059] (III) Connecting short peptide sequences

[0060] The nucleotide sequence of the connecting peptide for expressing the fusion enzyme of (-)-α-bisabolol synthase and farnesyl diphosphate synthase respectively: SEQ ID NO.7:CCAACGACGACGACGCCA

[0061] SEQ ID NO.8:GGAGGAGGAGGATCATCATCA

[0062] SEQ ID NO.9:GGAGGAGGAATC

[0063] SEQ ID NO.10:GGAAGCGGAGGA

[0064] SEQ ID NO.11:GGAGGAATCGGA

[0065] (IV) Functional gene sequence

[0066] The nucleotide sequence of (-)-α-bisabolol synthase MrBBS gene (SEQ ID NO.12):

[0067]

[0068] Nucleotide sequence of the farnesyl diphosphate synthase ispA gene (SEQ ID NO.13):

[0069] atggactttccgcagcaactcgaagcctgcgttaagcaggccaaccaggcgctgagccgttttatcgccccactgccctttcagaacactcccgtggtcgaaaccatgcagtatggcgcattattaggtggtaagcgcctgcgacctttcctggtttatgccaccggtcatatgttcggcgttagcacaaacacgctggacgcacccgctgccgccgttgagtgtatccacgcttactcattaattcatgatgatttaccggcaatggatgatgacgatctgcgtcgcggtttgccaacctgccatgtgaagtttggcgaagcaaacgcgattctcgctggcgacgctttacaaacgctggcgttctcgattttaagcgatgccgatatgccggaagtgtcggaccgcgacagaatttcgatgatttctgaactggcgagcgccagtggtattgccggaatgtgcggtggtcaggcattagatttagacgcggaaggcaaacacgtacctctggacgcgcttgagcgtattcatcgtcataaaaccggcgcattgattcgcgccgccgttcgccttggtgcattaagcgccggagataaaggacgtcgtgctctgccggtactcgacaagtatgcagagagcatcggccttgccttccaggttcaggatgacatcctggatgtggtgggagatactgcaacgttgggaaaacgccagggtgccgaccagcaacttggtaaaagtacctaccctgcacttctgggtcttgagcaagcccggaagaaagcccgggatctgatcgacgatgcccgtcagtcgctgaaacaactggctgaacagtcactcgatacctcggcactggaagcgctagcggactacatcatccagcgtaataaataa

[0070] Nucleotide sequence of the mevalonate kinase mvaKmm gene (SEQ ID NO.14):

[0071] atggtgagctgcagcgcgccgggcaaaatttatctgtttggcgaacatgcggtggtgtatggcgaaaccgcgattgcgtgcgcggtggaactgcgcacccgcgtgcgcgcggaactgaacgatagcattaccattcagagccagattggccgcaccggcctggattttgaaaaacatccgtatgtgagcgcggtgattgaaaaaatgcgcaaaagcattccgattaacggcgtgtttctgaccgtggatagcgatattccggtgggcagcggcctgggcagcagcgcggcggtgaccattgcgagcattggcgcgctgaacgaactgtttggctttggcctgagcctgcaggaaattgcgaaactgggccatgaaattgaaattaaagtgcagggcgcggcgagcccgaccgatacctatgtgagcacctttggcggcgtggtgaccattccggaacgccgcaaactgaaaaccccggattgcggcattgtgattggcgataccggcgtgtttagcagcaccaaagaactggtggcgaacgtgcgccagctgcgcgaaagctatccggatctgattgaaccgctgatgaccagcattggcaaaattagccgcattggcgaacagctggtgctgagcggcgattatgcgagcattggccgcctgatgaacgtgaaccagggcctgctggatgcgctgggcgtgaacattctggaactgagccagctgatttatagcgcgcgcgcggcgggcgcgtttggcgcgaaaattaccggcgcgggcggcggcggctgcatggtggcgctgaccgcgccggaaaaatgcaaccaggtggcggaagcggtggcgggcgcgggcggcaaagtgaccattaccaaaccgaccgaacagggcctgaaagtggattaa

[0072] The nucleotide sequence of mevalonate 5-pyrophosphate decarboxylase mvaD gene (SEQ ID NO.15):

[0073] atggatagagagcctgtaacagtacgttcctacgcaaatattgctattatcaaatattggggaaagaaaaaagaaaaagagatggtgcctgctactagcagtatttctctaactttggaaaatatgtatacagagacgaccttgtcgcctttaccagccaatgtaacagctgacgaattttacatcaatggtcagctacaaaatgaggtcgagcatgccaagatgagtaagattattgaccgttatcgtccagctggtgagggctttgtccgtatcgatactcaaaacaatatgcctactgcagcgggcctgtcctcaagttctagtggtttgtccgccctggtcaaggcttgtaatgcttatttcaagcttggattggatagaagtcagttggcacaggaagccaaatttgcctcaggctcttcttctcggagtttttatggaccactaggagcctgggataaggatagtggagaaatttaccctgtagagacagacttgaaactagctatgattatgttggtgctagaggacaagaaaaaaccaatctctagccgtgacgggatgaaactttgtgtggaaacctcgacgacttttgacgactgggttcgtcagtctgagaaggactatcaggatatgctgatttatctcaaggaaaatgattttgccaagattggagaattaacggagaaaaatgccctggctatgcatgctacgacaaagactgctagtccagccttttcttatctgacggatgcctcttatgaggctatggactttgttcgccagcttcgtgagaaaggagaggcctgctactttaccatggatgctggtcccaatgttaaggtcttctgtcaggagaaagacttggagcatttatcagaaattttcggtcatcgttatcgcttgattgtgtcaaaaacaaaggatttgagtcaagatgattgctgttaa

[0074] Nucleotide sequence of phosphomevalonate kinase mvaK2 gene (SEQ ID NO.16):

[0075]

[0076] The nucleotide sequence of the isopentenyl diphosphate delta-isomerase idi gene (SEQ ID NO.17):

[0077] atgcaaacggaacacgtcattttattgaatgcacagggagttcccacgggtacgctggaaaagtatgccgcacacacggcagacaccgcttacatctcgcgttctccagttggctgtttaatgccaaaggacaatt attagttacccgccgcgcactgagcaaaaaagcatggcctggcgtgtggactaactcggtttgtgggcacccacaactgggagaaagcaacgaagacgcagtgatccgccgttgccgttatgagcttggcgtggaaa ttacgcctcctgaatctatctatcctgactttcgctaccgcgccaccgatccgagtggcattgtggaaaatgaagtgtgtccggtatttgccgcacgcaccactagtgcgttacagatcaatgatgatgaagtgatg gattatcaatggtgtgatttagcagatgtattacacggtattgatgccacgccgtgggcgttcagtccgtggatggtgatgcaggcgacaaatcgcgaagccagaaaacgattatctgcatttacccagcttaaataa

[0078] The nucleotide sequence of 3-hydroxy-3-methylglutaryl-CoA synthase mvaS gene (SEQ ID NO.18):

[0079]

[0080] The nucleotide sequence of the acetoacetyl CoA thiolase / 3-hydroxy-3-methylglutaryl CoA reductase mvaE gene (SEQ ID NO.19):

[0081]

[0082] Nucleotide sequence of the mevalonate kinase mvaK1 gene (SEQ ID NO.20):

[0083] ATGACAAAAAAAGTTGGTGTCGGTCAGGCACATAGTAAGATAATTTTAATAGGGGAACATGCGGTCGTTTACGGTTATCCTGCCATTTCCCTGCCTCTTTTGGAGGTGGAGGTGACCTGTAAGGTAGTTCCTGCAGAGAGTCCTTGGCGCCTTTATGAGGAGGATACCTTGTCCATGGCGGTTTATGCCTCACTGGAGTATTTGGATATCACAGAAGCCTGCATTCGTTGTGAGATTGACTCGGCTATCCCTGAGAAACGGGGGATGGGTTCGTCAGCGGCTATCAGCATAGCGGCCATTCGTGCGGTATTTGACTACTATCAGGCTGATCTGCCTCATGATGTACTAGAAATCTTGGTCAATCGAGCTGAAATGATTGCCCATATGAATCCTAGTGGTTTGGATGCTAAGACCTGTCTCAGTGACCAACCTATTCGCTTTATCAAGAACGTAGGATTTACAGAACTTGAGATGGATTTATCCGCCTATTTGGTGATTGCCGATACGGGTGTTTATGGTCATACTCGTGAAGCCATCCAAGTGGTTCAAAATAAGGGCAAGGATGCCCTACCGTTTTTGCATGCCTTGGGAGAATTAACCCAGCAAGCAGAAGTTGCGATTTCACAAAAAGATGCTGAAGGACTGGGACAAATCCTCAGTCAAGCGCATTTACATTTAAAAGAAATTGGAGTCAGTAGCCCTGAGGCAGACTTTTTGGTTGAAACGACTCTTAGCCATGGTGCTCTGGGTGCCAAGATGAGCGGTGGTGGGCTAGGAGGTTGTATCATAGCCTTGGTAACCAATTTGACACACGCACAAGAACTAGCAGAAAGATTAGAAGAGAAAGGAGCTGTTCAGACATGGATAGAGAGCCTGTAA

[0084] V. Primer information involved

[0085] Table 1 Nucleotide sequences of primers

[0086] Name Primer SEQ ID NO MrBBs-F ATTTCACACAGGAAACAGCTGGTTAAACCATGAGCACACTGAGCGTCAG 21 MrBBs-R AGTTGCTGCGGAAAGTCCATTTTCCGTAACCTCCTTGGATCCTTAGACTATCATCGGATGTA 22 ispA-F TACATCCGATGATAGTCTAAGGATCCAAGGAGGTTACGGAAAATGGACTTTCCGCAGCAACT 23 ispA-R AACTCACATTACAGGTCGACTTATTTATTACGCTGGATGA 24 pSTV28-F ACTGGCCGTCGTTTTACAAC 25 pSTV28-R AGCTGTTTCCTGTGTGAAAT 26 mvaKmm-F TCATCCAGCGTAATAAATAAGTCGACCTGTAATGTGAGTT 27 idi-R ATAATAACTACTGTTTTCATCTAAATGCTCCTTTATTTAAGCTGGGTAAATG 28 mvaES-F CATTTACCCAGCTTAAATAAAGGAGCATTTAGATGAAAACAGTAGTTATTAT 29 mvaES-R GTTGTAAAACGACGGCCAGTTTAGTTTCGATAAGAACGAA 30 pSTV28-1--F ACTGGCCGTCGTTTTACAAC 31 pSTV28-1-R TTATTTAAGCTGGGTAAATG 32 mvaK1-F TTTCACACAGGAAACAGACCATGACAAAAAAAGTTGGTGT 33 mvaK1-R ATTTGCGTAGGAACGTACTGTTACAGGCTCTCTATCCATG 34 mvaDK2-idi-F CATGGATAGAGAGCCTGTAACAGTACGTTCCTACGCAAAT 35 mvaDK2-idi-R AAAACAGCCAAGCTTGCATGTTATTTAAGCTGGGTAAATG 36 pTrc99A-F CATGCAAGCTTGGCTGTTTT 37 pTrc99A-R GGTCTGTTTCCTGTGTGAAA 38 MrBBS-R1 TGGCGTCGTCGTCGTTGGGACTATCATCGGATGTACAA 39 MrBBS-R2 TGATGATGATCCTCCTCCTCCGACTATCATCGGATGTACAA 40 MrBBS-R3 GGAAAGTCGATTCCTCCTCCGACTATCATCGGATGTACAA 41 MrBBS-R4 GGAAAGTCTCCTCCGATTCCGACTATCATCGGATGTACAA 42 MrBBS-R5 GGAAAGTCTCCGATTCCTCCGACTATCATCGGATGTACAA 43 ispA-F1 CCAACGACGACGACGCCAGACTTTCCGCAGCAACTCGA 44 ispA-F2 GGAGGAGGAGGATCATCATCAGACTTTCCGCAGCAACTCGA 45 ispA-F3 TGATAGTCGGAGGAGGAATCGACTTTCCGCAGCAACTCGA 46 ispA-F4 TGATAGTCGGAAGCGGAGGAGACTTTCCGCAGCAACTCGA 47 ispA-F5 TGATAGTCGGAGGAATCGGAGACTTTCCGCAGCAACTCGA 48

[0087] 6. PCR fusion products

[0088] The nucleotide sequence of the fusion product of MrBBS gene and ispA gene (SEQ ID NO.49):

[0089]

[0090]

[0091] Note: The uppercase bold part is the 5' end RBS sequence of MrBBS gene (SEQ ID NO.1); the lowercase regular part is the MrBBS gene sequence (SEQ ID NO.12); the lowercase bold part is the 5' end RBS sequence of ispA gene (SEQ ID NO.2); the lowercase underlined part ispA gene sequence (SEQ ID NO.13).

[0092] The nucleotide sequence of the fusion product of mvaKmm gene, mvaD gene, mvaK2 gene, idi gene, mvaS gene and mvaE gene (SEQ ID NO.50):

[0093]

[0094]

[0095]

[0096]

[0097]

[0098] Note: The uppercase regular part is the pLac sequence at the 5' end of the mvaKmm gene (SEQ ID NO.6); the lowercase regular part is the mvaKmm gene sequence (SEQ ID NO.14); the lowercase italic underlined part is the mvaD gene sequence (SEQ ID NO.15); the lowercase italic part is the mvaK2 gene sequence (SEQ ID NO.16); the lowercase bold part is the RBS sequence at the 5' end of the idi gene (SEQ ID NO.3), and the uppercase regular underlined part is the idi gene sequence (SEQ ID NO.17); the uppercase regular bold part is the RBS sequence at the 5' end of the mvaE gene (SEQ ID NO.4), and the uppercase regular bold underlined part is the mvaE gene sequence (SEQ ID NO.19); the uppercase italic part is the RBS sequence at the 5' end of the mvaS gene (SEQ ID NO.5), and the uppercase italic underlined part is the mvaS gene sequence (SEQ ID NO.18).

[0099] The nucleotide sequence of the fusion product of mvaK1 gene, mvaD gene, mvaK2 gene and idi gene (SEQ ID NO.51):

[0100]

[0101]

[0102] Note: The uppercase positive part is the mvaK1 gene sequence (SEQ ID NO.20); the lowercase positive part is the mvaD gene sequence (SEQ ID NO.15); the lowercase underlined part is the mvaK2 gene sequence (SEQ ID NO.16); the lowercase bold italic part is the 5' end RBS sequence of the idi gene (SEQ ID NO.3), and the lowercase italic part is the idi gene sequence (SEQ ID NO.17).

[0103] Nucleotide sequence of the fusion product of MrBBS gene and ispA gene connected with a short peptide sequence: SEQ ID NO.52:

[0104]

[0105]

[0106] Note: The uppercase part is the 5' end RBS sequence of MrBBS gene (SEQ ID NO.1); the lowercase part is the MrBBS gene sequence (SEQ ID NO.12); the uppercase bold part is the connecting short peptide sequence (SEQ ID NO.7); the lowercase italic part is the ispA gene sequence (SEQ ID NO.13).

[0107] SEQ ID NO.53:

[0108]

[0109]

[0110] Note: The uppercase part is the 5' end RBS sequence of MrBBS gene (SEQ ID NO.1); the lowercase part is the MrBBS gene sequence (SEQ ID NO.12); the uppercase bold part is the connecting short peptide sequence (SEQ ID NO.8); the lowercase italic part is the ispA gene sequence (SEQ ID NO.13).

[0111] SEQ ID NO.54:

[0112]

[0113]

[0114] Note: The uppercase positive part is the 5' end RBS sequence of MrBBS gene (SEQ ID NO.1); the lowercase positive part is the MrBBS gene sequence (SEQ ID NO.12); the uppercase bold part is the connecting short peptide sequence (SEQ ID NO.9); the lowercase italic part is the ispA gene sequence (SEQ ID NO.13).

