Gene editing system for constructing ALS models with SOD1 gene mutations using porcine nuclear transfer donor cells and its applications

Abstract

This invention discloses a gene editing system for constructing porcine nuclear transplantation donor cells for ALS models with SOD1 gene mutations and its applications. This invention also provides a method for preparing recombinant cells: SOD1- g RNA1 (target sequence binding region as shown in nucleotides 3-22 of SEQ ID NO: 18), SOD1- g RNA6 (target sequence binding region as shown in nucleotides 3-22 of SEQ ID NO: 19), SOD1-mutant-ss160 (shown in SEQ ID NO: 20), and NCN protein (Cas9 protein or a fusion protein containing Cas9 protein) were co-transfected into porcine cells to obtain recombinant cells. This invention utilizes CRISPR / Cas9 technology combined with ssODN homologous recombination technology to perform point mutation gene editing of the SOD1 gene, mimicking the natural pathogenesis and genetic characteristics of ALS, and obtaining single-cell clones with precise point mutations in the SOD1 gene. This lays the foundation for later breeding of ALS disease model pigs using somatic cell nuclear transfer animal cloning technology.

Description

Technical Field

[0001] This invention belongs to the field of gene editing technology, specifically relating to a gene editing system for constructing porcine nuclear transplantation donor cells for a model of amyotrophic lateral sclerosis (ALS) with SOD1 gene mutation and its application. Background Technology

[0002] Amyotrophic lateral sclerosis (ALS), also known as Lou Gehrig's disease, is a major type of motor neuron disease (MND), commonly called "ALS" or "Lou Gehrig's disease." It is characterized by the progressive degeneration of motor nerve cells (neurons) in the brain and spinal cord. Motor neurons control muscle activity during movement, speech, swallowing, and breathing. Without stimulation of motor neurons, muscles gradually atrophy and degenerate, manifesting as progressive muscle weakness and paralysis, decreased speech, swallowing, and respiratory function, and ultimately respiratory failure and death. This disease does not affect sensory nerves, so it does not affect the patient's intelligence, memory, or sensation. The disease generally progresses rapidly, with an average lifespan of 3-5 years from the onset of symptoms, but this varies considerably due to individual heterogeneity. ALS is listed by the World Health Organization as one of the five major incurable diseases alongside AIDS and cancer, with an incidence rate of approximately 3 per 100,000, making it a rare disease worldwide.

[0003] The International Federation of ALS Associations designated June 21st as "World ALS Day" at an international patient conference held in Denmark in 2000. Various activities related to motor neuron disease are held around the world on this day to raise awareness and social compassion for patients suffering from this devastating disease. Currently, the pathophysiological mechanisms of ALS are not fully understood, and there are no accurate epidemiological reports on ALS incidence rates in China. However, the influence of genetic factors on ALS is widely recognized. Approximately 90% of ALS cases are sporadic (SALS), with the remaining cases being familial (FALS). More than 30 genes have been identified as being associated with FALS. Among these, the most common and studied genes are ALS1 (SOD1), ALS10 (TARDBP), ALS6 (FUS), and FTDALS1 (C9orf72), which are related to certain clinical characteristics of ALS, including age of onset, location, and survival.

[0004] SOD1 (superoxide dismutase 1) was the first gene associated with ALS discovered by a research team at the University of Massachusetts Medical School (UMMS) in 1993. Approximately one-fifth of ALS cases are associated with mutations in the SOD1 gene. Currently, over 180 mutations in the human SOD1 gene have been identified as being associated with ALS, almost all of which are autosomal dominant. Gene mutations alter the conformation of the SOD1 protein, leading to the accumulation of highly toxic hydroxyl radicals, resulting in mitochondrial dysfunction, RNA metabolism disorders, and DNA damage. Currently, it is generally believed that the neurotoxicity of mutant SOD1 protein is due to its abnormal accumulation and binding on the surface of organelles such as mitochondria, affecting organelle function, or to the abnormal accumulation of mutant proteins; however, neither of these theories has been confirmed in experimental animal models.

[0005] Research into the mechanisms of ALS development caused by SOD1 mutations and the development of corresponding drugs both require animal models. Currently, the most commonly used animal model is the mouse model. However, mice differ greatly from humans in body size, organ size, physiology, and pathology, and cannot realistically simulate normal human physiological and pathological states. Pigs, as large animals, have long been a primary source of meat for humans. Their body size and physiological functions are similar to humans, making them easy to breed and raise on a large scale. Furthermore, they face lower ethical and animal welfare requirements, making them ideal animal models for human diseases.

[0006] Gene editing is a biotechnology that has seen significant development in recent years. It encompasses everything from homologous recombination-based gene editing to nuclease-based technologies such as ZFN, TALEN, and CRISPR / Cas9, with CRISPR / Cas9 currently being the most advanced. Gene editing technology is increasingly being applied to the creation of animal models.

[0007] Homologous recombination (HDR) is the exchange of DNA sequence information through sequence homology: the repair template contains the desired insertion fragment, and both ends of the template are recombination arms with sequence homology to the insertion site. Double-stranded DNA (dsDNA) has traditionally been used as the repair template, but recent studies have revealed the superiority of single-stranded oligonucleotide deoxyribonucleotides (ssODNs) as HDR donor templates. First, ssODNs have higher insertion site specificity than dsDNA templates, which readily produce random insertions. Second, ssODNs require shorter homologous recombination arms than dsDNA templates; a design of 30-60 bases per side can achieve efficient and stable HDR, providing higher insertion efficiency compared to similar dsDNA templates. Third, dsDNA is easily merged by the NHEJ repair pathway, leading to homologous arm replication or partial integration of the dsDNA template, while ssODNs are less prone to this phenomenon. In addition, dsDNAs are harmful to cultured cells. Linear or plasmid dsDNAs have low transfection efficiency and cause adverse reactions in cells, while ssODN templates are more advantageous in these aspects. Summary of the Invention

[0008] The purpose of this invention is to provide a gene editing system for constructing SOD1 gene-mutated ALS model porcine nuclear transplantation donor cells and its applications.

[0009] The present invention provides a method for preparing recombinant cells, comprising the following steps: replacing the DNA molecule shown in SEQ ID NO: 21 in the chromosomal DNA of pig cells with the DNA molecule shown in SEQ ID NO: 20 to obtain recombinant cells.

[0010] The method for replacing the DNA molecule shown in SEQ ID NO: 21 in the chromosomal DNA of porcine cells with the DNA molecule shown in SEQ ID NO: 20 is as follows: porcine cells are co-transfected with SOD1-gRNA1, SOD1-gRNA6, SOD1-mutant-ss160 and NCN protein; SOD1-gRNA1 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 18; SOD1-gRNA6 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 19; SOD1-mutant-ss160 is a single-stranded DNA molecule shown in SEQ ID NO: 20; and NCN protein is a Cas9 protein or a fusion protein containing a Cas9 protein.

[0011] Specifically, the NCN protein is shown in SEQ ID NO: 3.

[0012] Specifically, the SOD1-gRNA1 is shown in SEQ ID NO: 18.

[0013] Specifically, the SOD1-gRNA6 is shown in SEQ ID NO: 19.

[0014] Specifically, the SOD1-gRNA1 is shown in SEQ ID NO: 10.

[0015] Specifically, the SOD1-gRNA6 is shown in SEQ ID NO: 15.

[0016] The porcine cells mentioned are porcine fibroblasts.

[0017] The porcine cells mentioned are primary porcine fibroblasts.

[0018] The ratios of porcine cells, SOD1-gRNA1, SOD1-gRNA6, SOD1-mutant-ss160, and NCN protein are as follows: 100,000 primary porcine fibroblasts: 0.8-1.2 μg SOD1-gRNA1: 0.8-1.2 μg SOD1-gRNA6: 1.8-2.2 μg SOD1-mutant-ss160: 3-5 μg NCN protein.

[0019] The ratio of porcine cells, SOD1-gRNA1, SOD1-gRNA6, SOD1-mutant-ss160, and NCN protein was as follows: 100,000 primary porcine fibroblasts: 1 μg SOD1-gRNA1 : 1 μg SOD1-gRNA6 : 2 μg SOD1-mutant-ss160 : 4 μg NCN protein.

[0020] The co-transfection specifically employs an electroporation transfection method.

[0021] The specific parameter settings for electroporation transfection are: 1450V, 10ms, 3pulse.

[0022] The co-transfection can be performed using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system electroporator.

[0023] The method for preparing the NCN protein includes the following steps:

[0024] (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacteria;

[0025] (2) The recombinant bacteria were cultured in liquid medium at 37°C, then IPTG was added and induced at 25°C, and then the bacterial cells were collected.

[0026] (3) The collected bacterial cells were broken down to collect the crude protein solution;

[0027] (4) The His6-tagged fusion protein was purified from the crude protein solution by affinity chromatography;

[0028] (5) The His6-tagged fusion protein was digested with enterokinase, and then the His6-tagged polypeptide was removed with Ni-NTA resin to obtain purified NCN protein.

[0029] The plasmid pKG-GE4 contains the fusion gene shown in nucleotides 5209-9852 of SEQ ID NO: 1.

[0030] The preparation method of the NCN protein specifically includes the following steps:

[0031] (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacteria.

[0032] (2) Inoculate the recombinant bacteria obtained in step (1) into liquid LB medium containing ampicillin and culture with shaking;

[0033] (3) Inoculate the bacterial culture obtained in step (2) into liquid LB medium and culture at 37°C with shaking at 230 rpm until OD. 600nm The value was 1.0, then IPTG was added to make the concentration in the system 0.5mM, and then the cells were cultured at 25℃ and 230rpm for 12 hours with shaking, and then the cells were collected by centrifugation.

