Specific primer pair for detecting histoplasma capsulatum and application thereof

By designing specific primer pairs and PCR detection methods, the problems of speed and accuracy in detecting Histoplasma capsulatum were solved, enabling differentiation from Basiliformis marneffei, thus ensuring the accuracy and speed of clinical diagnosis.

CN115838825BActive Publication Date: 2026-04-24HOSPITAL OF DERMATOLOGY CHINESE ACADEMY OF MEDICAL SCIENCES
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211372058.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-11-03
Publication Date
2026-04-24
Estimated Expiration
2042-11-03

AI Technical Summary

Technical Problem

Existing technologies make it difficult to detect Histoplasma capsulatum quickly and accurately, and it is easily confused with Basiliformis marneffei, leading to misdiagnosis and treatment delays.

Method used

A set of specific primer pairs was designed for the PCR detection of Histoplasma capsulatum. Combined with electrophoretic analysis, the rapidity and specificity of the detection were ensured, enabling the differentiation between Histoplasma capsulatum and Bassilis marneffei.

Benefits of technology

It enables rapid and accurate detection of capsular histoplasmosis, reduces the risk of misdiagnosis, and provides a powerful means for rapid clinical identification.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115838825B_ABST
    Figure CN115838825B_ABST
Patent Text Reader

Abstract

The application discloses a specific primer pair for detecting Coccidioides immitis and application thereof, and belongs to the technical field of microorganism detection. Six groups of forward primers and reverse primers are disclosed, and the specific primer pair of any group can be used to accurately identify Coccidioides immitis. The detection method is rapid, specific, convenient to operate and accurate in identification.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial detection technology, specifically relating to a specific primer pair for detecting Histoplasma capsulatum and its application. Background Technology

[0002] Histoplasma capsulatum is an opportunistic pathogen that can cause deep infections in immunocompromised patients and is prevalent in the Midwestern United States and Latin America. Due to its pathogenic characteristics, such as easily causing acute and chronic lung infections in patients, even disseminated infections, complex treatment processes, and a high risk of death, this bacterium has been classified as a highly pathogenic fungus of biohazard level 3 by many countries, including my country (see Wang Niuniu, Zheng Jianming, Liu Liguang, Research progress on disseminated histoplasmosis, Microbiology and Infection, December 25, 2020, Vol. 15, No. 6: 429-434; Pan Weihua, Epidemiological characteristics and prevention and control of histoplasmosis in my country, Bulletin of Dermatology, October 2017, Vol. 34, No. 5; Katia Cristina Dantas et al. Comparison of diagnostic methods to detect Histoplasma capsulatum in serum and blood samples from AIDS patients. PLoS One. 2018; 13(1):e0190408). In recent years, in addition to traditional imported cases, sporadic local cases of histoplasmosis have been increasingly reported in my country. Meanwhile, Ji Wang, Zhou Li, and others have found that due to the nonspecific clinical manifestations and limited etiological detection methods, histoplasmosis is easily confused with another pathogenic fungus, *Talaromyces marneffei*, leading to misdiagnosis and mistreatment. Therefore, there is an urgent need to find a method for the detection and identification of histoplasmosis (see Zhou Li, Fan Songqing, Liang Qingchun, et al., Clinical characteristics analysis and literature review of 8 cases of histoplasmosis, *Journal of Central South University (Medical Edition)*, 2016, Vol. 41, No. 6; Ji Wang et al. Identification of Histoplasma causing an unexplained disease cluster in Matthews Ridge, Guyana. *Biosafety and Health* (2019) 150–154).

[0003] Considering that traditional histoplasmosis diagnosis relies on culture as the gold standard, which takes 3-4 weeks and can easily miss the optimal treatment window, and carries a certain risk of laboratory transmission during the culture process (see GS de Hoog, J. Guarro, J. Gené, et al. Atlas of Clinical Fungi [M]. 4th edition 2020); and that pathological smear analysis is easily confused with other pathogens such as *Gastropoda marneffei*, those skilled in the art need to explore a technique that can circumvent these drawbacks and utilize molecular technology for rapid detection, ensuring clear identification results in the shortest possible time while maintaining safe laboratory procedures, effectively guaranteeing rapid clinical detection and identification of histoplasmosis.