[0115] SEQ ID NO.55

[0116]

[0117]

[0118] Note: The uppercase positive part is the 5' end RBS sequence of MrBBS gene (SEQ ID NO.1); the lowercase positive part is the MrBBS gene sequence (SEQ ID NO.12); the uppercase bold part is the connecting short peptide sequence (SEQ ID NO.10); the lowercase italic part is the ispA gene sequence (SEQ ID NO.13).

[0119] SEQ ID NO.56

[0120]

[0121]

[0122] Note: The uppercase positive part is the 5' end RBS sequence of MrBBS gene (SEQ ID NO.1); the lowercase positive part is the MrBBS gene sequence (SEQ ID NO.12); the uppercase bold part is the connecting short peptide sequence (SEQ ID NO.11); the lowercase italic part is the ispA gene sequence (SEQ ID NO.13).

[0123] Example 1 Construction of the recombinant genetically engineered bacteria producing (-)-α-bisabolol of the present invention

[0124] (1) Synthesize (Suzhou Jinweizhi Biotechnology Co., Ltd.) the gene MrBBS encoding the (-)-α-bisabolol synthase from chamomile flowers; use MrBBS-F / MrBBS-R1, MrBBS-F / MrBBS-R2, MrBBS-F / MrBBS-R3, MrBBS-F / MrBBS-R4, and MrBBS-F / MrBBS-R5 as primers to perform PCR amplification on the (-)-α-bisabolol synthase gene MrBBS. The PCR product is a (-)-α-bisabolol synthase gene MrBBS with a 9 bp RBS at the 5' end, a termination codon TAA removed from the end, and short peptide coding sequences of different lengths connected thereto (the nucleotide sequence of RBS is shown in SEQ ID NO.1, and the short peptide coding sequence is shown in SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10 or SEQ ID NO.11). The PCR product was detected by 1.0% agarose gel electrophoresis and the fragment was purified by a clean-up kit;

[0125] Using the E. coli DH5α / W3110 genome as a template, ispA fragments without start codon ATG and with short peptide coding sequences of different lengths (the short peptide coding sequences are shown in SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10 or SEQ ID NO.11) were amplified by PCR using primers ispA-F1 / ispA-R, ispA-F2 / ispA-R, ispA-F3 / ispA-R, ispA-F4 / ispA-R and ispA-F5 / ispA-R, respectively, and the fragments were purified using a clean-up kit;

[0126] The two recovered DNA fragments were subjected to fusion PCR using primers ispA-F1 / MrBBS-R1, ispA-F2 / MrBBS-R2, ispA-F3 / MrBBS-R3, ispA-F4 / MrBBS-R4, and ispA-F5 / MrBBS-R5, respectively. The PCR products were detected by 1.0% agarose gel electrophoresis and the fragments were recovered and purified by gel excision. Then, the purified fusion PCR products (nucleotide sequences as shown in SEQ ID NO.52-56) were connected to the linearized plasmid pSTV28 using the one-step cloning kit of Novozymes (37°C for 30 min). The plasmid was linearized to obtain primers pSTV28-F and pSTV28-R. The ligation products were transformed into E. coli DH5α, and obtain the transformation product; the transformation product is spread on LB solid medium (containing chloramphenicol at a final concentration of 34 mg / L), and the plasmid is extracted and sequenced for verification after shaking flask culture at 37°C and 220 rpm for 8 to 12 hours. If the verification is correct, the recombinant plasmid pSTV28-11 / 12 / 13 / 14 / 15 is obtained;

[0127] (2) The pUC57 / mvaKmmDK2-idi plasmid (Suzhou Jinweizhi Biotechnology Co., Ltd.) was synthesized as a template. The synthetic plasmid contained the mvaKmm gene encoding the mevalonate kinase from Methanosarcina, the mvaD gene encoding the mevalonate 5-pyrophosphate decarboxylase from Streptococcus pneumoniae, the mvaK2 gene encoding the phosphomevalonate kinase, and the idi gene encoding the isopentenyl diphosphate delta isomerase from Escherichia coli with a 12 bp RBS (the nucleotide sequence of the RBS is shown in SEQ ID NO.3); the mvaKmmDK2-idi gene was amplified by PCR using mvaKmm-F and idi-R as primers to obtain the mvaK1DK2-idi fragment with pLac (the nucleotide sequence of pLac is shown in SEQ ID NO.6, inserted into the 5' end of the mvaKmm gene); the PCR product was detected by 1.0% agarose gel electrophoresis and the fragment was purified using a clean-up kit;

[0128] Using the pUC57 / mvaES plasmid synthesized by chemical synthesis (Suzhou Jinweizhi Biotechnology Co., Ltd.) as a template, the synthetic plasmid contains the 3-hydroxy-3-methylglutaryl CoA synthase gene mvaS and the acetoacetyl CoA thiolase / 3-hydroxy-3-methylglutaryl CoA reductase gene mvaE from Enterobacter faecalis; (the 5' end of the mvaE gene carries an RBS, and the RBS nucleotide sequence is shown in SEQ ID NO.4; the 5' end of the mvaS gene carries an RBS, and the RBS nucleotide sequence is shown in SEQ ID NO.5) PCR is used to amplify using primers mvaES-F and mvaES-R, and the PCR product is purified using a clean-up kit;

[0129] The two recovered DNA fragments were subjected to fusion PCR using mvaKmm-F and mvaES-R, and the PCR products were detected by 1.0% agarose gel electrophoresis and the fragments were purified by gel excision; then the purified fusion PCR products (nucleotide sequence as shown in SEQ ID NO.50) were connected with the linearized plasmid pSTV28-11 / 12 / 13 / 14 / 15 using the one-step cloning kit of Novozymes (37°C for 30 min), and the plasmids were linearized using primers pSTV28-1-F and pSTV28-1-R; the connection products were transformed into E. coli DH5α to obtain transformation products; the transformation products were spread on LB solid culture medium (containing chloramphenicol at a final concentration of 34 mg / L), and the plasmids were extracted for sequencing verification after shaking flask culture at 37°C and 220 rpm for 8 to 12 hours. If the verification was correct, the recombinant plasmid pSTV28-21 / 22 / 23 / 24 / 25 was obtained;

[0130] (3) The pUC57 / mvaK1 plasmid (Suzhou Jinweizhi Biotechnology Co., Ltd.) was used as a template; mvaK1-F and mvaK1-R were used as primers to perform PCR amplification on the mevalonate kinase mvaK1 gene from Streptococcus pneumoniae to obtain the mvaK1 fragment. The PCR product was detected by 1.0% agarose gel electrophoresis and the fragment was purified using a clean-up kit;

[0131] Using pUC57 / mvaKmmDK2-idi plasmid as a template, using primers mvaDK2-idi-F and mvaDK2-idi-R to perform PCR amplification, a gene fragment containing mevalonate 5-pyrophosphate decarboxylase mvaD gene, phosphomevalonate kinase mvaK2 gene and isopentenyl diphosphate δ-isomerase idi gene from Streptococcus pneumoniae, i.e., mvaDK2-idi fragment (the idi gene 5' end of the fragment carries a 12 bp RBS, and the nucleotide sequence is shown in SEQ ID NO.3), the PCR product is detected by 1.0% agarose gel electrophoresis, and the fragment is purified by a clean-up kit;

[0132] The two recovered DNA fragments were subjected to fusion PCR using primers mvaK1-F and mvaDK2-idi-R, and the PCR products were detected by 1.0% agarose gel electrophoresis and the fragment mvaK1DK2-idi was purified by gel excision; then the purified PCR product (nucleotide sequence as shown in SEQ ID NO.51) was connected with the linearized plasmid pTrc99A using a one-step cloning kit of Novagen (37°C for 30 min), and the plasmid was linearized using primers pTrc99A-F and pTrc99A-R; the connection product was transformed into E.coli DH5α to obtain a transformation product; the transformation product was spread on LB solid culture medium (containing a final concentration of 100 mg / L ampicillin), and after incubation in a test tube at 37°C and 220 rpm for 8 to 12 hours, the plasmid was extracted for sequencing verification, and the recombinant plasmid pTrc99A-1 was obtained if the verification was correct;

[0133] (4) The above-constructed plasmids -21 / 22 / 23 / 24 / 25 and pTrc99A-1 were transformed into Escherichia coli DH5α to obtain transformation products; the transformation products were spread on LB solid culture medium (containing a final concentration of 100 mg / L ampicillin and 34 mg / L chloramphenicol resistance), and inverted cultured in a 37°C constant temperature incubator for about 12 hours to obtain transformants, which are the recombinant Escherichia coli engineered strains E. coli DH5α pSTV28-21 / 22 / 23 / 24 / 25&pTrc99A-1.

[0134] Example 2 Preparation of (-)-α-Bisabolol

[0135] 1) Take the E. coli DH5αpSTV28-21 / 22 / 23 / 24 / 25&pTrc99A-1 constructed in Example 1, inoculate it into a seed culture medium, and culture it on a shaker at 30°C and 200 rpm for 8 to 10 hours. Take the seed solution, inoculate it into a fermentation medium at 8% (v / v), and then cover it with 20% (v / v) n-dodecane, and culture it on a shaker at 30°C and 200 rpm for 3 hours. Add 10 μL of 0.25 M IPTG mother solution, and then culture it on a shaker at 30°C and 200 rpm for 47 hours.

[0136] The formula of the seed culture medium is: tryptone 10 g / L, yeast powder 5 g / L, sodium chloride 10 g / L, ampicillin final concentration 100 mg / L and chloramphenicol final concentration 34 mg / L;

[0137] The formula of the fermentation medium is 10 g / L glycerol, 2.2 g / L potassium dihydrogen phosphate, 2.9 g / L potassium hydrogen phosphate, 24 g / L yeast powder, 12 g / L yeast peptone, 0.1 mM IPTG, final concentration of ampicillin of 100 mg / L and final concentration of chloramphenicol of 34 mg / L.

[0138] Example 3 Preparation of (-)-α-Bisabolol

[0139] 1) Take the E. coli DH5αpSTV28-21 / 22 / 23 / 24 / 25&pTrc99A-1 constructed in Example 1, inoculate it into a seed culture medium, and culture it on a shaker at 30°C and 200 rpm for 8 to 10 hours. Take the seed solution, inoculate it into a fermentation medium at 8% (v / v), and then cover it with 20% (v / v) n-dodecane, and culture it on a shaker at 30°C and 200 rpm for 3 hours. Add 10 μL of 0.25 M IPTG mother solution, and then culture it on a shaker at 30°C and 200 rpm for 47 hours.

[0140] The formula of the seed culture medium is: tryptone 10 g / L, yeast powder 5 g / L, sodium chloride 10 g / L, ampicillin final concentration 100 mg / L and chloramphenicol final concentration 34 mg / L;

[0141] The formula of the fermentation medium is glucose 10 g / L, potassium dihydrogen phosphate 2.2 g / L, potassium dihydrogen phosphate 2.9 g / L, yeast powder 24 g / L, yeast peptone 12 g / L, IPTG 0.1 mM, ampicillin final concentration of 100 mg / L and chloramphenicol final concentration of 34 mg / L.

[0142] Comparative Example 1 Construction of recombinant genetically engineered bacteria producing (-)-α-bisabolol

[0143] (1) Chemical synthesis (Suzhou Jinweizhi Biotechnology Co., Ltd.) encoding the (-)-α-bisabolol synthase gene MrBBS from chamomile flowers; using MrBBS-F and MrBBS-R as primers, PCR amplification of the (-)-α-bisabolol synthase gene MrBBS was performed, and the PCR product was the (-)-α-bisabolol synthase gene MrBBS with a 9 bp RBS (the nucleotide sequence of RBS is shown in SEQ ID NO. 1), and the PCR product was detected by 1.0% agarose gel electrophoresis and the fragment was purified using a clean-up kit;

[0144] Using the E. coli DH5α / W3110 genome as a template, the ispA fragment with a 16 bp RBS (the nucleotide sequence of the RBS is shown in SEQ ID NO. 2) was amplified by PCR using primers ispA-F and ispA-R, and the fragment was purified using a clean-up kit;

[0145] The two recovered DNA fragments were subjected to fusion PCR using primers MrBBS-F and ispA-R, and the PCR products were detected by 1.0% agarose gel electrophoresis and the fragments were purified by gel excision; then the purified fusion PCR product (nucleotide sequence as shown in SEQ ID NO.49) was connected to the linearized plasmid pSTV28 using a one-step cloning kit of Novozymes (37°C for 30 min), and the plasmid was linearized using primers pSTV28-F and pSTV28-R; the connection product was transformed into E. coli DH5α to obtain a transformation product; the transformation product was spread on LB solid culture medium (containing chloramphenicol at a final concentration of 34 mg / L), and the plasmid was extracted for sequencing verification after shaking flask culture at 37°C and 220 rpm for 8 to 12 hours. If the verification was correct, the recombinant plasmid pSTV28-1 was obtained;

[0146] (2) Synthesize pUC57 / mvaKmmDK2-idi plasmid (Suzhou Jinweizhi Biotechnology Co., Ltd.), which contains the genes encoding mevalonate kinase mvaKmm from Methanosarcina, mevalonate 5-pyrophosphate decarboxylase mvaD from Streptococcus pneumoniae, phosphomevalonate kinase mvaK2, and isopentenyl diphosphate delta isomerase idi from Escherichia coli with 12 bp RBS (RBS nucleotide sequence is shown in SEQ ID NO.3); mvaKmm-F and idi-R are used as primers to perform PCR amplification on the mvaKmmDK2-idi gene to obtain a mvaK1DK2-idi fragment with pLac (pLac nucleotide sequence is shown in SEQ ID NO.6, inserted into the 5' end of the mvaKmm gene); the PCR product is detected by 1.0% agarose gel electrophoresis and the fragment is purified by a clean-up kit;

[0147] The pUC57 / mvaES plasmid was synthesized (Suzhou Jinweizhi Biotechnology Co., Ltd.), and the synthetic plasmid contained the 3-hydroxy-3-methylglutaryl CoA synthase gene mvaS and the acetoacetyl CoA thiolase / 3-hydroxy-3-methylglutaryl CoA reductase gene mvaE derived from Enterobacter faecalis; (the 5' end of the mvaE gene contained an RBS, and the nucleotide sequence of the RBS was shown in SEQ ID NO.4; the 5' end of the mvaS gene contained an RBS, and the nucleotide sequence of the RBS was shown in SEQ ID NO.5) by PCR using primers mvaES-F and mvaES-R, and the PCR product was purified using a clean-up kit;

[0148] The two recovered DNA fragments were subjected to fusion PCR using mvaKmm-F and mvaES-R, and the PCR products were detected by 1.0% agarose gel electrophoresis and the fragments were purified by gel excision. Then, the purified fusion PCR product (nucleotide sequence as shown in SEQ ID NO.50) was connected with the linearized plasmid pSTV28-1 using the one-step cloning kit of Novozymes (37°C for 30 min), and the plasmid was linearized to obtain primers pSTV28-1-F and pSTV28-1-R; the connection product was transformed into E.coliDH5α to obtain the transformation product; the transformation product was spread on LB solid culture medium (containing chloramphenicol at a final concentration of 34 mg / L), and the plasmid was extracted for sequencing verification after shaking flask culture at 37°C and 220 rpm for 8 to 12 hours. If the verification is correct, the recombinant plasmid pSTV28-2 ( Figure 1 );