[0034] (4) Take the bacterial cells obtained in step (3) and wash them with PBS buffer;

[0035] (5) Take the bacterial cells obtained in step (4), add crude extraction buffer and suspend the bacterial cells, then break the bacterial cells, then centrifuge and collect the supernatant, filter with a 0.22 μm pore size filter membrane and collect the filtrate;

[0036] (6) The His6-tagged fusion protein (the fusion protein shown in SEQ ID NO: 2) was purified from the filtrate obtained in step (5) by affinity chromatography;

[0037] (7) Take the column-passed solution collected in step (6), concentrate it using an ultrafiltration tube, and then dilute it with 25 mM Tris-HCl (pH 8.0);

[0038] (8) Add the His-tagged recombinant bovine enterokinase to the solution obtained in step (7) and digest it with enzymes;

[0039] (9) Mix the solution from step (8) with Ni-NTA resin, incubate, and then centrifuge to collect the supernatant.

[0040] (10) Take the supernatant obtained in step (9), concentrate it using an ultrafiltration tube, and then add it to the enzyme storage solution to obtain the NCN protein solution.

[0041] The specific method for purifying the His6-tagged fusion protein from the filtrate obtained in step (5) using affinity chromatography is as follows:

[0042] First, equilibrate the Ni-NTA agarose column with 5 column volumes of equilibration buffer (flow rate: 1 ml / min); then load 50 ml of the filtrate obtained in step (5) (flow rate: 0.5-1 ml / min); then wash the column with 5 column volumes of equilibration buffer (flow rate: 1 ml / min); then wash the column with 5 column volumes of buffer (flow rate: 1 ml / min) to remove contaminating proteins; then elute with 10 column volumes of elution buffer at a flow rate of 0.5-1 ml / min, and collect the post-column solution (90-100 ml).

[0043] The present invention also provides a protein (NCN protein), as shown in SEQ ID NO: 3.

[0044] The present invention also provides a protein (PRONCN protein) comprising, from upstream to downstream, the following elements: signal peptide, molecular chaperone protein, protein tag, protease cleavage site, nuclear localization signal, Cas9 protein, and nuclear localization signal.

[0045] The function of the signal peptide is to promote the secretory expression of a protein. The signal peptide can be selected from the Escherichia coli alkaline phosphatase (phoA) signal peptide, Staphylococcus aureus protein A signal peptide, Escherichia coli outer membrane protein (ompa) signal peptide, or any other prokaryotic gene signal peptide, preferably the alkaline phosphatase signal peptide (phoA signal peptide). The alkaline phosphatase signal peptide is used to guide the secretory expression of the target protein into the bacterial periplasmic lumen, thereby separating it from the intracellular protein. The target protein secreted into the bacterial periplasmic lumen is soluble and can be cleaved by the signal peptidase in the bacterial periplasmic lumen.

[0046] The function of the molecular chaperone protein is to increase the solubility of the protein. The molecular chaperone can be any protein that helps form disulfide bonds, preferably a thioreduction protein (TrxA protein). A thioreduction protein, acting as a molecular chaperone, helps the co-expressed target protein (e.g., Cas9 protein) form disulfide bonds, improving protein stability, correct folding, and increasing the solubility and activity of the target protein.

[0047] The protein tag is used for protein purification. The tag can be a His tag (His-Tag, His6 protein tag), GST tag, Flag tag, HA tag, c-Myc tag, or any other protein tag, with a His tag being more preferred. The His tag can bind to a Ni column, enabling one-step Ni column affinity chromatography to purify the target protein, greatly simplifying the purification process.

[0048] The function of the protease cleavage site is to cleave the non-functional segment after purification to release the native form of Cas9 protein. The protease can be selected from enterokinase, factor Xa, thrombin, TEV protease, HRV 3C protease, WELQut protease, or any other endopeptide, with enterokinase being more preferred. EK is an enterokinase cleavage site, facilitating the cleavage of the fused TrxA-His segment using enterokinase to obtain the native form of Cas9 protein. In this application, after cleaving the fusion protein with a His-tagged commercial enterokinase, the TrxA-His segment and the His-tagged enterokinase can be removed by a single affinity chromatography to obtain the native form of Cas9 protein, avoiding the damage and loss of the target protein caused by multiple purification dialysis processes.

[0049] The nuclear localization signal can be any nuclear localization signal, preferably the SV40 nuclear localization signal and / or the nucleoplasmin nuclear localization signal. The NLS is the nuclear localization signal; an NLS site is designed at both the N-terminus and C-terminus of Cas9, enabling Cas9 to more effectively enter the cell nucleus for gene editing.

[0050] The Cas9 protein may specifically be the spCas9 protein.

[0051] The PRONCN protein is shown in SEQ ID NO: 2.

[0052] This invention also protects a specific plasmid (pKG-GE4), which includes the following elements from upstream to downstream: promoter, operon, ribosome binding site, gene encoding PRONCN protein, and terminator.

[0053] The promoter may specifically be the T7 promoter. The T7 promoter is a strong prokaryotic expression promoter that can efficiently drive the expression of exogenous genes.

[0054] The operon can specifically be the Lac operon. The Lac operon is a regulatory element for lactose-induced expression. After the bacteria have grown to a certain number, the expression of the target protein can be induced by IPTG at low temperature, which can avoid the impact of premature expression of the target protein on the growth of the host bacteria. Induction at low temperature also significantly improves the solubility of the expressed target protein.

[0055] The ribosome binding site is the ribosome binding site during protein translation, which is essential for protein translation.

[0056] The terminator can specifically be a T7 terminator. The T7 terminator can effectively terminate gene transcription at the end of the target gene, preventing other downstream sequences outside the target gene from being transcribed and translated.

[0057] For the codons of spCas9 protein, this application has optimized the codons to fully adapt to the codon preferences of the high-efficiency E. coli expression strain E. coli BL21(DE3) selected in this application, thereby improving the expression level of Cas9 protein.

[0058] The T7 promoter is shown as nucleotides 5121-5139 in SEQ ID NO: 1.

[0059] The Lac operon is shown as nucleotides 5140-5164 in SEQ ID NO: 1.

[0060] The ribosome binding site is shown as nucleotides 5178-5201 in SEQ ID NO: 1.

[0061] The coding sequence of the alkaline phosphatase signal peptide is shown as nucleotides 5209-5271 in SEQ ID NO: 1.

[0062] The coding sequence of the TrxA protein is shown as nucleotides 5272-5598 in SEQ ID NO: 1.

[0063] The coding sequence of His-Tag is shown as nucleotides 5620-5637 in SEQ ID NO: 1.

[0064] The coding sequence of the enterokinase cleavage site is shown as nucleotides 5638-5652 in SEQ ID NO: 1.

[0065] The coding sequence of the nuclear localization signal is shown as nucleotides 5656-5670 in SEQ ID NO: 1.

[0066] The coding sequence of the spCas9 protein is shown as nucleotides 5701-9801 in SEQ ID NO: 1.

[0067] The coding sequence of the nuclear localization signal is shown as nucleotides 9802-9849 in SEQ ID NO: 1.

[0068] The T7 terminator is nucleotides 9902-9949 in SEQ ID NO: 1.

[0069] Specifically, plasmid pKG-GE4 contains the DNA molecule represented by nucleotides 5121-9949 of SEQ ID NO: 1.

[0070] Specifically, any of the plasmids pKG-GE4 described above is shown in SEQ ID NO: 1.

[0071] The NCN protein prepared using plasmid pKG-GE4 showed a significantly higher activity than the commercial Cas9 protein.

[0072] The present invention also protects a kit comprising any of the above-described SOD1-gRNA1, any of the above-described SOD1-gRNA6, any of the above-described SOD1-mutant-ss160 and any of the above-described NCN protein.

[0073] This invention also protects a kit comprising any of the above-described SOD1-gRNA1, any of the above-described SOD1-gRNA6, any of the above-described SOD1-mutant-ss160, and any of the above-described plasmid pKG-GE4. The kit further comprises *Escherichia coli* BL21(DE3).

[0074] The kits described above also include porcine cells.

[0075] The porcine cells mentioned are porcine fibroblasts.

[0076] The porcine cells mentioned are primary porcine fibroblasts.

[0077] This invention also protects the use of any of the above-described SOD1-gRNA1, any of the above-described SOD1-gRNA6, any of the above-described SOD1-mutant-ss160, and any of the above-described NCN proteins in the preparation kit.

[0078] This invention also protects the use of any of the above-described SOD1-gRNA1, any of the above-described SOD1-gRNA6, any of the above-described SOD1-mutant-ss160, and any of the above-described plasmid pKG-GE4 in the preparation of the kit.

[0079] The above-described kits are intended for use as follows (a), (b), or (c): (a) to prepare recombinant cells; (b) to prepare a pig model of amyotrophic lateral sclerosis (ALS); (c) to prepare a cell model, tissue model, or organ model of ALS.

[0080] This invention also protects recombinant cells prepared by any of the methods described above.

[0081] This invention also protects the use of the recombinant cells in the preparation of a pig model of amyotrophic lateral sclerosis (ALS).

[0082] Using the recombinant cells as nuclear transfer donor cells for somatic cell cloning, cloned pigs can be obtained, which are the model pigs of amyotrophic lateral sclerosis (ALS).

[0083] The present invention also protects porcine tissues or porcine organs having the recombinant cells.