[0004] Previously, there were a few patent applications in China regarding the design of primers for specific molecular diagnostics of Histoplasma capsulatum, such as "LAMP primer set, kit and method for detecting Histoplasma capsulatum" (applicants: Peking Union Medical College Hospital, Chinese Academy of Medical Sciences and Beijing Bio-Tech Co., Ltd., patent application number: 202110457838.3, patent application date: July 23, 2021). This method mainly uses the LAMP method, but LAMP technology is highly sensitive and therefore prone to false positives, making it difficult for domestic laboratories under current conditions to widely promote it; at the same time, it is also because... LAMP's high sensitivity places extremely high demands on primer design, requiring high specificity and sensitivity. However, in this patent, the inventors included too few bacterial species (3 fungi) in the negative control interference exclusion, and did not conduct negative amplification experiments to exclude interference from other common clinical pathogenic fungi. In particular, the easily confused *Brachysmus marneffei* was not included in the control group. If a suspected infection is found in clinical smears or pathological diagnosis, the possibility of *Brachysmus marneffei* being present cannot be ruled out. At the same time, the number of positive *Histoplasma capsulatum* samples in the above patent is too small (1 strain), which cannot ensure the breadth of sample coverage in the experimental design. Summary of the Invention

[0005] Objective of this invention: To address the shortcomings of existing technologies, this invention provides a specific primer pair for detecting *Histoplasma capsulatum*, enabling rapid and accurate detection of *Histoplasma capsulatum* using conventional PCR technology. The designed primer pair can also be optimized for quantitative real-time PCR for real-time rapid detection. This invention explores molecular target primers for rapid clinical identification from a molecular detection and amplification perspective, achieving accurate and rapid identification of clinically suspected *Histoplasma capsulatum* specimens and its differentiation from *Basilella marneffei*, providing a powerful tool for the clinical detection and prevention of histoplasmosis.

[0006] Technical solution: The objective of this invention is achieved through the following technical solution:

[0007] This invention provides a specific primer pair for detecting Histoplasma capsulatum, comprising the following six sets of forward and reverse primers:

[0008] (1) Group 1

[0009] CP069117.1_s3857-F: TGCGATCCTGTTGTGTGACA

[0010] CP069117.1_s3857-R:CGTCCTATGCCAGCACACTT;

[0011] (2) Second group

[0012] CP069117.1_s6964-F: GTCGAGCATACGCCTCACTT

[0013] CP069117.1_s6964-R: TATCGACGTCCAGTTCTCGC;

[0014] (3) Group 3

[0015] CP069117.1_s7420-F:GAGACTCCTTGCCTGGATCG

[0016] CP069117.1_s7420-R: CCGTCCGTGGCTAAGAATGT;

[0017] (4) Group 4

[0018] CP069118.1_s4904-F:CACAATGGAGAGGAGCACCA

[0019] CP069118.1_s4904-R:GCTGTTGCCGCCATTGGTTAT;

[0020] (5) Group 5

[0021] CP069118.1_s11573-F:TCGGAATTGGAACGTCGGTT

[0022] CP069118.1_s11573-R:GGTACGATCATGGCCGTCA;

[0023] (6) Group 6

[0024] CP069118.1_s11966-F:GGCGGTAAGTCGTTCAGGAC

[0025] CP069118.1_s11966-R: TGTCAGGCACTCCGATTCAG.

[0026] All six sets of specific primer pairs mentioned above can be used to detect Histoplasma capsulatum.

[0027] The present invention also provides the application of the above-mentioned specific primer pairs in the detection of Histoplasma capsulatum.

