A DNA nanoflower and its preparation method and use

Abstract

The present invention discloses a DNA nanoflower and its preparation method and use. The present invention focuses on a treatment strategy that synergistically promotes bone formation and anti-resorption. A novel DNA nanoflower (DNFs) rich in Ca2+ and multivalent CpG is constructed by an optimized rolling circle amplification technique for the treatment of osteoporosis. Compared with existing osteoporosis treatment drugs, DNFs utilize the acidic microenvironment on the bone surface of osteoclasts to acid-responsive release Ca2+, repair damaged bone tissue by enhancing bone collagen mineralization, and enhance bone hardness. On the other hand, DNFs can utilize multivalent CpG to inhibit osteoclast activity through cellular immune regulation and reduce the absorption of bone by osteoclasts. The DNFs prepared by the present invention can effectively synergistically immunomodulate and enhance bone repair for the combined treatment of osteoporosis, is expected to expand the universality of the application of DNA nanomaterials, and also provides a new theoretical basis and technical guarantee for the treatment of osteoporosis by nanotechnology.

Description

Technical Field

[0001] The present invention relates to the technical field of osteoporosis, in particular to a DNA nanoflower and its preparation method and use. Background Art

[0002] Osteoporosis is a systemic bone metabolic disease, and its pathological characteristics are reduced bone mass, increased bone fragility and fracture susceptibility. At present, in the research on the etiology and mechanism of osteoporosis, the irreversible dissolution of bone minerals and the degradation of organic components caused by the abnormal activation of osteoclasts are the key factors leading to the occurrence of osteoporosis. However, the current clinical treatment methods mainly focus on the biological intervention of osteoclasts, while ignoring the repair of damaged bones.

[0003] The rolling circle amplification (RCA) technology established in 1998 can be used to amplify large circular DNA templates, such as plasmids and phages. Using this technology, inorganic-DNA hybrid nanostructures in the shape of flowers can be prepared. However, most of the existing technologies use Mg ions as cofactors of DNA polymerase to prepare Mg-based DNA nanoflowers. The traditional experimental protocol is as follows:

[0004] (1) Prepare the template / primers (padlock probes) dimer

[0005] Mix the template and primers (padlock probes) at a concentration ratio of 1:2 (10 μM:20 μM), and make up the system with 1×PBS. Aliquot the mixed volume into 50 μL / tube and place it in a PCR instrument for annealing treatment to form a stable template / primers (padlock probes) dimer. The annealing steps are: 95°C, 3 min; cool down to 12°C at 1°C / min and store.

[0006] (2) Circularize the template

[0007] Prepare the cross-linking system (final concentration) according to the following component concentrations: 2 μM template / primers mixture (calculated according to the template concentration), 30 U / μL T4 DNA ligase, 1×T4 DNA ligase buffer.

[0008] Aliquot into 50 μL / tube for cross-linking to form a complete circular structure. The cross-linking steps are: overnight at 16°C (more than 12 hours), inactivate by heating at 75°C for 10 min.

[0009] The final product is centrifugally purified through a 10 kD ultrafiltration centrifugal tube to remove the buffer components in the system and avoid interfering with the subsequent reaction process.

[0010] (3) Verify the circularization effect

[0011] The cyclization effect can be verified by polyacrylamide gel electrophoresis as follows (final concentration):

[0012] In a 50 μL system, add 25 μL of the above-mentioned cyclized product, 1 μL of Exo I, 0.5 μL of Exo III, and 1×Exo I / Exo III buffer, and make up the system with water. The system reacts at 37 °C for 1 h to fully degrade the templates and single-stranded primers (padlock probes) that have not been successfully cyclized.

[0013] The degradation products are verified by 15% polyacrylamide gel electrophoresis. The presence of an obvious single band in the degraded products is regarded as successful.

[0014] The cyclization efficiency can be simply verified by comparing the gray levels of the uncyclized template single-strand and the degraded products.

