Application of miRNA-142-3p in predicting treatment responsiveness of IgA nephropathy
By detecting the relative expression level of miRNA-142-3p in urinary sediment and combining it with multivariate analysis, a non-invasive and rapid model for predicting the treatment response of IgA nephropathy was constructed. This solved the problems of high invasiveness, complexity and bias in existing methods and achieved high predictive efficiency.
Patent Information
- Application Number
- CN202210768864.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-06-30
- Publication Date
- 2026-02-13
- Estimated Expiration
- 2042-06-30
AI Technical Summary
Existing methods for predicting treatment responsiveness in IgA nephropathy require invasive renal biopsy and complex immunohistochemical staining, which are complicated, biased, time-consuming, and labor-intensive. Furthermore, existing urinary biomarkers lose their predictive value after adjusting for clinical and pathological indicators.
The relative expression level of miRNA-142-3p in urine sediment was used as a predictive indicator. Urine samples were detected by real-time PCR and combined with gender, urine protein quantification, serum albumin, baseline serum creatinine, serum cystatin C and baseline eGFR to construct a non-invasive and rapid predictive model.
It enables non-invasive, rapid, and accurate prediction of the response of IgA nephropathy patients to RAS blocker or immunosuppressant therapy, reducing patient trauma and economic burden, improving prediction accuracy, and simplifying the operation process.
Smart Images

Figure BDA0003723179250000081 
Figure BDA0003723179250000082 
Figure BDA0003723179250000091
Abstract
Description
TECHNICAL FIELD
[0001] The application relates to the technical field of detection kits, in particular to application of miRNA-142-3p in predicting treatment responsiveness of IgA nephropathy. BACKGROUND
[0002] IgA nephropathy is the most common primary glomerulonephritis and one of the main causes of uremia. Most IgA nephropathy is continuously progressive, and 15%-40% of patients will develop end-stage kidney disease within 5-25 years after diagnosis. IgA nephropathy is a disease with high individual heterogeneity, and different IgA nephropathy patients have high heterogeneity in clinical, pathological manifestations and responsiveness to treatment. Urinary protein is a recognized important factor affecting the prognosis of IgA nephropathy. Whether to reduce urinary protein and the degree of reduction is one of the most important treatment goals of IgA nephropathy.
[0003] The urinary protein remission state is also closely related to the prognosis of IgA nephropathy. RAS blockers (including ACEI-angiotensin converting enzyme inhibitors and ARB-angiotensin receptor blockers) are the basis of treatment of IgA nephropathy. The international authoritative guideline-improving global kidney disease prognosis organization (KDIGO) recommends that all IgA nephropathy patients should use the maximum tolerated dose of RAS blockers to reduce urinary protein levels except for contraindications. For high-risk progressive IgA nephropathy patients with 24-hour urinary protein quantification of more than 1g after 90 days of receiving optimal supportive treatment dominated by RAS blockers, it is suggested that immunosuppressive treatment (hormones or immunosuppressive agents) can be accepted. Whether it is basic RAS blockers or more aggressive immunosuppressive treatment, the purpose is to let IgA nephropathy patients achieve complete remission as soon as possible to delay the progression of renal function and improve the renal prognosis of IgA nephropathy patients.
[0004] Currently, there is no non-invasive biomarker with high sensitivity and specificity to predict the response of IgA nephropathy to treatment. In 2021, a research team in China found (Xie D, et al. J Am Soc Nephrol. 2021; 32: 3187-3196.) that the degree of macrophage infiltration positive for CD68 and CD206 in renal biopsy pathological tissue may predict the responsiveness of high-risk progressive IgA nephropathy patients to immunosuppressive therapy. The area under the curve (AUC) of the degree of macrophage infiltration positive for CD68 and CD206 in simple renal tissue for predicting the responsiveness of immunosuppressive therapy was 0.84. While adding age, gender, eGFR, urinary protein, mean arterial pressure and other clinical treatment and MEST-C of Oxford classification to form a prediction model, the AUC of the prediction model for the responsiveness of immunosuppressive therapy increased to 0.87. This index and the prediction model formed by it are the most effective indicators for predicting the responsiveness of IgA nephropathy treatment. Dr. Mac Hilhorst, an internationally renowned nephrologist, published a commentary (Hilhorst et al. J Am Soc Nephrol. 2021; 32: 2982-2984.) at the same time, praising this invasive index as a pioneering study to predict the responsiveness of IgA nephropathy treatment, but also repeatedly pointing out that urine markers may be the best source for finding non-invasive prediction of the responsiveness of IgA nephropathy treatment.
