Primer for identifying tetraodon genetic sex-specific molecular marker and application thereof
By designing specific primers for the X and Y chromosomes of the four-spined golden scorpion, and combining PCR amplification and agarose gel electrophoresis, the problem of genetic sex identification in the four-spined golden scorpion has been solved, enabling rapid and accurate sex identification and supporting asexual aquaculture and ecological safety.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-05-24
- Publication Date
- 2026-03-20
AI Technical Summary
Currently, no specific molecular markers related to genetic sex have been found in the four-spined golden coin fish, making it difficult to achieve rapid and accurate sex identification, which affects asexual aquaculture and ecological security.
A pair of specific primers were designed to target homologous DNA fragments on the X and Y chromosomes of the four-spined goldfish. PCR amplification and agarose gel electrophoresis were used to distinguish specific DNA fragments between male and female individuals, thus achieving accurate identification of genetic sex.
It enables rapid and accurate identification of the genetic sex of the four-spined goldfish, suitable for laboratories and ornamental fish farming enterprises, supporting sex selection and controlled breeding, and improving ecological safety and economic benefits.
Smart Images

Figure CN115181742B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of Scatophagus tetracanthus, and particularly relates to a primer for identifying a genetic sex-specific molecular marker of Scatophagus tetracanthus and application thereof. BACKGROUND
[0002] Ornamental fish refers to fish such as goldfish, koi, tropical fish and various fish bred in an aquarium for people to watch. Body color is an important measure for determining the ornamental and economic value of fish, and there is a great difference in body color between many male and female ornamental fish. The body color of male fish such as Trichogaster leeri (Ye Lingxian et al., 2004), Poecilia reticulata (Zhang Yongming et al., 2017) and Poecilia latipinna is more beautiful, and the dorsal fin and tail fin are more beautiful. Most ornamental fish are alien species, and monosex breeding can effectively prevent escaped or released ornamental fish from breeding in the wild, thereby limiting the population number of invasive biological species. Therefore, it is necessary to sell only one gender of fish when selling ornamental fish, and it is of application value to identify the gender of ornamental fish to ensure ecological safety.
[0003] Scatophagus tetracanthus, also known as African gold drum, belongs to Perciformes and Scatophagidae, is distributed in the Indo-West Pacific region, is omnivorous, has ornamental and edible values, and the juvenile fish can be used as ornamental fish and is a favorite ornamental fish. The ornamental fish market price in China is high, and the adult fish is about 600 yuan per tail. Through gender identification of specific molecular markers, female and male Scatophagus tetracanthus are screened for monosex breeding, which helps to avoid Scatophagus tetracanthus from becoming an invasive species and has important ecological benefits. The close relative of Scatophagus tetracanthus, Scatophagus argus, has an XY sex determination system, but it is not clear what type of sex determination Scatophagus tetracanthus has. The key to gender identification is to develop gender-specific or linked molecular markers for rapid identification of genetic sex. However, no specific molecular marker related to genetic sex has been found in Scatophagus tetracanthus. SUMMARY
[0004] The present application aims to provide a primer and kit for identifying a genetic sex-specific molecular marker of Scatophagus tetracanthus, which can simply and quickly realize genetic sex, greatly saving time and manpower.
[0005] The present application also aims to provide a method for identifying the genetic sex of Scatophagus tetracanthus.
[0006] A last object of the present application is to provide the use of the above-mentioned primer, kit or method in identifying the genetic sex of Tetrasperma quadricornis.
[0007] The above-mentioned first object of the present application can be realized by the following technical solution: a primer for identifying a genetic sex-specific molecular marker of Tetrasperma quadricornis, the primer comprising a forward primer and a reverse primer, the nucleotide sequence of the forward primer being shown in SEQ ID NO: 3, and the nucleotide sequence of the reverse primer being shown in SEQ ID NO: 4.
[0008] Specifically,
[0009] Forward primer F: 5'-TGACCTAGTGGTGGAATGAATAGAAGA-3' (SEQ ID NO: 3)
[0010] Reverse primer R: 5'-GAAGCAATATGAATGTGATGTG-3' (SEQ ID NO: 4).
[0011] The present application also provides a kit for identifying the genetic sex of Tetrasperma quadricornis, the kit containing the above-mentioned primer.