[0015] (4) Rolling circle amplification

[0016] Based on the product of step 2, rolling circle amplification is carried out. The system is as follows (final concentration): 500 nM cyclized template / primers (padlock probes), 1 mM dNTP, 0.5 U / μL phi29 DNA polymerase, 1×phi29 DNA polymerase buffer, and make up the system with water.

[0017] The mixed system reacts at 30 °C for a certain time, and the specific reaction duration depends on the requirements and the amplification effect of the sequence.

[0018] After the reaction, the enzyme can be inactivated by choosing 75 °C for 10 min. The design with a long amplification time is beneficial to the formation of nanoflowers. Or the product can be purified through a 50 kD ultrafiltration centrifugal tube to remove unreacted dNTP and buffer components, which is beneficial to the formation of DNA-based structures such as linear / aggregated structures.

[0019] (5) Verification of amplification effect

[0020] The rolling circle amplification effect needs to be verified by 2% agarose gel electrophoresis.

[0021] Most of the existing technologies use Mg ions as cofactors of DNA polymerase to prepare DNA nanoflowers. As the main inorganic component of DNA nanoflowers, Mg ions have poor in vivo safety and no special functions, and these characteristics seriously limit the clinical use of DNA nanoflowers prepared based on Mg ions. Therefore, it is necessary to design a DNA nanoflower and its preparation method and use. Summary of the invention

[0022] In order to overcome the defects in the prior art, a DNA nanoflower and its preparation method and use are provided.

[0023] The present invention is realized through the following solutions:

[0024] A DNA nanoflower, which contains Ca ions and multivalent CpGs.

[0025] A method for preparing a DNA nanoflower, the method comprising the following steps:

[0026] First step: Mix 100 μM phosphorylated template and 200 μM primary primer in a ratio of 1:2 in PBS or aqueous solution to obtain a mixture;

[0027] Second step: Subject the mixture obtained in the first step to multiple cycles of heating, and then gradually cool it to 20 °C using a PCR thermal reactor;

[0028] Third step: Prepare circular DNA using the product cooled to 20 °C obtained in the second step. After annealing, add T4 DNA ligase and T4 DNA ligase buffer, and incubate the reaction solution overnight at 16 °C; Heat the reaction solution to 65 °C for 10 minutes to form a closed DNA ring;

[0029] Fourth step: Then mix the closed DNA ring obtained in the third step with Phi29 DNA polymerase and dNTPs in a reaction buffer solution, and react at 37 °C for 2 h;

[0030] Fifth step: Mix the product obtained in the fourth step with Ca 2+ Mix, and then incubate at room temperature for 24 hours to terminate the reaction to obtain a DNA nanoflower containing Ca 2+ and multivalent CpGs.

[0031] In the first step, the serial number of the phosphorylated template is: GACTGGTATATTTTTTAACGTCAGGAACGTCATGGATTTTTAACGCTATAGT;

[0032] The serial number of the primary primer is: ATATACCAGTCACTATAGCGTT.

[0033] In the second step, the specific steps of the cyclic heating are: heat at 95 °C for 2 minutes, heat at 65 °C for 2 minutes, gradually cool to 60 °C at a rate of 1 °C / min, then heat at 95 °C for 2 minutes again, heat at 65 °C for 2 minutes again, and gradually cool to 60 °C at a rate of 1 °C / min again. The number of cycles of the cyclic heating is 80 times.

[0034] In the third step, the concentration of the T4 DNA ligase is 2 U / μL.

[0035] The DNA nanoflower is used for treating osteoporosis.