[0084] The present invention also protects the use of the recombinant cells, the porcine tissue, the porcine organ, or the porcine model of amyotrophic lateral sclerosis (ALS) prepared using the recombinant cells, as follows (d1) or (d2) or (d3) or (d4):

[0085] (d1) Screening for drugs to treat amyotrophic lateral sclerosis (ALS);

[0086] (d2) Efficacy evaluation of drugs for amyotrophic lateral sclerosis (ALS);

[0087] (d3) Evaluate the efficacy of gene therapy and / or cell therapy for amyotrophic lateral sclerosis (ALS);

[0088] (d4) To study the pathogenesis of amyotrophic lateral sclerosis (ALS).

[0089] The pig mentioned above can specifically refer to the Congjiang Xiang pig.

[0090] Compared with the prior art, the present invention has at least the following beneficial effects:

[0091] (1) The research object of this invention (pig) has better applicability than other animals (mice, mice, primates).

[0092] Rodents such as mice and rats differ greatly from humans in body size, organ size, physiology, and pathology, making it impossible to realistically simulate normal human physiological and pathological states. Studies have shown that over 95% of drugs proven effective in mice and rats are ineffective in human clinical trials. Among large animals, primates are the closest relatives to humans, but they are small, reach sexual maturity late (mating begins at 6-7 years old), and are single-birth animals, resulting in extremely slow population expansion and high rearing costs. Furthermore, primate cloning is inefficient, difficult, and costly.

[0093] Pigs, as model animals, do not have the aforementioned drawbacks. Pigs are the closest relatives to humans besides primates, and their body size, weight, and organ size are similar to humans. They are also remarkably similar to humans in anatomy, physiology, immunology, nutritional metabolism, and disease pathogenesis. Furthermore, pigs reach sexual maturity early (4-6 months), have high reproductive capacity, produce multiple offspring per litter, and can form a large herd within 2-3 years. In addition, pig cloning technology is very mature, and the costs of cloning and raising pigs are much lower than for primates. Therefore, pigs are very suitable animals to serve as human disease models.

[0094] (2) The vector constructed in this invention uses the strong promoter T7-lac, which can efficiently express the target protein, to express the target protein. The signal peptide of bacterial periplasmic protein alkaline phosphatase (phoA) guides the secretion of the target protein into the bacterial periplasmic lumen, thereby separating it from intracellular proteins. The target protein secreted into the bacterial periplasmic lumen is soluble. Simultaneously, the thioreduction protein TrxA is fused with the Cas9 protein for expression. TrxA helps the co-expressed target protein form disulfide bonds, improving protein stability, correct folding, and increasing the solubility and activity of the target protein. To facilitate the purification of the target protein, a His tag is designed, allowing for one-step Ni column affinity chromatography purification of the target protein, greatly simplifying the purification process. Furthermore, an enterokinase cleavage site is designed after the His tag to facilitate the removal of the fused TrxA-His polypeptide fragment, yielding the native form of the Cas9 protein. After cleaving the fusion protein with a His-tagged enterokinase, the TrxA-His polypeptide fragment and the His-tagged enterokinase can be removed by a single affinity chromatography step, yielding the native form of Cas9 protein. This avoids the damage and loss to the target protein caused by multiple purification dialysis steps. Furthermore, this invention also designs an NLS site at the N-terminus and C-terminus of Cas9, enabling Cas9 to more effectively enter the cell nucleus for gene editing. Additionally, this invention selects E. coli BL21(DE3) as the target protein expression strain, which can efficiently express exogenous genes cloned into expression vectors containing the phage T7 promoter (such as pET-32a). Moreover, this invention optimizes the codons for the Cas9 protein to perfectly suit the codon preferences of the expression strain, thereby improving the expression level of the target protein. Furthermore, this invention induces the expression of the target protein with IPTG at low temperature after the bacteria have grown to a certain quantity, avoiding the impact of premature expression on host bacterial growth. Low-temperature induction also significantly improves the solubility of the expressed target protein. After the above-mentioned optimization design and experimental implementation, the activity of the obtained Cas9 protein was significantly improved compared with that of the commercial Cas9 protein.

[0095] (3) Gene editing was performed using the Cas9 high-efficiency protein constructed and expressed in this invention in combination with in vitro transcribed gRNA. The optimal ratio of Cas9 and gRNA was optimized. Combined with synthesized ssODN as Donor DNA, the single-cell clone rate of target site point mutation was as high as 25%, which is much higher than the conventional point mutation efficiency (<5%).

[0096] (4) Using the single-cell clone with target gene point mutation obtained in this invention, somatic cell nuclear transfer animal cloning can directly obtain cloned pigs containing target gene point mutation, and the mutation can be stably inherited.

[0097] The method of microinjecting gene-edited material into fertilized eggs followed by embryo transfer, used in mouse model creation, has a very low probability of directly obtaining point-mutant offspring (less than 1%), requiring crossbreeding and selection of offspring. This is not suitable for creating models of large animals (such as pigs) with long gestation periods. Therefore, this invention employs a technically challenging method of primary cell in vitro editing and ssODN homologous recombination followed by screening for positive edited single-cell clones. Subsequently, somatic cell nuclear transfer animal cloning technology is used to directly obtain pig models of the corresponding disease, which can significantly shorten the pig model creation cycle and save manpower, material resources, and financial resources.

[0098] This invention utilizes CRISPR / Cas9 technology combined with ssODN homologous recombination technology to perform point mutation gene editing of the SOD1 gene, simulating the natural pathogenesis and genetic characteristics of ALS. A single-cell clone with a precisely mutated SOD1 gene was obtained, laying the foundation for later development of ALS disease model pigs using somatic cell nuclear transfer animal cloning technology. This model pig will provide a powerful experimental tool for studying the pathogenesis of ALS and for drug development.

[0099] This invention lays a solid foundation for obtaining ALS model pigs with SOD1 gene mutations through gene editing. It will contribute to the research and elucidation of the pathogenesis of ALS caused by SOD1 gene mutations. It can also be used for drug screening, efficacy testing, gene therapy, and cell therapy research, providing effective experimental data for further clinical applications and thus offering powerful experimental tools for the successful treatment of human ALS. This invention has significant application value for the development of ALS drugs and for elucidating the pathogenesis of the disease. Attached Figure Description

[0100] Figure 1 This is a schematic diagram of the structure of plasmid pX330.

[0101] Figure 2 This is a schematic diagram of the structure of plasmid pKG-GE3.

[0102] Figure 3 This is a schematic diagram of the structure of plasmid pKG-U6gRNA.

[0103] Figure 4 This is a schematic diagram of inserting a DNA molecule of approximately 20 bp into the plasmid pKG-U6gRNA.

[0104] Figure 5 This is a schematic diagram of the structure of plasmid pET-32a.

[0105] Figure 6 This is a schematic diagram of the structure of plasmid pKG-GE4.

[0106] Figure 7This is an electrophoresis diagram showing the optimized ratio of gRNA to NCN protein in Example 3.

[0107] Figure 8 This is an electrophoresis diagram comparing the gene editing efficiency of NCN protein and commercial Cas9 protein in Example 3.

[0108] Figure 9 This is an electrophoresis image of PCR amplification performed using different primer pairs with genome extracted from ear tissue of pig No. 1 as a template in Example 4.

[0109] Figure 10 The image shows electrophoresis diagrams of PCR amplification performed in Example 4 using genomic DNA from 18 pigs as templates and primer pairs consisting of SOD1-E4g-JDF50 and SOD1-E4g-JDR540.

[0110] Figure 11 This is an electrophoresis diagram comparing the editing efficiency of different target sites in Example 4.

[0111] Figure 12 This is an electrophoresis image from Example 5.

[0112] Figure 13 The results of reverse sequencing of clone number SOD1-ss160-2 and alignment with the target site mutation sequence are shown.

[0113] Figure 14 The results show the alignment of reverse sequencing of clone number SOD1-ss160-3 with the target site mutation sequence.

[0114] Figure 15 The results show the alignment of reverse sequencing of clone number SOD1-ss160-21 with the target site mutation sequence.

[0115] Figure 16 The results show the alignment of reverse sequencing of clone number SOD1-ss160-10 with the target site mutation sequence.

[0116] Figure 17 The results show the alignment of reverse sequencing of clone number SOD1-ss160-25 with the target site mutation sequence.

[0117] Figure 18 The results show the alignment of reverse sequencing of clone number SOD1-ss160-1 with the target site mutation sequence. Detailed Implementation

[0118] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0119] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. The recombinant plasmids constructed in the examples have all been sequenced and verified. The commercially available Cas9-A protein is a commercially available, effective Cas9 protein. The commercially available Cas9-B protein is a commercially available, effective Cas9 protein. Complete culture medium (% by volume): 15% fetal bovine serum (Gibco) + 83% DMEM medium (Gibco) + 1% Penicillin-Streptomycin (Gibco) + 1% HEPES (Solarbio). Cell culture conditions: 37°C, incubator with 5% CO2 and 5% O2.

[0120] The primary porcine fibroblasts used in the examples were all prepared from newly formed ear tissue of Jiangxian pigs. The method for preparing primary porcine fibroblasts was as follows: ① Take 0.5g of pig ear tissue, remove hair and bone tissue, then soak in 75% alcohol for 30-40s, then wash 5 times with PBS buffer containing 5% (v / v) Penicillin-Streptomycin (Gibco), and then wash once with PBS buffer; ② Cut the tissue into small pieces with scissors, digest with 5mL of 0.1% collagenase solution (Sigma) at 37℃ for 1h, then centrifuge at 500g for 5min and discard the supernatant; ③ Resuspend the pellet in 1mL of complete culture medium, then plate it into a 10cm diameter cell culture dish containing 10mL of complete culture medium and sealed with 0.2% gelatin (VWR), and culture until the cells reach approximately 60% confluence with the bottom of the dish; ④ After completing step ③, digest with trypsin and collect the cells, then resuspend them in complete culture medium. These cells are used for subsequent electroporation experiments.