[0012] The present application finds a sequence specific to male fish and its homologous sequence by analyzing the sequence information of the sex determination and differentiation related genes of Tetrasperma quadricornis through molecular biology and bioinformatics methods, and it is speculated that they are from the X and Y chromosomes of Tetrasperma quadricornis, i.e., it is established that Tetrasperma quadricornis has a male heterogametic XY sex determination system, wherein the DNA fragment on the X chromosome is 873 bp, the sequence is shown in SEQ ID NO: 1, and is named as SEQ_chr_X; the DNA fragment on the Y chromosome is 772 bp, the sequence is shown in SEQ ID NO: 2, and is named as SEQ_chr_Y.
[0013] Therefore, the present application provides a genetic sex-specific molecular marker of Tetrasperma quadricornis, the molecular marker being two DNA fragments partially homologous in the X and Y chromosomes of Tetrasperma quadricornis, the nucleotide sequence of the DNA fragment on the X chromosome being shown in SEQ ID NO: 1, and the nucleotide sequence of the DNA fragment on the Y chromosome being shown in SEQ ID NO: 2.
[0014] The specific molecular marker of the present application has differences in the X and Y chromosomes of Tetrasperma quadricornis, and the differences can be used to identify the genetic sex of Tetrasperma quadricornis. Therefore, the use of the specific molecular marker in preparing a sex identification primer of Tetrasperma quadricornis also belongs to the protection scope of the present application.
[0015] The present application is based on the sequences of the two DNA fragments of the specific molecular marker to design a pair of primers for identifying the genetic sex specific molecular marker of Tetraspimossambica, so as to amplify the DNA fragments with homologous differences on the X and Y chromosomes of Tetraspimossambica, and then the specific DNA fragments of the XX and XY individuals can be distinguished clearly through agarose gel electrophoresis, so that the genetic sex of Tetraspimossambica can be identified accurately.
[0016] The primers capable of PCR amplifying the specific molecular marker or the partial fragment thereof have significant differences on the X and Y chromosomes.
[0017] The above second object of the present application can be achieved by the following technical scheme: a method for identifying the genetic sex of Tetraspimossambica, comprising the following steps:
[0018] (S1) extracting the genomic DNA of the Tetraspimossambica sample to be tested;
[0019] (S2) designing the primers and taking the genomic DNA extracted in step (S1) as the template to PCR amplify the specific molecular marker or the partial fragment thereof, wherein the specific molecular marker is two DNA fragments homologous in part in the X and Y chromosomes of Tetraspimossambica, the nucleotide sequence of the DNA fragment on the X chromosome is shown in SEQ ID NO: 1, and the nucleotide sequence of the DNA fragment on the Y chromosome is shown in SEQ ID NO: 2;
[0020] (S3) performing agarose gel electrophoresis on the PCR amplification product of step (S2);
[0021] (S4) analyzing the electrophoresis result, and judging the genetic sex of Tetraspimossambica according to the electrophoresis result, wherein the judging standard is that:
[0022] when the PCR amplification product has only one clear band, the sample to be tested is a female with XX genotype;
[0023] when the PCR amplification product has two clear bands, the sample to be tested is a male with XY genotype.
[0024] Preferably, the reaction system for PCR amplification in step (S2) is 2x PCR mix 12.5 μL, 10 μmol / L forward and reverse primers each 0.5 μL, genomic DNA 1 μL, and ddH2O 10.5 μL, with a total of 25 μL.
[0025] Preferably, the PCR amplification program in step (S2) is 95℃ for 3 min, 95℃ for 30 s, 60℃ for 30 s, 72℃ for 1 min, 37 cycles, and 72℃ for 10 min extension.
[0026] The application can determine that the sex determination system of Tetraspina quadricornis is the XX / XY type of male heterogamy, the female is the XX chromosome type, and the male is the XY chromosome type; the primer of the application can amplify a single electrophoresis band in the XX female individual, and can amplify two electrophoresis bands in the XY male individual, the molecular weight difference of which is 101 bp, and the genetic sex of Tetraspina quadricornis can be accurately determined through agarose gel electrophoresis.
[0027] The third purpose of the application can be realized by the following technical scheme: the application of the above-mentioned primer, the above-mentioned kit or the above-mentioned method in identifying the genetic sex of Tetraspina quadricornis.
