PCR primers, detection methods, and PCR detection kits for detecting the genome of Populus tomentosa in Xinjiang

Abstract

The present invention discloses PCR primers, a detection method, and a PCR detection kit for detecting the genome of Xinjiang poplar. Based on the genomes of Populus alba, Xinjiang poplar, Populus rapa, and Populus tremula, the present invention finds fragments with large differences in the genome through whole genome sequence comparison analysis, and designs specific primers for each poplar accordingly, from which specific primers that accurately distinguish the Xinjiang poplar genome from the genomes of other poplars are screened. The present invention further provides a PCR detection method and a detection kit for quickly distinguishing Xinjiang poplar from other poplar species using the specific primers. The present invention can quickly distinguish Xinjiang poplar from other poplar species. The PCR detection method is easy to operate and has a simple banding pattern. It does not require sequencing to directly distinguish Xinjiang poplar-specific genomic fragments by amplifying fragments. It has application prospects in the classification and utilization of poplar planting resources and the identification of hybrids.

Description

Technical Field

[0001] This invention relates to primers and detection methods for detecting poplar species, and more particularly to PCR-specific primers, PCR detection methods, and PCR detection kits for detecting the genome of Populus alba var. pyramidalis Bge., belonging to the field of PCR detection of Populus alba genome. Background Technology

[0002] Currently, SSR primers are the main type used for identifying different tree species, but SSR primers exist in all species and are not specific enough at the genome level.

[0003] To date, there are no genome-specific primers for identifying Populus tomentosa. Using such specific primers, it is possible to quickly identify whether a tree species contains the genome of Populus tomentosa, thereby inferring whether Populus tomentosa participated in the formation of that tree species. Summary of the Invention

[0004] One of the objectives of this invention is to provide specific PCR primer pairs for accurate identification of the genome of Populus tomentosa in Xinjiang;

[0005] The second objective of this invention is to provide a rapid PCR detection method for distinguishing Xinjiang poplar from other poplar species;

[0006] The third objective of this invention is to provide a PCR detection kit for detecting the genome of Populus tomentosa in Xinjiang.

[0007] The above-mentioned objective of the present invention is achieved through the following technical solution:

[0008] One aspect of the present invention is to provide a specific PCR primer pair for distinguishing the genomes of Xinjiang poplar from those of other poplar species, selected from either primer pair 1 or primer pair 2; the nucleotide sequence of the upstream primer of primer pair 1 is: TTATGAACCTGCTGTTTGTGAAG, and the nucleotide sequence of the downstream primer of primer pair 1 is: GGATGAGAATAAAGCCAGAAGAA.

[0009] The nucleotide sequence of the upstream primer of primer pair 2 is: ACCGTCGGTATAAAATACTCGGG, and the nucleotide sequence of the downstream primer of primer pair 2 is: TCGTCCACCCTCAAGGAAAA.

[0010] A second aspect of the present invention is to provide a rapid PCR detection method for distinguishing Xinjiang poplar from other poplar species, comprising:

[0011] (1) Extract DNA from the poplar samples to be tested;

[0012] (2) Using the extracted poplar sample DNA as a template, a PCR reaction system was established using the upstream and downstream primers of primer pair 1 or primer pair 2 as PCR amplification primers for PCR amplification.

[0013] (3) If a specific amplification band appears, it indicates that the poplar sample to be tested contains Xinjiang poplar genomic components. Specifically, PCR amplification is performed by establishing a PCR reaction system using the upstream and downstream primers of primer pair 1 as PCR amplification primers. If a specific amplification band of 856 bp appears, it indicates that the poplar sample to be tested contains Xinjiang poplar genomic components. PCR amplification is performed by establishing a PCR reaction system using the upstream and downstream primers of primer pair 2 as PCR amplification primers. If a specific amplification band of 648 bp appears, it indicates that the poplar sample to be tested contains Xinjiang poplar genomic components.

[0014] As a preferred embodiment of the present invention, the PCR reaction system established in step (2) includes: 2 μL of sample DNA to be tested, 10 μL of PCR Mix, 0.5 μL of upstream primer, 0.5 μL of downstream primer, and 7 μL of double-distilled water.

