A molecular marker for prognosis of esophageal adenocarcinoma and its application

Abstract

The present invention relates to the use of miR-421 and / or miR-550a-1 as a prognostic marker for esophageal adenocarcinoma, for example, in constructing a prognostic model for esophageal adenocarcinoma, preparing a diagnostic kit for esophageal adenocarcinoma, and preparing a therapeutic drug for esophageal adenocarcinoma. Molecular markers miR-421 and / or miR-550a-1 play a vital role in the occurrence and development of EAC and the prognosis of EAC patients by inhibiting key target genes.

Description

Technical Field

[0001] The invention belongs to the technical field of tumor molecular biology, and specifically relates to a molecular marker for prognosis of esophageal adenocarcinoma and an application thereof. Background Art

[0002] Esophageal adenocarcinoma (EAC) is a malignant tumor of the digestive system with a poor prognosis. It often occurs in the esophageal submucosal or cardia glands, and the postoperative situation is not optimistic. It is reported that the annual increase in EAC patients in China is about 5%. The cause of the disease is unknown. Most of them have progressed to the advanced stage when diagnosed. Clinically, almost all EAC patients have a poor prognosis, with an average survival (OS) of less than 13 months and a high mortality rate, which seriously threatens human life and health.

[0003] The incidence of EAC is increasing year by year. Its causes are related to obesity, smoking, gastroesophageal reflux disease, BE and other factors. It is necessary to find more effective technologies or treatments. So far, many studies have shown that abnormally expressed miRNAs can be used for the diagnosis and prognosis of various types of tumors and diseases, such as lung cancer, liver cancer, breast cancer, etc. However, only a few studies have reported on the significance of miRNAs as biomarkers for the diagnosis and prognosis of EAC.

[0004] The expression of miRNAs related to EAC diagnosis is significantly different in EAC and adjacent tissues. miR-203 is considered a tumor suppressor in EAC because its expression is significantly downregulated in EAC compared with normal tissues and is negatively correlated with the progression of EAC. miR-21-5p and miR-25-3p play the role of tumor promoters in EAC. As a biomarker for EAC diagnosis, miR-21-5p upregulation in EAC promotes EAC cell apoptosis and metastasis. miR-25-3p is highly expressed in EAC and can be used to distinguish patients with esophageal adenocarcinoma from healthy controls.

[0005] There are more miRNAs related to EAC prognosis than miRNAs used for EAC diagnosis, but most of their research remains at the experimental research level, and the mechanism of its influence on the occurrence and development of EAC has not been studied in depth, and there is a lack of effective evidence to guide the use of miRNAs in clinical treatment. Among the miRNAs related to EAC prognosis, miR-145, miR-203 and miR-221 have been studied more deeply. Studies have shown that miR-145, as a tumor suppressor, plays an important role in the anti-anoikis process of cancer progression. Derouet et al. showed that the expression of miR-145 enhanced the invasion of EAC cells and the adhesion of fibronectin and delayed the cleavage of PARP and caspase-3, thereby protecting EAC cells from anoikis, and did not affect the resistance of EAC to chemotherapeutic drugs. Saad et al. showed that the downregulation of miR-203 was significantly correlated with the progression and tumor stage of EAC. Studies have shown that inhibition of miR-221 expression in 5-fluorouracil-resistant cells leads to decreased cell proliferation, increased apoptosis, and restoration of chemosensitivity, which in turn leads to activation of the Wnt / β-catenin pathway mediated by dysregulated expression of DKK2. In addition, downregulation of miR-221 leads to changes in EMT-related genes (such as E-cadherin and vimentin) and significantly slows the growth of xenograft tumors in nude mice. In addition, there is severe dysregulation of target genes (CDH1, CD44, MYC, and ABCG2) regulated by miR-221 and associated with Wnt / β-catenin signaling and chemoresistance. The above studies show that the expression level of miRNA is associated with the diagnosis or prognosis of EAC, and the factors affecting the diagnosis and prognosis of EAC are complex. Overall, miR-145 and miR-221 found in the above studies are significantly associated with the prognosis of EAC patients, and their specific molecular mechanisms have been clarified. Therefore, in future EAC studies, miR-145 and miR-221 will be of great value for the prognosis of EAC patients.