[0028] Compared with the prior art, the application has the following advantages:
[0029] (1) The application screens two partially homologous DNA fragments on X and Y chromosomes from the genomic information of Tetraspina quadricornis, and designs specific primers for genetic sex identification of Tetraspina quadricornis, so that the genetic sex of Tetraspina quadricornis can be quickly and accurately distinguished;
[0030] (2) The method of the application can amplify specific DNA fragments in female and male individuals and can be distinguished by agarose gel electrophoresis, and is suitable for accurately identifying the genetic sex of Tetraspina quadricornis in a laboratory or an ornamental fish breeding enterprise;
[0031] (3) The method of the application is suitable for accurately identifying the genetic sex of Tetraspina quadricornis in a laboratory or an ornamental fish breeding enterprise, and the method for detecting the genetic sex of Tetraspina quadricornis can be used for sex identification and screening of Tetraspina quadricornis at different growth stages and different groups, and has important significance for studying the sex control breeding of Tetraspina quadricornis, ornamental fish breeding, the sex determination and differentiation mechanism of Tetraspina quadricornis and realizing the sex screening. BRIEF DESCRIPTION OF DRAWINGS
[0032] Figure 1 The agarose gel electrophoresis graph of PCR products of 6 female and 6 male Tetraspina quadricornis in the embodiment 1 of the application is shown in the figure, 1-6, female fish; 7-12, male fish;
[0033] Figure 2 The sequence alignment graph of the homologous DNA fragments of Y and X chromosomes of Tetraspina quadricornis in the embodiment 1 of the application is shown in the figure, the primer position is marked with an arrow, the square box: the DNA fragment sequence inserted and deleted by the Y chromosome of the application for identifying the genetic sex relative to the X chromosome; the consistent sequence of the DNA fragments of the Y and X chromosomes is shown in the black background, and the sequence difference is shown in white;
[0034] Figure 3 The agarose gel electrophoresis graph of PCR products of 17 female and 13 male Tetraspina quadricornis in the embodiment 2 of the application is shown in the figure, -: water, negative control. DETAILED DESCRIPTION
[0035] The present application is further described in detail by the following description and examples, which are intended to be illustrative only and not limiting of the scope of the application. The experimental methods used in the following examples are routine methods unless otherwise specified; the materials, reagents, etc. used are commercially available unless otherwise specified.
[0036] Example 1 Obtaining of sex-specific markers of Scatophagus tusk
[0037] 1. Discovery of sex-specific molecular markers
[0038] The inventors' team used Illumina genome sequencing data of a male Scatophagus tusk to isolate the sequence of the Scatophagus tusk dmrt1 (doublesex-and mab-3-related transcription factor 1) gene by aligning the sex determination candidate gene dmrtl (NCBI accession number MG765300.1) of the same genus Scatophagus argus. Through alignment analysis, part of the Scatophagus tusk dmrt1 genomic sequence was isolated, and it was found that in addition to the normal dmrt1, another copy of dmrt1 might exist, and part of its sequence was obtained. According to the sequence alignment analysis of Scatophagus tusk dmrt1 and its homologous genes, primers were designed to verify whether they are linked to sex. According to the sequence of dmrt1 and its homologous genes, a sequence specific to male fish and its homologous sequence were found, which were speculated to come from the X and Y chromosomes of Scatophagus tusk, respectively, i.e. to establish that Scatophagus tusk has a male heteromorphic XY sex determination system, in which the DNA fragment on the X chromosome is 873 bp, the sequence is shown as SEQ ID NO: 1, and is named SEQ_chr_X; the DNA fragment on the Y chromosome is 772 bp, the sequence is shown as SEQ ID NO: 2, and is named SEQ_chr_Y; also known as a sex-specific molecular marker of Scatophagus tusk, the molecular marker is two DNA fragments partially homologous in the X and Y chromosomes of Scatophagus tusk, the nucleotide sequence of the DNA fragment on the X chromosome is shown as SEQ ID NO: 1, and the nucleotide sequence of the DNA fragment on the Y chromosome is shown as SEQ ID NO: 2.
[0039] Based on the sequences of the two DNA fragments, a pair of primers for identifying the sex-specific molecular marker of Tetrasomus quadricornis was designed to amplify the homologous DNA fragments with differences on X and Y chromosomes of Tetrasomus quadricornis. The specific DNA fragments of XX and XY individuals can be distinguished by agarose gel electrophoresis, and the genetic sex of Tetrasomus quadricornis can be accurately identified.