[0036] The beneficial effects of the present invention are:

[0037] The present invention focuses on the therapeutic strategy of synergistically promoting bone formation and resisting bone resorption. Through the optimized rolling circle amplification technology, a new DNA nanoflower (DNFs) rich in Ca2+ and multivalent CpG is constructed for the treatment of osteoporosis. Compared with existing osteoporosis treatment drugs, DNFs utilize the acidic microenvironment acid response between osteoclasts and the bone surface to release Ca2+, repair damaged bone tissue by enhancing bone collagen mineralization, and enhance bone hardness. On the other hand, DNFs can utilize multivalent CpG to inhibit osteoclast activity through cellular immune regulation and reduce the absorption effect of osteoclasts on bones. The DNFs prepared by the present invention can effectively synergize immune regulation and enhance bone repair to treat osteoporosis, which is expected to expand the extensive application of DNA nanomaterials and provide a new theoretical basis and technical guarantee for the treatment of osteoporosis with nanotechnology. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 .Preliminary results of the preparation and characterization of the new DNA nanoflower. Transmission electron microscopy (a) and scanning electron microscopy (b) results of the new DNA nanoflower. (c) High-resolution transmission electron microscopy mapping results of the new DNA nanoflower. (d) DLS hydration particle size results of the new DNA nanoflower.

[0039] Figure 2 .Preliminary results of the novel DNA nanoflowers enhancing bone collagen mineralization. (a) Transmission electron microscopy results of the novel DNA nanoflowers in different acidic environments. (b) Micro-CT results show the changes in fluorescence intensity of the CpG complementary sequence in the novel DNA nanoflowers at different amplification times. (c) Agarose gel electrophoresis results of the novel DNA nanoflowers and free CpG after treatment in serum (upper figure) and DNA enzyme (lower figure) environments.

[0040] Figure 3 .Preliminary results of the novel DNA nanoflower inhibiting osteoclastogenesis. (ab) Confocal microscopy to evaluate the changes in the cell contour and morphology of osteoclasts after treatment with different drugs. (cd) TRAP staining to evaluate the changes in the number and distribution of osteoclasts after treatment with different drugs. (e) WB analysis of the expression of osteoclast function effector proteins (NFAT2, c-Fos, CTSK) after treatment with different drugs.

[0041] Figure 4 .Biological safety evaluation of DNA nanoflowers. (a) The uptake of DNA nanoflowers by macrophages is dose-dependent. (b) CCK-8 results show that high doses of DNA nanoflowers do not cause significant cell damage to macrophages. (c) Cell death and viability staining results show that high doses of DNA nanoflowers do not cause significant damage to macrophages.

[0042] Figure 5.DNA nanoflowers can reverse ovariectomy (OVX)-induced bone loss in mice. (a) Schematic diagram of the establishment of the OVX mouse model and experimental design for evaluating the protective effect of DNFs. (b, c) Micro-CT evaluation showed that DNFs could well prevent tibial bone mass. (d, e) H&E and TRAP staining images showed that in OVX mice treated with DNFs, more bone microstructures were maintained and fewer osteoclasts were formed on the bone surface. (f) Statistical results of the ultimate force, stiffness, elastic modulus, and ultimate stress of the three-point bending test of the midshaft of the tibia in OVX mice treated with DNA nanoflowers. Detailed implementation mode

[0043] The preferred embodiments of the present invention will be further described below in conjunction with the accompanying drawings:

[0044] A DNA nanoflower, which contains Ca ions and multivalent CpGs.

[0045] A method for preparing a DNA nanoflower, which includes the following steps:

[0046] First step: Mix 100 μM phosphorylated template and 200 μM primary primer in a ratio of 1:2 in PBS or aqueous solution to obtain a mixture;

[0047] Second step: Heat the mixture obtained in the first step through multiple cycles in sequence, and then gradually cool it to 20 °C using a PCR thermal reactor;

[0048] Third step: Prepare circular DNA with the product cooled to 20 °C obtained in the second step. After annealing, add T4 DNA ligase and T4 DNA ligase buffer, and incubate the reaction solution overnight at 16 °C; Heat the reaction solution to 65 °C and maintain it for 10 minutes to form a closed DNA ring;

[0049] Fourth step: Then mix the closed DNA ring obtained in the third step with Phi29 DNA polymerase and dNTPs in a reaction buffer solution and react at 37 °C for 2 h;

[0050] Fifth step: Mix the product obtained in the fourth step with Ca 2+ and incubate at room temperature for 24 hours to terminate the reaction to obtain a DNA nanoflower containing Ca 2+ and multivalent CpGs.