[0005] Previous studies have found that urinary miR-146a, miR-21 and miR-205 have significant differences between complete remission and non-complete remission groups of IgA nephropathy treatment. However, multivariate analysis found that only baseline eGFR was associated with complete remission of IgA nephropathy (Liang et al. BMC Nephrology. 2017; 18: 63). In addition, urinary hepatocyte growth factor receptor (cMet) has also been reported to have significant differences between complete remission and non-complete remission groups of IgA nephropathy (J Cell Mol Med. 2020; 24: 11158-11169.). At the end of the average 15-month follow-up, the hazard ratio (HR) of urinary cMet was 0.5, and the P value was 0.011. However, after adjusting the systolic blood pressure, eGFR, urinary protein, RAS blocker or immunosuppressive therapy between the complete remission and non-complete remission groups, urinary cMet lost its predictive value for complete remission (P=0.058). SUMMARY
[0006] The present application finds that the currently reported urine markers for predicting the responsiveness of IgA nephropathy treatment, such as urine miR-146a, miR-21, miR-205 or cMet, lose their predictive value after adjusting clinical and pathological indicators (all P>0.05), suggesting that the predictive effect of the previous urine markers often comes from certain clinical and / or pathological indicators closely related to the markers, rather than the markers themselves.
[0007] The current finding of the degree of infiltration of kidney tissue CD68 and CD206 positive macrophages is a better index for predicting the responsiveness of immunosuppressive treatment of IgA nephropathy. However, this index requires the patient to undergo renal biopsy, and the pathological tissue sections obtained after the operation need to be subjected to special immunohistochemical staining of CD68 and CD206 for the infiltrating macrophages in the kidney tissue. However, the distribution of positive cells in the glomerulus of a single section is severely biased. In order to reduce the influence of the above bias on the results, the research team borrowed a similar method from the Hirsch-index for evaluating paper citation indicators, named I-score, to quantify the glomerular infiltration intensity, taking into account both the number of glomeruli and the number of positive cells. However, this index has very obvious limitations for predicting the responsiveness of IgA nephropathy treatment.
[0008] Firstly, the index score is based on the infiltration of a special subpopulation of macrophages in the kidney tissue, which requires the patient to undergo renal biopsy. Renal biopsy is an invasive procedure, and there are many contraindications (such as significant bleeding tendency, severe hypertension, solitary kidney, etc.) and complications (hematuria, perirenal hematoma, perirenal abscess and arteriovenous fistula, etc.).
[0009] Secondly, IgA nephropathy is an autoimmune disease, and most patients have multiple relapses. Invasive renal biopsy cannot be repeated according to the patient's treatment needs, so many IgA nephropathy patients miss the opportunity to assess the responsiveness of treatment at the time of relapse.
[0010] Thirdly, in addition to the need for complex renal biopsy, the index also requires special immunohistochemical staining of macrophages in the kidney tissue, which requires very high expertise of the renal biopsy operator and the pathology professional for postoperative pathological sectioning and special staining, affecting its practicality and generalizability.
[0011] Furthermore, the index has a serious bias that positive cells often concentrate in one or a few glomeruli. In order to control the bias, the infiltration degree of an average of 20 glomeruli in each section needs to be calculated and averaged. However, the number of glomeruli in a kidney tissue section is not often more than 20, and it is currently considered that the number of glomeruli in each section should be more than 8 to be qualified.
[0012] Even if a complex correction method is used, it is difficult to completely avoid the bias of the index, especially when the number of glomeruli in the kidney tissue section is small (such as less than 10, and it is generally considered that the number of glomeruli in each section is greater than 8 to be qualified), and the bias is more obvious.
[0013] Finally, the index scoring method I-score is relatively complex, and the operation process is time-consuming and laborious.
[0014] The purpose of the present application is to provide a non-invasive, rapid and accurate method for evaluating the treatment responsiveness of IgA nephropathy by using urinary sediment miRNAs. The purpose is to solve the problems of the current index for predicting the treatment responsiveness of IgA nephropathy, such as the need for invasive renal biopsy, the need for complex special immunohistochemical staining, and the large bias and complex calculation of the scoring method.