[0121] Example 1: Construction of recombinant plasmids

[0122] I. Construction of Efficient Eukaryotic Cas9 Expression Vectors

[0123] The starting plasmid is pX330-U6-Chimeric_BB-CBh-hSpCas9, abbreviated as plasmid pX330. A schematic diagram of the structure of plasmid pX330 can be found here. Figure 1The plasmid pX330 is a circular plasmid, as shown in SEQ ID NO: 1 of patent application 202010084343.6.

[0124] Based on plasmid pX330, plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO was constructed. Plasmid pU6gRNA eEF1a-mNLS-hSpCas9-EGFP-PURO, abbreviated as plasmid pKG-GE3, is shown in SEQ ID NO: 2 of patent application 202010084343.6. All plasmids pKG-GE3 are circular plasmids. A schematic diagram of the structure of plasmid pKG-GE3 is shown below. Figure 2 In patent application 202010084343.6, SEQ ID NO: 2, nucleotides 395-680 form the CMV enhancer, nucleotides 682-890 form the EF1a promoter, nucleotides 986-1006 encode the nuclear localization signal (NLS), nucleotides 1016-1036 encode the nuclear localization signal (NLS), nucleotides 1037-5161 encode the Cas9 protein, nucleotides 5162-5209 encode the nuclear localization signal (NLS), nucleotides 5219-5266 encode the nuclear localization signal (NLS), and nucleotides 5276-5332 encode the self-cleaving polypeptide P2A (the amino acid sequence of the self-cleaving polypeptide P2A is "ATNFSLLKQAGDVEENPGP", and the self-cleavage break is located at [location missing]. Nucleotides 5333-6046 (between the first and second amino acid residues at the C-terminus) encode the EGFP protein, nucleotides 6056-6109 encode the self-cleaving polypeptide T2A (the amino acid sequence of the self-cleaving polypeptide T2A is “EGRGSLLTCGDVEENPGP”, and the self-cleavage occurs between the first and second amino acid residues at the C-terminus), nucleotides 6110-6703 encode the Puromycin protein (abbreviated as Puro protein), nucleotides 6722-7310 form the WPRE sequence element, nucleotides 7382-7615 form the 3'LTR sequence element, and nucleotides 7647-7871 form the bGH poly(A)signal sequence element. In SEQ ID NO: 2 of patent application 202010084343.6, nucleotides 911-6706 form a fusion gene to express the fusion protein. Due to the presence of the self-cleaving peptide P2A and the self-cleaving peptide T2A, the fusion protein spontaneously forms the following three proteins: a protein with Cas9 protein, a protein with EGFP protein, and a protein with Puro protein.

[0125] Compared with plasmid pX330, plasmid pKG-GE3 underwent the following modifications: ① Removal of the residual gRNA backbone sequence (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTTT) to reduce interference; ② Modification of the original chickenβ-actin promoter to the EF1a promoter with higher expression activity to increase the protein expression capacity of the Cas9 gene; ③ Addition of nuclear localization signal encoding genes (NLS) upstream and downstream of the Cas9 gene to increase the nuclear localization capacity of the Cas9 protein; ④ The original plasmid lacked any eukaryotic cell selection markers, which was not conducive to the selection and enrichment of positive transformed cells. The P2A-EGFP-T2A-PURO encoding gene was inserted downstream of the Cas9 gene to endow the vector with fluorescence and eukaryotic cell resistance selection capabilities; ⑤ Insertion of WPRE elements and 3'LTR sequence elements to enhance the protein translation capacity of the Cas9 gene.

[0126] II. Construction of pKG-U6gRNA expression vector

[0127] Using pUC57 as the starting plasmid, the pKG-U6gRNA vector was constructed. The pKG-U6gRNA vector is the plasmid pKG-U6gRNA; its structural diagram is shown below. Figure 3 This is a circular plasmid, as shown in SEQ ID NO: 3 of patent application 202010084343.6. In SEQ ID NO: 3 of patent application 202010084343.6, nucleotides 2280-2539 form the hU6 promoter, and nucleotides 2558-2637 are used for transcription to form the gRNA backbone. In use, a DNA molecule of approximately 20 bp (the target sequence binding region for transcription to form gRNA) is inserted into the plasmid pKG-U6gRNA to form the recombinant plasmid. See the schematic diagram below. Figure 4 gRNA is transcribed from recombinant plasmids in cells.

[0128] III. Construction of High-Efficiency Prokaryotic Cas9 Expression Vectors

[0129] A schematic diagram of the structure of plasmid pET-32a is shown below. Figure 5 .

[0130] Plasmid pKG-GE4 was obtained by modifying plasmid pET-32a. Plasmid pET32a-T7lac-phoA:SP-TrxA-His-EK-NLS-spCas9-NLS-T7ter (abbreviated as plasmid pKG-GE4), as shown in SEQ ID NO: 1, is a circular plasmid; its structural diagram is shown below. Figure 6 .

[0131] In SEQ ID NO: 1, nucleotides 5121-5139 form the T7 promoter, nucleotides 5140-5164 encode the Lac operator, nucleotides 5178-5201 form the ribosome binding site (RBS), nucleotides 5209-5271 encode the alkaline phosphatase signal peptide (phoA signal peptide), nucleotides 5272-5598 encode the TrxA protein, nucleotides 5620-5637 encode the His-Tag, nucleotides 5638-5652 encode the enterokinase cleavage site (EK cleavage site), nucleotides 5656-5670 encode the nuclear localization signal, nucleotides 5701-9801 encode the spCas9 protein, nucleotides 9802-9849 encode the nuclear localization signal, and nucleotides 9902-9949 form the T7 terminator. The nucleotides encoding the spCas9 protein have been codon-optimized for Escherichia coli BL21(DE3) strain.

[0132] The main modifications to plasmid pKG-GE4 are as follows: ① The coding region of the TrxA protein was retained. The TrxA protein can help the expressed target protein form disulfide bonds, increasing the solubility and activity of the target protein. An alkaline phosphatase signal peptide coding sequence was added before the TrxA protein coding region. The alkaline phosphatase signal peptide can guide the expressed target protein to be secreted into the bacterial periplasmic lumen and can be cleaved by prokaryotic periplasmic signal peptidase. ② A His-Tag coding sequence was added after the TrxA protein coding sequence. The His-Tag can be used for... Enrichment of the target protein; ③ Add the coding sequence of the enterokinase cleavage site DDDDK (Asp-Asp-Asp-Asp-Lys) downstream of the His-Tag coding sequence. The purified protein will remove His-Tag and the upstream fused TrxA protein under the action of enterokinase; ④ Insert the Cas9 gene of suitable Escherichia coli BL21(DE3) strain with optimized codons, and add nuclear localization signal coding sequences upstream and downstream of this gene to increase the nuclear localization ability of the purified Cas9 protein in the later stage.

[0133] The fusion gene in plasmid pKG-GE4, as shown in nucleotides 5209-9852 of SEQ ID NO: 1, encodes the fusion protein (PRONCN protein) shown in SEQ ID NO: 2. Due to the presence of alkaline phosphatase signal peptide and enterokinase cleavage site, the fusion protein is cleaved by enterokinase to form the protein shown in SEQ ID NO: 3, which is named NCN protein.

[0134] Example 2: Preparation and purification of NCN protein

[0135] I. Induced Expression

[0136] 1. Plasmid pKG-GE4 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacteria.

[0137] 2. Inoculate the recombinant bacteria obtained in step 1 into liquid LB medium containing 100 μg / ml ampicillin and culture overnight at 37°C with shaking at 200 rpm.

[0138] 3. Inoculate the bacterial culture obtained in step 2 into liquid LB medium and incubate at 37°C with shaking at 230 rpm until OD reaches the target value. 600nm The concentration was set to 1.0, then isopropyl thiogalactoside (IPTG) was added to a concentration of 0.5 mM in the system. The mixture was then cultured at 25°C and 230 rpm for 12 hours with shaking. Finally, the cells were collected by centrifugation at 4°C and 10,000 g for 15 minutes.

[0139] 4. Take the bacterial cells obtained in step 3 and wash them with PBS buffer.

[0140] II. Purification of the fusion protein TrxA-His-EK-NLS-spCas9-NLS

[0141] 1. Take the bacterial cells obtained in step one, add crude extraction buffer and suspend the bacterial cells, then homogenize the bacterial cells using a homogenizer (1000 rpm for three cycles), then centrifuge at 4°C and 15000g for 30 min, collect the supernatant, filter the supernatant through a 0.22μm pore size filter membrane, and collect the filtrate. In this step, 10 ml of crude extraction buffer is prepared for every gram of wet bacterial cells.

[0142] Crude extraction buffer: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 5mM Imidazole, 1mM PMSF, with the balance being ddH2O.

[0143] 2. Affinity chromatography was used to purify the fusion protein.

[0144] First, equilibrate the Ni-NTA agarose column with 5 column volumes of equilibration buffer (flow rate: 1 ml / min); then load 50 ml of the filtrate obtained in step 1 (flow rate: 0.5-1 ml / min); then wash the column with 5 column volumes of equilibration buffer (flow rate: 1 ml / min); then wash the column with 5 column volumes of buffer (flow rate: 1 ml / min) to remove contaminating proteins; finally, elute with 10 column volumes of elution buffer at a flow rate of 0.5-1 ml / min, and collect the post-column solution (90-100 ml).

[0145] Ni-NTA agarose column: GenScript, L00250 / L00250-C, 10ml packing material.

[0146] Equilibrium solution: contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole, and the balance is ddH2O.

[0147] Buffer solution: containing 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 50 mM Imidazole, with the balance being ddH2O.