[0006] Some studies have focused on exploring the role of miRNAs in EAC treatment by analyzing the role of miRNAs in EAC cell lines, which is promising for the identification of future clinically relevant therapeutic agents or biomarkers, such as the effects of miR-221 and miR-222 inhibitors on the EAC cell line OE33. In this study, miRNA inhibitors were injected around the tumors of 5 mice and negative controls were injected around the contralateral tumors. The results showed that the growth curves of treated and untreated tumors had significant statistical differences after day 8, revealing that miR-221 and miR-222 inhibitors may be used as therapeutic agents to reduce EAC growth. Studies have also shown that inhibiting the expression of miR-221 in 5-fluorouracil-resistant cells leads to decreased cell proliferation and increased apoptosis as well as restoration of chemosensitivity, leading to the activation of the Wnt / β-catenin pathway mediated by dysregulated expression of DKK2. Derouet et al. found that miR-145 exhibited different resistance characteristics in different cell lines. In this study, miR-145 did not protect OE33 cells from 5-fluorouracil or cisplatin, but it protected SK-GT-4 cells from cisplatin. In FLO-1 cells, miR-145 enhanced the effect of cisplatin, but had no effect on 5-fluorouracil. Zhang et al. showed that downregulation of miR-26a in the esophageal adenocarcinoma cell line OE33 could inhibit 5-fluorouracil-induced apoptosis. In contrast, upregulation of miR-26a had no effect on 5-fluorouracil-induced apoptosis, suggesting that inhibition of miR-26a expression could increase the survival rate of OE33 cells and reduce sensitivity to apoptosis induced by anoikis or chemotherapy. Hu et al. studied the role of miR-148 in the EAC cell line OE33 and the chemoradiosensitive subcell line OE33R. In this study, upregulation of miR-148a improved the response of the OE33 cell line to 5-fluorouracil and cisplatin treatment compared with the negative control. The response of the OE33R cell line to anticancer therapy was also improved after miR-148a transfection compared with controls, suggesting that this miRNA plays an important role in the therapeutic response.

[0007] It can be seen that the results of the above studies indicate that miRNAs play an important role in the survival and growth of EAC tumors and are expected to be used in the treatment of EAC, which lays a solid foundation for further clinical research to evaluate the role of these miRNAs. However, research reports in the field of EAC are still limited, and effective biomarkers for clinical EAC diagnosis, prognosis, and treatment are still lacking. Therefore, it is urgent to explore new, more effective, and more accurate biomarkers for EAC diagnosis, prognosis assessment, and targeted therapy. Summary of the invention

[0008] To achieve the above object, in one aspect, the present invention provides a molecular marker for prognosis of esophageal adenocarcinoma, wherein the molecular marker is miR-421 and / or miR-550a-1.

[0009] In another aspect, the present invention provides use of miR-421 and / or miR-550a-1 as a molecular marker for prognosis of esophageal adenocarcinoma.

[0010] In another aspect, the present invention provides the use of molecular markers miR-421 and / or miR-550a-1 in constructing a prognostic model for esophageal adenocarcinoma.

[0011] found that high expression of miR-421 and / or miR-550a-1 indicated poor prognosis in esophageal adenocarcinoma.

[0012] Furthermore, provided is the use of mature forms of miR-421 and miR-550a-1, miR-421, miR-550a-3p, and miR-550a-5p, in constructing a prognostic model for esophageal adenocarcinoma.

[0013] Furthermore, the construction of the esophageal adenocarcinoma prognostic model includes the following steps: (a) using multivariate Cox regression analysis to obtain the regression coefficient of mir-421 and the regression coefficient of mir-550a-1; calculating the patient's risk score based on the regression coefficient and the expression values ​​of mir-421 and mir-550a-1; (b) using the median of the risk score as the threshold, dividing the samples into a high-risk group and a low-risk group, thereby constructing an esophageal adenocarcinoma prognostic risk model of miRNAs; (c) using the receiver operating characteristic, consistency index and calibration curve to evaluate the prognostic model; (d) constructing a nomogram of the esophageal adenocarcinoma prognostic model to predict the relationship between the expression level of each miRNA and the overall survival rate of EAC patients.

[0014] In this model, it was found that high expression of mature miR-421, miR-550a-3p, and miR-550a-5p indicated a poor prognosis for esophageal adenocarcinoma.

[0015] Furthermore, the key target gene of miR-421 is at least one of PPM1L and SLC18A2; the key target gene of miR-550a-3p is at least one of ASAP3, LMF1, PRKACB and PDCD4; the key target gene of miR-550a-5p is at least one of BCL2L2, PTPN21 and RPS6KA5.

[0016] In another aspect, the present invention provides use of the target genes PPM1L, SLC18A2, ASAP3, LMF1, PRKACB, PDCD4, BCL2L2, PTPN21 and RPS6KA5 in constructing a prognostic model for esophageal adenocarcinoma.

[0017] In another aspect, the present invention provides the use of molecular markers miR-421 and / or miR-550a-1, or their mature forms miR-421, miR-550a-3p, miR-550a-5p, or genes PPM1L, SLC18A2, ASAP3, LMF1, PRKACB, PDCD4, BCL2L2, PTPN21 and RPS6KA5 in the preparation of a diagnostic kit for esophageal adenocarcinoma.