[0149] (3) The pUC57 / mvaK1 plasmid was synthesized by chemical synthesis (Suzhou Jinweizhi Biotechnology Co., Ltd.); the mevalonate kinase mvaK1 gene from Streptococcus pneumoniae was amplified by PCR using mvaK1-F and mvaK1-R as primers to obtain the mvaK1 fragment. The PCR product was detected by 1.0% agarose gel electrophoresis and the fragment was purified using a clean-up kit;

[0150] Using pUC57 / mvaKmmDK2-idi plasmid as a template, using primers mvaDK2-idi-F and mvaDK2-idi-R to perform PCR amplification, a gene fragment containing mevalonate 5-pyrophosphate decarboxylase mvaD gene, phosphomevalonate kinase mvaK2 gene and isopentenyl diphosphate δ-isomerase idi gene from Streptococcus pneumoniae, i.e., mvaDK2-idi fragment (the idi gene 5' end of the fragment carries a 12 bp RBS, and the nucleotide sequence is shown in SEQ ID NO.3), the PCR product is detected by 1.0% agarose gel electrophoresis, and the fragment is purified by a clean-up kit;

[0151] The two recovered DNA fragments were subjected to fusion PCR using primers mvaK1-F and mvaDK2-idi-R, and the PCR products were detected by 1.0% agarose gel electrophoresis and the fragment mvaK1DK2-idi was purified by gel excision; then the purified PCR product (nucleotide sequence as shown in SEQ ID NO.51) was connected with the linearized plasmid pTrc99A using a one-step cloning kit of Novozymes (37°C for 30 min), and the plasmid was linearized using primers pTrc99A-F and pTrc99A-R; the ligation product was transformed into E.coli DH5α to obtain a transformation product; the transformation product was spread on LB solid culture medium (containing a final concentration of 100 mg / L ampicillin), and the plasmid was extracted and sequenced after incubation at 37°C and 220 rpm for 8 to 12 hours. If the verification was correct, the recombinant plasmid pTrc99A-1 ( Figure 2 );

[0152] (4) The plasmids pSTV28-2 and pTrc99A-1 constructed above were transformed into Escherichia coli DH5α / W3110 to obtain a transformation product; the transformation product was spread on LB solid culture medium (containing a final concentration of 100 mg / L ampicillin and 34 mg / L chloramphenicol resistance), and inverted in a 37°C constant temperature incubator for about 12 hours to obtain a transformant, which is the recombinant Escherichia coli engineered strain DH5α / W3110 pSTV28-2&pTrc99A-1.

[0153] Comparative Example 2 Preparation of (-)-α-Bisabolol

[0154] 1) Take the Escherichia coli engineered strain DH5α / W3110 pSTV28-2&pTrc99A-1 constructed in Comparative Example 1, inoculate it into a seed culture medium, and culture it on a shaker at 30°C and 200rpm for 8 to 10 hours. Take the seed solution, inoculate it into a fermentation medium at 8% (v / v), and then cover it with 20% (v / v) n-dodecane, and culture it on a shaker at 30°C and 200rpm for 3 hours. Add 10 μL of 0.25M IPTG mother solution, and then culture it on a shaker at 30°C and 200rpm for 47 hours.

[0155] The formula of the seed culture medium is: tryptone 10 g / L, yeast powder 5 g / L, sodium chloride 10 g / L, ampicillin final concentration 100 mg / L and chloramphenicol final concentration 34 mg / L;

[0156] The formula of the fermentation medium is 10 g / L glycerol, 2.2 g / L potassium dihydrogen phosphate, 2.9 g / L potassium hydrogen phosphate, 24 g / L yeast powder, 12 g / L yeast peptone, 0.1 mM IPTG, final concentration of ampicillin of 100 mg / L and final concentration of chloramphenicol of 34 mg / L.

[0157] Comparative Example 3 Preparation of (-)-α-Bisabolol

[0158] 1) Take the Escherichia coli engineered strain DH5α / W3110 pSTV28-2&pTrc99A-1 constructed in Comparative Example 1, inoculate it into a seed culture medium, and culture it on a shaker at 30°C and 200rpm for 8 to 10 hours. Take the seed solution, inoculate it into a fermentation medium at 8% (v / v), and then cover it with 20% (v / v) n-dodecane, and culture it on a shaker at 30°C and 200rpm for 3 hours. Add 10 μL of 0.25M IPTG mother solution, and then culture it on a shaker at 30°C and 200rpm for 47 hours.

[0159] The formula of the seed culture medium is: tryptone 10 g / L, yeast powder 5 g / L, sodium chloride 10 g / L, ampicillin final concentration 100 mg / L and chloramphenicol final concentration 34 mg / L;

[0160] The formula of the fermentation medium is glucose 10 g / L, potassium dihydrogen phosphate 2.2 g / L, potassium dihydrogen phosphate 2.9 g / L, yeast powder 24 g / L, yeast peptone 12 g / L, IPTG 0.1 mM, ampicillin final concentration of 100 mg / L and chloramphenicol final concentration of 34 mg / L.

[0161] The beneficial effects of the present invention are further illustrated by test examples below:

[0162] Experimental Example 1 Application of Recombinant Escherichia coli in Synthesis of (-)-α-Bisabolol

[0163] 1. Culture medium preparation

[0164] LB medium composition: peptone 10g / L, yeast powder 5g / L, sodium chloride 10g / L, solvent is deionized water, pH value is natural. LB plate is to add agar with a final concentration of 2g / L in LB liquid medium.

[0165] Seed medium: tryptone 10 g / L, yeast powder 5 g / L, sodium chloride 10 g / L, ampicillin final concentration 100 mg / L and chloramphenicol final concentration 34 mg / L;

[0166] Fermentation medium: glucose / glycerol 10 g / L, potassium dihydrogen phosphate 2.2 g / L, potassium dihydrogen phosphate 2.9 g / L, yeast powder 24 g / L, yeast peptone 12 g / L, IPTG 0.1 mM, final concentration of ampicillin 100 mg / L and final concentration of chloramphenicol 34 mg / L.

[0167] (2) Production of (-)-α-Bisabolol

[0168] The E. coli engineering strain DH5α / W3110 pSTV28-2 & pTrc99A-1 constructed in Comparative Example 1 was selected for fermentation experiment test in a shake flask (the synthetic metabolic process of (-)-α-bisabolol during fermentation is shown in Figure 4 ), the specific shake flask fermentation experimental steps are as follows:

[0169] A single colony streaked and cultured overnight on LB solid medium was selected and inoculated into seed medium, and cultured at 30°C and 200rpm shaking for 8-10 hours. The cultured seeds were inoculated into the fermentation medium at 8% (v / v), and then 20% (v / v) n-dodecane was added, and cultured at 30°C and 200rpm shaking for 50 hours. After fermentation for 3 hours, 10 μL of 0.25M IPTG mother solution was added. After the fermentation was completed, the supernatant of the fermentation liquid was taken to obtain (-)-α-bisabolol.

[0170] (3) Determination of (-)-α-bisabolol content:

[0171] Standard sample preparation: Prepare 9g / L (-)-α-bisabolol standard sample, dilute to concentrations of 10, 30, 50, 70, and 90mg / L respectively, and pass 1mL through the membrane for testing;

[0172] Sample preparation: Take 1 mL of fermentation liquid and centrifuge at 12000 rpm for 5 min to separate the two phases; the separated organic phase is passed through a membrane for testing;

[0173] GC-MS detection method: the column temperature control program is 50℃ for 3min; the temperature is increased to 280℃ at 20℃ / min and maintained for 5min; the injection port temperature is 200℃; the injection mode split ratio is 10:1; the split flow rate is 10mL / min; the chromatographic column is Agilent HP-5MS UI (30m*250um*0.25um); the column flow rate is: 1mL / min;

[0174] Detection of the content of (-)-α-bisabolol in the fermentation broth obtained by fermentation of recombinant E. coli DH5α / W3110 pSTV28-2&pTrc99A-1, the detection results and GC-MS spectrum Figure 5 .Depend on Figure 5It can be seen that when E. coli DH5α / W3110 pSTV28-2&pTrc99A-1 are inoculated into the fermentation medium with glucose as the carbon source and fermented for 50 hours, the production of (-)-α-bisabolol in the fermentation liquid of E. coli DH5αpSTV28-2&pTrc99A-1 can reach 5 g / L; while the production of E. coli W3110pSTV28-2&pTrc99A-1 is 3.9 g / L.

[0175] Glycerol or glucose was used as the sole carbon source in the fermentation medium to investigate the ability of recombinant E. coli DH5αpSTV28-2&pTrc99A-1 to synthesize (-)-α-bisabolol under different carbon sources. The yield of (-)-α-bisabolol synthesized under shake flask culture conditions was as follows: Figure 6 When glycerol was the sole carbon source, the yield of (-)-α-bisabolol synthesized by strain E. coli DH5αpSTV28-2&pTrc99A-1 reached 2.8 g / L after 50 h of shake flask fermentation, which was lower than the yield when glucose was the sole carbon source, indicating that glucose as the sole carbon source was more conducive to the synthesis of (-)-α-bisabolol.

[0176] Experimental Example 2: Effects of different linked short peptides on the yield of (-)-α-bisabolol

[0177] Five strains of E. coli engineered strains E. coli DH5αpSTV28-21 / 22 / 23 / 24 / 25&pTrc99A-1 constructed in Example 1, expressing α-bisabolol synthase MrBBS and farnesyl diphosphate synthase ispA fusion enzymes connected by different connecting polypeptides, were selected for fermentation test in shake flasks. Glucose was used as the sole carbon source in the fermentation medium, and fermentation production was carried out according to the method of Experimental Example 1. The synthesis yield of (-)-α-bisabolol under shake flask culture conditions was as follows: Figure 7 When the shake flask fermentation was continued for 50 h, the yield of (-)-α-bisabolol synthesized by strain E. coli DH5αpSTV28-24&pTrc99A-1 reached 6.8 g / L, and the plasmid map of pSTV28-24 is shown in Figure 3 .

[0178] from Figure 7The fermentation results show that the connecting peptide between α-bisabolol synthase MrBBS and farnesyl diphosphate synthase IspA has a great influence on the yield of bisabolol. Among them, the connecting peptide encoded by SEQ ID NO.10 (the corresponding amino acid sequence is Gly-Ser-Gly-Gly) has a great promoting effect on the increase of bisabolol yield. The reason may be that MrBBS and IspA are fused and expressed through the connecting peptide, so that the two enzymes are closer in spatial structure, which is convenient for farnesyl diphosphate synthase ispA to catalyze the product farnesyl pyrophosphate as a substrate of bisabolol synthase MrBBS to be quickly obtained by MrBBS for reaction, thereby increasing the final yield of (-)-α-bisabolol.