[0148] Eluent: Contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 500 mM Imidazole, and the balance is ddH2O.

[0149] III. Enzymatic digestion of the fusion protein TrxA-His-EK-NLS-spCas9-NLS and purification of the NCN protein

[0150] 1. Take 15 ml of the post-column solution collected in step 2, concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, 15 ml capacity), and then dilute it to 1 ml with 25 mM Tris-HCl (pH 8.0). Use 6 ultrafiltration tubes to obtain a total of 6 ml.

[0151] 2. Add the commercially available His-tagged recombinant bovine enterokinase (Sangon Biotech, C620031, Recombinant Bovine Enterokinase Light Chain, His-tagged) to the solution obtained in step 1 (approximately 6 ml), and digest at 25°C for 16 hours. Add 2 units of enterokinase per 50 μg of protein.

[0152] 3. Mix the solution from step 2 (approximately 6 ml) with 480 μl of Ni-NTA resin (GenScript, L00250 / L00250-C), mix by rotation at room temperature for 15 min, then centrifuge at 7000 g for 3 min, and collect the supernatant (4-5.5 ml).

[0153] 4. Take the supernatant obtained in step 3 and concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, capacity 15 ml). Then add it to the enzyme storage solution and adjust the protein concentration to 5 mg / ml to obtain the NCN protein solution.

[0154] Sequencing revealed that the N-terminal 15 amino acid residues in the NCN protein solution are as shown in positions 1 to 15 of SEQ ID NO: 3, which is the NCN protein.

[0155] The NCN protein used in subsequent embodiments was provided by an NCN protein solution.

[0156] Enzyme stock solution (pH 7.4): contains 10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% (v / v) glycerol, with the balance being ddH2O.

[0157] Example 3: Performance of NCN protein

[0158] The following two gRNA targets targeting the TTN gene were selected:

[0159] TTN-gRNA1: AGAGCACAGTCAGCCTGGCG;

[0160] TTN-gRNA2: CTTCCAGAATTGGATCTCCG.

[0161] The primers used to identify target fragments containing gRNA from the TTN gene are as follows:

[0162] TTN-F55: TACGGAATTGGGGAGCCAGCGGA;

[0163] TTN-R560: CAAAGTTAACTCTCTGTGTCT.

[0164] I. Preparation of gRNA

[0165] 1. Preparation of TTN-T7-gRNA1 and TTN-T7-gRNA2 transcription templates

[0166] The TTN-T7-gRNA1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 4.

[0167] The TTN-T7-gRNA2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 5.

[0168] 2. Obtain gRNA through in vitro transcription

[0169] Using TTN-T7-gRNA1 as a transcription template, in vitro transcription was performed using the Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), followed by MEGA clearing. TM The TTN-gRNA1 was recovered and purified using a Transcription Clean-Up Kit (Thermo, AM1908). TTN-gRNA1 is a single-stranded RNA, as shown in SEQ ID NO: 6.

[0170] Using TTN-T7-gRNA2 as a transcription template, in vitro transcription was performed using the Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), followed by MEGA clearing. TM The TTN-gRNA2 was recovered and purified using a Transcription Clean-Up Kit (Thermo, AM1908). TTN-gRNA2 is a single-stranded RNA, as shown in SEQ ID NO: 7.

[0171] II. Optimization of the ratio of gRNA to NCN protein

[0172] 1. Co-transfection of porcine primary fibroblasts

[0173] Group 1: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was approximately 100,000 porcine primary fibroblasts: 0.5 μg TTN-gRNA1 : 0.5 μg TTN-gRNA2 : 4 μg NCN protein.

[0174] Group 2: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was approximately 100,000 porcine primary fibroblasts: 0.75 μg TTN-gRNA1 : 0.75 μg TTN-gRNA2 : 4 μg NCN protein.

[0175] Group 3: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2 : 4 μg NCN protein.

[0176] Group 4: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was approximately 100,000 porcine primary fibroblasts: 1.25 μg TTN-gRNA1 : 1.25 μg TTN-gRNA2 : 4 μg NCN protein.

[0177] Group 5: TTN-gRNA1 and TTN-gRNA2 were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.

[0178] Co-transfection was performed using electroporation with a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3 pulses).

[0179] 2. After completing step 1, incubate in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total incubation time after electroporation is 48 hours.

[0180] 3. After completing step 2, cells were digested and collected with trypsin, genomic DNA was extracted, and PCR amplification was performed using primers consisting of TTN-F55 and TTN-R560, followed by 1% agarose gel electrophoresis.

[0181] See electrophoresis image Figure 7 The 505bp band is the wild-type band (WT), and the band around 254bp (the wild-type band theoretically has a deletion of 251bp) is the deletion mutation band (MT).

[0182] Gene deletion mutation efficiency = (MT gray level / MT band bp) / (WT gray level / WT band bp + MT gray level / MT band bp) × 100%. The gene deletion mutation efficiency of the first group is 19.9%, the gene deletion mutation efficiency of the second group is 39.9%, the gene deletion mutation efficiency of the third group is 79.9%, and the gene deletion mutation efficiency of the fourth group is 44.3%. No mutation occurred in the fifth group.

[0183] The results showed that the gene editing efficiency was highest when the mass ratio of the two gRNAs to NLS-spCas9-NLS protein was 1:1:4, and the actual dosage was 1 μg:1 μg:4 μg. Therefore, the optimal dosage of the two gRNAs to NCN protein was determined to be 1 μg:1 μg:4 μg.

[0184] III. Comparison of gene editing efficiency between NCN protein and commercial Cas9 protein

[0185] 1. Co-transfection of porcine primary fibroblasts

[0186] Cas9-A group: TTN-gRNA1, TTN-gRNA2, and commercial Cas9-A protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2 : 4 μg Cas9-A protein.

[0187] pKG-GE4 group: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2 : 4 μg NCN protein.

[0188] Cas9-B group: TTN-gRNA1, TTN-gRNA2, and commercial Cas9-B protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts : 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2 : 4 μg Cas9-B protein.

[0189] Control group: porcine primary fibroblasts were co-transfected with TTN-gRNA1 and TTN-gRNA2. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2.

[0190] Co-transfection was performed using electroporation with a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3 pulses).

[0191] 2. After completing step 1, incubate in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total incubation time after electroporation is 48 hours.

[0192] 3. After completing step 2, cells were digested and collected with trypsin, genomic DNA was extracted, and PCR amplification was performed using primers consisting of TTN-F55 and TTN-R560, followed by 1% agarose gel electrophoresis.

[0193] See electrophoresis image Figure 8 The gene deletion mutation efficiency using commercial Cas9-A protein was 28.5%, that using NCN protein was 85.6%, and that using commercial Cas9-B protein was 16.6%.

[0194] The results showed that, compared with commercially available Cas9 protein, the NCN protein prepared using this invention significantly improved gene editing efficiency.

[0195] Example 4: Screening for highly efficient gRNA targets of the SOD1 gene

[0196] Porcine SOD1 gene information: Encoding superoxide dismutase 1; located on chromosome 13; GeneID 397036, Susscrofa. The amino acid sequence encoded by the porcine SOD1 gene is shown in SEQ ID NO: 8. In the genomic DNA, the porcine SOD1 gene has 16 exons. In studies of SOD1 mutations associated with human ALS, G85R and G93A have been confirmed to correspond to porcine exon 4. The partial sequence of the porcine SOD1 gene (containing exon 3, intron 3, exon 4, and part of intron 4) in the porcine genomic DNA is shown in SEQ ID NO: 9.

[0197] I. Conservation analysis of pre-specified point mutation sites and adjacent genomic sequences in the SOD1 gene

[0198] Eighteen newborn Congjiang Xiang pigs were selected, including 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10) and 8 males (named A, B, C, D, E, F, G, and H).

[0199] SOD1-E4g-JDF50: TCAGAATGTTGCCGTTCTGGA;

[0200] SOD1-E4g-JDR540:CGCAGCAGAACAGTGTTCTTA;

[0201] SOD1-E4g-JDF121: TAGATTATTCTGACTCAGTCCA;

[0202] SOD1-E4g-JDR505:CATTCTTCGCTACAATCATTC.

[0203] Genomic DNA was extracted from ear tissue of pig '1' as a template, and PCR amplification was performed using different primer pairs, followed by 1% agarose gel electrophoresis. See the electrophoresis image below. Figure 9 . Figure 9 In the middle group: Group 1: SOD1-E4g-JDF50 / SOD1-E4g-JDR505; Group 2: SOD1-E4g-JDF50 / SOD1-E4g-JDR540; Group 3: SOD1-E4g-JDF121 / SOD1-E4g-JDR505; Group 4: SOD1-E4g-JDF121 / SOD1-E4g-JDR540. The results showed that the primer pair composed of SOD1-E4g-JDF50 and SOD1-E4g-JDR540 was preferred for amplifying the target fragment.

[0204] Using genomic DNA from 18 pigs as templates, PCR amplification was performed using primer pairs consisting of SOD1-E4g-JDF50 and SOD1-E4g-JDR540, followed by 1% agarose gel electrophoresis. (See electrophoresis image below.) Figure 10 PCR amplification products were recovered and sequenced. The sequencing results were compared and analyzed with SOD1 gene sequences in public databases. Conserved regions common to 18 pigs were selected for gRNA target design.

[0205] II. Target Screening

[0206] Several targets were initially screened by NGG (avoiding possible mutation sites), and 6 targets were further screened out after preliminary experiments.