[0018] Furthermore, the diagnostic kit comprises the target gene primer sequences shown in the following SEQ ID No. 1-20:

[0019] SEQ ID No.1PPM1L-F GAGTTACTTCTTCCACACCGACGAG

[0020] SEQ ID No.2PPM1L-R GCTACCTTGCCCTTCACCATCTTC

[0021] SEQ ID No.3SLC18A2-F GTCCTTCTGCTGGTGGTGCTATTG

[0022] SEQ ID No.4SLC18A2-RTTCTTCTTTGGCAGGTGGACTTCG

[0023] SEQ ID No.5ASAP3-F ACAAGCAGTTTGGGACGGAGAAAG

[0024] SEQ ID No.6ASAP3-R CAGCCATACTTGACTCCACACTTCC

[0025] SEQ ID No.7LMF1-F TCCACTATGAGACCCAGCCGATG

[0026] SEQ ID No.8LMF1-R AAGAGGAAGAAGGGCACCAGGAG

[0027] SEQ ID No.9PRKACB-F GTGGATTGGTGGGCATTAGGAGTG

[0028] SEQ ID No.10PRKACB-R CTGAACTGAAGTGGGATGGGAATCG

[0029] SEQ ID No.11PDCD4-F CAAAGGGAAGGTTGCTGGATAGGC

[0030] SEQ ID No.12PDCD4-R TCCACCTCCTCCACATCATACACC

[0031] SEQ ID No.13BCL2L2-F CGCCTTGTAGCCTTCTTTGTCTTTG

[0032] SEQ ID No.14BCL2L2-R CACCATCCACTCCTGCACTTGTC

[0033] SEQ ID No.15PTPN21-FGCCCCACCCCAGACTATGAGAC

[0034] SEQ ID No.16PTPN21-R GTACGAGCTGCCGATGTTGAGG

[0035] SEQ ID No.17RPS6KA5-F AAACTACACCCACCAAGACACTGC

[0036] SEQ ID No.18RPS6KA5-RACTGAGTCCGAGAACTGGAAGAGG

[0037] In another aspect, the present invention provides the use of molecular markers miR-421 and / or miR-550a-1, or their mature forms miR-421, miR-550a-3p, miR-550a-5p, or genes PPM1L, SLC18A2, ASAP3, LMF1, PRKACB, PDCD4, BCL2L2, PTPN21 and RPS6KA5 in the preparation of therapeutic drugs for esophageal adenocarcinoma.

[0038] Furthermore, knocking out miR-421 and / or miR-550a-1, or knocking out their mature forms miR-421, miR-550a-3p, miR-550a-5p inhibits the proliferation, migration and invasion of esophageal adenocarcinoma cells.

[0039] Beneficial Effects

[0040] Esophageal adenocarcinoma (EAC) is one of the malignant tumors with the fastest increasing incidence. Clinically, almost all EAC patients have a poor prognosis, with an average survival (OS) of less than 13 months and a 5-year survival rate of less than 20%. There is still a lack of effective biomarkers for clinical diagnosis, prognosis, and treatment of EAC. The present invention provides novel biomarkers for diagnosis, prognosis assessment, and targeted therapy of EAC. Upregulation of miR-421 can play a vital role in the occurrence and development of EAC and the prognosis of EAC patients by binding to and inhibiting the expression of PPM1L and SLC18A2; upregulation of miR-550a-3p can play a vital role in the occurrence and development of EAC and the prognosis of EAC patients by binding to and inhibiting the expression of ASAP3, LMF1, PRKACB and PDCD4; upregulation of miR-550a-5p can play a vital role in the occurrence and development of EAC and the prognosis of EAC patients by binding to and inhibiting the expression of BCL2L2, LMF1, PTPN21 and RPS6KA5. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 is a diagram showing differentially expressed miRNAs highly associated with EAC in Example 1, Figure 1 A: Volcano plot of differential miRNAs; Figure 1 B: Heat map of differential miRNAs; Figure 1 C: Correlation characteristic diagram between miRNAs and normal esophageal tissue and esophageal adenocarcinoma tissue samples; Figure 1 D: Venn diagram of differential miRNAs and blue modules.

[0042] Figure 2 It is the forest plot of the univariate Cox regression analysis in Example 1 of the present invention.

[0043] Figure 3 This is a diagram showing Lasso regression screening of prognosis-related variables for esophageal adenocarcinoma in Example 1 of the present invention.

[0044] Figure 4 is a risk assessment scatter plot of the model constructed in Example 1 of the present invention, Figure 4 A: Scatter plot of patient groups based on risk scores; Figure 4 B: Scatter plot of the relationship between risk score and survival of EAC patients.