[0040] The designed pair of primers are as follows:
[0041] Forward primer F: 5'-TGACCTAGTGGTGGAATGAATAGAAGA-3' (SEQ ID NO: 3);
[0042] Reverse primer R: 5'-GAAGCAATATGAATGTGATGTG-3' (SEQ ID NO: 4).
[0043] The genomic DNA of 6 female and 6 male Tetrasomus quadricornis was amplified by PCR using the pair of primers. A band of about 873 bp (as shown in SEQ ID NO: 1) was amplified in both female and male individuals. In addition, a band of about 772 bp (as shown in SEQ ID NO: 2) was also amplified in XY individuals, as shown in FIG. 1. Figure 1
[0044] 2. Cloning and sequence analysis of sex-specific molecular marker
[0045] The genomic DNA of 3 female and 3 male Tetrasomus quadricornis was amplified by the above primers, and the agarose gel electrophoresis was performed. The single band amplified in XX female individuals and the two bands amplified in XY male individuals were recovered by cutting the gel, respectively, and were ligated to pEASY-T3 vector. Then, the ligated products were transformed into competent E. coli cells, and 50 μL of bacterial solution was spread on LB solid medium after 1 hour of culture in LB liquid medium. After overnight culture, single colonies were picked and identified by PCR. The positive clones were sequenced.
[0046] The sequencing results of 5-10 positive clones from each fish were multiple aligned by DNAMAN 4.0 software. The results showed that the single amplified band from female individuals was 873 bp, and the homology among different female individuals was as high as 99.0%-99.7%. It was probably from X chromosome band, so the sequence was named SEQ chr X. The fragment length from male individuals which was equal to the amplified band from female individuals was also 873 bp, and the homology among different male individuals was as high as 99.2%-99.9%. Therefore, the fragment was SEQ chr X. The fragment length from male individuals which was smaller than SEQ chr X sequence was 772 bp, and the homology among different male individuals was as high as 99.6%-100.0%. It was probably from Y chromosome band, so the male specific fragment was named SEQ chr Y. The homology of SEQ chr X sequence and SEQ chr Y sequence from male individuals was 90.9%. The homology of SEQ chr X and SEQ chr Y from male individuals with SEQ chr X sequence from female individuals was 99.1% and 90.3% respectively. The above results showed that SEQ chr X existed in both male and female individuals, and SEQ chr Y only existed in male individuals. That is, SEQ chr X and SEQ chr Y were from homologous sequences of X and Y chromosomes respectively. SEQ chr Y and SEQ chr X were from normal and abnormal Dmrt1 sequences respectively, indicating that Dmrt1 of Tetraspimolaena might also be linked to male sex, and was a sex determination candidate gene, similar to the case of Trichogaster trichopterus. The molecular marker near the sex determination gene was the best sex specific molecular marker.
[0047] The X chromosome specific sequence SEQ chr X and Y chromosome specific sequence SEQ chr Y obtained by sequencing were subjected to sequence alignment analysis. The results, as shown in Figure 2 , the differences between SEQ chr X and SEQ chr Y sequences were mainly at 3 places: compared with X chromosome specific molecular marker, Y chromosome specific molecular marker had 69 bp and 170 bp sequence insertion and deletion.
[0048] Example 2 Application of Tetraspimolaena Genetic Sex Identification Primer Sequence
[0049] 1. Rapid and accurate identification of genetic sex of Tetraspimolaena, comprising the following steps:
[0050] (1) Collection of Tetraspimolaena and phenotypic sex identification
[0051] In order to verify the accuracy of the genetic sex identification of the present application, 30 four-spined goldfish (17 phenotypic females and 13 phenotypic males) purchased from Guangzhou Baiyi City Flower Bird Fish and Insect New World were collected, and the phenotypic sex of the four-spined goldfish was determined by observing the gonadal tissue section.
[0052] (2) Extraction of four-spined goldfish genomic DNA
[0053] The tail fin of the four-spined goldfish to be tested was cut, and the genomic DNA of the four-spined goldfish was extracted by using a genomic DNA extraction kit according to the steps.
[0054] (3) Sequencing detection of the DNA of the sample to be tested
[0055] The extracted genomic DNA was subjected to PCR amplification by using the four-spined goldfish sex identification primers SEQ ID NO: 3 and SEQ ID NO: 4 of Example 1;
[0056] PCR reaction system: 2x PCR mix Buffer 12.5 μL, 10 μmol / L upper and lower primers each 0.5 μL, template DNA 1 μL, ddH2O 10.5 μL, mixed and centrifuged.