[0015] Another purpose of the present application is to provide a kit for predicting the treatment responsiveness of IgA nephropathy without physical trauma, simple operation, short detection time, no bias and simple calculation.
[0016] In a first aspect, the present application claims the use of miRNA-142-3p in predicting the treatment responsiveness of IgA nephropathy.
[0017] In the application provided by the present application, the treatment includes treating IgA nephropathy with RAS blockers or immunosuppressive agents.
[0018] RAS blockers (including ACEI-angiotensin-converting enzyme inhibitors and ARB-angiotensin receptor blockers) are the basis of treatment for IgA nephropathy. Immunosuppressive therapy refers to hormone or immunosuppressive agent therapy. Whether it is a basic RAS blocker or a more aggressive immunosuppressive therapy, the purpose is to allow IgA nephropathy patients to achieve complete remission as soon as possible, so as to delay the progression of renal function and improve the renal prognosis of IgA nephropathy patients.
[0019] If the responsiveness of patients treated with RAS blockers or immunosuppressive agents to drugs can be accurately predicted, the treatment regimen can be changed in time.
[0020] In a second aspect, the present application claims a reagent or kit containing primer sequences for amplifying miRNA-142-3p, which is used to detect the relative expression amount of miRNA-142-3p in urine samples of IgA nephropathy patients treated with RAS blockers or immunosuppressive agents.
[0021] More specifically, in the reagent or kit provided by the present application, the primer sequence for amplifying miRNA-142-3p is shown in SEQ ID NO. 1.
[0022] In the reagent or kit provided by the application, the relative expression amount of the miRNA-142-3p is detected by fluorescent quantitative PCR.
[0023] In the reagent or kit provided by the application, the critical value of the relative expression amount of the miRNA-142-3p is 0.163. According to the calculation of the ROC curve, when the expression amount of the miRNA-142-3p in the urine of a patient is higher than 0.163, it is inferred that the patient cannot achieve complete remission after treatment.
[0024] In a third aspect, the application claims a new model for predicting the responsiveness of IgA nephropathy to RAS blocker or immunosuppressant treatment, wherein the relative expression amount of the miRNA-142-3p in urine is used as an index for predicting the responsiveness of treatment.
[0025] In the model provided by the application, the index further comprises gender, urine protein quantification, blood albumin, baseline blood creatinine, blood cystatin C and baseline eGFR.
[0026] The application also claims the application of the miRNA-142-3p or the above model in improving the prediction accuracy of the responsiveness of IgA nephropathy treatment; the treatment is RAS blocker or immunosuppressant treatment.
[0027] In a fourth aspect, the application claims a method for predicting the responsiveness of IgA nephropathy treatment for non-disease diagnosis purposes, comprising: extracting the RNA of the urinary sediment in the urine sample of an IgA nephropathy patient and synthesizing cDNA by reverse transcription, and obtaining the relative expression amount of the miRNA-142-3p in the cDNA based on SYBR Green fluorescent quantitative PCR.
[0028] The method for predicting the responsiveness of IgA nephropathy treatment provided by the application can be used to predict the health status or recovery of an IgA nephropathy patient after treatment with a RAS blocker or an immunosuppressant; for non-disease treatment and diagnosis purposes, the method for predicting the responsiveness of IgA nephropathy treatment provided by the application can be used in the research and development of RAS blockers or immunosuppressants as IgA nephropathy treatment drugs.
[0029] The application has the following beneficial effects:
[0030] (1) The application can realize the non-invasive and rapid prediction of the responsiveness of IgA nephropathy treatment, and accurately predict which patients can achieve complete remission after treatment.
[0031] (2) This invention only requires the patient to provide a morning urine sample. Compared with the current method of using renal biopsy to measure the degree of CD68 and CD206 positive macrophage infiltration in kidney tissue, it has a significant advantage of being non-invasive. Even if the patient's condition recurs repeatedly, the treatment responsiveness can be assessed at any time according to the treatment needs. Moreover, collecting a morning urine sample does not pose any risk or trauma to the patient and is very safe and reliable.
[0032] (3) The present invention uses real-time PCR, which is simple to operate and reliable in terms of results. No additional manpower or material resources are required for special training, thus giving the present invention a wider application space and the advantage of rapid promotion.