[0045] Figure 5 5A : Kaplan–Meier curve of the prognostic model for esophageal adenocarcinoma; Figure 5B: Kaplan–Meier curve of internal validation model 1 for esophageal adenocarcinoma; Figure 5 C: Kaplan–Meier curve of internal validation model 2 for esophageal adenocarcinoma; Figure 5 D: Nightingale rose plot of the AUC values ​​of the esophageal adenocarcinoma prognostic model, internal validation model 1, and internal validation model 2; Figure 5 E Radar plot of the CI values ​​of the esophageal adenocarcinoma prognostic model, internal validation model 1, and internal validation model 2.

[0046] Figure 6 This is a graph showing the relationship between the expression level of each miRNA and the overall survival rate in Example 1 of the present invention.

[0047] Figure 7 is a diagram showing a calibration curve for evaluating the prognostic model for esophageal adenocarcinoma in Example 1 of the present invention, Figure 7 A: 1-year calibration curve; Figure 7 B: 3-year calibration curve; Figure 7 C: Calibration curve for 4.3 years.

[0048] Figure 8 This is a graph showing the survival curves of mir-421 and mir-550a-1 in Example 2 of the present invention. Figure 8 A and 8D: survival curves of mir-421; Figure 8 B and 8E: survival curves of mir-550a-3p; Figure 8 C and 8F: Survival curves of mir-550a-3p.

[0049] Fig. 9 This is a diagram showing the expression of key prognostic miRNAs in esophageal adenocarcinoma cell lines and normal esophageal epithelial cell lines in Example 2 of the present invention. Fig. 9 A and 9B: Expression of miR-421 in Heec, OE33, and SEG-1 cells; Fig. 9 C and 9D: Expression of miR-550a-3p in Heec, OE33, and SEG-1 cells; Fig. 9 E and 9F: Expression of miR-550a-5p in Heec, OE33 and SEG-1 cells.

[0050] Fig.10 is a graph of Example 3 of the present invention showing differentially expressed mRNAs highly associated with EAC, Fig.10 A: Volcano plot of differential mRNAs; Fig.10 B: Heat map of differentially expressed mRNAs; Fig.10 C: Correlation characteristic diagram between mRNAs and normal esophageal tissue and esophageal adenocarcinoma tissue samples; Fig.10D: Venn diagram of differential mRNAs and blue modules.

[0051] Fig.11 It is a regulatory network diagram of miRNAs and their target genes in Example 3 of the present invention.

[0052] Fig.12 is a diagram showing the functional enrichment analysis of target genes in Example 3 of the present invention, Fig.12 A: biological pathways involved in the target gene; Fig.12 B: Molecular functions involved in target genes; Fig.12 C: Pathways in which the target gene participates.

[0053] Fig.13 is a graph showing the survival curve of the target gene and its expression in esophageal adenocarcinoma and normal esophageal tissue in Example 3 of the present invention, Fig.13 A-13H: Survival curve of target gene; Fig.13 I: Expression of target genes in esophageal adenocarcinoma and normal esophageal tissues.

[0054] Fig.14 This is a diagram showing the expression of the target gene in esophageal adenocarcinoma and normal esophageal tissue in Example 3 of the present invention.

[0055] Fig.15 is a diagram showing the effects of the expression of miR-421 and miR-550a-3p on the proliferation, migration and invasion of OE33 cells in Example 4 of the present invention, Fig.15 A and Fig.15 C represents the transfection efficiency of miR-421 and miR-550a-3p in OE33 cells, respectively; Fig.15 B and 15D show the effects of miR-421inhibitor and miR-550a-3p inhibitor on OE33 cell proliferation, respectively; Fig.15 E and 15F respectively show the effects of miR-421inhibitor and miR-550a-3p inhibitor on OE33 cell migration; Fig.15 G and 15H respectively show the effects of miR-421inhibitor and miR-550a-3p inhibitor on the invasion of OE33 cells.

[0056] Specific embodiment

[0057] The technical solution of the present invention is described in detail below in conjunction with specific embodiments and drawings.

[0058] The EAC cells OE33 and normal esophageal epithelial cells Heec used in the examples were purchased from Guangzhou Ruibo Biotechnology Co., Ltd.

[0059] miR-421 inhibitor and miR-550a-3p inhibitor were also purchased from Guangzhou Ruibo Biotechnology Co., Ltd.

[0060] The primers for the mature form of miR-421, miR-421, and the mature forms of miR-550a-1, miR-550a-3p and miR-550a-5p, were provided by Guangzhou Ruibo Biotechnology Co., Ltd.

[0061] Example 1: Acquisition of differential miRNAs highly associated with esophageal adenocarcinoma

[0062] The miRNA-seq data of 88 EAC tissues and 9 EAC para-tissues and their corresponding clinical characteristic data, such as overall survival (OS), survival status, age, gender and other clinical characteristic data, were downloaded from the TCGA database.

[0063] (1) Obtaining differentially expressed miRNAs highly associated with esophageal adenocarcinoma

[0064] Through “edgeR” differential analysis and weighted gene co-expression network analysis, 28 differential miRNAs were found to be highly correlated with EAC, among which 17 miRNAs were upregulated in EAC tissues compared with normal esophageal tissues, and 11 miRNAs were downregulated in EAC tissues, such as Figure 1 shown.