[0179] In summary, the present invention recombines specific genes such as MVA pathway genes such as mvaKmm into Escherichia coli, connects MrBBS gene and ispA gene through short peptide coding sequences in the recombinant Escherichia coli, and overexpresses genes such as mvaK2, mvaD, idi, etc., so that the yield in the shake flask stage of the production process can reach 6.8 g / L. The yield after amplification in the fermentation tank can break through the current publicly reported yield and is suitable for practical promotion and application. SEQUENCE LISTING <110> Shanghai Ruikang Biotechnology R&D Co., Ltd. <120> A recombinant genetic engineering bacterium producing (-)-α-bisabolol and its preparation method and use <130> GY218-2022P0115014CCR3 <160> 56 <170> PatentIn version 3.5 <210> 1 <211> 9 <212> DNA <213> Artificial sequence <400> 1 ggttaaacc 9 <210> 2 <211> 16 <212> DNA <213> Artificial sequence <400> 2 aaggaggtta cggaaa 16 <210> 3 <211> 12 <212> DNA <213> Artificial sequence <400> 3 aggagagaaa tt <210> 4 <211> 12 <212> DNA <213> The snowstorm <400> 4 aggagcattt about <210> 5 <211> 12 <212> DNA <213> The snowstorm <400> 5 aggagaacc tt <210> 6 <211> 151 <212> DNA <213> The snowstorm <400> 6 60. taatgtgagt tagctcactc attaggcacc ccaggcttta cactttatgc ttccggctcg tatgttgtgt ggaattgtga gcggataaca atttcacaca ggaaacagct atgaccatga ttacgaattc gagctcggta cccggggatc c <210> 7 <211> 18 <212> DNA <213> The snowstorm <400> 7 18. snow cgacgcca <210> 8 <211> 21 <212> DNA <213> The snowstorm <400> 8 ggaggaggag gatcatcatc a <210> 9 <211> 12 <212> DNA <213> The snowstorm <400> 9 ggaggaggaa tc 12 <210> 10 <211> 12 <212> DNA <213> Artificial sequence <400> 10 ggaagcggag ga 12 <210> 11 <211> 12 <212> DNA <213> Artificial sequence <400> 11 ggaggaatcg ga 12 <210> 12 <211> 1719 <212> DNA <213> Artificial sequence <400> 12 atgagcacac tgagcgtcag caccccgagc tttagcagca gccctctgtc gagcgtgaat 60 aagaacagca ccaagcagca tgtcactcgt aacagcgtga tctttcacga ctcgatttgg 120 ggggaccagt tcctggaata caaagagaaa ttcaacgttg caaccgagaa acagcttata 180 gaagagctga aagaagaagt gcgtaacgaa ctgatgattc gtgcatgtaa tgaagcgagc 240 cggtatatca aactgatcca gctgatcgat gttgttgaac gtctggggct ggcctatcat 300 tttgaaaaag agattgagga aagcctccag catatatatg tgacgtatgg tcataaatgg 360 acgaattaca acaatattga gagcctgagt ctgtggttcc gcctgcttcg tcaaaatggc 420 tttaatgtta gctcggatat atttgaaaat cacattgatg agaaaggaaa ttttcaggag 480 agcctgtgca atgatccgca ggggatgctg gcgctgtatg aagcggcata tatgcgtgtt 540 gaaggagaga tcattctgga caaagcactc gaatttacca agctgcatct ggggatcatt 600 agcaatgatc ctagctgtga tagcagccta cgtacggaaa tcaagcaggc actgaaacag 660 ccactgcgcc ggcggctgcc aaggctggaa gccgttcgtt acattgccat ttatcagcag 720 aaggcgagcc atagcgaggt tctgctgaag ctggccaaac tggacttcaa cgttctgcag 780 gaaatgcaca aagacgaatt gagccaaata tgcaaatggt ggaaagatct ggatatacgt 840 aacaaactgc cctatgttcg tgatcgtctg attgaaggct atttttggat tctgggtatt 900 tatttcgaac cgcaacactc ccgtacccgt atgttcctga tgaaaacctg tatgtggctg 960 atcgtgctgg acgatacgtt tgataattac ggcacctatg aagagttaga gatctttacc 1020 caagcagtcg aacgttggag cattacctgt ctggatgaac tgccagagta tatgaagctg 1080 atatatcacg agcaatttcg cgtgcatcag gaaatggagg aaagcctgga aaaggagggt 1140 aaggcctacc agattcatta tatcaaagaa atggccaaag aaggtactcg ttcgctgctg 1200 ctggaagcga aatggctgaa ggaaggctat atgcctaccc tggatgagta cctgagcaac 1260 agcctggtca cctgcggcta tgcactgatg accgcacgca gctacgttgc ccgtgacgac 1320 ggcattgtta ccgaagatgc attcaaatgg gttgcaacgc acccgccgat tgttaaagca 1380 gcatgcaaaa ttctgcgcct gatggacgac attgcaaccc ataaagagga acaggagcgg 1440 ggacacattg caagtagcat tgagtgttac aggaaggaaa ccggagctag cgaagaggag 1500 gcttgcatgg actttctgaa gcaggttgaa gatggttgga aagttattaa tcaagaaagc 1560 ctgatgccga ccgatgttcc gttccctctg ctgattccgg caattaacct ggcacgtgtg 1620 agcgacaccc tgtacaaaga caacgatggt tataatcatg ccgataaaga ggttataggt 1680 tatattaaaa gcctgtttgt acatccgatg atagtctaa 1719 <210> 13 <211> 900 <212> DNA <213> Artificial Sequence <400> 13 atggactttc cgcagcaact cgaagcctgc gttaagcagg ccaaccaggc gctgagccgt 60 tttatcgccc cactgccctt tcagaacact cccgtggtcg aaaccatgca gtatggcgca 120 ttattaggtg gtaagcgcct gcgacctttc ctggtttatg ccaccggtca tatgttcggc 180 gttagcacaa acacgctgga cgcacccgct gccgccgttg agtgtatcca cgcttactca 240 ttaattcatg atgatttacc ggcaatggat gatgacgatc tgcgtcgcgg tttgccaacc 300 tgccatgtga agtttggcga agcaaacgcg attctcgctg gcgacgcttt acaaacgctg 360 gcgttctcga ttttaagcga tgccgatatg ccggaagtgt cggaccgcga cagaatttcg 420 atgatttctg aactggcgag cgccagtggt attgccggaa tgtgcggtgg tcaggcatta 480 gatttagacg cggaaggcaa acacgtacct ctggacgcgc ttgagcgtat tcatcgtcat 540 aaaaccggcg cattgattcg cgccgccgtt cgccttggtg cattaagcgc cggagataaa 600 ggacgtcgtg ctctgccggt actcgacaag tatgcagaga gcatcggcct tgccttccag 660 gttcaggatg acatcctgga tgtggtggga gatactgcaa cgttgggaaa acgccagggt 720 gccgaccagc aacttggtaa aagtacctac cctgcacttc tgggtcttga gcaagcccgg 780 aagaaagccc gggatctgat cgacgatgcc cgtcagtcgc tgaaacaact ggctgaacag 840 tcactcgata cctcggcact ggaagcgcta gcggactaca tcatccagcg taataaataa 900 <210> 14 <211> 906 <212> DNA <213> Artificial Sequence <400> 14 atggtgagct gcagcgcgcc gggcaaaatt tatctgtttg gcgaacatgc ggtggtgtat 60 ggcgaaaccg cgattgcgtg cgcggtggaa ctgcgcaccc gcgtgcgcgc ggaactgaac 120 gatagcatta ccattcagag ccagattggc cgcaccggcc tggattttga aaaacatccg 180 tatgtgagcg cggtgattga aaaaatgcgc aaaagcattc cgattaacgg cgtgtttctg 240 accgtggata gcgatattcc ggtgggcagc ggcctgggca gcagcgcggc ggtgaccatt 300 gcgagcattg gcgcgctgaa cgaactgttt ggctttggcc tgagcctgca ggaaattgcg 360 aaactgggcc atgaaattga aattaaagtg cagggcgcgg cgagcccgac cgatacctat 420 gtgagcacct ttggcggcgt ggtgaccatt ccggaacgcc gcaaactgaa aaccccggat 480 tgcggcattg tgattggcga taccggcgtg tttagcagca ccaaagaact ggtggcgaac 540 tgcggcattg tgattggcga taccggcgtg tttagcagca ccaaagaact ggtggcgaac 540 gtgcgccagc tgcgcgaaag ctatccggat ctgattgaac cgctgatgac cagcattggc 600 gtgcgccagc tgcgcgaaag ctatccggat ctgattgaac cgctgatgac cagcattggc 600 aaaattagcc gcattggcga acagctggtg ctgagcggcg attatgcgag cattggccgc 660 aaaattagcc gcattggcga acagctggtg ctgagcggcg attatgcgag cattggccgc 660 ctgatgaacg tgaaccaggg cctgctggat gcgctgggcg tgaacattct ggaactgagc 720 ctgatgaacg tgaaccaggg cctgctggat gcgctgggcg tgaacattct ggaactgagc 720 cagctgattt atagcgcgcg cgcggcgggc gcgtttggcg cgaaaattac cggcgcgggc 780 cagctgattt atagcgcgcg cgcggcgggc gcgtttggcg cgaaaattac cggcgcgggc 780 ggcggcggct gcatggtggc gctgaccgcg ccggaaaaat gcaaccaggt ggcggaagcg 840 ggcggcggct gcatggtggc gctgaccgcg ccggaaaaat gcaaccaggt ggcggaagcg 840 gtggcgggcg cgggcggcaa agtgaccatt accaaaccga ccgaacaggg cctgaaagtg 900 gtggcgggcg cgggcggcaa agtgaccatt accaaaccga ccgaacaggg cctgaaagtg 900 gattaa 906 gattaa 906 <210> 15<210> 15 <211> 954<211> 954 <212> DNA<212> DNA <213> 人工序列<213> Artificial sequence <400> 15<400> 15 atggatagag agcctgtaac agtacgttcc tacgcaaata ttgctattat caaatattgg 60 atggatagag agcctgtaac agtacgttcc tacgcaaata ttgctattat caaatattgg 60 ggaaagaaaa aagaaaaaga gatggtgcct gctactagca gtatttctct aactttggaa 120 ggaaagaaaa aagaaaaaga gatggtgcct gctactagca gtatttctct aactttggaa 120 aatatgtata cagagacgac cttgtcgcct ttaccagcca atgtaacagc tgacgaattt 180 aatatgtata cagagacgac cttgtcgcct ttaccagcca atgtaacagc tgacgaattt 180 tacatcaatg gtcagctaca aaatgaggtc gagcatgcca agatgagtaa gattattgac 240 cgttatcgtc cagctggtga gggctttgtc cgtatcgata ctcaaaacaa tatgcctact 300 gcagcgggcc tgtcctcaag ttctgtgt tgtccgccc tggtcaggc tgtaatgct 360 tattcaagc ttggattgga tattcag ttggcacagg aagccaaatt tgcctcaggc 420 tcttctctc ggagtttta tggaccacta ggagcctggg ataggatag tggaaatt 480 taccctgtag agacagactt gaaactagct atgattgt tggtgctaga ggacaagaaa 540 aaaccaatct ctagccgtga cgggatgaaa ctttgtgtgg aaacctcgac gacttttgac 600 gactgggttc gtcagtctga gaggactt caggaatgc tgatttact gaggaaat 660 gattttgcca agattggaga attaacggag aaaaatgccc tggctatgca tgctacgaca 720 aagactgcta gtccagcctt ttctctg acggatgcct cttatgaggc tatggacttt 780 gttcgccagc ttcgtgagaa aggagaggcc tgctacttta ccatggatgc tggtcccaat 840 gttaaggtct tctgtcagga gaagacttg gagcatttat cagaaatttt cggtcatcgt 900 tatcgcttga ttgtgtcaaa aacaaaggat ttgagtcaag atgattgctg ttaa 954 <210> 16 <211> 1008 <212> DNA <213> Artificial Sequence <400> 16 atgattgctg ttaaaacttg cggaaaactc tattgggcag gtgaatatgc tattttagag 60 ccagggcagt tagctttgat aaaggatatt cccatctata tgagggctga gattgctttt 120 tctgacagct accgtatcta ttcagatatg tttgatttcg cagtggactt aaggcctaat 180 cctgactaca gcttgattca agaaacgatt gctttgatgg gagacttcct cgctgttcgt 240 ggtcagaatt taagaccttt ttctctagaa atctgtggca aaatggaacg agaagggaaa 300 aagtttggtc taggttctag tggcagcgtc gttgtcttgg ttgtcaaggc tttactggct 360 ctgtatgatg tttctgttga tcaggagctc ttgttcaagc tgactagcgc tgtcttgctc 420 aagcgaggag acaatggttc catgggcgac cttgcctgta ttgtggcaga ggatttggtt 480 ctctaccagt catttgatcg ccagaaggtg gctgcttggt tagaagaaga aaacttggcg 540 acagttctgg agcgtgattg gggcttttca atttcacaag tgaaaccaac tttagaatgt 600 gatttcttag tgggatggac caaggaagtg gctgtatcga gtcacatggt ccagcaaatc 660 aagcaaaata tcaatcaaaa ttttttaagt tcctcaaaag aaacggtggt ttctttggtc 720 gaagccttgg aacaggggaa atcagaaaag attatcgagc aagtagaagt agccagcaag 780 cttttagaag gcttgagtac agatatttac acgcctttgc ttagacagtt gaaagaagcc 840 agtcaagatt tgcaggccgt tgccaagagt agtggtgctg gtggtggtga ctgtggcatc 900 gccctgagtt ttgatgcgca atcaaccaaa accttaaaaa atcgttgggc cgatctgggg 960 attgagctct tatatcaaga aaggatagga catgacgaca aatcgtaa 1008 <210> 17 <211> 549 <212> DNA <213> Artificial Sequence <400> 17 atgcaaacgg aacacgtcat tttattgaat gcacagggag ttcccacggg tacgctggaa 60 aagtatgccg cacacacggc agacacccgc ttacatctcg cgttctccag ttggctgttt 120 aatgccaaag gacaattatt agttacccgc cgcgcactga gcaaaaaagc atggcctggc 180 gtgtggacta actcggtttg tgggcaccca caactgggag aaagcaacga agacgcagtg 240 atccgccgtt gccgttatga gcttggcgtg gaaattacgc ctcctgaatc tatctatcct 300 gactttcgct accgcgccac cgatccgagt ggcattgtgg aaaatgaagt gtgtccggta 360 tttgccgcac gcaccactag tgcgttacag atcaatgatg atgaagtgat ggattatcaa 420 tggtgtgatt tagcagatgt attacacggt attgatgcca cgccgtgggc gttcagtccg 480 tggatggtga tgcaggcgac aaatcgcgaa gccagaaaac gattatctgc atttacccag 540 cttaaataa 549 <210> 18 <211> 1152 <212> DNA <213> Artificial Sequence <400> 18 atgacaattg ggattgataa aattagtttt tttgtgcccc cttattatat tgatatgacg 60 gcactggctg aagccagaaa tgtagaccct ggaaaatttc atattggtat tgggcaagac 120 caaatggcgg tgaacccaat cagccaagat attgtgacat ttgcagccaa tgccgcagaa 180 gcgatcttga ccaaagaaga taaagaggcc attgatatgg tgattgtcgg gactgagtcc 240 agtatcgatg agtcaaaagc ggccgcagtt gtcttacatc gtttaatggg gattcaacct 300 ttcgctcgct ctttcgaat caggaagct tgttacggag caacgcagg cttacagtta 360 gctaagaatc acgtagcctt acatccagat aaaaaagtct tggtcgtagc agcagatatt 420 gcaaataatg gcttaaattc tggcggtgag cctacacaag gagctggggc ggttgcaatg 480 ttagttgcta gtgaaccgcg cattttggct ttaaaagagg ataatgtgat gctgacgcaa 540 gatatctatg acttttggcg tccacaggc catccatatc ctatggtcga tggtccttg 600 tcaacgaaa cctacatcca atctttgcc caagtctggg atgaactaa aaaacgaacc 660 ggtcttgatt ttgcagatta tgatgcttta gcgttccata ttccttacac aaaaatgggc 720 aaaaaagccct tattagcaa aatctccgac caacgag caghacagga acgaattttta 780 gcccgttatg aagaaagcat catctatagt cgtcgcgtag gaacttgta tacggttca 840 ctttatctgg gactcattc ccttttagaa aatgcaacga ctttaacccc aggcaatcaa 900 attgggttat tcagttatgg tctggtgct gtcgctgaat tttcactgg tgaattagta 960 gctggttatc aaaatcattt aaaaagaa actcatttag cactgctgga taatcggaca 1020 gaactttcta tcgctgaata tgaagccatg tttgcagaaa ctttagacac agacattgat 1080 caaacgttaa aagatgaatt aaaatatagt atttctgcta ttaataatac cgttcgttct 1140 tatcgaaact aa 1152 <210> 19 <211> 2412 <212> DNA <213> Artificial sequence <400> 19 atgaaaacag tagttattat tgatgcatta cgaacaccaa ttggaaaata taaaggcagc 60 ttaagtcaag taagtgccgt agacttagga acacatgtta caacacaact tttaaaaaga 120 cattccacta tttctgaaga aattgatcaa gtaatctttg gaaatgtttt acaagctgga 180 aatggccaaa atcccgcacg acaaatagca ataaacagcg gtttatctca tgaaattccc 240 gcaatgacag ttaatgaggt ctgcggatca ggaatgaagg ccgttatttt ggcgaaacaa 300 ttgattcaat taggagaagc ggaagtttta attgctggcg ggattgagaa tatgtcccaa 360 gcacctaaat tacaacgatt taattacgaa acagaaagct atgatgcgcc tttttctagt 420 atgatgtacg atgggttaac ggatgccttt agtggtcaag caatgggctt aactgctgaa 480 aatgtggccg aaaagtatca tgtaactaga gaagagcaag atcaattttc tgtacattca 540 caattaaaag cagctcaagc acaagcagaa gggatattcg ctgacgaaat agccccatta 600 gaagtatcag gaacgcttgt ggagaaagat gaagggattc gccctaattc gagcgttgag 660 aagctaggaa cgcttaaaac agtttttaaa gaagacggta ctgtaacagc agggaatgca 720 tcaaccatta atgatggggc ttctgctttg attattgctt cacaagaata tgccgaagca 780 cacggtcttc cttatttagc tattattcga gacagtgtgg aagtcggtat tgatccagcc 