[0033] (4) In the prior art, the scoring of the degree of infiltration of CD68 and CD206 positive macrophages in kidney tissue has a huge bias, which has to be done by a relatively complex counting and statistical method, which is time-consuming, laborious and too professional. In addition, for some patients, the number of glomeruli in the renal biopsy section is too small, and the possibility of bias is still difficult to avoid.
[0034] The calculation method of this invention is 2 -Δct The relative quantitative method is simple and easy to calculate, and can be performed in various commonly used office software such as Excel.
[0035] (5) The current scoring of the degree of CD68 and CD206 positive macrophage infiltration in renal tissue requires renal biopsy and relatively specialized immunohistochemical staining. The preoperative examination and hospitalization costs are often around 5,000-8,000 yuan, while the cost of CD68 and CD206 immunohistochemical staining is even higher, and both are out-of-pocket expenses. In contrast, this invention utilizes simple quantitative real-time PCR technology to collect morning urine samples from patients, eliminating the need for hospitalization and a series of preoperative examinations, thereby greatly reducing the economic burden on patients.
[0036] (6) The current scoring of the degree of CD68 and CD206 positive macrophage infiltration in renal tissue involves preoperative examination, renal biopsy, pathological preparation, postoperative observation, and special immunohistochemical staining, and the hospitalization time is often about 7 to 10 days. However, the present invention uses the widely adopted real-time quantitative PCR technology, which can provide the final results from morning urine collection in just 8 to 12 hours, saving patients valuable time. Attached Figure Description
[0037] Figure 1 This invention compares the expression levels of urinary miRNA-142-3p in the complete remission group and the non-complete remission group of IgA nephropathy.
[0038] Figure 2 The ROC curve for predicting non-complete remission in IgA nephropathy is presented in this invention. Detailed Implementation
[0039] The following examples are intended to illustrate the present application but not to limit the scope of the present application. Modifications or substitutions of the methods, steps or conditions of the present application, which do not depart from the spirit and essence of the present application, are intended to fall within the scope of the present application.
[0040] If not specifically indicated, the experimental materials, reagents and instruments used in the present application are commercially available. If not specifically indicated, all the technical means in the present application are conventional means known to those skilled in the art.
[0041] The IgA nephropathy patients in the present application refer to the patients with nephropathy after treatment with RAS blockers and / or immunosuppressants.
[0042] Example 1 Urinary miRNA-142-3p is the most important independent risk factor for non-complete remission of IgA nephropathy
[0043] IgA nephropathy can be divided into complete remission group and non-complete remission group according to its treatment responsiveness. Complete remission is defined as the decrease of urinary protein quantification of IgA nephropathy patients to below 0.3 g / d and stable eGFR (decrease of eGFR compared with baseline level at kidney biopsy is less than 25%) after treatment. The patients who do not achieve complete remission are divided into non-complete remission group. This definition of complete remission is the most commonly used standard for complete remission of glomerular diseases in the world.
[0044] For IgA nephropathy patients who achieve and maintain complete remission for a long time, compared with the patients who do not achieve complete remission, the progression of renal function and the risk of end-stage renal disease are greatly reduced, and the renal function can be in a long-term stable state.
[0045] In the present application, IgA nephropathy patients can be divided into complete remission group and non-complete remission group according to whether complete remission is achieved after treatment, wherein the complete remission group has 22 patients, and the non-complete remission group has 95 patients.
[0046] Compared with the complete remission group, the patients in the non-complete remission group had higher urine protein quantitation, baseline serum creatinine, serum cystatin C, proportion of Oxford classification-T2, and urine miRNA-142-3p expression, and lower serum albumin and baseline eGFR (Table 1). When comparing the baseline clinical and pathological indicators between the two groups, the indicators with P values less than 0.1 were respectively brought into logistics regression analysis for single factor and multi-factor analysis. The results showed that miRNA-142-3p (OR = 3854930.528, 95% CI 38.491-3.861E+11, P = 0.010) and baseline serum creatinine (OR = 1.195, 95% CI 1.016-1.406, P = 0.032) were independent risk factors for non-complete remission of IgA nephropathy after treatment (Table 2), and serum albumin (HR = 0.790, 95% CI 0.682-0.994, P = 0.044) was an independent protective factor for non-complete remission of IgA nephropathy (Table 2).