[0015] As a preferred embodiment of the present invention, the PCR amplification program in step (2) includes: 95℃ for 5 min, 95℃ for 30 s, annealing for 30 s, 72℃ for 30 s, 35 cycles, 72℃ for 5 min, 12℃, ∞.

[0016] A third aspect of the present invention is to provide a PCR detection kit for detecting the genome of *Populus thunbergii*, comprising: Taq enzyme, dNTPs, and Mg. 2+ ddH2O and PCR amplification primers; wherein the PCR amplification primers consist of upstream and downstream primers of primer pair 1 or primer pair 2.

[0017] The specific PCR primer pair for identifying the genome of Populus spp. provided by this invention can quickly distinguish Populus spp. from other Populus species. The PCR detection method and agarose gel electrophoresis are convenient and easy to operate, with simple banding patterns. It can distinguish the specific genome fragment of Populus spp. directly by amplifying fragments without sequencing, effectively saving manpower and resources. It has good application prospects in the classification, utilization and identification of hybrids of poplar planting resources. Attached Figure Description

[0018] Figure 1 Electrophoresis results of specific bands amplified by PCR using genome-specific primers selected from Xinjiang poplar; 1-5 are silver poplar, Xinjiang poplar, tremolo poplar, mountain poplar, and water poplar (negative control), respectively.

[0019] Figure 2Results of PCR amplification of some non-specific primers during the screening of genome-specific primers for Populus tinctoria in Xinjiang; 1-5 are Populus tinctoria, ...serrata, Populus tomentosa, and Populus alba (negative control), respectively. Detailed Implementation

[0020] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as a result. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions to the details and form of the present invention can be made without departing from the spirit and scope of the invention, but all such modifications and substitutions fall within the protection scope of the present invention.

[0021] Example 1: Screening of specific PCR primers for identifying the genome of Populus tomentosa in Xinjiang

[0022] 1. Test materials

[0023] Genomic DNA and water (negative control) of Populus alba L., Populus alba var. pyramidalis Bge., Populus adenopoda Maxim., and Populus davidiana Dode.

[0024] Based on the genomes of four poplar species previously obtained by the inventors' laboratory, whole-genome sequence alignment analysis revealed segments with significant differences in the genomes. Based on this, specific primers for each poplar species were designed, with 100 primer pairs designed for each chromosome (Table 1 only lists a portion of the designed primers). Then, primers were screened by PCR amplification to select primers that specifically amplified the genome of the Xinjiang poplar.

[0025] Table 1 lists some of the amplification primers designed using the same design principles and methods to distinguish the genome of Populus alba in Xinjiang.

[0026] Table 1. Some PCR primers used for screening genome-specific fragments of Populus alba in Xinjiang.

[0027]

[0028] 2. Test methods

[0029] Using the primer set selected above, PCR amplification was performed on the above four genomes.

[0030] PCR reaction system (20 μL): DNA 2 μL (10-30 ng / μL), PCR Mix 10 μL (Sangon Biotech, Shanghai), upstream primer 0.5 μL (10 μM), downstream primer 0.5 μL (10 μM), pure water 7 μL.

[0031] PCR reaction program: 95℃ for 5 min, 95℃ for 30 s, annealing for 30 s, 72℃ for 30 s, 35 cycles, 72℃ for 5 min, 12℃, infinity. Products were electrophoresed on a 1.5% agarose gel. Based on the banding results, primers containing specific bands in the *Populus thunbergii* genome were selected.

[0032] 3. Test Results

[0033] The amplification results of the designed specific primers are shown in Table 1. Figure 1 The distinguishing criterion is the presence or absence of a band; for example, the appearance of a band in lane 2 indicates the detection of Xinjiang poplar genome components. Figure 1 and Figure 2 The results showed that only 2 of the 18 primer pairs designed (Chr18A-1 and Chr06A-20) could amplify a single specific band. Chr18A-1 had better amplification effect, higher sensitivity, and easier results to distinguish.