840 tatatgggaa ttcgccgat taaagccatt caaaaactgt tagcgcgcaa tcaacttact 900 acggaagaaa ttgatctgta tgaaatcaac gaagcatttg cagcaacttc aatcgtggtc 960 caaagagaac tggctttacc agaggaaaag gtcaacattt atggtggcgg tatttcatta 1020 ggtcatgcga ttggtgccac aggtgctcgt ttattaacga gtttaagtta tcaattaaat 1080 caaaaagaaa agaaattgg agtggcttct tttgtatcg gcggtggctt aggactcgct 1140 atgctactag agagacctca gcaaaaaaaa aacagccgat tttatcaaat gagtcctgag 1200 gaacgcctgg cttctctctct taatgaggc cagatttctg ctgatacaa aaagaattt 1260 gaaaatacgg ctttatctc gcagattgcc aatcatatga ttgaaatca atcagtgaa 1320 acagaagtgc cgatgggcgt tggcttacat ttacagtgg acgaactga ttatttgta 1380 ccaatggcga cagaagagcc ctcagtgatt gcggctttga gtaatggtgc aaaatagca 1440 caggaattta aacagtgaa tcaacgt ttaatgcgtg cagaatcgt ttttacgat 1500 gttgcagacg ccgagtcatt gattgaa ctacaagtaa gagaacgga atttttca 1560 caagcagagt tagttatcc atctatcgtt aaacgcggcg gcggcttaag agatttgca 1620 tatcgtgctt ttgatgaatc atttgtatct gtcgactttt tagtagatgt taaggatgca 1680 atgggggcaa atatcgttaa cgctatgttg gaagtgtgg ccgagttgtt ccgtgaatgg 1740 tttgcggagc aaagatttt attcagttatt ttaagtatt atgccacgga gtcggttgtt 1800 acgatgaaaa cggctattcc agttcacgt ttaagtagg ggagcaatgg ccgggaatt 1860 gctgaaaaaa ttgtttagc gctcattag atccttatcg gctcagtcacg 1920 cataacaaag ggatcatgaa tggcattgaa gctgtcgttt tagctacagg aaatgataca 1980 cgcgctgtta gcgcttcttg tcatgctttt gcggtgaagg aaggtcgcta ccaaggtttg 2040 actagttgga cgctggatgg cgaacaacta attggtgaaa tttcagttcc gcttgcgtta 2100 gccacggttg gcggtgccac aaaagtctta cctaaatctc aagcagctgc tgatttgtta 2160 gcagtgacgg atgcaaaaga actaagtcga gtagtagcgg ctgttggttt ggcacaaaat 2220 ttagcggcgt tacgggcctt agtctctgaa ggaattcaaa aaggacacat ggctctacaa 2280 gcacgttctt tagcgatgac ggtcggagct actggtaaag aagttgaggc agtcgctcaa 2340 caattaaaac gtcaaaaaac gatgaaccaa gaccgagcct tggctatttt aaatgattta 2400 agaaaacaat aa 2412 <210> 20 <211> 879 <212> DNA <213> Artificial Sequence <400> 20 atgacaaaaa aagttggtgt cggtcaggca catagtaaga taattttaat aggggaacat 60 gcggtcgttt acggttatcc tgccatttcc ctgcctcttt tggaggtgga ggtgacctgt 120 aaggtagttc ctgcagagag tccttggcgc ctttatgagg aggatacctt gtccatggcg 180 gtttatgcct cactggagta tttggatatc acagaagcct gcattcgttg tgagattgac tcggctatcc ctgagaaacg ggggatgggt tcgtcagcgg ctatcagcat agcggccatt 300. cgtgcggtat ttgactacta tcaggctgat ctgcctcatg atgtactaga aatcttggtc 360 aatcgagctg aaatgattgc ccatatgaat cctagtggtt tggatgctaa gacctgtctc agtgaccaac ctattcgctt tatcaagac gtaggattta cagaacttga gatggattta tccgcctatt tggtgattgc cgatacgggt gtttatggtc atactcgtga agccatccaa 540 gtggttcaaa ataagggcaa ggatgcccta ccgtttttgc atgccttggg agaatttaacc cagcaagcag aagttgcgat ttcacaaaaa gatgctgaag gactgggaca aatcctcagt caagcgcatt tacatttaaa agaaattgga gtcagtagcc ctgaggcaga ctttttggtt gaaacgactc ttagccatgg tgctctgggt gccaagatga gcggtggtgg gctaggaggt 780 tgtatcatag ccttggtac caatttgaca cacgcacaag aactagcaga aagattagaa gagaaaggag ctgttcagac atggatagag agcctgtaa 879 <210> twenty one <211> 49 <212> DNA <213> Artificial sequence <400> twenty one atttcacaca ggaaacagct ggttaaacca tgagcacact gagcgtcag 49 <210> twenty two <211> 62 <212> DNA <213> Artificial sequence <400> twenty two agttgctgcg gaaagtccat tttccgtaac ctccttggat ccttagacta tcatcggatg 60 ta 62 <210> twenty three <211> 62 <212> DNA <213> Artificial sequence <400> twenty three tacatccgat gatagtctaa ggatccaagg aggttacgga aaatggactt tccgcagcaa 60 ct 62 <210> twenty four <211> 40 <212> DNA <213> Artificial sequence <400> twenty four aactcacatt acaggtcgac ttatttatta cgctggatga 40 <210> 25 <211> 20 <212> DNA <213> Artificial sequence <400> 25 actggccgtc gttttacaac 20 <210> 26 <211> 20 <212> DNA <213> Artificial sequence <400> 26 agctgtttcc tgtgtgaaat 20 <210> 27 <211> 40 <212> DNA <213> Artificial sequence <400> 27 tcatccagcg taataaataa gtcgacctgt aatgtgagtt 40 <210> 28 <211> 52 <212> DNA <213> Artificial sequence <400> 28 ataataacta ctgttttcat ctaaatgctc ctttatttaa gctgggtaaa tg 52 <210> 29 <211> 52 <212> DNA <213> Artificial sequence <400> 29 catttaccca gcttaaataa aggagcattt agatgaaaac agtagttatt at 52 <210> 30 <211> 40 <212> DNA <213> Artificial sequence <400> 30 gttgtaaaac gacggccagt ttagtttcga taagaacgaa 40 <210> 31 <211> 20 <212> DNA <213> Artificial sequence <400> 31 actggccgtc gttttacaac 20 <210> 32 <211> 20 <212> DNA <213> Artificial sequence <400> 32 ttatttaagc tgggtaaatg 20 <210> 33 <211> 40 <212> DNA <213> Artificial sequence <400> 33 tttcacacag gaaacagacc atgacaaaaa aagttggtgt 40 <210> 34 <211> 40 <212> DNA <213> Artificial sequence <400> 34 atttgcgtag gaacgtactg ttacaggctc tctatccatg 40 <210> 35 <211> 40 <212> DNA <213> Artificial sequence <400> 35 catggataga gagcctgtaa cagtacgttc ctacgcaaat 40 <210> 36 <211> 40 <212> DNA <213> Artificial sequence <400> 36 aaaacagcca agcttgcatg ttatttaagc tgggtaaatg 40 <210> 37 <211> 20 <212> DNA <213> Artificial sequence <400> 37 catgcaagct tggctgtttt 20 <210> 38 <211> 20 <212> DNA <213> Artificial sequence <400> 38 ggtctgtttc ctgtgtgaaa 20 <210> 39 <211> 38 <212> DNA <213> Artificial sequence <400> 39 tggcgtcgtc gtcgttggga ctatcatcgg atgtacaa 38 <210> 40 <211> 41 <212> DNA <213> Artificial sequence <400> 40 tgatgatgat cctcctcctc cgactatcat cggatgtaca a 41 <210> 41 <211> 40 <212> DNA <213> Artificial sequence <400> 41 ggaaagtcga ttcctcctcc gactatcatc ggatgtacaa 40 <210> 42 <211> 40 <212> DNA <213> Artificial sequence <400> 42 ggaaagtctc ctccgattcc gactatcatc ggatgtacaa 40 <210> 43 <211> 40 <212> DNA <213> Artificial sequence <400> 43 ggaaagtctc cgattcctcc gactatcatc ggatgtacaa 40 <210> 44 <211> 38 <212> DNA <213> Artificial sequence <400> 44 38. snow snow snow snow snow snow snow snow <210> 45 <211> 41 <212> DNA <213> The snowstorm <400> 45 ggaggaggag gatcatcatc agactttccg cagcaactcg a <210> 46 <211> 40 <212> DNA <213> The snowstorm <400> 46 tgatagtcgg together gactttccgc together <210> 47 <211> 40 <212> DNA <213> The snowstorm <400> 47 tgatagtcgg rich gactttccgc rich <210> 48 <211> 40 <212> DNA <213> The snowstorm <400> 48 tgatagtcgg between gactttccgc between <210> 49 <211> 2644 <212> DNA <213> The snowstorm <400> 49 ggttaaacca tgagcacact gagcgtcagc accccgagct ttagcagcag ccctctgtcg agcgtgaata agaacagcac caagcagcat gtcactcgta acagcgtgat ctttcacgac tcgatttgg gggaccagtt cctggaatac aaagagaaat tcaacgttgc aaccgagaaa 180 cagcttatag aagagctgaa agaagaagtg cgtaacgaac tgatgattcg tgcatgtaat 240 gaagcgagcc ggtatatcaa actgatccag ctgatcgatg ttgttgaacg tctggggctg 300 gcctatcatt ttgaaaaaga gattgaggaa agcctccagc atatatatgt gacgtatggt 360 cataaatgga cgaattacaa caatattgag agcctgagtc tgtggttccg cctgcttcgt 420 caaaatggct ttaatgttag ctcggatata tttgaaaatc acattgatga gaaaggaaat 480 tttcaggaga gcctgtgcaa tgatccgcag gggatgctgg cgctgtatga agcggcatat 540 atgcgtgttg aggagagat cattctggac aaagcactcg aatttaccaa gctgcatctg 600 gggatcatta gcaatgatcc tagctgtgat agcagcctac gtacggaaat caagcaggca 660 ctgaaacagc cactgcgccg gcggctgcca aggctgggaag ccgttcgtta cattgccatt 720 tatcagcaga aggcgagcca tagcgaggtt ctgctgaagc tggccaaact ggacttcaac 780 gttctgcagg aaatgcacaa agacgaattg agccaaatat gcaaatggtg gaaagatctg 840 gatatacgta acaaactgcc ctatgttcgt gatcgtctga ttgaaggcta ttttggatt 900 ctgggtattt atttcgaacc gcaacactcc cgtacccgta tgttcctgat gaaaacctgt 960 atgtggctga tcgtgctgga cgatacgtttt gataattacg gcacctatga agagttagag 1020 atctttaccc aagcagtcga acgttggagc attackcttgtc tggatgact gccagagtat 1080 atgaagctga tatatcacga gcaatttcgc gtgcatcagg aaatggagga aagcctggaa 1140 aaggagggta aggcctacca gattcattat atcaagaaa tggccaaaga aggtactcgt 1200 tcgctgctgc tggaagcgaa atggctgaag gaagctata tgcctaccct ggatgagtac 1260 ctgagcaaca gcctggtcac ctgcggctat gcactgatga ccgcacgcag ctacgttgcc 1320 cgtgacgacg gcattgttac cgaagatgca ttcaatggg ttgcaacgca cccgccgatt 1380 gttaaagcag catgcaaat tctgcgcctg atggacgaca ttgcaaccca taaagaggaa 1440 caggagcgggg gacattgc aagtagcatt gagtgttaca gggaggac cggagctagc 1500 gagaggagg cttgcatgga ctttctgaag caggttgaag atggttgga agttattaat 1560 caagaaagcc tgatgccgac cgatgttccg ttccctctgc tgattccggc aattaacctg 1620 gcacgtgtga gcgacaccct gtacaaagac aacgatggtt ataatcatgc cgataaagag 1680 gttataggtt atattaaaag cctgtttgta catccgatga tagtctaaaa ggaggttacg 1740 gaaaatggac tttccgcagc aactcgaagc ctgcgttaag caggccaacc aggcgctgag 1800 ccgttttatc gccccactgc cctttcagaa cactcccgtg gtcgaaacca tgcagtatgg 1860 cgcattatta ggtggtaagc gcctgcgacc tttcctggtt tatgccaccg gtcatatgtt 1920 cggcgttagc acaaacacgc tggacgcacc cgctgccgcc gttgagtgta tccacgctta 1980 ctcattaatt catgatgatt taccggcaat ggatgatgac gatctgcgtc gcggtttgcc 2040 aacctgccat gtgaagtttg gcgaagcaaa cgcgattctc gctggcgacg cttacaaac 2100 gctggcgtc tcgattttaa gcgatgccga tatgccggaa gtgtcggacc gcgacagaat 2160 ttcgatgatt tctgaactgg cgagcgccag tggtattgcc ggaatgtgcg gtggtcaggc 2220 attagatta gacgcggaag gcaaacacgt acctctggac gcgcttgagc gtattcatcg 2280 tcataaaacc ggcgcattga ttcgcgccgc cgttcgcctt ggtgcattaa gcgccggaga 2340 taaaggacgt cgtgctctgc cggtactcga caagtatgca gagagcatcg gccttgcctt 2400 ccaggttcag gatgacatcc tggatgtggt gggagatact gcaacgttgg gaaaacgcca 2460 gggtgccgac cagcaacttg gtaaaagtac ctaccctgca cttctgggtc ttgagcaagc 2520 ccggaagaaa gcccgggatc tgatcgacga tgcccgtcag tcgctgaaac aactggctga 2580 acagtcactc gatacctcgg cactggaagc gctagcggac tacatcatcc agcgtaataa 2640 ataa 2644 <210> 50 <211> 7168 <212> DNA <213> Artificial Sequence <400> 50 taatgtgagt tagctcactc attaggcacc ccaggcttta cactttatgc ttccggctcg 60 tatgttgtgt ggaattgtga gcggataaca atttcacaca ggaaacagct atgaccatga 120 ttacgaattc gagctcggta cccggggatc catggtgagc tgcagcgcgc cgggcaaaat 180 ttatctgttt ggcgaacatg cggtggtgta tggcgaaacc gcgattgcgt gcgcggtgga 240 actgcgcacc cgcgtgcgcg cggaactgaa cgatagcatt accattcaga gccagattgg 300 ccgcaccggc ctggattttg aaaaacatcc gtatgtgagc gcggtgattg aaaaaatgcg 360 caaaagcatt ccgattaacg gcgtgtttct gaccgtggat agcgatattc cggtgggcag 420 cggcctgggc agcagcgcgg cggtgaccat tgcgagcatt ggcgcgctga acgaactgtt 480 tggctttggc ctgagcctgc aggaaattgc gaaactgggc catgaaattg aaattaaaagt 540 gcagggcgcg gcgagcccga ccgataccta tgtgagcacc tttggcggcg tggtgaccat 600 tccggaacgc cgcaaactga aaaccccgga ttgcggcatt gtgattggcg atacggcgt 660 gtttagcagc accaaagaac tggtggcgaa cgtgcgccag ctgcgcgaaa gctatccgga 720 tctgattgaa ccgctgatga ccagcattgg caaaattagc cgcattggcg aacagctggt 780 gctgagcggc gattatgcga gcattggccg cctgatgaac gtgaaccagg gcctgctgga 840 tgcgctgggc gtgaacattc tggaactgag ccagctgatt tatagcgcgc gcgcggcggg 900 cgcgtttggc gcgaaaatta ccggcgcggg cggcggcggc tgcatggtgg cgctgaccgc 960 gccggaaaaa tgcaaccagg tggcggaagc ggtggcgggc gcgggcggca aagtgaccat 1020 1080. taccaaaccg accgaacagg gcctgaaagt ggattaaatg gatagagagc ctgtaacagt acgttcctac gcaaatattg ctattatcaa atattgggga aagaaaaaag aaaaaagagat ggtgcctgct actagcagta tttctctaac tttggaaaat atgtatacag agacgacctt gtcgccttta ccagccaatg taacagctga cgaatttc atcaatggtc agctacaaaa tgaggtcgag catgccaaga tgagtaagat tattgaccgt tatcgtccag ctggtgaggg ctttgtccgt atcgatactc aaaacaatat gcctactgca gcggggcctgt cctcaagttc 1380. tagtggtttg tccgccctgg tcaaggcttg taatgcttat ttcaagcttg gattggatag aagtcagttg gcacaggaag ccaaatttgc ctcaggctct tcttctcgga gtttttatgg accactagga gcctgggata aggatagtgg agaaatttac cctgtagga cagacttga actagctatg attatgttgg tgctagagga caagaaaaa ccaatctcta gccgtgacgg gatgaaactt tgtgtggaaa cctcgacgac ttttgacgac tgggttcgtc agtctgagaa ggactatcag gatatgctga tttatctcaa ggaaaatgat tttgccaaga ttggagaatt 1740 aacggagaaa aatgccctgg ctatgcatgc tacgacaaag actgctagtc cagccttttc 1800 ttatctgacg gatgcctctt atgaggctat ggactttgtt cgccagcttc gtgagaaagg 1860 agaggcctgc tactttacca tggatgctgg tcccaatgtt aaggtcttct gtcaggagaa 1920 agacttggag catttatcag aaattttcgg tcatcgttat cgcttgattg tgtcaaaaac 1980 aaaggatttg agtcaagatg attgctgtta aatgattgct gttaaaactt gcggaaaact 2040 ctattgggca ggtgaatatg ctattttaga gccagggcag ttagctttga taaaggatat 2100 tcccatctat atgagggctg agattgcttt ttctgacagc taccgtatct attcagatat 2160 gtttgatttc gcagtggact taaggcctaa tcctgactac agcttgattc aagaaacgat 2220 tgctttgatg ggagacttcc tcgctgttcg tggtcagaat ttaagacctt tttctctaga 2280 aatctgtggc aaaatggaac gagaagggaa aaagtttggt ctaggttcta gtggcagcgt 2340 cgttgtcttg gttgtcaagg ctttactggc tctgtatgat gtttctgttg atcaggagct 2400 cttgttcaag ctgactagcg ctgtcttgct caagcgagga gacaatggtt ccatgggcga 2460 ccttgcctgt attgtggcag aggatttggt tctctaccag tcatttgatc gccagaaggt 2520 ggctgcttgg ttagaagaag aaaacttggc gacagttctg gagcgtgatt ggggctttc 2580 aatttcacaa gtgaaaccaa ctttagaatg tgatttctta gtgggatgga ccaaggaagt 2640 ggctgtatcg agtcacatgg tccagcaaat caagcaaaat atcaatcaaa atttttaag 2700 ttcctcaaaa gaaacggtgg tttctttggt cgaagccttg gaacagggga aatcagaaaa 2760 gattatcgag caagtagaag tagccagcaa