[0065] (2) Obtaining key miRNAs related to the prognosis of esophageal adenocarcinoma

[0066] The 28 differentially expressed miRNAs highly correlated with EAC were used as the basic data for this part of the study.

[0067] 1) Univariate Cox regression analysis to screen miRNAs related to prognosis of esophageal adenocarcinoma

[0068] In order to preliminarily obtain miRNAs related to EAC prognosis, the coxph() function in the "survival" function package in R was used to implement this process. By incorporating 28 miRNAs into univariate Cox regression analysis, a total of 4 miRNAs were screened out that were related to EAC prognosis (P < 0.05), of which 3 miRNAs had HR > 1, namely mir-421, mir-550a-1, and mir-4664, and 1 miRNA had HR < 1. The results are shown in Figure 2. Figure 2 As shown, the black dotted line represents HR=1, the left side of the dotted line is the protective factor, the right side is the risk factor, and the line segment represents the confidence interval.

[0069] Therefore, mir-421, mir-550a-1, and mir-4664 are risk factors in EAC, and mir-664a is a protective factor in EAC.

[0070] 2) Lasso regression analysis

[0071] Since false-positive miRNAs may appear in the four EAC prognostic miRNAs screened by univariate Cox regression analysis, in order to prevent the problem of false-positive prognostic miRNAs caused by overfitting of the data, the "glmnet" function package in R was used to solve this problem. Because the "glmnet" function package requires that when the patient's survival time is 0, the corresponding sample cannot be included in the Lasso regression analysis, the corresponding samples with a survival time of 0 are removed, and finally the sample data of 87 EAC patients are included in the Lasso regression analysis. By using the glmnet() function and glmnet.cv() function in the "glmnet" function package, the optimal lamda value is selected as 0.06019627, and 3 miRNAs related to EAC prognosis are screened. The results are as follows Figure 3 As shown, Figure 3 In A, each curve corresponds to a variable, representing a regression coefficient and its path change, that is, the number of variables that are non-zero under the current lamda value; Figure 3 B, Cross-validation curve (red) and standard deviation curves along the upper and lower lamda values. The vertical dashed lines are the minimum lamda value and the lamda value of the most regularized model, respectively.

[0072] 3) Establishment of a prognostic model for esophageal adenocarcinoma and its evaluation and screening of key miRNAs for the prognosis of esophageal adenocarcinoma

[0073] To obtain the key miRNAs related to the prognosis of esophageal adenocarcinoma, univariate Cox and Lasso regression were used to analyze the differential miRNAs and the EAC prognostic model was constructed based on the multivariate Cox regression algorithm;

[0074] Multivariate Cox regression analysis was used to obtain the regression coefficient of mir-421 (0.3896754) and the regression coefficient of mir-550a-1 (0.5312030). Based on the regression coefficients and the expression values ​​of mir-421 and mir-550a-1, the risk score of each EAC patient was calculated. The formula for calculating the risk score is:

[0075] Risk score=Expression mir-421 0.3896754+Expression mir-550a-1 0.5312030

[0076] Using the median risk score as the threshold, the EAC samples were divided into high-risk group and low-risk group ( Figure 4 A), thus constructing a prognostic risk model of miRNAs. In the model, as the risk score increases, the number of EAC patients who die also increases ( Figure 4 B).

[0077] The prognostic model was evaluated using receiver operating characteristic curve (ROC), consistency index and calibration curve; the EAC patients were randomly divided into internal validation sets 1 and 2 using the "caret" function package to verify the predictive ability of the prognostic model and perform separate survival analysis and ROC analysis on the prognostic miRNAs to determine the key miRNAs for EAC prognosis. The results showed that the KM (Kaplan Meier, KM) survival analysis showed that the overall survival rate of EAC patients in the low-risk group was significantly higher than that of EAC patients in the high-risk group, which revealed that the prognosis of EAC patients in the high-risk group was poor, as shown in Figures 5A-5C, Entirety, Validation 1 and Validation 2 represent the esophageal adenocarcinoma prognostic model, internal validation model 1 and internal validation model 2, respectively;. The ROC curve results showed that the 1- to 5-year AUC values ​​of the overall, internal validation set 1 and internal validation set 2 were all greater than 0.7, as shown in Figures 5A-5C. Figure 5 D shows the Nightingale rose plot of the AUC values ​​of the esophageal adenocarcinoma prognostic model, internal validation model 1, and internal validation model 2. At the same time, the CI values ​​of the EAC prognostic model for the overall, internal validation set 1, and internal validation set 2 were 0.69, 0.68, and 0.67, respectively. Figure 5 E. These results all show that the EAC prognostic model has good predictive ability.