[0028] Furthermore, the detection method for Histoplasma capsulatum includes the following steps:

[0029] (1) Extracting fungal DNA from the sample to be tested;

[0030] (2) Using any of the above-mentioned specific primer pairs for detecting Histoplasma capsulatum, the DNA of the sample obtained in step (1) is amplified by PCR.

[0031] (3) After amplification, the PCR products were analyzed by electrophoresis.

[0032] Furthermore, the reaction system (20 μL) for the above PCR amplification is as follows:

[0033]

[0034] All reagents involved in the above reaction system can be obtained from New England Biolabs.

[0035] Furthermore, the PCR reaction procedure is as follows:

[0036] (a) Pre-denaturation at 95℃ for 5 min;

[0037] (b) (95℃ denaturation for 30s; 55℃ annealing for 30s; 72℃ extension for 45s) × 35 cycles

[0038] (c) 72℃ for a total extension of 10 min.

[0039] This invention first designs specific primer pairs, and then uses each specific primer pair to perform PCR amplification of DNA in the test samples to accurately detect *Histoplasma capsulatum*. The detection method of this invention has the advantages of rapid detection, high specificity, convenient operation, and accurate detection. This invention explores molecular target primers for rapid clinical identification from the perspective of molecular detection and amplification, achieving accurate and rapid identification of clinically suspected *Histoplasma capsulatum* specimens and the ability to differentiate it from *Basilella marneffei*, providing a powerful tool for the clinical detection and prevention and control of histoplasmosis. Attached Figure Description

[0040] Figure 1Electrophoresis images showing positive amplification of 10 Histoplasma capsulatum strains from different evolutionary clades using six sets of designed specific primer pairs. Detailed Implementation

[0041] The technical solution of the present invention will be described in detail below through specific embodiments, but the scope of protection of the present invention is not limited to the embodiments described.

[0042] Example 1: Screening for specific target gene loci of Histoplasma capsulatum and designing amplification primers.

[0043] 1. Genome Search: Genome data for both *Histoplasma capsulatum* and *Talaromyces marneffei* were searched and analyzed on the GENEBANK website (https: / / www.ncbi.nlm.nih.gov / ), as follows: *Histoplasma capsulatum*: Genome accession numbers: GCA_000150115.1, GCA_017310585.1, GCA_017607465.1, GCA_013420885.1, GCA_000151005.2, GCA_000151035.1, GCA_000313325.1, GCA_017355575.1, GCA_017310615.1

[0044] Talaromyces marneffei: Genome accession numbers: GCA_000001985.1, GCA_003971505.1, GCA_009556855.1, GCA_009650675.1, GCA_013122295.1, GCA_006111635.1, GCA_011320185.1, GCA_000750115.1, GCA_000227055.2.

[0045] 2. Primer design:

[0046] (1) Based on the downloaded genome, find the common genome segments in the species Histoplasma capsulatum and Talaromyces marneffei;

[0047] (2) The genome of Talamoyces marneffei was compared with the common sequence and the sequence that did not match Talamoyces marneffei was found;

[0048] (3) Design primers based on unique sequences (to ensure that the amplification product is between 150-280 bp), then align the primers with the Talamoyces marneffei reference genome and filter out the primers that can be aligned.

[0049] (4) Based on the above screening of the remaining primers, continue to filter out primers containing three consecutive repeating single bases;

[0050] (5) Filter out sequences in the product containing lowercase atcg and N;

[0051] (6) Primers and products were compared with the Histoplasma capsulatum genome. Only products and primers that could be matched to one fragment on the genome were selected.

[0052] Based on the above method, 10 pairs of specific primers were initially designed and obtained. Detailed sequence information is shown in Table 1.

[0053] Table 1. 10 pairs of specific primers obtained from the preliminary design.

[0054]

[0055] Example 2: PCR positive amplification verification of primer design

[0056] 1. Total DNA extraction from Histoplasma capsulatum: Ten Histoplasma capsulatum strains were used in the laboratory (see Table 2).