[0051] In the first step, the serial number of the phosphorylated template is: GACTGGTATATTTTTTAACGTCAGGAACGTCATGGATTTTTAACGCTATAGT;

[0052] The serial number of the primary primer is: ATATACCAGTCACTATAGCGTT.

[0053] In the second step, the specific steps of the cyclic heating are as follows: heating at 95°C for 2 minutes, heating at 65°C for 2 minutes, gradually cooling to 60°C at a rate of 1°C / min, then heating at 95°C for 2 minutes again, heating at 65°C for 2 minutes again, and gradually cooling to 60°C at a rate of 1°C / min again. The number of cycles of the cyclic heating is 80 times.

[0054] In the third step, the concentration of the T4 DNA ligase is 2 U / μL.

[0055] The DNA nanoflowers are used for treating osteoporosis.

[0056] The present invention is different from the existing methods for preparing DNA nanoflowers. Ca ions are used as cofactors of DNA polymerase to prepare DNA nanoflowers. Ca ions are important components in the human body and can effectively supplement the lack of Ca ions during the occurrence of osteoporosis, showing high clinical translation prospects.

[0057] The present invention first uses Ca ions as cofactors of Phi29 DNA polymerase to prepare novel DNA nanoflowers rich in Ca ions for the treatment of osteoporosis. The present invention first uses DNA strands encoding CpG as templates to prepare novel DNA nanoflowers loaded with multivalent CpG. The present invention first uses DNA nanoflowers rich in Ca ions and multivalent CpG to treat osteoporosis by anti-resorption and promoting bone formation.

[0058] Characterization and optimization of the preparation conditions of the DNA nanoflower material of the present application

[0059] The obtained novel DNA nanoflowers are comprehensively characterized by various electron microscopy techniques and spectroscopy methods, such as scanning electron microscopy, (high-resolution) transmission electron microscopy, atomic force microscopy, and inductively coupled plasma resonance. The hydrodynamic diameter of the novel DNA nanoflowers is examined by dynamic light scattering (DLS) using a ZetaSizer Nano ZS instrument. Novel DNA nanoflower materials with ideal physical and chemical properties are prepared by optimizing the preparation conditions (such as reaction time, reaction temperature, and feed ratio of each component).

[0060] According to the above research plan, from the results of transmission electron microscopy ( Figure 1 a) and scanning electron microscopy ( Figure 1 b), it can be seen that in the preliminary experiment, we have successfully prepared spherical and flower-shaped nanoparticles with round and uniform particle structures. More importantly, the results of transmission electron microscopy mapping elemental analysis ( Figure 1 c) show that Ca is successfully loaded into the DNA nanoflowers 2+, It is preliminarily proved that the novel DNA nanoflowers can effectively deliver Ca 2+ , and is expected to enhance the ability of bone collagen mineralization. At the same time, the DLS data shows ( Figure 1 d), the novel DNA nanoflowers prepared by us have a hydrodynamic diameter of about 350 nm, which is consistent with the transmission electron microscopy results.

[0061] Evaluation of the mechanism of enhanced collagen mineralization by the DNA nanoflower material of this application

[0062] Add the DNA nanoflowers to 400 μL of PBS buffer with pH values of 7.4 and 5.0 respectively. After incubation at 37 °C for different times, the released calcium ions are collected with an ultrafiltration tube, and the released Ca 2+ concentration is measured by a calcium colorimetric assay kit or inductively coupled plasma optical emission spectrometer.