[0078] Finally, a nomogram of the EAC prognostic model was further constructed to predict the relationship between the expression levels of each miRNAs and the overall survival rate of EAC patients, e.g. Figure 6 As shown, the scale bars represent the expression, score, total score and 1, 3 and 5-year survival rates of miRNAs. The results showed that with the increase in the expression of mir-421 and mir-550a-1, the higher the score and total score, the shorter the 1-year, 3-year and 5-year survival time of EAC patients, indicating that high expression of mir-421 and mir-550a-1 is associated with the poor prognosis of EAC.

[0079] To further evaluate the accuracy of the EAC prognostic model, a calibration curve was used to evaluate the EAC prognostic model, such as Figure 7As shown, the abscissa and ordinate represent the predicted event (living and dying) incidence and the observed actual event incidence, respectively; the dotted line and solid line in the figure represent the predicted event probability = observed event probability and the fitting curve, respectively. The results show that the EAC prognostic model has good predictive performance.

[0080] The above results indicate that mir-421 and mir-550a-1 play a very important role in the EAC prognostic model, revealing that mir-421 and mir-550a-1 are key miRNAs for EAC prognosis.

[0081] Example 2: Acquisition of mature mir-421 and mir-550a-1 and the prognostic value of mature mir-421 and mir-550a-1

[0082] Through the miRbase database, the mature forms of key mir-421 and mir-550a-1 related to EAC prognosis were obtained. The results showed that there was only one mature form of mir-421 (miR-421) and two mature forms of mir-550a-1 (miR-550a-3p and miR-550a-5p).

[0083] Through the Bioinformatics Analysis Home database, the expression values ​​of miR-421, miR-550a-3p, and miR-550a-5p in EAC tissues were obtained. Based on the optimal cutoff values ​​of the three miRNAs expression values, EAC patients were divided into two groups, namely the high expression group and the low expression group. The results showed that the overall survival rate of patients in the high expression group was significantly lower than that of patients in the low expression group. Figure 8 As shown in A-8C, the purple line and the blue line in the figure represent the overall survival rates of patients in the high expression group and the low expression group, respectively.

[0084] To ensure the accuracy of the results, the median was used to group the expression of EAC patients. Figure 8 As shown in D-8F, the overall survival rate of patients in the high expression group was lower than that of patients in the low expression group.

[0085] Expression verification of mature miRNAs key to prognosis in esophageal adenocarcinoma cells

[0086] In order to verify the expression of mature forms of key miRNAs for EAC prognosis in EAC cells and normal esophageal epithelial cells, qRT-PCR was used to detect the expression levels of mature forms of miR-421, miR-421, and mature forms of miR-550a-1, miR-550a-3p and miR-550a-5p in EAC cells OE33, SEG-1 and normal esophageal epithelial cells Heec. Fig. 9As shown in A-9F, (A) and (B) the expression of miR-421 in Heec, OE33 and SEG-1 cells; (C) and (D) the expression of miR-550a-3p in Heec, OE33 and SEG-1 cells; (E) and (F) the expression of miR-550a-5p in Heec, OE33 and SEG-1 cells; **P<0.01; ***P<0.001.

[0087] The results showed that the expression of miR-421, miR-550a-3p and miR-550a-5p in EAC cells was significantly higher than that in Heec cells (P < 0.05). Therefore, the three miRNAs were included in the subsequent biological function study.

[0088] Example 3: Prediction and identification of target genes of mature miRNAs critical for the prognosis of esophageal adenocarcinoma

[0089] 1) Obtain differential mRNAs highly associated with esophageal adenocarcinoma

[0090] It has been found that miR-421, miR-550a-3p and miR-550a-5p are significantly highly expressed in EAC tissues / cells, revealing that miR-421, miR-550a-3p and miR-550a-5p may affect the occurrence and development of EAC. Therefore, in order to obtain the target genes of miR-421, miR-550a-3p and miR-550a-5p, the "edgeR" function package and combined WGCNA were used to screen mRNAs that were highly related to EAC and downregulated in EAC tissues, providing data support for subsequent prediction of target genes.

[0091] The results of differential analysis showed that 3390 differential mRNAs were screened, of which 1155 mRNAs were significantly upregulated in EAC tissues compared with normal esophageal tissues, and 2235 mRNAs were significantly downregulated in EAC tissues, such as Fig.10 As shown in A and 10B, Fig.10 A is the volcano plot of differential mRNAs; Fig.10 B is a heat map of differential mRNAs. The WGCNA analysis results show that a total of 5 modules were screened, among which the blue module has the highest correlation coefficient with EAC (cor=0.62). Fig.10 As shown in C, Fig.10C is the correlation feature diagram between mRNAs and normal esophageal tissue and esophageal adenocarcinoma tissue samples. The Venn diagram of differential mRNAs and blue modules shows that 610 differential mRNAs highly correlated with EAC were screened, among which 178 mRNAs highly correlated with EAC and downregulated in EAC tissues were screened compared with normal esophageal tissues, such as Fig.10 As shown in D.