[0057] Table 2. Sources of 10 Histoplasma capsulatum strains

[0058]

[0059] Total DNA was extracted from each strain using the following method:

[0060] (1) Take 1g of bacterial cells from a pure culture strain and place them in a grinding tube containing grinding beads;

[0061] (2) Add 600 μL of lysis buffer (100 mmol / L Tris-HCl, 100 mmol / L EDTA, 400 mmol / L NaCl and 2% SDS), place it on a FastPrep-24 high-efficiency lysizer from MP Company in the United States and grind it vigorously for 30 seconds. Then place the suspension in a 65°C water bath and heat for 10 minutes.

[0062] (3) Add 140 μL of saturated phenol solution (pH 4.5±0.2), mix well, and centrifuge at 10000 r / min for 10 min;

[0063] (4) Take the supernatant and add 400 μL of isopropanol, centrifuge at 10000 r / min for 2 min;

[0064] (5) After discarding the supernatant, drain the water, add 300 μL of double-distilled water heated to 65°C, mix by blowing and aspiration, add 150 μL of 3M sodium acetate solution, 300 μL of anhydrous ethanol and 5 μL of ribonuclease, and mix well;

[0065] (6) Transfer the suspension to a collection tube, centrifuge at 10000r / min for 1min, discard the waste liquid, add 600μL of washing solution to centrifuge and wash the DNA in the collection tube twice, and centrifuge once empty.

[0066] (7) Add 5 μL of preheated TE buffer to the collection tube, let it stand, then transfer it to a new 1.5 mL centrifuge tube and centrifuge at 10000 r / min for 1 min to collect the DNA solution.

[0067] All reagents used in the above operations were sourced from Sangon Biotech (Shanghai) Co., Ltd.

[0068] 2. PCR Amplification and Verification: Using total DNA extracted from 10 Histoplasma capsulatum strains as templates, PCR experiments were performed on each of the 10 primer pairs listed in Table 1 for the first round of verification and screening. The PCR method used was High-Fidelity DNA Polymerases, with a 20 μL reaction system.

[0069]

[0070] All reagents used in the above reaction system were obtained from New England Biolabs. The reaction buffer was prepared using... Reaction Buffer Pack (Catalog No. B9027S, Concentration 5×).

[0071] PCR instrument: Type 9700

[0072] The PCR reaction procedure is as follows:

[0073] (a) Pre-denaturation at 95℃ for 5 min;

[0074] (b) (95℃ denaturation for 30s; 55℃ annealing for 30s; 72℃ extension for 45s) × 35 cycles

[0075] (c) 72℃ for a total extension of 10 min.

[0076] After PCR amplification, the primer pairs that produced a single, significant band of 300 bp in total DNA from the 10 tested Histoplasma capsulatum samples were: CP069117.1_s3857-F&R, CP069117.1_s6964-F&R, CP069117.1_s7420-F&R, CP069117.1_s8505-F&R, CP069118.1_s4904-F&R, CP069118.1_s11573-F&R, CP069118.1_s11966-F&R, and CP069120.1_s562-F&R.

[0077] These 8 primer pairs can amplify specific sequences of Histoplasma capsulatum. Primer sequence information is detailed in Table 1.

[0078] Example 3: Amplification of species-specific primers for screening Histoplasma capsulatum from primers that showed positive amplification.

[0079] To ensure the primers possess high genus specificity, applying only to *Histoplasma capsulatum*, the inventors designed an exclusion experiment to confirm that primers that have produced positive amplification against *Histoplasma capsulatum* cannot amplify positive amplification against other fungal species or human gene fragments. The experimental method involves using genomic DNA from other fungi / humans as templates to perform PCR verification on the aforementioned eight primer pairs, excluding primers that produce positive amplification in the exclusion experiment (PCR positivity against genomic DNA from other fungi / humans is considered non-specific amplification).