[0063] Bilateral ovariectomy was performed on 8-week-old female Sprague-Dawley rats (body weight 290 - 330 g) to induce an osteoporosis model. After sacrificing the rats, the osteoporotic tibias were cut into thin slices and dried in an oven at 37 °C for 7 days before use. The novel DNA nanoflowers were injected into the osteoporotic bones, and then the bones were placed in a 37 °C water bath for 14 d. After that, the bones were dried at room temperature before further experiments. A high-resolution micro-CT scanner was used to measure the changes in bone microstructure and perform quantitative analysis. Scanning electron microscopy was further used to observe the changes in osteoporotic microstructure and detect the calcium and phosphorus contents in osteoporotic bone.

[0064] Due to the overactivation of osteoclasts secreting a large amount of acid, the osteoporotic microenvironment is in an acidic environment, and this acidic environment is expected to promote the release of the loaded Ca 2 from the DNA nanoflowers, thus better enhancing collagen mineralization. The transmission electron microscopy results show ( Figure 2 a), by incubating the novel DNA nanoflowers in an acidic environment, the flower-like structure is destroyed, preliminarily proving that the acidic environment can promote the release of Ca 2+ . By simulating the in vivo collagen mineralization environment, the micro-CT results show ( Figure 2 b - c), the novel DNA nanoflowers can enhance bone collagen mineralization, and the DNA nanoflowers pretreated with an acidic environment in advance can enhance the collagen mineralization process. At the same time, more refined mineralization results can also be observed using scanning electron microscopy ( Figure 2 d).

[0065] Evaluation of the mechanism of the DNA nanoflowers of this application in inhibiting osteoclasts

[0066] Study on the inhibition of osteoclasts by novel DNA nanoflowers: Bone marrow-derived macrophages were isolated from 6-8-week-old C57 mice. Briefly, the bone marrow cells in the femurs and tibias were flushed out. To obtain pure bone marrow-derived macrophages (BMMs), non-adherent cells were collected and cultured in α-MEM medium supplemented with 25 ng / mL M-CSF. Then, the adherent cells were washed three times with PBS and seeded onto 12-well plates. After incubation with M-CSF (30 ng / mL) and RANKL (100 ng / mL) for 3 days, a certain concentration of novel DNA nanoflowers was added for co-culture. After 5 days of treatment, techniques such as Actin cytoskeleton staining and TRAP staining were used to examine the ability of DNFs to inhibit osteoclastogenesis. To explore the effect of inhibiting cell fusion, cells were pre-labeled with the blue fluorescent nuclear dye Hoechst or the red fluorescent cell membrane dye CM-Dil and incubated at room temperature for 10 minutes. The two groups of cells were placed together on the culture plate, and after co-incubation with DNA nanoflowers for 24 hours, the medium was removed and fluorescence microscopy was performed to examine cell fusion.

[0067] Bone resorption assay: Bone marrow-derived macrophages BMMs were seeded onto the surface of freeze-dried bovine bone slices at a density of 2×105 cells / well to simulate the in vivo bone resorption process. RANKL (50 ng / mL) was added to stimulate osteoclastogenesis in the cells for 5 days, and DNA nanoflowers were added to the solution. After the experiment, the bone slices were fixed with 4% paraformaldehyde (PFA) for 30 min, and the surface cells were scraped off with a brush. Then the bone slices were sputter-coated with Au-Pd and the osteoclast erosion of the bone surface was observed by SEM.

[0068] Osteoclasts are formed by the fusion of bone marrow-derived macrophages, and are accompanied by the characteristics of large cell volume and many tentacles. Therefore, the effect of drugs on osteoclastogenesis can be investigated by observing the changes in cell morphology. The results of Actin staining showed ( Figure 3 a-b) that after induction with RANKL, the cell volume increased and the tentacles became more numerous, indicating that bone marrow-derived macrophages were successfully induced to differentiate into osteoclasts. The formation of osteoclasts was inhibited after the addition of CpG, indicating that free CpG could inhibit the differentiation of bone marrow-derived macrophages into osteoclasts. The inhibitory effect was stronger after the addition of DNA nanoflowers containing an equal amount of CpG. One reason is that the DNA nanoflowers shown in the above results can give better stability to CpG, and another reason may be that DNA nanoflowers increase the cellular uptake of CpG. After using the osteoclast-specific identification method TRAP staining, it was also observed that DNA nanoflowers could better inhibit the differentiation of bone marrow-derived macrophages into osteoclasts compared with free CpG ( Figure 3 c-d). The WB results further showed ( Figure 3e), DNA nanoflowers can inhibit the expression of osteoclast-related proteins, demonstrating the inhibitory effect of DNA nanoflowers on osteoclasts.