gcttttagaa ggcttgagta cagatattta 2820 cacgccttg cttagacagt tgaaagaagc cagtcaagat ttgcaggccg ttgccaagag 2880 tagtggtgct ggtggtggtg actgtggcat cgccctgagt tttgatgcgc aatcaaccaa 2940 aaccttaaaa aatcgttggg ccgatctggg gattgagctc ttatatcaag aaaggatagg 3000 acatgacgac aaatcgtaaa ggagagaaat tatgcaaacg gaacacgtca ttttattgaa 3060 tgcacaggga gttcccacgg gtacgctgga aaagtatgcc gcacacacgg cagacacccg 3120 cttacatctc gcgttctcca gttggctgtt taatgccaaa ggacaattat tagttacccg 3180 ccgcgcactg agcaaaaaag catggcctgg cgtgtggact aactcggttt gtgggcaccc 3240 acaactggga gaaagcaacg aagacgcagt gatccgccgt tgccgttatg agcttggcgt 3300 ggaaattacg cctcctgaat ctatctatcc tgactttcgc taccgcgcca ccgatccgag 3360 tggcattgtg gaaaatgaag tgtgtccggt atttgccgca cgcaccacta gtgcgttaca 3420 gatcaatgat gatgaagtga tggattatca atggtgtgat ttagcagatg tattacacgg 3480 tattgatgcc acgccgtggg cgttcagtcc gtggatggtg atgcaggcga caaatcgcga 3540 agccagaaaa cgattatctg catttaccca gcttaataa aggagcattt agatgaaaac 3600 agtagttatt attgatgcat tacgaacacc aattggaaaa tataaaggca gcttaagtca 3660 agtaagtgcc gtagacttag gaacacatgt tacaacacaa cttttaaaaa gacattccac 3720 tatttctgaa gaaattgatc aagtaatctt tggaaatgtt ttacaagctg gaaatggcca 3780 aaatcccgca cgacaaatag caataaacag cggtttatct catgaaattc ccgcaatgac 3840 agttaatgag gtctgcggat caggaatgaa ggccgttatt ttggcgaaac aattgattca 3900 attaggagaa gcggaagttt taattgctgg cgggattgag aatatgtccc aagcacctaa 3960 attacaacga tttaattacg aaacagaaag ctatgatgcg cctttttcta gtatgatgta 4020 cgatgggtta acggatgcct ttagtggtca agcaatgggc ttaactgctg aaaatgtggc 4080 cgaaaagtat catgtaacta gagaagagca agatcaattt tctgtacatt cacaattaaa 4140 agcagctcaa gcacaagcag aagggatatt cgctgacgaa atagccccat tagaagtatc 4200 aggaacgctt gtggagaaag atgaagggat tcgccctaat tcgagcgttg agaagctagg 4260 aacgcttaaa acagttttta aagaagacgg tactgtaaca gcagggaatg catcaaccat 4320 taatgatggg gcttctgctt tgattattgc ttcacaagaa tatgccgaag cacacggtct 4380 tccttattta gctattattc gagacagtgt ggaagtcggt attgatccag cctatatggg 4440 aatttcgccg attaaagcca ttcaaaaact gttagcgcgc aatcaactta ctacggaaga 4500 aattgatctg tatgaaatca acgaagcatt tgcagcaact tcaatcgtgg tccaaagaga 4560 actggcttta ccagaggaaa aggtcaacat ttatggtggc ggtatttcat taggtcatgc 4620 gattggtgcc acaggtgctc gtttattaac gagtttaagt tatcaattaa atcaaaaaga 4680 aaagaaatat ggagtggctt ctttatgtat cggcggtggc ttaggactcg ctatgctact 4740 agagagacct cagcaaaaaa aaaacagccg attttatcaa atgagtcctg aggaacgcct 4800 ggcttctctt cttaatgaag gccagatttc tgctgataca aaaaaagaat ttgaaaatac 4860 ggctttatct tcgcagattg ccaatcatat gattgaaaat caaatcagtg aaacagaagt 4920 gccgatgggc gttggcttac atttaacagt ggacgaaact gattatttgg taccaatggc 4980 gacagaagag ccctcagtga ttgcggcttt gagtaatggt gcaaaaatag cacaaggatt 5040 taaaacagtg aatcaacaac gtttaatgcg tggacaaatc gttttttacg atgttgcaga 5100 cgccgagtca ttgattgatg aactacaagt aagagaaacg gaaatttttc aacaagcaga 5160 gttaagttat ccatctatcg ttaaacgcgg cggcggctta agagatttgc aatatcgtgc 5220 ttttgatgaa tcatttgtat ctgtcgactt tttagtagat gttaaggatg caatgggggc 5280 aaatatcgtt aacgctatgt tggaaggtgt ggccgagttg ttccgtgaat ggtttgcgga 5340 gcaaaagatt ttatcagta ttttaagtaa ttatgccacg gagtcggttg ttacgatgaa 5400 aacggctatt ccagtttcac gtttaagtaa ggggagcaat ggccgggaaa ttgctgaaaa 5460 aattgtttta gcttcacgct atgcttcatt agatccttat cgggcagtca cgcataacaa 5520 agggatcatg aatggcattg aagctgtcgt tttagctaca ggaaatgata cacgcgctgt 5580 tagcgcttct tgtcatgctt ttgcggtgaa ggaaggtcgc taccaaggtt tgactagttg 5640 gacgctggat ggcgaacac taattggtga aatttcagtt ccgcttgcgt tagccacggt 5700 tggcggtgcc acaaaagtct tacctaaatc tcaagcagct gctgatttgt tagcagtgac 5760 ggatgcaaaa gaactaagtc gagtagtagc ggctgttggt ttggcacaaa atttagcggc 5820 gttacgggcc ttagtctctg aaaggaattca aaaaggacac atggctctac aagcacgttc 5880 5940 acgtcaaaaa acgatgaacc aagaccgagc cttggctatt ttaaatgatt taagaaaaca 6000 ataaaggaga aaccttatga caattgggat tgataaaatt agttttttg tgccccctta 6060 ttatattgat atgacggcac tggctgaagc cagaaatgta gaccctggaa aatttcatat 6120 tggtattggg caagaccaaa tggcggtgaa cccaatcagc caagatattg tgacatttgc 6180 agccaatgcc gcagaagcga tcttgaccaa agaagataaa gaggccattg atatggtgat 6240 tgtcgggact gagtccagta tcgatgagtc aaaagcggcc gcagttgtct tacatcgttt 6300 aatggggatt caacctttcg ctcgctcttt cgaaatcaag gaagcttgtt acggagcaac 6360 tgcaggctta cagttagcta agaatcacgt agccttacat ccagataaaa aagtcttggt 6420 cgtagcagca gatattgcaa aatatggctt aaattctggc ggtgagccta cacaaggagc 6480 tggggcggtt gcaatgttag ttgctagtga accgcgcatt ttggctttaa aagaggataa 6540 tgtgatgctg acgcaagata tctatgactt ttggcgtcca acaggccatc catatcctat 6600 ggtcgatggt cctttgtcaa acgaaaccta catccaatct tttgcccaag tctgggatga 6660 acataaaaaa cgaaccggtc ttgattttgc agattatgat gctttagcgt tccatattcc 6720 ttacacaaaa atgggcaaaa aagccttatt agcaaaaatc tccgaccaaa ctgaagcaga acaggacga attttagccc gttatgaga aagcatcatc tatagtcgtc gcgtaggaa cttgtatacg ggttcacttt atctgggact catttccctt ttagaaaatg caacgacttt aaccgcaggc aatcaaattg ggttattcag ttatggttct ggtgctgtcg ctgaattttt cactggtgaa ttagtagctg gttatcaaaa tcatttacaa aaagaaactc atttagcact gctggataat cggacagaac tttctatcgc tgaatgaa gccatgtttg cagaaacttt agacacagac attgatcaaa cgttaaaaga tgaattaaaa tatagtattt ctgctattaa taataccgtt cgttcttatc 7168 <210> 51 <211> 3402 <212> DNA <213> The snowstorm <400> 51 atgacaaaaa aagttggtgt cggtcaggca catagtaaga taattttaat aggggaacat gcggtcgttt acggttatcc tgccatttcc ctgcctcttt tggaggtgga ggtgacctgt 120 aaggtagttc ctgcagagag tccttggcgc ctttatgagg aggatacctt gtccatggcg 180 gtttatgcct cactggagta tttggatatc acagaagcct gcattcgttg tgagattgac 240 tcggctatcc ctgagaaacg ggggatgggt tcgtcagcgg ctatcagcat agcggccatt 300 cgtgcggtat ttgactacta tcaggctgat ctgcctcatg atgtactaga aatcttggtc 360 aatcgagctg aaatgattgc ccatatgaat cctagtggtt tggatgctaa gacctgtctc 420 agtgaccaac ctattcgctt tatcaagaac gtaggattta cagaacttga gatggattta 480 tccgcctatt tggtgattgc cgatacgggt gtttatggtc atactcgtga agccatccaa 540 gtggttcaaa ataagggcaa ggatgcccta ccgtttttgc atgccttggg agaattaacc 600 cagcaagcag aagttgcgat ttcacaaaaa gatgctgaag gactgggaca aatcctcagt 660 caagcgcatt tacatttaaa agaaattgga gtcagtagcc ctgaggcaga ctttttggtt 720 gaaacgactc ttagccatgg tgctctgggt gccaagatga gcggtggtgg gctaggaggt 780 tgtatcatag ccttggtaac caatttgaca cacgcacaag aactagcaga aagattagaa 840 gagaaaggag ctgttcagac atggatagag agcctgtaaa tggatagaga gcctgtaaca 900 gtacgttcct acgcaatat tgctattatc aaatattggg gaagaaaaa agaaaagag 960 atggtgcctg ctactagcag tattctcta actttggaa atatgtatac agagacgacc 1020 ttgtcgcctt taccagccaa tgtacagct gacgaatttt acatcaatgg tcagctacaa 1080 aatgaggtcg agcatgccaa gatgagtaag attattgacc gttatcgtcc agctggtgag 1140 ggctttgtcc gtatcgatac tcaacaat atgcctactg cagcgggcct gtcctcaagt 1200 tctagtggtt tgtccgccct gtcagct tgtaatgctt attcagct tgtcagct 1260 agaagtcagt tggcacagga agccaattt gctcaggct cttctctcg gagtttttat 1320 ggaccactag gagcctggga taggactt ggagaattt accctgtaga gagacttg 1380 aaactagcta tgattgtt ggtgctagag gatagaaa aaccaatctc tagccgtgac 1440 gggatgaaac ttgtgtgga aacctcgacg acttttgacg actggttcg tcagtctgag 1500 aaggactatc aggatatgct gatttatctc aaggaaatg attttgcca gattggagaa 1560 ttaacggaga aaatgccct ggctatgcat gctacgacaa agacctag tccagccttt 1620 tcttatctga cggatgcctc ttatgaggct atggactttg ttcgccagct tcgtgagaaa 1680 ggagaggcct gctactttac catggatgct ggtcccaatg ttaaggtctt ctgtcaggag 1740 aaagacttgg agcatttatc agaaattttc ggtcatcgtt atcgcttgat tgtgtcaaaa 1800 acaaaggatt tgagtcaaga tgattgctgt taaatgattg ctgttaaaac ttgcggaaaa 1860 ctctattggg caggtgaata tgctatttta gagccagggc agttagcttt gataaaggat 1920 attcccatct atatgagggc tgagattgct ttttctgaca gctaccgtat ctattcagat 1980 atgtttgatt tcgcagtgga cttaaggcct aatcctgact acagcttgat tcaagaaacg 2040 attgctttga tgggagactt cctcgctgtt cgtggtcaga atttaagacc tttttctcta 2100 gaaatctgtg gcaaaatgga acgagaaggg aaaaagtttg gtctaggttc tagtggcagc 2160 gtcgttgtct tggttgtcaa ggctttactg gctctgtatg atgtttctgt tgatcaggag 2220 ctcttgttca agctgactag cgctgtcttg ctcaagcgag gagacaatgg ttccatgggc 2280 gaccttgcct gtattgtggc agaggatttg gttctctacc agtcatttga tcgccagaag 2340 gtggctgctt ggttagaaga agaaaacttg gcgacagttc tggagcgtga tggggcttt 2400 tcaatttcac aagtgaacc aactttagaa tgtgatttct tagtggtg gaccaaggaa 2460 gtggctgtat cgagtcacat ggtccagcaa atcaagcaa atcaatca aaattttta 2520 agttcctca aagaaacggt gttctttg gtcgaagcct tggacaggg gaatcagaa 2580 aagattatcg agcaagtaga agtagccagc aaggctttag aaggcttgag tacagatatt 2640 tacacgcctt tgcttagaca gttgaaagaa gccagtcaag atttgcaggc cgttgccaag 2700 agtagtggtg ctggtggtgg tgactgtggc atcgccctga gttttgatgc gcaatcaacc 2760 aaaaccttaa aaatcgttg ggccgatctg gggattgagc tcttatatca agaaggata 2820 ggacatgacg acaatcgta aaggagaa attatgcaa cggaacacgt cattttattg 2880 aatgcacagg gagttcccac gggtacgctg gaaagtatg ccgcacac ggcagacacc 2940 cgcttacatc tcgcgttctc cagttggctg tttaatgcca aaggacatt attagttacc 3000 cgccgcgcac tgagcaaaa agcatggcct ggcgtgtgga ctaactcggt tgtgggcac 3060 ccacaactgg gagaaagcaa cgaagacgca gtgatccgcc gttgccgtta tgagcttggc 3120 gtggaaatta cgcctcctga atctatctat cctgactttc gctaccgcgc caccgatccg 3180 agtggcattg tggaaaatga agtgtgtccg gtatttgccg cacgcaccac tagtgcgtta 3240 cagatcaatg atgatgaagt gatggattat caatggtgtg atttagcaga tgtattacac 3300 ggtattgatg ccacgccgtg ggcgttcagt ccgtggatgg tgatgcaggc gacaaatcgc 3360 gaagccagaa aacgattatc tgcatttacc cagcttaaat aa 3402 <210> 52 <211> 2640 <212> DNA <213> Artificial Sequence <400> 52 ggttaaacca tgagcacact gagcgtcagc accccgagct ttagcagcag ccctctgtcg 60 agcgtgaata agaacagcac caagcagcat gtcactcgta acagcgtgat ctttcacgac 120 tcgatttggg gggaccagtt cctggaatac aaagagaaat tcaacgttgc aaccgagaaa 180 cagcttatag aagagctgaa agaagaagtg cgtaacgaac tgatgattcg tgcatgtaat 240 gaagcgagcc ggtatatcaa actgatccag ctgatcgatg ttgttgaacg tctggggctg 300 gcctatcatt ttgaaaaaga gattgaggaa agcctccagc atatatatgt gacgtatggt 360 cataaatgga cgaattacaa caatattgag agcctgagtc tgtggttccg cctgcttcgt 420 caaaatggct ttaatgttag ctcggatata tttgaaaatc acattgatga gaaaggaaat 480 tttcaggaga gcctgtgcaa tgatccgcag gggatgctgg cgctgtatga agcggcatat 540 atgcgtgttg aaggagagat cattctggac aaagcactcg aatttaccaa gctgcatctg 600 gggatcatta gcaatgatcc tagctgtgat agcagcctac gtacggaaat caagcaggca 660 ctgaaacagc cactgcgccg gcggctgcca aggctggaag ccgttcgtta cattgccatt 720 tatcagcaga aggcgagcca tagcgaggtt ctgctgaagc tggccaaact ggacttcaac 780 gttctgcagg aaatgcacaa agacgaattg agccaaatat gcaaatggtg gaaagatctg 840 gatatacgta acaaactgcc ctatgttcgt gatcgtctga ttgaaggcta tttttggatt 900 ctgggtattt atttcgaacc gcaacactcc cgtacccgta tgttcctgat gaaaacctgt 960 atgtggctga tcgtgctgga cgatacgttt gataattacg gcacctatga agagttagag 1020 atctttaccc aagcagtcga acgttggagc attacctgtc tggatgaact gccagagtat 1080 atgaagctga tatatcacga gcaatttcgc gtgcatcagg aaatggagga aagcctggaa 1140 aaggagggta aggcctacca gattcattat atcaaagaaa tggccaaaga aggtactcgt 1200 tcgctgctgc tggaagcgaa atggctgaag gaaggctata tgcctaccct ggatgagtac 1260 ctgagcaaca gcctggtcac ctgcggctat gcactgatga ccgcacgcag ctacgttgcc 1320 cgtgacgacg gcattgttac cgaagatgca ttcaaatggg ttgcaacgca cccgccgatt 1380 gttaaagcag catgcaaaat tctgcgcctg atggacgaca ttgcaaccca taaagaggaa 1440 caggagcggg gacacattgc aagtagcatt gagtgttaca ggaaggaaac cggagctagc 1500 gaagaggagg cttgcatgga ctttctgaag caggttgaag atggttggaa agttattaat 1560 caagaaagcc tgatgccgac cgatgttccg ttccctctgc tgattccggc aattaacctg 1620 gcacgtgtga gcgacaccct gtacaaagac aacgatggtt ataatcatgc cgataaagag 1680 gttataggtt atattaaaag cctgtttgta catccgatga tagtcccaac gacgacgacg 1740 ccagactttc cgcagcaact cgaagcctgc gttaagcagg ccaaccaggc gctgagccgt 1800 tttatcgccc cactgccctt tcagaacact cccgtggtcg aaaccatgca gtatggcgca 1860 ttattaggtg gtaagcgcct gcgacctttc ctggtttatg ccaccggtca tatgttcggc 1920 gttagcacaa acacgctgga cgcacccgct gccgccgttg agtgtatcca cgcttactca 1980 ttaattcatg atgatttacc ggcaatggat gatgacgatc tgcgtcgcgg tttgccaacc 2040 tgccatgtga agtttggcga agcaaacgcg attctcgctg gcgacgcttt acaaacgctg 2100 gcgttctcga ttttaagcga tgccgatatg ccggaagtgt cggaccgcga cagaatttcg 2160 atgatttctg aactggcgag cgccagtggt attgccggaa tgtgcggtgg tcaggcatta 2220 gatttagacg cggaaggcaa acacgtacct ctggacgcgc ttgagcgtat tcatcgtcat 2280 aaaaccggcg cattgattcg cgccgccgtt cgccttggtg cattaagcgc cggagataaa 2340 ggacgtcgtg ctctgccggt actcgacaag tatgcagaga gcatcggcct tgccttccag 2400 gttcaggatg acatcctgga tgtggtggga gatactgcaa cgttgggaaa acgccagggt 2460 gccgaccagc aacttggtaa aagtacctac cctgcacttc tgggtcttga gcaagcccgg 2520 aagaaagccc gggatctgat cgacgatgcc cgtcagtcgc tgaaacaact ggctgaacag 2580 tcactcgata cctcggcact ggaagcgcta gcggactaca tcatccagcg taataaataa 2640 <210> 53 <211> 2643 <212> DNA <213> Artificial sequence <400> 53 ggttaaacca tgagcacact gagcgtcagc accccgagct ttagcagcag ccctctgtcg 60 agcgtgaata