[0207] The six target points are as follows:

[0208] SOD1-E4-gRNA1:AGAATCTTCGATGTACACAG;

[0209] SOD1-E4-gRNA2: GACTGCTGGCAAAGATGGTG;

[0210] SOD1-E4-gRNA3:TGCCAGCAGTCACATTGCCC;

[0211] SOD1-E4-gRNA4: GACCTGGGCAATGTGACTGC;

[0212] SOD1-E4-gRNA5:TGATGGAATGGTCTCCCGAG;

[0213] SOD1-E4-gRNA6:GTTTTCACCGTCAGGCACGT.

[0214] III. Preparation of Recombinant Plasmids

[0215] The pKG-U6gRNA plasmid was digested with restriction endonuclease BbsI, and the vector backbone (a large linear fragment of about 3kb) was recovered.

[0216] SOD1-E4-gRNA1-S and SOD1-E4-gRNA1-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA(SOD1-E4-gRNA1). Plasmid pKG-U6gRNA(SOD1-E4-gRNA1) expresses the sgRNA shown in SEQ ID NO: 10. SOD1-E4-gRNA1 .

[0217] sgRNA SOD1-E4-gRNA1 (SEQ ID NO: 10):

[0218] AGAAUCUUCGAUGUACACAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaagu ggcaccgagucggugcuuuu.

[0219] SOD1-E4-gRNA2-S and SOD1-E4-gRNA2-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA(SOD1-E4-gRNA2). Plasmid pKG-U6gRNA(SOD1-E4-gRNA2) expresses the sgRNA shown in SEQ ID NO: 11. SOD1-E4-gRNA2 .

[0220] sgRNA SOD1-E4-gRNA2 (SEQ ID NO: 11):

[0221] GACUGCUGGCAAAGAUGGUGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaagu ggcaccgagucggugcuuuu.

[0222] SOD1-E4-gRNA3-S and SOD1-E4-gRNA3-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA(SOD1-E4-gRNA3). Plasmid pKG-U6gRNA(SOD1-E4-gRNA3) expresses the sgRNA shown in SEQ ID NO: 12. SOD1-E4-gRNA3 .

[0223] sgRNA SOD1-E4-gRNA3 (SEQ ID NO: 12):

[0224] UGCCAGCAGUCACAUUGCCCguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaagu ggcaccgagucggugcuuuu.

[0225] SOD1-E4-gRNA4-S and SOD1-E4-gRNA4-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA(SOD1-E4-gRNA4). Plasmid pKG-U6gRNA(SOD1-E4-gRNA4) expresses the sgRNA shown in SEQ ID NO: 13. SOD1-E4-gRNA4 .

[0226] sgRNA SOD1-E4-gRNA4 (SEQ ID NO: 13):

[0227] GACCUGGGCAAUGUGACUGCguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaagu ggcaccgagucggugcuuuu.

[0228] SOD1-E4-gRNA5-S and SOD1-E4-gRNA5-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA(SOD1-E4-gRNA5). Plasmid pKG-U6gRNA(SOD1-E4-gRNA5) expresses the sgRNA shown in SEQ ID NO: 14. SOD1-E4-gRNA5 .

[0229] sgRNA SOD1-E4-gRNA5 (SEQ ID NO: 14):

[0230] UGAUGGAAUGGUCUCCCGAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaagu ggcaccgagucggugcuuuu.

[0231] SOD1-E4-gRNA6-S and SOD1-E4-gRNA6-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA(SOD1-E4-gRNA6). Plasmid pKG-U6gRNA(SOD1-E4-gRNA6) expresses the sgRNA shown in SEQ ID NO: 15. SOD1-E4-gRNA6 .

[0232] sgRNASOD1-E4-gRNA6 (SEQ ID NO:15):

[0233] GUUUUCACCGUCAGGCACGUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaagu ggcaccgagucggugcuuuu。

[0234] SOD1-E4-gRNA1-S:caccgAGAATCTTCGATGTACACAG;

[0235] SOD1-E4-gRNA1-A:aaacCTGTGTACATCGAAGATTCTc。

[0236] SOD1-E4-gRNA2-S:caccGACTGCTGGCAAAGATGGTG;

[0237] SOD1-E4-gRNA2-A:aaacCACCATCTTTGCCAGCAGTC。

[0238] SOD1-E4-gRNA3-S:caccgTGCCAGCAGTCACATTGCCC;

[0239] SOD1-E4-gRNA3-A:aaacGGGCAATGTGACTGCTGGCAc。

[0240] SOD1-E4-gRNA4-S:caccGACCTGGGCAATGTGACTGC;

[0241] SOD1-E4-gRNA4-A:aaacGCAGTCACATTGCCCAGGTC。

[0242] SOD1-E4-gRNA5-S:caccgTGATGGAATGGTCTCCCGAG;

[0243] SOD1-E4-gRNA5-A:aaacCTCGGGAGACCATTCCATCAc。

[0244] SOD1-E4-gRNA6-S:caccGTTTTCACCGTCAGGCACGT;

[0245] SOD1-E4-gRNA6-A:aaacACGTGCCTGACGGTGAAAAC。

[0246] SOD1-E4-gRNA1-S, SOD1-E4-gRNA1-A, SOD1-E4-gRNA2-S, SOD1-E4-gRNA2-A, SOD1-E4-gRNA3-S, SOD1-E4-gRNA3-A, SOD1 -E4-gRNA4-S, SOD1-E4-gRNA4-A, SOD1-E4-gRNA5-S, SOD1-E4-gRNA5-A, SOD1-E4-gRNA6-S, and SOD1-E4-gRNA6-A are all single-stranded DNA molecules.

[0247] IV. Comparison of Editing Efficiency for Different Targets

[0248] 1. Co-transfection

[0249] Group 1: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (SOD1-E4-gRNA1) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (SOD1-E4-gRNA1): 1.08 μg of plasmid pKG-GE3.

[0250] Group 2: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (SOD1-E4-gRNA2) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (SOD1-E4-gRNA2): 1.08 μg of plasmid pKG-GE3.

[0251] Group 3: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (SOD1-E4-gRNA3) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (SOD1-E4-gRNA3): 1.08 μg of plasmid pKG-GE3.

[0252] Group 4: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (SOD1-E4-gRNA4) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (SOD1-E4-gRNA4): 1.08 μg of plasmid pKG-GE3.

[0253] Group 5: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (SOD1-E4-gRNA5) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (SOD1-E4-gRNA5) : 1.08 μg of plasmid pKG-GE3.

[0254] Group 6: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (SOD1-E4-gRNA6) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (SOD1-E4-gRNA6): 1.08 μg of plasmid pKG-GE3.

[0255] Group 7: Primary porcine fibroblasts were electroporated without plasmids using the same electroporation parameters.

[0256] Co-transfection was performed using electroporation with a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3 pulses).

[0257] 2. After completing step 1, incubate in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total incubation time after electroporation is 48 hours.

[0258] 3. After completing step 2, cells were digested and collected using trypsin, lysed, and genomic DNA was extracted. PCR amplification was performed using primers consisting of SOD1-E4g-JDF50 and SOD1-E4g-JDR540, followed by 1% agarose gel electrophoresis. The mutation status of the target gene was detected. The target PCR product length was 490 bp. See the electrophoresis image below. Figure 11 .

[0259] After gel extraction and recovery of the target product, it was sent to a sequencing company for sequencing. The sequencing results were then analyzed using the web-based Synthego ICE tool to determine the gene editing efficiency of different target sites. The gene editing efficiencies of groups one through six were 62%, 28%, 10%, 19%, 9%, and 59%, respectively. No gene editing occurred in group seven. The results indicate that SOD1-E4-gRNA1 and SOD1-E4-gRNA6 have relatively high editing efficiencies.

[0260] Example 5: Preparation of SOD1 gene-edited monoclonal cells using somatic cell cloning.

[0261] Two highly efficient gRNA targets were selected from those screened in Example 4.

[0262] I. Preparation of gRNA

[0263] 1. Preparation of SOD1-T7-gRNA1 and SOD1-T7-gRNA6 transcription templates

[0264] The SOD1-T7-gRNA1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 16.

[0265] The SOD1-T7-gRNA6 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 17.

[0266] 2. Obtain gRNA through in vitro transcription

[0267] Using SOD1-T7-gRNA1 as a transcription template, in vitro transcription was performed using the Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), followed by MEGA clearing. TM The SOD1-gRNA1 was recovered and purified using the TranscriptionClean-Up Kit (Thermo, AM1908). SOD1-gRNA1 is a single-stranded RNA, as shown in SEQ ID NO: 18.

[0268] Using SOD1-T7-gRNA6 as a transcription template, in vitro transcription was performed using the Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), followed by MEGA clearing. TM The SOD1-gRNA6 was recovered and purified using the TranscriptionClean-Up Kit (Thermo, AM1908). SOD1-gRNA6 is a single-stranded RNA, as shown in SEQ ID NO: 19.

[0269] II. Synthesis of single-stranded Donor DNA containing the SOD1 mutation site

[0270] A single-stranded DNA corresponding to the human SOD1 G85R and G93A amino acid mutations was synthesized as the Donor DNA. In addition to the target site mutation, this single-stranded DNA also contained synonymous mutations at the 3' end of the target PAM or adjacent PAM of SOD1-E4-gRNA1 and SOD1-E4-gRNA6. This single-stranded Donor DNA was named SOD1-mutant-ss160.

[0271] SOD1-mutant-ss160 is shown in SEQ ID NO: 20.

[0272] III. Transfection of porcine primary fibroblasts

[0273] 1. SOD1-gRNA1, SOD1-gRNA6, SOD1-mutant-ss160, and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was approximately 100,000 porcine primary fibroblasts: 1 μg SOD1-gRNA1 : 1 μg SOD1-gRNA6 : 2 μg SOD1-mutant-ss160 : 4 μg NCN protein. Co-transfection was performed using electroporation with a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3 pulses).