[0080] 1. Exclusion of bacterial strains and DNA extraction

[0081] Species closely related to *Histoplasma capsulatum*, as well as related pathogenic fungi that are easily misdiagnosed or confused clinically, were excluded from the list of fungal species. The excluded *Histoplasma capsulatum* species included: *Aspergillus fumigatus*, *Aspergillus terreus*, *Aspergillus flavus*, *Candida albicans*, *Candida glabrata*, *Candida tropicalis*, *Coccidioides spp.*, *Fusarium solani*, *Microsporum spp.*, *Sedosporium apicalis*, *Mucor racemose*, *Mucor irregularis*, *Paecilomyces lilacinus*, and *Basilella marneffei*. Our team selected 28 fresh strains of the excluded species from the collection of the Medical Branch of the Pathogenic Microorganism Culture Collection Center of the Chinese Academy of Medical Sciences, and extracted their total DNA as templates. The extraction method was the same as the total DNA extraction method in Example 2.

[0082] 2. PCR amplification verification

[0083] The total DNA template of the excluded Histoplasma capsulatum strains was amplified and verified using the eight primer pairs described in Example 2. A negative PCR result was considered to indicate that the primers were specific to Histoplasma capsulatum, while a positive result was considered to indicate non-specific amplification. The PCR method used in this round of screening and exclusion experiments was the same as the method described in the PCR amplification and verification steps in Example 2.

[0084] After verification, two primer pairs (CP069117.1_s8505-F&R and CP069120.1_s562-F&R) produced non-specific amplification products among the eight primer pairs designed for the detection of *Histoplasma capsulatum*. Finally, six *Histoplasma capsulatum*-specific primer pairs were identified (CP069117.1_s3857-F&R, CP069117.1_s6964-F&R, CP069117.1_s7420-F&R, CP069118.1_s4904-F&R, CP069118.1_s11573-F&R, and CP069118.1_s11966-F&R). Detailed primer sequence information is shown in Table 1.

[0085] 3. Human genome negative amplification verification

[0086] Considering that the designed primers are ultimately intended for clinical testing and identification, the six species-specific primers for *Histoplasma capsulatum* confirmed in the previous step were again subjected to negative amplification of the human genome to verify that the PCR amplification of the screening primers for the human gene should be negative (the human gene comes from blood samples taken from healthy clinical individuals), thus eliminating interference from the human gene during the clinical testing process. The PCR amplification method is the same as that described in the PCR amplification verification steps in Example 2.

[0087] After verification by human genome PCR, all 6 primer pairs were negative for human gene amplification, making them suitable for rapid clinical molecular detection. Primer sequence information is detailed in Table 1.

[0088] Example 4: Method for verifying Histoplasma capsulatum using six primer pairs: CP069117.1_s3857-F&R, CP069117.1_s6964-F&R, CP069117.1_s7420-F&R, CP069118.1_s4904-F&R, CP069118.1_s11573-F&R, and CP069118.1_s11966-F&R.

[0089] Following the method described in Example 2, "PCR Positive Amplification Verification Using Primer Design," DNA from *Histoplasma capsulatum* clades 1-10 in Table 2 was amplified and verified. PCR products were detected by 2% agarose gel electrophoresis. See the electrophoresis results for details. Figure 1 .

[0090] Lanes 1-10: Primer pair CP069117.1_s3857-F&R amplified positive PCR bands of Histoplasma capsulatum in Table 2 (numbers 1-10), with a size of 300bp.

[0091] Lanes 11-20: Primer pair CP069117.1_s6964-F&R amplified positive PCR bands of Histoplasma capsulatum (numbers 1-10) in Table 2, with a size of 300bp.

[0092] Lanes 21-30: Primer pair CP069117.1_s7420-F&R amplified positive PCR bands of Histoplasma capsulatum 1-10 in Table 2, with a size of 300bp;

[0093] Lanes 31-40: Primer pair CP069118.1_s4904-F&R amplified positive PCR bands of Histoplasma capsulatum 1-10 in Table 2, with a size of 300bp;

[0094] Lanes 41-50: Primer pair CP069118.1_s11573-F&R amplified positive bands of Histoplasma capsulatum 1-10 in Table 2, with a size of 300bp;

[0095] Lanes 51-60: Primer pair CP069118.1_s11966-F&R amplified positive bands of Histoplasma capsulatum (capsule numbers 1-10) in Table 2, with a size of 300 bp.