[0092] 2) Prediction of target genes of mature miRNAs key to prognosis of esophageal adenocarcinoma

[0093] In order to predict the downstream target genes of miR-421, miR-550a-3p and miR-550a-5p, miRDB, miRTarBase, miRwalk and TargetScan were applied to the prediction of target genes, and the prediction results were intersected with the mRNAs that were highly correlated with EAC and downregulated in EAC tissues. The results showed that 20 target genes downregulated in EAC tissues were preliminarily predicted, among which NR3C2, KCNJ15, THRB, SLC18A2, MXI1, PPM1L, and ELAVL2 were target genes of miR-421, KCNJ15, THRB, PRKACB, PDCD4, MYO9A, LMF1, REEP1, ASAP3, and CPEB3 were target genes of miR-550a-3p, and ECHDC2, LMF1, RPS6KA5, NT5C1B, BCL2L2, PTPN21, and SCNN1G were target genes of miR-550a-5p. Fig.11 As shown, miRNAs and target genes are indicated, respectively.

[0094] 3) Functional enrichment analysis to identify target genes

[0095] The enrichment analysis results of the 20 target genes showed that the target genes were only enriched in biological pathways (BP) and molecular functions (MF). The genes enriched in BP included biological behavior, cellular lipid response, cytokine stimulation response, dephosphorylation, and active regulation of defense response, such as Fig.12 As shown in A. The MF involved mainly includes cation transmembrane transport activation, phosphoester hydrolase activation, and phosphatase activation, such as Fig.12 As shown in B. KEGG enrichment analysis showed that 4 target genes were enriched in the miRNAs cancer pathway, such as Fig.12 As shown, PRKACB and PDCD4 are the target genes of miR-550a-3p, and RPS6KA5 and BCL2L2 are the target genes of miR-550a-5p.

[0096] 4) Survival analysis to identify target genes

[0097] In order to obtain target genes associated with the prognosis of EAC, survival analysis of the target genes was performed. The analysis results showed that among the 20 target genes, low expression of ASAP3, BCL2L2, LMF1, PPM1L, PTPN21, SLC18A2, and NR3C2 were associated with poor prognosis of EAC, such as Fig.13 As shown in A-13I, high expression of ELAVL2 was associated with poor prognosis of EAC, as shown in Figures 13H-13I, **P<0.01; ***P<0.001.

[0098] 5) Verification of target gene expression level

[0099] In previous studies, it was found that the target genes PRKACB, PDCD4, RPS6KA5 and BCL2L2 were enriched in the miRNAs cancer pathway; low expression of target genes ASAP3, BCL2L2, PTPN21, PPM1L, SLC18A2, NR3C2 and LMF1 was associated with poor prognosis in EAC. Therefore, in order to verify the expression levels of these 10 target genes in EAC tissue and normal esophageal tissue, 662 EAC normal esophageal tissue samples and 78 EAC tissue sample data in the Xena data were integrated, normalized and batch effects were removed, and the corresponding target gene expression data were analyzed and box plots were drawn, as shown in Figure 14, ***P < 0.001, NSP > 0.05.

[0100] The results showed that except for NR3C2, the expression of the remaining target genes in EAC tissue was significantly lower than that in normal esophageal tissue. Therefore, except for NR3C2, the 10 target genes were consistent with the previous results, which revealed that PPM1L and SLC18A2, ASAP3, LMF1, PRKACB and PDCD4, BCL2L2, PTPN21 and RPS6KA5 may be the key target genes of miR-421, miR-550a-3p, and miR-550a-5p, respectively.

[0101] Example 4: Cell Testing

[0102] The expression of miR-421 and miR-550a-3p in EAC cell lines was significantly higher than that in normal esophageal epithelial cells Heec. Therefore, miR-421inhibitor and miR-550a-3p inhibitor (both purchased from Guangzhou Ruibo Biotechnology Co., Ltd.) were used to transfect the OE33 cell line to exogenously inhibit the expression of miR-421 and miR-550a-3p. After transfection with miR-421inhibitor and miR-550a-3p inhibitor, the expression levels of miR-421 and miR-550a-3p in OE33 cells were knocked down by more than 75% compared with the negative control group, as shown in Figure 2. Fig.15 A and Fig.15 As shown in C.

[0103] CCK-8 assay revealed that knocking down the expression of miR-421 and miR-550a-3p could significantly reduce the proliferation ability of OE33 cells. Fig.15 B and Fig.15 As shown in D, this indicates that knocking down the expression of miR-421 and miR-550a-3p can significantly inhibit the proliferation of OE33 cells.