[0274] 2. After completing step 1, incubate in complete culture medium for 16-18 hours, then replace with fresh complete culture medium. The total incubation time after electroporation is 48 hours.

[0275] 3. After completing step 2, digest and collect cells with trypsin, wash with complete culture medium, resuspend in complete culture medium, and then pick each single clone and transfer it to a 96-well plate (1 cell per well, 100 μl of complete culture medium per well) and culture for 2 weeks (replace with fresh complete culture medium every 2-3 days).

[0276] 4. After completing step 3, digest the cells with trypsin and collect them (about 2 / 3 of the cells obtained from each well are seeded into a 6-well plate containing complete culture medium, and the remaining 1 / 3 are collected in a 1.5 mL centrifuge tube).

[0277] 5. Take the 6-well plate from step 4, culture until the cells reach 80% confluence, digest with trypsin and collect the cells, and freeze the cells using cell cryopreservation solution (90% complete culture medium + 10% DMSO, volume ratio).

[0278] 6. Take the centrifuge tube from step 4, collect the cells, lyse the cells, and extract genomic DNA. Perform PCR amplification using a primer pair consisting of SOD1-E4g-JDF50 and SOD1-E4g-JDR540, followed by electrophoresis. Use porcine primary fibroblasts as a wild-type control. See the electrophoresis image below. Figure 12 . Figure 12 The lane numbers in the table are consistent with the cell numbers in Table 1.

[0279] 7. After completing step 6, recover the PCR amplification products and sequence them.

[0280] If a monoclonal cell has only one sequencing result, its genotype is homozygous wild-type. If a monoclonal cell has two sequencing results, one consistent with the sequencing result of the primary porcine fibroblast and the other showing a mutation (including deletion, insertion, or substitution of one or more nucleotides), the genotype of that monoclonal cell is heterozygous. If a monoclonal cell has two sequencing results, both showing mutations (including deletion, insertion, or substitution of one or more nucleotides) compared to the sequencing result of the primary porcine fibroblast, the genotype of that monoclonal cell is biallelic mutant. If a monoclonal cell has only one sequencing result and shows a mutation (including deletion, insertion, or substitution of one or more nucleotides) compared to the sequencing result of the primary porcine fibroblast, the genotype of that monoclonal cell is biallelic mutant. If a monoclonal cell has only one sequencing result and is consistent with the sequencing result of the primary porcine fibroblast, the genotype of that monoclonal cell is homozygous wild-type.

[0281] The results are shown in Table 1. The genotypes of single-cell clones numbered 2, 14, 15, 22, and 40 were homozygous wild-type. The genotypes of single-cell clones numbered 3, 8, 9, 11, 16, 17, 18, 23, 25, 28, 30, 32, 34, 37, and 39 were heterozygous. The genotypes of single-cell clones numbered 4, 12, 21, 24, 26, 33, 36, and 38 were biallelic mutants. The genotypes of single-cell clones numbered 1, 5, 6, 7, 10, 13, 19, 20, 27, 29, 31, and 35 were biallelic mutants. Among them, single-cell clones 9, 16, 18, 25, and 39 were heterozygous for point mutations at the target site (i.e., one of the two homologous chromosomes underwent a single-stranded Donor DNA replacement, while the other remained wild-type), while single-cell clones 1, 6, 29, 31, and 35 were biallelic mutants with point mutations at the target site (i.e., both homologous chromosomes underwent single-stranded Donor DNA replacement). The success rate of obtaining SOD1 gene-edited single-cell clones was 87.5%, and the success rate of obtaining single-cell clones with point mutations at the target site was 25%.

[0282] Example sequencing alignment results are as follows Figures 13 to 18 . Figure 13 The result is the result of reverse sequencing of clone number SOD1-ss160-2 and alignment with the target site mutation sequence, indicating that it is wild-type. Figure 14 The result is the result of reverse sequencing of clone number SOD1-ss160-3 and alignment with the target site mutation sequence, indicating a heterozygous mutant. Figure 15The results are from the reverse sequencing of clone number SOD1-ss160-21 and the alignment of the reverse sequencing with the target site mutation sequence, indicating a homozygous mutant with different biallelic variations. Figure 16 The results are from the reverse sequencing of clone number SOD1-ss160-10 and the alignment of the target site mutation sequence, indicating a homozygous mutant with identical biallelic variants. Figure 17 The result is the result of the reverse sequencing of clone number SOD1-ss160-25 and the alignment of the target site mutation sequence, which is a heterozygous mutant of the target site point mutation. Figure 18 The result is the alignment of the reverse sequencing of clone number SOD1-ss160-1 with the target site mutation sequence, which is a homozygous mutant of the target site point mutation.

[0283] Table 1. Genotyping results of single-cell clones with SOD1 gene point mutations.

[0284]

[0285]

[0286]

[0287] Note: Target site mutation refers to the replacement of a single strand of Donor DNA; that is, the DNA molecule shown in SEQ ID NO: 21 in the chromosomal DNA is replaced by the DNA molecule shown in SEQ ID NO: 20.