[0096] Lanes 1-10, 11-20, 21-30, 31-40, 41-50, and 51-60 show that all six primer pairs were positive for specific amplification of 10 Histoplasma capsulatum strains from different sources and clades. This demonstrates that the primer pairs designed and screened in the final step (CP069117.1_s3857-F&R, CP069117.1_s6964-F&R, CP069117.1_s7420-F&R, CP069118.1_s4904-F&R, CP069118.1_s11573-F&R, and CP069118.1_s11966-F&R) can effectively and specifically amplify Histoplasma capsulatum fungi.

[0097] This invention explores the screening of specific primers for the rapid molecular detection of Histoplasma capsulatum, a highly pathogenic fungus in China. The primers can be developed into a rapid detection kit for histoplasmosis, providing a molecular method for the rapid differentiation and diagnosis of histoplasmosis in clinical practice. This will supplement reliable technical means for the clinical molecular diagnosis of this disease in China, and also provide accurate and rapid monitoring for the prevention and control of this fungal disease and for import and export quarantine.

[0098] As described above, although the invention has been shown and described with reference to specific preferred embodiments, it should not be construed as limiting the invention itself. Various changes in form and detail may be made without departing from the spirit and scope of the invention as defined in the appended claims.

Claims

1. A specific primer pair for detecting Histoplasma capsulatum, characterized in that, This includes the following six sets of forward and reverse primers: Group 1 CP069117.1_s3857-F: TGCGATCCTGTTGTGTGACA CP069117.1_s3857-R:CGTCCTATGCCAGCACACTT; Group 2 CP069117.1_s6964-F: GTCGAGCATACGCCTCACTT CP069117.1_s6964-R: TATCGACGTCCAGTTCTCGC; Group 3 CP069117.1_s7420-F:GAGACTCCTTGCCTGGATCG CP069117.1_s7420-R: CCGTCCGTGGCTAAGAATGT; Group 4 CP069118.1_s4904-F:CACAATGGAGAGGAGCACCA CP069118.1_s4904-R:GCTGTTGCCGCCATTGGTTAT; Group 5 CP069118.1_s11573-F:TCGGAATTGGAACGTCGGTT CP069118.1_s11573-R:GGTACGATCATGGCCGTCA; Group 6 CP069118.1_s11966-F:GGCGGTAAGTCGTTCAGGAC CP069118.1_s11966-R: TGTCAGGCACTCCGATTCAG.

2. A method for detecting Histoplasma capsulatum for non-disease diagnosis and treatment purposes, characterized in that, The steps include: (1) extracting fungal DNA from the sample to be tested; (2) Using any one of the specific primer pairs in claim 1, perform PCR amplification on the sample DNA obtained in step (1); (3) After amplification, the PCR products were analyzed by electrophoresis; the primer pair showed positive PCR amplification bands for Histoplasma capsulatum, with a size of 300 bp; The reaction system for PCR amplification is as follows: 4 μL of 5× reaction buffer, 2 μL of 2.5 mM dNTPs, 0.8 μL of 5 μM forward primer, 0.8 μL of 5 μM reverse primer, 0.4 μL of high-fidelity DNA polymerase, 10 ng of template DNA, and sterile water to a final volume of 20 μL. The PCR amplification procedure is as follows: (a) Pre-denaturation at 95℃ for 5 min; (b) 95℃ denaturation for 30s, 55℃ annealing for 30s, 72℃ extension for 45s, for a total of 35 cycles; (c) 72℃ for a total extension of 10 min.

Citation Information

Patent Citations

  • LAMP primer group, kit and method for detecting capsule histoplasma capsulatum

    CN113151557A