[0069] In vitro biological property study: The newly prepared DNA nanoflower materials were evaluated for their biological effects in multiple aspects. First, classical MTT, CCK-8 assays, and Calcein-AM / PI assay were used to study the toxicity of the nanoflower materials to different types of cells (epithelial cells, macrophages, osteoclasts). On this basis, the integrity of the cell membrane and DNA damage of various cells after treatment with DNA nanoflowers were evaluated. Bone marrow-derived macrophages were isolated from 6-8-week-old C57 mice. The bone marrow-derived macrophages obtained by the above method were seeded into 96-well plates (1×104 cells / well), and different amounts of DNA nanoflowers were added and incubated for 24 h to determine the cytotoxicity.

[0070] The results showed ( Figure 4 a), as the amount of nanoflowers added increased, the fluorescence intensity of the nanoparticles in the cells gradually increased, indicating that the uptake of nanoflowers in cells showed a dose-dependent characteristic. CCK-8 ( Figure 4 b) and cell viability staining ( Figure 4 c) results showed that even when the amount of nanoflowers added reached 100 μM, it did not cause obvious damage to the cells, demonstrating its good biocompatibility.

[0071] Evaluation of the anti-osteoporosis and safety of the DNA nanoflowers of the present application

[0072] Investigation of the ability of DNA nanoflowers to relieve osteoporosis in vivo: First, an osteoporosis model was constructed by bilateral ovariectomy of female mice. The ability of DNFs to relieve bone loss was investigated by intrabone cavity administration. The reliability of the intrabone cavity administration method was investigated using fluorescence labeling and a live imaging system, and the metabolism of DNFs in vivo was also investigated. The mouse leg bones were taken out, and methods such as TRAP staining, ALP staining, micro-CT, ELISA bone formation index, and mechanical experiments were used to systematically investigate the ability of DNFs to relieve osteoporosis.

[0073] Force.

[0074] Two months after the operation, micro-CT was used to evaluate the protective effect of the bone scaffold in the tibia. As Figure 5 shown in a, in mice, the bone loss induced by the OVX procedure was inhibited, and the osteopenia phenotype of the trabecular bone was alleviated after treatment with MDFs. Quantitative measurement of bone characteristics showed that the bone volume per unit tissue and the trabecular bone number in the OVX+MDFs group were significantly higher than those in the OVX group, approaching the normal level and similar to the Sham group ( Figure 5c). Histological examination (H&E staining) consistently showed that compared with the OVX group, the bone volume and bone surface in the MDFs treatment group were well maintained ( Figure 5 d). TRAP staining was used to observe the protective effect of MDFs on inhibiting osteoclast formation. As Figure 5 shown in e, OVX treatment led to an increase in the number of osteoclasts (trap-positive cells), while MDFs treatment significantly inhibited osteoclast formation in osteoporosis patients and restored it to near-normal levels. Further quantitative analysis showed that both TRAP+ osteoclasts and multinucleated TRAP+ osteoclasts on trabecular bone in the MDFs group were fewer than those in the OVX group ( Figure 5 f). Quantitative analysis of mineral apposition rate (MAR) and bone formation rate / bone surface (BFR / BS) further indicated that MDFs could promote bone formation ( Figure 5 h). Finally, a three-point bending test was used to evaluate the change in bone strength after MDFs treatment. As Figure 5 shown, treating OVX mice with tibia showed enhanced material strength compared with the OVX group: including higher maximum load, ultimate load to failure, energy at maximum load, and energy at ultimate load. The MDFs-treated OVX group was higher than the OVX group.