[0034] according to Figure 2 It can be seen that none of the 16 primer pairs in Table 1 are specific to the Xinjiang poplar genome. They can amplify corresponding fragments from other poplars at the same time and cannot be used as specific primers to detect whether the sample contains Xinjiang poplar genome components.

Claims

1. A specific PCR primer pair for distinguishing the genomes of *Populus alba* var. *pyramidalis* Bge. from other *Populus* species, characterized in that, Selected from any pair of primers 1 or 2; the nucleotide sequence of the upstream primer of primer pair 1 is: TTATGAACCTGCTGTTTGTGAAG, and the nucleotide sequence of the downstream primer of primer pair 1 is: GGATGAGAATAAAGCCAGAAGAA; The nucleotide sequence of the upstream primer of primer pair 2 is: ACCGTCGGTATAAAATACTCGGG, and the nucleotide sequence of the downstream primer of primer pair 2 is: TCGTCCACCCTCAAGGAAAA.

2. The specific PCR primer pair according to claim 1, characterized in that, Other Populus species mentioned include the silver poplar (Populus alba L.), the whistling poplar (Populus adenopoda Maxim.), and the mountain poplar (Populus davidiana Dode).

3. The application of the specific PCR primer pair described in claim 1 in the detection of the genome of Populus tomentosa in Xinjiang.

4. A PCR detection method for distinguishing Xinjiang poplar (Populus alba var. pyramidalis Bge.) from other poplar species, characterized in that, include: (1) Extract DNA from the poplar samples to be tested; (2) Using the extracted poplar sample DNA as a template, and using the upstream and downstream primers of primer pair 1 or primer pair 2 of claim 1 as PCR amplification primers, a PCR reaction system is established for PCR amplification. (3) If a specific amplification band appears, it indicates that the poplar sample to be tested contains Xinjiang poplar genome components.

5. The PCR detection method according to claim 4, characterized in that, A PCR reaction system was established using the upstream and downstream primers of primer pair 1 of claim 1 as PCR amplification primers. If a specific amplification band of 856 bp appeared, it indicates that the poplar sample to be tested contains Xinjiang poplar genomic components. A PCR reaction system was established using the upstream and downstream primers of primer pair 2 of claim 1 as PCR amplification primers. If a specific amplification band of 648 bp appeared, it indicates that the poplar sample to be tested contains Xinjiang poplar genomic components.

6. The PCR detection method according to claim 4, characterized in that, The PCR reaction system established in step (2) includes: 2 μL of sample DNA to be tested, 10 μL of PCR Mix, 0.5 μL of upstream primer, 0.5 μL of downstream primer, and 7 μL of double-distilled water.

7. The PCR detection method according to claim 4, characterized in that, The PCR amplification program described in step (2) includes: 95℃ for 5 min, 95℃ for 30 s, annealing for 30 s, 72℃ for 30 s, 35 cycles, 72℃ for 5 min, 12℃, ∞.

8. The PCR detection method according to claim 4, characterized in that, Other Populus species mentioned include Populus alba L., Populus adenopoda Maxim., and Populus davidiana Dode.

9. A PCR detection kit for detecting the genome of Populus euphratica in Xinjiang, comprising: Taq enzyme, dNTPs, Mg 2+ ddH2O and PCR amplification primers; characterized in that the PCR amplification primers are selected from any pair of primer pair 1 or primer pair 2; the nucleotide sequence of the upstream primer of primer pair 1 is: TTATGAACCTGCTGTTTGTGAAG, and the nucleotide sequence of the downstream primer of primer pair 1 is: GGATGAGAATAAAGCCAGAAGAA. The nucleotide sequence of the upstream primer of primer pair 2 is: ACCGTCGGTATAAAATACTCGGG, and the nucleotide sequence of the downstream primer of primer pair 2 is: TCGTCCACCCTCAAGGAAAA.

10. The application of the PCR detection kit according to claim 9 in the detection of the genome of Populus tomentosa in Xinjiang.

Images