[0047] Table 1. Comparison of basic conditions of the complete remission group and the non-complete remission group
[0048]
[0049] Table 2. Single factor and multi-factor logistics regression analysis of non-complete remission of IgA nephropathy after treatment
[0050]
[0051] Example 2. Predictive efficiency of urine miRNA-142-3p for treatment responsiveness of IgA nephropathy
[0052] The urine miRNA-142-3p expression in the non-complete remission group of IgA nephropathy patients after treatment was significantly higher than that in the complete remission group (Table 1 and Figure 1 , P < 0.001).
[0053] According to whether complete remission occurred after treatment of IgA nephropathy, the patients were divided into a complete remission group and a non-complete remission group. The maximum area under the ROC curve of urine miRNA-142-3p for predicting non-complete remission was 0.847 (95% confidence interval 0.769-0.925), and the specificity was as high as 95% when the critical value of urine miRNA-142-3p was greater than 0.1295 (Table 3 and Figure 2 ). When the specificity was maximum, the critical value of urine miRNA-142-3p expression was higher than 0.1630, the specificity was 100%, and the sensitivity was 57.0% (Table 4).
[0054] According to the ROC curve calculation, when the expression level of urine miRNA-142-3p of a patient is higher than 0.163, it is speculated that the patient cannot obtain complete remission after treatment.
[0055] Table 3. Maximum area under the ROC curve of urine miRNA-142-3p expression for predicting no complete remission
[0056]
[0057] Table 4. Maximum sensitivity and maximum specificity of predicting no complete remission of IgA nephropathy
[0058]
[0059] Example 3 Prediction performance of urine miRNA-142-3p-based prediction model for treatment responsiveness of IgA nephropathy
[0060] The baseline serum creatinine and blood albumin still significant after adding multi-factor logistics regression analysis were combined with urine miRNA-142-3p as prediction model 1. The area under the AUC curve increased to 0.901, the sensitivity increased to 79.1%, and the specificity was still as high as 90% (Table 5). And the combination of six commonly used clinical indicators such as gender, urine protein quantification, blood albumin, baseline serum creatinine, blood cystatin C, and baseline eGFR with urine miRNA-142-3p as prediction model 2. The AUC increased to 0.927, the sensitivity further increased to 83.3%, and the specificity was as high as 94.4% (Table 6). Whether it is prediction model 1 or prediction model 2, the prediction performance of IgA nephropathy treatment responsiveness is significantly higher than the existing prediction model of 0.87 (Xie D, et al. J Am Soc Nephrol. 2021; 32: 3187-3196.).
[0061] Table 5. Maximum area under the ROC curve of prediction model 1 for evaluating no complete remission of IgA nephropathy
[0062]
[0063] Table 6. Maximum area under the ROC curve of prediction model 2 for evaluating no complete remission of IgA nephropathy
[0064]
[0065] Example 4 Kit and method for predicting treatment responsiveness of IgA nephropathy
[0066] The present embodiment provides a kit and method for predicting treatment responsiveness of IgA nephropathy, and the main materials include:
[0067] 1) TRIzol for extracting total RNA;
[0068] 2) miRcute Enhanced miRNA First-Strand cDNA Synthesis Kit: Model KR211, manufactured by TIANGEN;
[0069] 3) Primers: The primer sequence of the main indicator miRNA-142-3p is UGUAGUGUUUCCUACUUUAUGGA (SEQ ID NO. 1), and the primer sequence of the housekeeping gene U6 snRNA is AAAGCAGGCUUUAAAGGAACCU (SEQ ID NO. 2);
[0070] 4) miRcute Enhanced miRNA Fluorescent Quantitative Detection Kit (SYBR Green): Model FP411, manufactured by TIANGEN.
[0071] 5) Other reagents: chloroform, isopropanol, DEPC water, and RNase-free double-distilled water.
[0072] The method for predicting the responsiveness of IgA nephropathy to treatment uses the following main equipment:
[0073] 1) Various PCR instruments.
[0074] 2) Various benchtop low-temperature high-speed centrifuges.
[0075] 3) SPSS software: any version of SPSS software.