[0075] For the first time, the present invention focuses on two strategies of synergistic anti-resorption and bone formation promotion for the treatment of osteoporosis. A novel DNA nanoflower rich in calcium ions and multivalent CpGs achieves a synergistic effect in the treatment of osteoporosis by promoting bone collagen mineralization and inhibiting osteoclast generation. Compared with the treatment strategies of anti-resorption or bone formation promotion alone, the present application can more effectively achieve the treatment and repair of osteoporosis. Different from other nano-delivery systems, the DNA nanoflower prepared in the present application has a simple and efficient preparation method, has a certain degree of innovation and universality, provides a certain reference value for the construction of other functional carriers, and at the same time provides a new idea for the development of drug delivery systems for osteoporosis treatment. Each important component (Ca 2+ and DNA) in the DNA nanoflower used in the present application plays an important role, and has good biocompatibility, biodegradability, and acid responsiveness, so it has a certain potential for clinical translation.

[0076] Although the technical solutions of the present invention have been described and listed in detail, it should be understood that for those skilled in the art, making modifications to the above embodiments or adopting equivalent alternative solutions are obvious to those skilled in the art. These modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection required by the present invention. Sequence Listing <110> Renji Hospital, Shanghai Jiao Tong University School of Medicine <120> A DNA Nanoflower and Its Preparation Method and Use <130> DPC.RJ.0036 <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 52 <212> DNA <213> Artificial(Artificial sequence) <400> 1 gactggtata ttttttaacg tcaggaacgt catggatttt taacgctata gt 52 <210> 2 <211> 22 <212> DNA <213> Artificial sequence <400> 2 atataccagt cactatagcg tt 22

Claims

1. A DNA nanoflower, characterized in that: the DNA nanoflower contains Ca ions and multivalent CpG, and the preparation method of the DNA nanoflower comprises the following steps: First step, mix 100 μM phosphorylated template and 200 μM primary primer in a ratio of 1:2 in PBS or aqueous solution to obtain a mixture. The sequence of the phosphorylated template is: GACTGGTATATTTTT TAACGTCAGGAACGTCATGGATTTTTAACGCTATAGT, and the sequence of the primary primer is: ATATACCAGTCACTATAGCGTT; Second step, subject the mixture obtained in the first step to multiple cycles of heating in sequence, and then gradually cool it to 20 °C using a PCR thermal reactor; Third step, prepare circular DNA using the product cooled to 20 °C obtained in the second step. After annealing, add T4 DNA ligase and T4 DNA ligase buffer, and incubate the reaction solution overnight at 16 °C; heat the reaction solution to 65 °C and maintain it for 10 minutes to form a closed DNA ring; Fourth step, then mix the closed DNA ring obtained in the third step with Phi29 DNA polymerase and dNTPs in a reaction buffer solution and react at 37 °C for 2 h; Step 5: Mix the product obtained in the fourth step with Ca 2+ and then incubate at room temperature for 24 hours to terminate the reaction, obtaining DNA nanoflowers containing Ca 2+ and multivalent CpG.

2. A DNA nanoflower according to claim 1, characterized in that, in the second step, the specific steps of the cyclic heating are: heat at 95 °C for 2 minutes, heat at 65 °C for 2 minutes, gradually cool to 60 °C at a rate of 1 °C / min, then heat at 95 °C for 2 minutes again, heat at 65 °C for 2 minutes again, and gradually cool to 60 °C at a rate of 1 °C / min again. The number of cycles of the cyclic heating is 80 times.

3. A DNA nanoflower according to claim 1, characterized in that: in the third step, the concentration of the T4 DNA ligase is 2 U / μL.

4. Use of a DNA nanoflower according to any one of claims 1-3, characterized in that: the DNA nanoflower is used for preparing a drug for treating osteoporosis.

Images