agaacagcac caagcagcat gtcactcgta acagcgtgat ctttcacgac 120 tcgatttggg gggaccagtt cctggaatac aaagagaaat tcaacgttgc aaccgagaaa 180 cagcttatag aagagctgaa agaagaagtg cgtaacgaac tgatgattcg tgcatgtaat 240 gaagcgagcc ggtatatcaa actgatccag ctgatcgatg ttgttgaacg tctggggctg 300 gcctatcatt ttgaaaaaga gattgaggaa agcctccagc atatatatgt gacgtatggt 360 cataaatgga cgaattacaa caatattgag agcctgagtc tgtggttccg cctgcttcgt 420 caaaatggct ttaatgttag ctcggatata tttgaaaatc acattgatga gaaaggaaat 480 tttcaggaga gcctgtgcaa tgatccgcag gggatgctgg cgctgtatga agcggcatat 540 atgcgtgttg aaggagat cattctggac aaagcactcg aatttaccaa gctgcatctg 600 gggatcatta gcaatgatcc tagctgtgat agcagcctac gtacggaaat caagcaggca 660 ctgaaacagc cactgcgccg gcggctgcca aggctggaag ccgttcgtta cattgccatt 720 tatcagcaga aggcgagcca tagcgaggtt ctgctgaagc tggccaaact ggacttcaac 780 840 gatatacgta acaaactgcc ctatgttcgt gatcgtctga ttgaaggcta tttttggatt 900 ctgggtattt atttcgaacc gcaacactcc cgtacccgta tgttcctgat gaaaacctgt 960 atgtggctga tcgtgctgga cgatacgttt gataattacg gcacctatga agagttagag 1020 atctttaccc aagcagtcga acgttggagc attacctgtc tggatgaact gccagagtat 1080 atgaagctga tatatcacga gcaattcgc gtgcatcagg aaatggagga aagcctggaa 1140 aaggggtta aggcctacca gattcattat atcaaagaaa tggccaaaga aggtactcgt 1200 tcgctgctgc tggaagcgaa atggctgaag gaaggctata tgcctaccct ggatgagtac 1260 ctgagcaaca gcctggtcac ctgcggctat gcactgatga ccgcacgcag ctacgttgcc 1320 cgtgacgacg gcattgttac cgaagatgca ttcaaatggg ttgcaacgca cccgccgatt 1380 gttaaagcag catgcaaaat tctgcgcctg atggacgaca ttgcaaccca taaagaggaa 1440 caggagcggg gacacattgc aagtagcatt gagtgttaca ggaaggaaac cggagctagc 1500 gaagaggagg cttgcatgga ctttctgaag caggttgaag atggttggaa agttattaat 1560 caagaaagcc tgatgccgac cgatgttccg ttccctctgc tgattccggc aattaacctg 1620 gcacgtgtga gcgacaccct gtacaaagac aacgatggtt ataatcatgc cgataaagag 1680 gttataggtt atattaaaag cctgtttgta catccgatga tagtcggagg aggaggatca 1740 tcatcagact ttccgcagca actcgaagcc tgcgttaagc aggccaacca ggcgctgagc 1800 cgttttatcg ccccactgcc ctttcagaac actcccgtgg tcgaaaccat gcagtatggc 1860 gcattattag gtggtaagcg cctgcgacct ttcctggttt atgccaccgg tcatatgttc 1920 ggcgttagca caaacacgct ggacgcaccc gctgccgccg ttgagtgtat ccacgcttac tcattaattc atgatgattt accggcaatg gatgatgacg atctgcgtcg cggtttgcca acctgccatg tgaagtttgg cgaagcaaac gcgattctcg ctggcgacgc tttacaaacg ctggcgttct cgattttaag cgatgccgat atgccggaag tgtcggaccg cgacagaatt tcgatgattt ctgaactggc gagcgccagt ggtattgccg gaatgtgcgg tggtcaggca 2220 ttagatttag acgcggaagg caaacacgta cctctggacg cgcttgagcg tattcatcgt cataaaaccg gcgcattgat tcgcgccgcc gttcgccttg gtgcattaag cgccggagat 2340 aaaggacgtc gtgctctgcc ggtactcgac aagtatgcag agagcatcgg ccttgccttc caggttcagg atgacatcct ggatgtggtg ggagatactg caacgttggg aaaacgccag 2460 ggtgccgacc agcaacttgg taaaagtacc taccctgcac ttctgggtct tgagcaagcc cggaagaaag cccgggatct gatcgacgat gcccgtcagt cgctgaaaca actggctgaa cagtcactcg atacctcggc actggaagcg ctagcggact acatcatcca gcgtaataaa taa 2643 <210> 54 <211> 2634 <212> DNA <213> Artificial sequence <400> 54 ggttaaacca tgagcacact gagcgtcagc accccgagct ttagcagcag ccctctgtcg 60 agcgtgaata agaacagcac caagcagcat gtcactcgta acagcgtgat ctttcacgac 120 tcgatttggg gggaccagtt cctggaatac aaagagaaat tcaacgttgc aaccgagaaa 180 cagcttatag aagagctgaa agaagaagtg cgtaacgaac tgatgattcg tgcatgtaat 240 gaagcgagcc ggtatatcaa actgatccag ctgatcgatg ttgttgaacg tctggggctg 300 gcctatcatt ttgaaaaaga gattgaggaa agcctccagc atatatatgt gacgtatggt 360 cataaatgga cgaattacaa caatattgag agcctgagtc tgtggttccg cctgcttcgt 420 caaaatggct ttaatgttag ctcggatata tttgaaaatc acattgatga gaaaggaaat 480 tttcaggaga gcctgtgcaa tgatccgcag gggatgctgg cgctgtatga agcggcatat 540 atgcgtgttg aaggagagat cattctggac aaagcactcg aatttaccaa gctgcatctg 600 gggatcatta gcaatgatcc tagctgtgat agcagcctac gtacggaaat caagcaggca 660 ctgaaacagc cactgcgccg gcggctgcca aggctggaag ccgttcgtta cattgccatt 720 tatcagcaga aggcgagcca tagcgaggtt ctgctgaagc tggccaaact ggacttcaac 780 gttctgcagg aaatgcacaa agacgaattg agccaaatat gcaaatggtg gaaagatctg 840 gatatacgta acaaactgcc ctatgttcgt gatcgtctga ttgaaggcta tttttggatt 900 ctgggtattt atttcgaacc gcaacactcc cgtacccgta tgttcctgat gaaaacctgt 960 atgtggctga tcgtgctgga cgatacgttt gataattacg gcacctatga agagttagag 1020 atctttaccc aagcagtcga acgttggagc attacctgtc tggatgaact gccagagtat 1080 atgaagctga tatatcacga gcaatttcgc gtgcatcagg aaatggagga aagcctggaa 1140 aaggagggta aggcctacca gattcattat atcaaagaaa tggccaaaga aggtactcgt 1200 tcgctgctgc tggaagcgaa atggctgaag gaaggctata tgcctaccct ggatgagtac 1260 ctgagcaaca gcctggtcac ctgcggctat gcactgatga ccgcacgcag ctacgttgcc 1320 cgtgacgacg gcattgttac cgaagatgca ttcaaatggg ttgcaacgca cccgccgatt 1380 gttaaagcag catgcaaaat tctgcgcctg atggacgaca ttgcaaccca taaagaggaa 1440 caggagcggg gacacattgc aagtagcatt gagtgttaca ggaaggaaac cggagctagc 1500 gaagaggagg cttgcatgga ctttctgaag caggttgaag atggttggaa agttattaat 1560 caagaaagcc tgatgccgac cgatgttccg ttccctctgc tgattccggc aattaacctg 1620 gcacgtgtga gcgacaccct gtacaaagac aacgatggtt ataatcatgc cgataaagag 1680 gttataggtt atattaaaag cctgtttgta catccgatga tagtcggagg aggaatcgac 1740 tttccgcagc aactcgaagc ctgcgttaag caggccaacc aggcgctgag ccgttttatc 1800 gccccactgc cctttcagaa cactcccgtg gtcgaaacca tgcagtatgg cgcattatta 1860 ggtggtaagc gcctgcgacc tttcctggtt tatgccaccg gtcatatgtt cggcgttagc 1920 acaaacgc tggacgcacc cgctgccgcc gttgagtgta tccacgctta ctcattaatt 1980 catgatgatt taccggcaat ggatgatgac gatctgcgtc gcggtttgcc aacctgccat 2040 gtgaagtttg gcgaagcaaa cgcgattctc gctggcgacg ctttacaaac gctggcgttc 2100 tcgattttaa gcgatgccga tatgccggaa gtgtcggacc gcgacagaat ttcgatgatt 2160 tctgaactgg cgagcgccag tggtattgcc ggaatgtgcg gtggtcaggc attagattta 2220 gacgcggaag gcaaacacgt acctctggac gcgcttgagc gtattcatcg tcataaaacc 2280 ggcgcattga ttcgcgccgc cgttcgcctt ggtgcattaa gcgccggaga taaaggacgt 2340 cgtgctctgc cggtactcga caagtatgca gagagcatcg gccttgcctt ccaggttcag 2400 gatgacatcc tggatgtggt gggagatact gcaacgttgg gaaaacgcca gggtgccgac 2460 cagcaacttg gtaaaagtac ctaccctgca cttctgggtc ttgagcaagc ccggaagaaa 2520 gcccgggatc tgatcgacga tgcccgtcag tcgctgaaac aactggctga acagtcactc 2580 gatacctcgg cactggaagc gctagcggac tacatcatcc agcgtaataa ataa 2634 <210> 55 <211> 2634 <212> DNA <213> Artificial Sequence <400> 55 ggttaaacca tgagcacact gagcgtcagc accccgagct ttagcagcag ccctctgtcg 60 agcgtgaata agaacagcac caagcagcat gtcactcgta acagcgtgat ctttcacgac 120 tcgatttgg gggaccagtt cctggaatac aaagagaaat tcaacgttgc aaccgagaaa 180 cagcttatag aagagctgaa agaagaagtg cgtaacgaac tgatgattcg tgcatgtaat 240 gaagcgagcc ggtatatcaa actgatccag ctgatcgatg ttgttgaacg tctggggctg 300 gcctatcatt ttgaaaaaga gattgaggaa agcctccagc atatatatgt gacgtatggt 360 cataaatgga cgaattacaa caatattgag agcctgagtc tgtggttccg cctgcttcgt 420 caaaatggct ttaatgttag ctcggatata tttgaaaatc acattgatga gaaaggaaat 480 tttcaggaga gcctgtgcaa tgatccgcag gggatgctgg cgctgtatga agcggcatat 540 atgcgtgttg aggagagat cattctggac aaagcactcg aatttaccaa gctgcatctg 600 gggatcatta gcaatgatcc tagctgtgat agcagcctac gtacggaaat caagcaggca 660 ctgaaacagc cactgcgccg gcggctgcca aggctgggaag ccgttcgtta cattgccatt 720 tatcagcaga aggcgagcca tagcgaggtt ctgctgaagc tggccaaact ggacttcaac 780 gttctgcagg aaatgcacaa agacgaattg agccaaatat gcaaatggtg gaaagatctg 840 gatatacgta acaaactgcc ctatgttcgt gatcgtctga ttgaaggcta tttttggatt 900 ctgggtattt atttcgaacc gcaacactcc cgtacccgta tgttcctgat gaaaacctgt 960 atgtggctga tcgtgctgga cgatacgttt gataattacg gcacctatga agagttagag 1020 atctttaccc aagcagtcga acgttggagc attacctgtc tggatgaact gccagagtat 1080 atgaagctga tatatcacga gcaatttcgc gtgcatcagg aaatggagga aagcctggaa 1140 aaggagggta aggcctacca gattcattat atcaaagaaa tggccaaaga aggtactcgt 1200 tcgctgctgc tggaagcgaa atggctgaag gaaggctata tgcctaccct ggatgagtac 1260 ctgagcaaca gcctggtcac ctgcggctat gcactgatga ccgcacgcag ctacgttgcc 1320 cgtgacgacg gcattgttac cgaagatgca ttcaaatggg ttgcaacgca cccgccgatt 1380 gttaaagcag catgcaaaat tctgcgcctg atggacgaca ttgcaaccca taaagaggaa 1440 caggagcggg gacacattgc aagtagcatt gagtgttaca ggaaggaaac cggagctagc 1500 gaagaggagg cttgcatgga ctttctgaag caggttgaag atggttggaa agttattaat 1560 caagaaagcc tgatgccgac cgatgttccg ttccctctgc tgattccggc aattaacctg 1620 gcacgtgtga gcgacaccct gtacaaagac aacgatggtt ataatcatgc cgataaagag 1680 gttataggtt atattaaaag cctgtttgta catccgatga tagtcggaag cggaggagac 1740 tttccgcagc aactcgaagc ctgcgttaag caggccaacc aggcgctgag ccgttttatc 1800 gccccactgc cctttcagaa cactcccgtg gtcgaaacca tgcagtatgg cgcattatta 1860 ggtggtaagc gcctgcgacc tttcctggtt tatgccaccg gtcatatgtt cggcgttagc 1920 acaaacgc tggacgcacc cgctgccgcc gttgagtgta tccacgctta ctcattaatt 1980 catgatgatt taccggcaat ggatgatgac gatctgcgtc gcggtttgcc aacctgccat 2040 gtgaagtttg gcgaagcaaa cgcgattctc gctggcgacg cttacaaac gctggcgttc 2100 tcgattttaa gcgatgccga tatgccggaa gtgtcggacc gcgacagaat ttcgatgatt 2160 tctgaactgg cgagcgccag tggtattgcc ggaatgtgcg gtggtcaggc attagattta 2220 gacgcggaag gcaaacacgt acctctggac gcgcttgagc gtattcatcg tcataaaacc 2280 ggcgcattga ttcgcgccgc cgttcgcctt ggtgcattaa gcgccggaga taaaggacgt 2340 cgtgctctgc cggtactcga caagtatgca gagagcatcg gccttgcctt ccaggttcag 2400 gatgacatcc tggatgtggt gggagatact gcaacgttgg gaaaacgcca gggtgccgac 2460 cagcaacttg gtaaaagtac ctaccctgca cttctgggtc ttgagcaagc ccggaagaaa 2520 gcccgggatc tgatcgacga tgcccgtcag tcgctgaaac aactggctga acagtcactc 2580 gatacctcgg cactggaagc gctagcggac tacatcatcc agcgtaataa ataa 2634 <210> 56 <211> 2634 <212> DNA <213> Artificial Sequence <400> 56 ggttaaacca tgagcacact gagcgtcagc accccgagct ttagcagcag ccctctgtcg 60 agcgtgaata agaacagcac caagcagcat gtcactcgta acagcgtgat ctttcacgac 120 tcgatttggg gggaccagtt cctggaatac aaagagaaat tcaacgttgc aaccgagaaa 180 cagcttatag aagagctgaa agagaagtg cgtaacgaac tgatgattcg tgcatgtaat 240 gaagcgagcc ggtatatcaa actgatccag ctgatcgatg tgttgaacg tctggggctg 300 gcctatcatt ttgaaaaaga gattgaggaa agcctccagc atatatgt gacgtatggt 360 cataaatgga cgaattacaa caatattgag agcctgagtc tgtggttccg cctgcttcgt 420 caaaatggct ttaatgttag ctcggatata ttgaaatc acattgatga gaaggaaat 480 tttcaggaga gcctgtgcaa tgatccgcag gggatgctgg cgctgtatga agcggcatat 540 atgcgtgttg aaggagat cattctggac aaagcactcg atttacca gctgcatctg 600 gggatcatta gcaatgatcc tagcttgat agcagcctac gtacggaat caagcaggca 660 ctgaaacagc cactgcgccg gcggctgcca aggctggaag ccgttcgtta cattgccatt 720 tatcagcaga aggcgagcca tagcgaggtt ctgctgaagc tggccaact ggacttcaac 780 gttctgcagg aaatgcaca agacgaattg agccaaat gcaatggtg gaagatctg 840 gatatacgta acaaactgcc ctatgttcgt gatcgtctga ttgaaggcta ttttggatt 900 ctgggtattt atttcgaacc gcaacactcc cgtacccgta tgttcctgat gaaaacctgt 960 atgtggctga tcgtgctgga cgatacgttt gataattacg gcacctatga agagttagag 1020 atctttaccc aagcagtcga acgttggagc attacctgtc tggatgaact gccagagtat 1080 atgaagctga tatatcacga gcaatttcgc gtgcatcagg aaatggagga aagcctggaa 1140 aaggagggta aggcctacca gattcattat atcaaagaaa tggccaaaga aggtactcgt 1200 tcgctgctgc tggaagcgaa atggctgaag gaaggctata tgcctaccct ggatgagtac 1260 ctgagcaaca gcctggtcac ctgcggctat gcactgatga ccgcacgcag ctacgttgcc 1320 cgtgacgacg gcattgttac cgaagatgca ttcaaatggg ttgcaacgca cccgccgatt 1380 gttaaagcag catgcaaaat tctgcgcctg atggacgaca ttgcaaccca taaagaggaa 1440 caggagcggg gacacattgc aagtagcatt gagtgttaca ggaaggaaac cggagctagc 1500 gaagaggagg cttgcatgga ctttctgaag caggttgaag atggttggaa agttattaat 1560 caagaaagcc tgatgccgac cgatgttccg ttccctctgc tgattccggc aattaacctg 1620 gcacgtgtga gcgacaccct gtacaaagac aacgatggtt ataatcatgc cgataaagag 1680 gttataggtt atattaaaag cctgtttgta catccgatga tagtcggagg aatcggagac 1740 tttccgcagc aactcgaagc ctgcgttaag caggccaacc aggcgctgag ccgttttatc 1800 gccccactgc cctttcagaa cactcccgtg gtcgaaacca tgcagtatgg cgcattatta 1860 ggtggtaagc gcctgcgacc tttcctggtt tatgccaccg gtcatatgtt cggcgttagc 1920 acaaacacgc tggacgcacc cgctgccgcc gttgagtgta tccacgctta ctcattaatt 1980 catgatgatt taccggcaat ggatgatgac gatctgcgtc gcggtttgcc aacctgccat 2040 gtgaagtttg gcgaagcaaa cgcgattctc gctggcgacg ctttacaaac gctggcgttc 2100 tcgattttaa gcgatgccga tatgccggaa gtgtcggacc gcgacagaat ttcgatgatt 2160 tctgaactgg cgagcgccag tggtattgcc ggaatgtgcg gtggtcaggc attagattta 2220 gacgcggaag gcaaacacgt acctctggac gcgcttgagc gtattcatcg tcataaaacc 2280 ggcgcattga ttcgcgccgc cgttcgcctt ggtgcattaa gcgccggaga taaaggacgt 2340 cgtgctctgc cggtactcga caagtatgca gagagcatcg gccttgcctt ccaggttcag 2400 gatgacatcc tggatgtggt gggagatact gcaacgttgg gaaaacgcca gggtgccgac 2460 cagcaacttg gtaaaagtac ctaccctgca cttctgggtc ttgagcaagc ccggaagaaa 2520 gcccgggatc tgatcgacga tgcccgtcag tcgctgaaac aactggctga acagtcactc 2580 gatacctcgg cactggaagc gctagcggac tacatcatcc agcgtaataa ataa 2634