[0057] PCR amplification program: 95°C for 3 min; 95°C for 30 s, 60°C for 30 s, 72°C for 1 min, 37 cycles; 72°C for 10 min, 4°C for storage.
[0058] The PCR product was subjected to 1.5% agarose electrophoresis at 150 V for 20 min, and the gel imaging system was photographed for observation.
[0059] The results showed that there were 17 XX female fish and 13 XY male fish. Matching analysis with the phenotypic identification results showed that the genotypic sex and the phenotypic sex identification results were completely consistent, and the coincidence rate of the genetic sex and the phenotypic sex was 100% (17 female fish and 13 male fish electropherogram). From the above results, it can be known that the sex-specific molecular marker developed in the present application is suitable for genetic sex identification of four-spined goldfish, and the marker has high reliability. Figure 3
[0060] Example 3: Kit for rapidly identifying the genetic sex of four-spined goldfish
[0061] The kit for identifying the genetic sex of four-spined goldfish provided in the present embodiment contains primers for identifying the genetic sex of four-spined goldfish; the primer sequences are as follows:
[0062] Upper primer F: 5'-TGACCTAGTGGTGGAATGAATAGAAGA-3' (SEQ ID NO: 3)
[0063] Downstream primer R: 5'-GAAGCAATATGAATGTGATGTG-3' (SEQ ID NO: 4)
[0064] Meanwhile, the kit further comprises reagents required for PCR amplification reaction: 2x PCR mix Buffer and ddH2O.
[0065] The use method of the kit comprises the following steps:
[0066] S1. Extracting genomic DNA of the sample to be tested;
[0067] S2. Performing PCR amplification on the genomic DNA of S1 by using the above primer pair;
[0068] S3. Performing electrophoresis on the PCR amplification product of S2, and according to the electrophoresis result, if a single band is shown in the sample of S2, it is a female fish; if two clear bands are shown, it is a male fish.
[0069] The present application is not limited to the above specific embodiments, and the above embodiments are only for the purpose of being able to describe the use process of the present application in detail, and the production methods and technical details with equal functions also belong to part of the content of the present application. In fact, those skilled in the art can find different adjustment schemes according to their own needs according to the foregoing description, and these adjustments should be within the scope of the claims attached herein. SEQUENCE LISTING <110> Guangdong Ocean University <120> Primer for identifying genetic sex-specific molecular marker of Scatophagus tetracanthus and application thereof <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 873 <212> DNA <213> Scatophagus tetracanthus <400> 1 tgacctagtg gtggaatgaa tagaagaatc ttatgaagtt catgttttct tttcctatca 60 actgtccgat caaaagatct gaggcaagcc tagatctata caatttgaat acatcgaatt 120 atttcattc aaaggctcat tttggaaaat aaaaacaaaa cgtctgcttg agctctgctc 180 ttgggtgcat aattcatgac gaagcataaa ccaacttaaa ctagtacatt aacgcagttc 240 tcaggttcat atttcaaatg tgatgatgat ctagaaatac tgaaatacag ccacaaacat 300 ctcactttag tctctgaaac aatcttattt gttgtgcctt ctgtttatgt gtttgtccag 360 ggagtcactc gatgttgtcc tctggcctgt cgactgctgc ccgggcttat gctgagggac 420 caatctacta ttgcaacttc caccagcctt tgtgctaccc cactactat gtcagcttcc 480 gcaactacca gcactaccag gtgactcaca acaaccactg tgctgtttat caatcaagag 540 tcaaactctc atttgaagcc tatttgaggg ctcatagtag atatttgtac actgtagtgt 600 gtgaaaatcc tcctctgatt aacagcaggt tcatgtttgc ctaaagtatg ttgctgaggt 660 tgttgatgct cttgctctta tacatacctt atgaaaggtt gaggattcag cctgctgcaa 720 gagtcatatg cgacagttag aaaatagag cagacagcag tactgcaact aataattatt 780 ttcattca tcataattaa ttggaggatt attaattat ttgatgaaaa aaaaagtaa 840 AAAATATTCA TCACATCACA TTCA TATTGCTTC 873 <210> 2 <211> 772 <212> DNA <213> Scatophagus tetracanthus <400> 2 TGACCTAGTG GTGGAATGAA TAGAAGAATT TTATGAAGTT CTTATGTTTT CTTTTCCTGT 60 CAACTGTTCG ATCAAAAGAT CTGAGGCAAG CCTAGATCTA TACAATTTGA ATACATTGAA 120 TTATTTTCAT TCAGAGGCTC ATTTTGGAAA ATAAAAACA AATGTCTGCT TGAGCTCTGC 180 TCTTGGGTGC ATAA CATGACAACATGGTTAAGTTTTACAAATTGGCTTATTAACCCTAAT 240 TAATCCAAGC AAAACATAAA CTAAC TAAAA CAAATACTTT AACGCAGTTCTC AGATT CAT 300 ATTTCAAATG TGATGATGAT C TAGAAATAC TGAAATAC TGCCAAAAAC ATCTC ACTTTAG 360 TCTCTGAAAC AATCTTATTT GTTGTGCCTT CTGTTTATGT GTTTGTCCAG GGAGTCGCTC 420 GATGTTGTTC TC CAGCTTGTC GACTGGTGCCGGGCTCATAATGAGGAACCATCTGACCT 480 GCTGCTGGAA ACCTCCTATT ACAACTTTCA CCTGCCTTTG TGCTACCCCAC TTACTATGG 540 CAGCCTCTAC AACTACCAGC AATACCAGGT GACTCACAAC AATC ACTCTGCT GTTTATCA 600 atccaacagt caaactctca tttgaagcct ttttgagggc tcatagtaga tatttgtaca 660 ctgtagtgcg tgaaaatcct tatctgatta acagcaggtt catgttgatg ggtgatgggt 720 gatgaataaa cccaggaaaa agatattcat cacatcacat tcatattgct tc 772 <210> 3 <211> 27 <212> DNA <213> Artificial Sequence <400> 3 tgacctagtg gtggaatgaa tagaaga 27 <210> 4 <211> 22 <212> DNA <213> Artificial Sequence <400> 4 gaagcaatat gaatgtgatg tg 22
Claims
1. A primer for identifying sex-specific molecular markers in the four-spined goldfish, characterized by: The primers include a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown in SEQ ID NO: 3, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO:
4. The specific molecular marker for the genetic sex of the four-spined golden scorpion consists of two partially homologous DNA fragments on the X and Y chromosomes of the four-spined golden scorpion. The nucleotide sequence of the DNA fragment on the X chromosome is shown in SEQ ID NO: 1, and the nucleotide sequence of the DNA fragment on the Y chromosome is shown in SEQ ID NO:
2.
2. A kit for identifying the genetic sex of the four-spined goldfish, characterized by: The kit contains the primers described in claim 1.
3. A method for identifying the genetic sex of the four-spined goldfish, characterized by: Includes the following steps: (S1) Extract genomic DNA from the sample of the four-spined golden scorpion; (S2) Design the primers in claim 1 and use the genomic DNA extracted in step (S1) as a template to amplify the specific molecular marker or a partial fragment thereof by PCR. The specific molecular marker is two DNA fragments that are partially homologous in the X and Y chromosomes of the four-spined goldfish, wherein the nucleotide sequence of the DNA fragment on the X chromosome is as shown in SEQ ID NO: 1, and the nucleotide sequence of the DNA fragment on the Y chromosome is as shown in SEQ ID NO:
2. (S3) Perform agarose gel electrophoresis on the PCR amplification products from step (S2); (S4) Analyze the electrophoresis results and determine the genetic sex of the four-spined goldfish based on the results. The criteria for determination are as follows: If the PCR amplification product has only one clear band, then the sample to be tested is a female fish of the XX genotype. If the PCR amplification product has two clear bands, the sample to be tested is a male fish with the XY genotype.
4. The method for identifying the genetic sex of the four-spined goldfish according to claim 3, characterized in that: The PCR amplification reaction system in step (S2) consists of 12.5 μL of 2× PCR mix, 0.5 μL each of 10 μmol / L forward and reverse primers, 1 μL of genomic DNA, and 10.5 μL of ddH2O, for a total of 25 μL.
5. The method for identifying the genetic sex of the four-spined goldfish according to claim 3, characterized in that: The PCR amplification program in step (S2) is 95 ℃ for 3 min; 95 ℃ for 30 s, 60 ℃ for 30 s, 72 ℃ for 1 min, for 37 cycles; extension at 72 ℃ for 10 min.
6. The application of the primers of claim 1, the kit of claim 2, or the method of any one of claims 3-5 in identifying the genetic sex of the four-spined goldfish.