[0076] The method for predicting the responsiveness of IgA nephropathy to treatment provided in this embodiment includes the following steps:
[0077] 1) Sample collection and preservation
[0078] 50-100 ml of morning urine of an IgA nephropathy patient before treatment is collected in a 50 ml sterile centrifuge tube, 1-2 tubes per patient, and is stored in an ice box or at 4°C for transportation to the laboratory for processing.
[0079] 2) Separation of urinary sediment
[0080] The collected morning urine is centrifuged at 4°C and 3000g for 30 min, the urine supernatant after centrifugation is discarded, and a small amount of urine supernatant remaining at the bottom of the tube is carefully sucked out with a syringe tip to retain the urinary sediment.
[0081] 3) Extraction of total RNA from urinary sediment (TRIzol method)
[0082] 500 ul of pre-cold 4°C TRIzol is added to the total urinary sediment, and the mixture is uniformly blown and mixed with a syringe tip, and the above liquid is transferred to a new RNase-free 1.5 ml EP tube, and is left to stand at room temperature for 5 min;
[0083] Add room temperature chloroform (trichloromethane) 200ul, fast and hard shake to mix for 15s until the chloroform is completely mixed, stand at room temperature for 3min;
[0084] Centrifuge at 4℃, 12000rpm for 15min, the EP tube can be seen liquid into 3 layers (the upper layer of transparent water phase is RNA, the middle layer of white is protein, and the lower layer of pink is DNA); Carefully transfer the upper layer of transparent water phase to a sterilized RNase-free 1.5ml EP tube, try to avoid absorbing or disturbing the middle layer of protein.
[0085] Add equal volume of -20℃ isopropanol, ice bath for 20min (the RNA is precipitated from liquid to solid); centrifuge at 4℃, 12000rpm for 15min, discard the supernatant; Add 1ml 75% DEPC ethanol, mix well; 4℃ centrifuge, 12000rpm, 5min, discard the supernatant; Carefully aspirate the liquid with a gun head, dry in a ventilated oven for 5-15min (from white to transparent), add 10-15ul DECP water, mix gently, ice bath for 30min, form RNA solution. Take 1-2ul RNA solution, measure the RNA concentration on NANODROP 2000c.
[0086] 4) Reverse transcription to synthesize cDNA
[0087] Use TIANGEN miRcute enhanced miRNA cDNA first strand synthesis kit to reverse transcribe the extracted total RNA to cDNA.
[0088] Put the miRNA RT Enzyme Mix frozen at -20℃ on ice, thaw the frozen 2x miRNA RT Reaction Buffer, and mix gently after thawing;
[0089] Fix the total RNA quality of the sample to 500ng (total system 500ng), calculate the volume of RNA solution (Total RNA) added according to the measured concentration;
[0090] Prepare a new RNase-free 0.5ml EP tube, add 10ul 2x miRNA RT Reaction Buffer, calculated RNA solution volume, RNase-free double distilled water (8ul minus the volume of RNA solution to be added); Finally add miRNA RT Enzyme Mix;
[0091] After brief centrifugation, react at 42℃ for 60min (miRNA adds A tail reaction and reverse transcription reaction), react at 95℃ for 3min (enzyme inactivation reaction).
[0092] 5) Detection of the expression amount of miRNA-142-3p:
[0093] The detection of the expression level of miRNA-142-3p in the above synthetic cDNA is based on SYBR Green fluorescent quantitative PCR technology, and the kit is a miRcute enhanced miRNA fluorescent quantitative detection kit from TIANGEN company.
[0094] Melt 2x miRcute Plus miRNA Premix, Reverse Primer at room temperature; and mix the melted 2x miRcute Plus miRNA Premix up and down, and centrifuge slightly for standby;
[0095] Put the synthetic cDNA, RNase-free double distilled water and other reaction reagents on ice; configure the reaction system: 10ul 2x miRcute Plus miRNA Premix, miRNA-142-3p or U6 primer 0.4ul, Reverse Primer 0.4ul, miRNA first strand cDNA 2ul, RNase-free double distilled water 7.2ul, and supplement the reaction system to 20ul.
[0096] The reaction is carried out in various PCR instruments, and the reaction conditions are as follows: 1x (1 cycle) - 95℃, 15min (initial template denaturation); and then 40-45x (40 to 45 cycles) - 94℃, 20sec (template denaturation in PCR cycle) and 60℃, 34sec (annealing, extension). Each sample of miRNA-142-3p and U6 is provided with 2 vice holes (i.e. all conditions remain unchanged, and 2 repeated experiments are made). The housekeeping gene (U6) is amplified at the same time as the sample to be tested in the reaction, so as to determine the expression level of the target gene in the sample.