Claims

1. A recombinant genetically engineered bacterium producing (-)-α-bisabolol, characterized in that: It contains (-)-α-bisabolol synthase MrBBS gene, farnesyl diphosphate synthase iSpA recombinant Escherichia coli expressing genes and MVA pathway genes; The (-)-α-bisabolol synthase MrBBS farnesyl diphosphate synthase iSpA The genes are connected by the nucleotide sequence shown in SEQ ID NO.10; The (-)-α-bisabolol synthase MrBBS The nucleotide sequence of the gene is shown in SEQ ID NO.12; the farnesyl diphosphate synthase iSpA The nucleotide sequence of the gene is shown in SEQ ID NO.13; The MVA pathway gene includes a nucleotide sequence such as mevalonate kinase shown in SEQ ID NO.14 mvvK Gene, nucleotide sequence of mevalonate 5-pyrophosphate decarboxylase as shown in SEQ ID NO.15 mxDV Gene, nucleotide sequence as shown in SEQ ID NO.16 phosphomevalonate kinase mvaK2 Gene, nucleotide sequence of isopentenyl diphosphate delta-isomerase as shown in SEQ ID NO.17 idi Gene, nucleotide sequence of 3-hydroxy-3-methylglutaryl CoA synthase as shown in SEQ ID NO.18 mxDV Gene, nucleotide sequence of acetoacetyl CoA thiolase / 3-hydroxy-3-methylglutaryl CoA reductase as shown in SEQ ID NO.19 mxD gene, and mevalonate kinase as shown in SEQ ID NO.20 mvaK1 Gene.

2. The recombinant genetically engineered bacterium according to claim 1, characterized in that: The (-)-α-bisabolol synthase MrBBS The 5' end of the gene carries the nucleotide sequence shown in SEQ ID NO.

1.

3. The recombinant genetically engineered bacterium according to claim 2, characterized in that: The (-)-α-bisabolol synthase MrBBS farnesyl diphosphate synthase iSpA The nucleotide sequence after gene connection is shown in SEQ ID NO.

55.

4. The recombinant genetically engineered bacteria according to claim 1, characterized in that: The 5' end of the isopentenyl diphosphate delta-isomerase idi gene carries the nucleotide sequence SEQ ID NO. 3, acetoacetyl CoA thiolase / 3-hydroxy-3-methylglutaryl CoA reductase mxD The 5' end of the gene carries the nucleotide sequence SEQ ID NO. 4, 3-hydroxy-3-methylglutaryl CoA synthase mxDV The 5' end of the gene carries the nucleotide sequence SEQ ID NO. 5, mevalonate kinase mvvK The 5' end of the gene carries the nucleotide sequence SEQ ID NO.

6.

5. The recombinant genetically engineered bacterium according to claim 1, characterized in that: The MVA pathway genes and (-)-α-bisabolol synthase MrBBS farnesyl diphosphate synthase iSpA The gene is connected to two plasmids, wherein the nucleotide sequence connected to one plasmid includes SEQ ID NO. 55 and SEQ ID NO. 50, and the nucleotide sequence connected to the other plasmid includes SEQ ID NO. 51; The plasmids are plasmid pSTV28 and plasmid pTrc99A.

6. The recombinant genetically engineered bacterium according to any one of claims 1 to 5, characterized in that: The recombinant Escherichia coli is a recombinant Escherichia coli E. coli DH5α or E. coli W3110.

7. A method for preparing the recombinant genetically engineered bacteria according to any one of claims 1 to 6, characterized in that: It includes the following steps: 1) Take (-)-α-bisabolol synthase MrBBS farnesyl diphosphate synthase iSpA Gene fusion, the fusion product is connected with the linearized expression vector, then introduced into E. coli, and the recombinant expression vector is extracted; The (-)-α-bisabolol synthase MrBBS The stop codon TAA in the gene was replaced by the nucleotide sequence shown in SEQ ID NO.10, and the farnesyl diphosphate synthase without the start codon ATG was synthesized. iSpA Genetic connections; 2) Taking the MVA pathway gene fusion, connecting the fusion product with the recombinant expression vector obtained in step 1) after enzyme digestion, and then introducing it into Escherichia coli to extract the recombinant expression vector; 3) Take mevalonate kinase mvaK1 mevalonate 5-pyrophosphate decarboxylase mxDV gene, phosphomevalonate kinase mvaK2 Isopentenyl diphosphate delta-isomerase idi The gene fragments of the gene are fused, the fusion product is connected with the linearized expression vector, and then introduced into Escherichia coli to extract the recombinant expression vector; 4) The recombinant expression vector obtained in step 2) and the recombinant expression vector obtained in step 3) are introduced into Escherichia coli to obtain recombinant genetically engineered bacteria.

8. The preparation method according to claim 7, characterized in that: Step 2) The MVA pathway gene fusion is to fuse the gene containing mevalonate kinase mvvK Gene, mevalonate 5-pyrophosphate decarboxylase mxDV gene, phosphomevalonate kinase mvaK2 Isopentenyl diphosphate delta-isomerase idi Gene fragment containing 3-hydroxy-3-methylglutaryl CoA synthase mxDV acetoacetyl CoA thiolase / 3-hydroxy-3-methylglutaryl CoA reductase mxD Fusion of gene fragments.

9. The preparation method according to claim 7, characterized in that: In step 1), the expression vector is plasmid pSTV28, and / or, in step 3), the expression vector is plasmid pTrc99A.

10. Use of the recombinant genetically engineered bacteria according to any one of claims 1 to 6 in the preparation of (-)-α-bisabolol and its preparations.

11. A method for producing (-)-α-bisabolol, characterized in that: It includes the following steps: Take the recombinant genetically engineered bacteria according to any one of claims 1 to 6, inoculate it into a seed culture medium, culture it for 8 to 10 hours, take the seed liquid, inoculate it into a fermentation medium, add n-dodecane, and ferment it for 30 to 60 hours; The formula of the seed culture medium is: 5-15 g / L tryptone, 2-8 g / L yeast powder, 5-15 g / L sodium chloride, 50-150 mg / L ampicillin final concentration and 30-40 mg / L chloramphenicol final concentration; The formula of the fermentation medium is: 5-15 g / L glucose or glycerol, 2-3 g / L potassium dihydrogen phosphate, 2.5-3.0 g / L dipotassium hydrogen phosphate, 20-28 g / L yeast powder, 10-20 g / L yeast peptone, 0.1-0.2 mM IPTG, a final concentration of ampicillin of 50-150 mg / L, and a final concentration of chloramphenicol of 30-38 mg / L.

12. The method according to claim 11, characterized in that: The volume ratio of the seed solution, fermentation medium and n-dodecane is 2:25:5; the culture is shaken culture, the temperature is 30°C, and the rotation speed is 200 rpm; after the fermentation culture reaches 3 h, the culture container with a capacity of 4-8×10 -4 0.25 M IPTG.

13. The method according to claim 11, characterized in that: The formula of the seed culture medium is: tryptone 10 g / L, yeast powder 5 g / L, sodium chloride 10 g / L, ampicillin final concentration 100 mg / L and chloramphenicol final concentration 34 mg / L; The formula of the fermentation medium is 10 g / L glucose or glycerol, 2.2 g / L potassium dihydrogen phosphate, 2.9 g / L potassium hydrogen phosphate, 24 g / L yeast powder, 12 g / L yeast peptone, 0.1 mM IPTG, a final concentration of ampicillin of 100 mg / L and a final concentration of chloramphenicol of 34 mg / L.

Images