[0104] In order to study the effects of miR-421 and miR-550a-3p on the migration of OE33 cells, the transfected miR-421inhibitor and miR-550a-3p inhibitor were respectively subjected to Transwell migration assay. The results showed that after transfection with miR-421inhibitor and miR-550a-3p inhibitor, the number of OE33 cells migrating was significantly reduced compared with the control group (P < 0.05). Fig.15 E and Fig.15 As shown in F.

[0105] In order to study the effects of miR-421 and miR-550a-3p on the invasion of OE33 cells, transfected miR-421inhibitor and miR-550a-3p inhibitor were used for transwell invasion assay. The results showed that after transfection of miR-421inhibitor and miR-550a-3p inhibitor, the number of OE33 cells invading was significantly reduced compared with the negative control group (P < 0.05). Fig.15 G and Fig.15 As shown in H.

[0106] **P<0.01; ***P<0.001

[0107] Based on the above research progress, the upregulation of miR-421 can play a vital role in the occurrence and development of EAC and the prognosis of EAC patients by binding to and inhibiting the expression of PPM1L and SLC18A2; the upregulation of miR-550a-3p can play a vital role in the occurrence and development of EAC and the prognosis of EAC patients by binding to and inhibiting the expression of ASAP3, LMF1, PRKACB and PDCD4; the upregulation of miR-550a-5p can play a vital role in the occurrence and development of EAC and the prognosis of EAC patients by binding to and inhibiting the expression of BCL2L2, LMF1, PTPN21 and RPS6KA5.

[0108] Table 1 Target gene primer sequences

[0109] SEQUENCE LISTING <110> Zhengzhou University <120> A molecular marker for prognosis of esophageal adenocarcinoma and its application <130> Z9084 <160> 20 <170> PatentIn version 3.3 <210> 1 <211> 25 <212> DNA <213> Artificial sequence <400> 1 gagttacttc ttccacaccg acgag 25 <210> 2 <211> twenty four <212> DNA <213> Artificial sequence <400> 2 gctaccttgc ccttcaccat cttc 24 <210> 3 <211> twenty four <212> DNA <213> Artificial sequence <400> 3 gtccttctgc tggtggtgct attg 24 <210> 4 <211> 24 <212> DNA <213> Artificial sequence <400> 4 ttcttctttg gcaggtggac ttcg 24 <210> 5 <211> 24 <212> DNA <213> Artificial sequence <400> 5 acaagcagtt tgggacggag aaag 24 <210> 6 <211> 25 <212> DNA <213> Artificial sequence <400> 6 cagccatact tgactccaca cttcc 25 <210> 7 <211> 23 <212> DNA <213> Artificial sequence <400> 7 tccactatga gacccagccg atg 23 <210> 8 <211> 23 <212> DNA <213> Artificial sequence <400> 8 aagaggaaga agggcaccag gag 23 <210> 9 <211> 24 <212> DNA <213> Artificial sequence <400> 9 gtggattggt gggcattagg agtg 24 <210> 10 <211> 25 <212> DNA <213> Artificial sequence <400> 10 ctgaactgaa gtgggatggg aatcg 25 <210> 11 <211> 24 <212> DNA <213> Artificial sequence <400> 11 caaagggaag gttgctggat aggc 24 <210> 12 <211> 24 <212> DNA <213> Artificial sequence <400> 12 tccacctcct ccacatcata cacc 24 <210> 13 <211> 25 <212> DNA <213> Artificial sequence <400> 13 cgccttgtag ccttctttgt ctttg 25 <210> 14 <211> 23 <212> DNA <213> Artificial sequence <400> 14 caccatccac tcctgcactt gtc 23 <210> 15 <211> 22 <212> DNA <213> Artificial sequence <400> 15 gccccacccc agactatgag ac 22 <210> 16 <211> 22 <212> DNA <213> Artificial sequence <400> 16 gtacgagctg ccgatgttga gg 22 <210> 17 <211> 24 <212> DNA <213> Artificial sequence <400> 17 aaactacacc caccaagaca ctgc 24 <210> 18 <211> 24 <212> DNA <213> Artificial sequence <400> 18 actgagtccg agaactggaa gagg 24 <210> 19 <211> 20 <212> DNA <213> Artificial sequence <400> 19 caggaggcat tgctgatgat 20 <210> 20 <211> 18 <212> DNA <213> Artificial sequence <400> 20 gaaggctggg gctcattt 18

Claims

1. Application of miR-550a-3p, a prognostic molecular marker for esophageal adenocarcinoma, in constructing a prognostic model for esophageal adenocarcinoma.

2. The use according to claim 1, characterized in that High expression of miR-550a-3p indicates poor prognosis in esophageal adenocarcinoma.

3. Application of reagents for detecting the molecular marker miR-550a-3p in the preparation of diagnostic kits for esophageal adenocarcinoma.

Images