[0097] The expression amount of miRNA-142-3p in the sample is taken as the control with U6, and the value of 2-Ct (target miRNA-U6) is taken as the expression of miRNA-142-3p in each patient.
[0098] 7) ROC curve of miRNA-142-3p predicting the treatment responsiveness of IgA nephropathy:
[0099] The AUC of the relative expression amount of miRNA-142-3p as a single index detection is 0.847 (0.769, 0.925), which is similar to the 0.84 (95% CI 0.81-0.88) of the current invasive method for predicting the treatment responsiveness of IgA nephropathy in kidney tissue.
[0100] Comparative Example 1
[0101] The present application obtains a plurality of miRNAs with differences in the complete remission group and the non-complete remission group when analyzing the urine sediment miRNA expression profile. The experimental exploration of the correlation between the miRNAs and the treatment response of IgA nephropathy is provided by the present comparative example, and the results are as follows:
[0102] For the secondary analysis of the urine sediment miRNA expression profile of the early IgA nephropathy, the IgA nephropathy patients are divided into the complete remission group and the non-complete remission group according to the treatment response. It is found that 32 differential miRNAs, of which 12 are increased in the complete remission group and 20 are increased in the non-complete remission group. The present application verifies 11 miRNAs (miRNA-98-5p, miRNA-92a-3p, miRNA-425-5p, miRNA-204-5p, miRNA-19a-3p, miRNA-197-3p, miRNA-194-5p, miRNA-185-5p, miRNA-17-5p, miRNA-142-3p and miRNA-140-3p) in a large sample (22 in the complete remission group and 95 in the non-complete remission group), and it is found that, in addition to miRNA-142-3p, miRNA-92a-3p also has a significant difference. The expression amount of miRNA-92a-3p in the non-complete remission group is significantly higher than that in the complete remission group (median ratio, 0.1427 vs 0.0801, P=0.035). But it is found that there is no statistical difference (P=0.834) in the single factor logistics regression of whether the IgA nephropathy patient has no complete remission after treatment.
[0103] However, the maximum area under curve (AUC) of the ROC curve of miRNA-92a-3p for predicting non-complete remission is only 0.661, which is significantly lower than that of miRNA-142-3p and the existing indicators of the infiltration degree of macrophages positive for CD68 and CD206 in kidney tissue.
[0104] Although the present application has been described in detail by the general description and specific embodiments above, some modifications or improvements can be made on the basis of the present application, which is obvious to those skilled in the art. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the present application, all belong to the scope of the present application. SEQUENCE LISTING <110> The First Medical Center of General Hospital of Chinese People's Liberation Army <120> Application of miRNA-142-3p in predicting treatment response of IgA nephropathy <130> KHP221116992.3 <160> 2 <170> SIPO SequenceListing 1.0 <210> 1 <211> 23 <212> RNA <213> Artificial Sequence <400> 1 uguaguguuu ccuacuuuau gga 23 <210> 2 <211> 22 <212> RNA <213> Artificial Sequence <400> 2 aaagcaggcu uuaaaggaac cu 22
Claims
1. Use of a miRNA-142-3p detection reagent in preparation of a reagent or kit for predicting treatment responsiveness of IgA nephropathy; The treatment is treatment of IgA nephropathy with a RAS blocker or an immunosuppressant.
2. Use according to claim 1, characterized in that, The reagent or kit contains a primer sequence for amplifying miRNA-142-3p, and is used for detecting the relative expression amount of miRNA-142-3p in a urine sample of an IgA nephropathy patient treated with a RAS blocker or an immunosuppressant.
3. Use according to claim 2, characterized in that, The primer sequence for amplifying miRNA-142-3p is shown in SEQ ID NO.
1.
4. Use according to claim 3, characterized in that, The reagent or kit detects the relative expression amount of the miRNA-142-3p by fluorescence quantitative PCR.
5. Use according to claim 4, characterized in that, The critical value of the relative expression amount of the miRNA-142-3p is 0.163.
Citation Information
Patent Citations
Urine PCR (Polymerase Chain Reaction) kit for predicting renal function progress of IgA nephropathy
CN114921541A