[0288] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims. sequence list <110> Nanjing Qizhen Gene Engineering Co., Ltd. <120> Gene editing system for constructing ALS models with SOD1 gene mutations using porcine nuclear transfer donor cells and its applications <130> GNCYX210910 <160> twenty one <170> SIPOSequenceListing 1.0 <210> 1 <211> 9974 <212> DNA <213> Artificial Sequence <400> 1 tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60 cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120 ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180 gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240 acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300 ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360 ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420 acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480<00006�0>tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540 tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat 600 gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt 660 ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg 720 agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga 780 agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg 840 tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt 900 tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg 960 cagtgctgcc ataaccatga gtgataacac tgcggccaac ttacttctga caacgatcgg 1020 aggaccgaag gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga 1080 tcgttgggaa ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc 1140 tgcagcaatg gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc 1200 ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc 1260 ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg 1320 cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac 1380 gacggggagt caggcaacta tggatgaacg aatagacag atcgctgaga taggtgcctc actgattaag cattggtaac tgtcagacca agtttactca fathercttt agttgattt aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac caaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 1680 accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 1740. aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcgga caggagagcg cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca 2160 cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa 2220 cgccagcaac gcggccttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 2280 ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 2340 taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 2400 gcgcctgatg cggtattttc tccttacgca tctgtgcggt atttcacacc catatatgg 2460 tgcactctca gtacaatctg ctctgatgcc ccatagttaa gccagtatac actccgctat 2520 cgctacgtga ctgggtcatg gctgcgcccc gacacccgcc aacacccgct gacgcgccct 2580 gacgggcttg tctgctcccg gcatccgctt acagacaagc tgtgaccgtc tccgggagct 2640 gcatgtgtca gaggttttca ccgtcatcac cgaaacgcgc gaggcagctg cggtaaagct 2700 catcagcgtg gtcgtgaagc gattcacaga tgtctgcctg ttcatccgcg tccagctcgt 2760 tgagtttctc cagaagcgtt aatgtctggc ttctgataaa gcgggccatg ttaagggcgg 2820 ttttttcctg ttggtcact gatgcctccg tgtaaggggg atttctgttc atgggggtaa 2880 tgataccgat gaacgagag aggatgctca cgatacggggt tactgat gaacatgccc 2940 ggttactgga acgttgtgag ggtaacaac tggcggtag gatgcggcgg gaccagagaa 3000 aaatcactca gggtcaatgc cagcgcttcg ttatacaga tgtaggtgtt ccacagggta 3060 gccagcagca tcctgcgatg cagatccgga acataatggt gcagggcgct gacttccgcg 3120 tttccagact ttacgaaca cggaaccga agaccattca tgttgttgct caggtcgcag 3180 acgttttgca gcagcagtcg cttcacgttc gctcgcgtat cggtgattca ttctgctaac 3240 cagtaggca accccgccag cctagccggg tcctcaacga caggagcacg atcatgcgca 3300 cccgtggggc cgccatgccg gcgataatgg cctgctctc gccgaaacgt ttggtggcgg 3360 gaccagtgac gaaggcttga gcgaggggcgt gcaagattcc gataccgca agcgacaggc 3420 cgatcatcgt cgcgctccag cgaagcggt cctcgccgaa atgacccag agcgctgccg 3480 gcacctgtcc tacgagttgc atgataaga agacagtcat aagtgcggcg acgatagtca 3540 tgccccgcgc ccaccggaag gagctgactg ggttgaaggc tctcaagggc atcggtcgag 3600 atcccggtgc ctaatgagtg agctaactta cattaattgc gttgcgctca ctgcccgctt 3660 tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag 3720 gcggtttgcg tattgggcgc cagggtggtt tttcttttca ccagtgagac gggcaacagc 3780 tgattgccct tcaccgcctg gccctgagag agttgcagca agcggtccac gctggtttgc 3840 cccagcaggc gaaaatcctg tttgatggtg gttaacggcg ggatataaca tgagctgtct 3900 tcggtatcgt cgtatcccac taccgagatg tccgcaccaa cgcgcagccc ggactcggta 3960 atggcgcgca ttgcgcccag cgccatctga tcgttggcaa ccagcatcgc agtgggaacg 4020 atgccctcat tcagcatttg catggtttgt tgaaaaccgg acatggcact ccagtcgcct 4080 tcccgttccg ctatcggctg aatttgattg cgagtgagat atttatgcca gccagccaga 4140 cgcagacgcg ccgagacaga acttaatggg cccgctaaca gcgcgatttg ctggtgaccc 4200 aatgcgacca gatgctccac gcccagtcgc gtaccgtctt catgggagaa aataatactg 4260 ttgatgggtg tctggtcaga gacatcaaga fathercgccg gacattagt gcaggcagct tccacagcaa tggcatcctg gtcatccagc ggatagttaa tgatcagccc actgacgcgt tgcgcgagaa gattgtgcac cgccgcttta caggcttcga cgccgcttcg ttctaccatc 4440 gacaccacca cgctggcacc cagttgatcg gcgcgagatt taatcgccgc gacaatttgc gacggcgcgt gcagggccag actggaggtg gcaacgccaa tcagcaacga ctgtttgccc 4560. gccagttgtt gtgccacgcg gttgggaatg taattcagct ccgccatcgc cgcttccact 4620 ttttcccgcg ttttcgcaga aacgtggctg gcctggttca ccaccgggga aacggtctga 4680. taagagacac cggcatactc tgcgacatcg fathercgtta ctggtttcac attcaccacc ctgaattgac tctcttccgg gcgctatcat gccataccgc gaaaggtttt gcgccattcg 4800. atggtgtccg ggatctcgac gctctccctt atgcgactcc tgcattagga agcagcccag 4860 tagtagttg aggccgttga gcaccgccgc cgcaaggaat ggtgcatgca aggagatggc 4920 gcccaacagt cccccggcca cggggcctgc caccataccc acgccgaaac aagcgctcat 4980. gagcccgaag tggcgagccc gatcttcccc atcggtgatg tcggcgatat aggcgccagc 5040 aaccgcacct gtggcgccgg tgatgccggc cacgatgcgt ccggcgtaga ggatcgagat 5100 5160 ttcccctcta gaataattt tgtttaactt taagaaggag atatacatat gaacaaagc 5220 actattgcac tggcactctt accgttactg tttacccctg tgacaaaagc catgagcgat 5280 aaaattattc acctgactga cgacagtttt gacacggatg tactcaaagc ggacggggcg 5340 atcctcgtcg atttctgggc agagtggtgc ggtccgtgca aaatgatcgc cccgattctg 5400 5460 aaccctggca ctgcgccgaa atatggcatc cgtggtatcc cgactctgct gctgttcaaa 5520 aacggtgaag tggcggcaac caaagtgggt gcactgtcta aaggtcagtt gaaagagttc 5580 ctcgacgcta acctggccgg ttctggttct ggccatatgc accatcatca tcatcatgac 5640 gatgacgata agatgcccaa aaagaaacga aaggtgggta tccacggagt cccagcagcc 5700 gacaaaaaat atagcatcgg cctggacatc ggtaccaaca gcgttggctg ggcagtgatc 5760 actgatgaat acaaagttcc atccaaaaaa tttaaagtac tgggcaacac cgaccgtcac 5820 tctatcaaaa aaaacctgat tggtgctctg ctgtttgaca gcggcgaaac tgctgaggct 5880 acccgtctga aacgtacggc tcgccgtcgc tacactcgtc gtaaaaaccg catctgttat 5940 ctgcaggaaa ttttctctaa cgaaatggca aaagttgatg atagcttctt tcatcgtctg 6000 gaagagagct tcctggtgga agaagataaa aaacacgaac gtcacccgat tttcggtaac 6060 attgtggatg aggttgccta ccacgagaaa tatccgacca tctaccatct gcgtaaaaaa 6120 ctggttgata gcactgacaa agcggatctg cgtctgatct acctggctct ggcacacatg 6180 atcaaattcc gtggtcactt cctgatcgaa ggtgatctga accctgataa ctccgacgtg 6240 gacaaactgt tcattcagct ggttcagacc tataaccagc tgttcgaaga aaacccgatc 6300 aacgcgtccg gtgtagacgc taaggcaatt ctgtctgcgc gtctgtctaa gtctcgtcgt 6360 ctggaaaacc tgattgcgca actgccaggt gaaaagaaaa acggcctgtt cggcaatctg 6420 atcgccctgt ccctgggtct gactccgaac tttaaatcca actttgacct ggcggaagat 6480 gccaagctgc agctgagcaa agatacctat gacgatgacc tggataacct gctggcacag 6540 atcggtgatc agtatgccga tctgttcctg gccgcgaaaa acctgtctga tgcgattctg 6600 ctgtctgata tcctgcgcgt taacactgaa attactaaag cgccgctgag cgcatccatg 6660 attaaacgtt acgatgaaca ccaccaggat ctgaccctgc tgaaagcgct ggtgcgtcag 6720 cagctgccgg aaaaatacaa ggagatcttc ttcgaccaga gcaaaaacgg ttacgcgggc 6780 tacattgatg gtggtgcatc tcaggaggaa ttctacaaat tcattaaacc gatcctggaa 6840 aaaatggatg gtactgaaga gctgctggtt aaactgaatc gtgaagatct gctgcgcaaa 6900 cagcgtacct tcgataacgg ttccatcccg catcagattc atctgggcga actgcacgct 6960 atcctgcgcc gtcaggaaga cttttatccg ttcctgaaag acaaccgtga gaaaattgaa 7020 aaaatcctga ccttccgtat tccgtactat gtaggtccgc tggcgcgtgg taactcccgt 7080 ttcgcttgga tgacccgcaa aagcgaagaa accatcaccc cgtggaattt cgaagaagtc 7140 gttgacaaag gcgcgtccgc gcagtctttc atcgaacgca tgacgaactt cgacaaaaac 7200 ctgccgaacg agaaagtgct gccgaaacac tctctgctgt acgagtactt cactgtgtac 7260 aacgaactga ccaaagtgaa atacgtcacc gaaggtatgc gtaaaccggc attcctgtcc 7320 ggtgagcaaa aaaaagcaat cgtggatctg ctgttcaaaa ccaaccgtaa agtaaccgtg 7380 aaacagctga aggaagacta tttcaagaaa atcgaatgtt ttgattctgt tgaaatctcc 7440 ggcgtggaag atcgcttcaa tgcgtccctg ggtacgtatc acgacctgct gaaaattatc 7500 aaagacaaag attttctgga caacgaggaa aacgaagaca tcctggagga tattgtactg 7560 accctgaccc tgttcgaaga ccgtgagatg atcgaagaac gcctgaaaac ctacgcccac 7620 ctgttcgatg acaaggtaat gaagcagctg aaacgtcgtc gttataccgg ctggggtcgt 7680 ctgtcccgta aactgatcaa tggcatccgt gataaacagt ctggcaaaac catcctggac 7740 ttcctgaaat ccgacggttt cgcgaatcgt aacttcatgc aactgattca tgacgattct 7800 ctgactttca aagaagacat ccagaaagca caggtttccg gccagggtga ctctctgcac 7860 gagcacattg ccaatctggc tggttctccg gctattaaaa agggtattct gcagactgtg 7920 aaagtagttg atgagctggt caaagtaatg ggccgtcaca agccggaaaa cattgtgatc 7980 gaaatggcac gtgaaaacca gacgacccag aaaggtcaga aaaactctcg tgaacgcatg 8040 aaacgtatcg aagaaggcat caaagaactg ggctctcaga tcctgaagga acaccctgta 8100 gaaaataccc agctgcagaa cgaaaagctg tatctgtatt acctgcagaa cggccgcgat 8160 atgtatgtgg accaggaact ggatatcaac cgcctgtccg attacgatgt agatcacatc 8220 gtgccgcaaa gcttcctgaa agacgacagc attgacaaca aagtactgac ccgttctgat 8280 aagaaccgtg gcaaatccga taacgtcccg tctgaagaag ttgttaaaaa aatgaaaaac 8340 tattggcgtc agctgctgaa cgcgaaactg atcacccagc gtaagttcga caatctgact 8400 aaagctgagc gcggtggtct gtccgaactg gataaagcgg gttttatcaa acgccagctg 8460 gttgaaaccc gtcagatcac gaagcacgtt gcgcagattc tggactctcg tatgaacacc 8520 aaatacgacg aaaacgacaa actgatccgc gaggttaagg ttatcaccct gaaaagcaaa 8580 ctggtatccg attttcgtaa agactttcag ttctacaaag tgcgcgaaat taacaactat 8640 caccacgctc acgatgcata tctgaatgca gttgttggca cggcgctgat caaaaagtat 8700 ccgaaactgg aatctgaatt cgtatacggc gattacaaag tgtatgacgt tcgtaagatg 8760 atcgcaaaat ccgagcagga aattggtaag gcgacggcga aatacttctt ttattccaat 8820 attatgaact ttttcaaaac cgaaatcacc ctggcgaatg gtgaaattcg taaacgcccg 8880 ctgatcgaaa ccaacggtga aactggtgaa atcgtttggg acaaaggccg cgacttcgcg 8940 accgtgcgta aagttctgtc tatgccgcaa gtgaacatcg tcaagaagac cgaagtacaa 9000 accggcggtt ttagcaaaga gagcattctg ccaaaacgta actccgacaa actgatcgcg 9060 cgcaagaaag actgggatcc gaaaaaatac ggtggtttcg attctccaac cgttgcttat 9120 tccgttctgg tggtagccaa agttgagaaa ggtaaaagca aaaaactgaa atccgtaaag 9180 gaactgctgg gtattactat catggagcgt agctccttcg aaaaaaaccc gatcgatttt 9240 ctggaagcga aaggctataa agaagtcaaa aaggacctga tcatcaaact gccaaaatac 9300 agcctgttcg agctggaaaa cggccgtaaa cgtatgctgg catctgcggg cgaactgcag 9360 aaaggcaacg agctggctct gccgtccaaa tacgtgaact ttctgtacct ggcctctcac 9420 tacgaaaaac tgaaaggttc cccggaagac aacgaacaga aacagctgtt cgtagagcag 9480 cacaaacact acctggacga gatcatcgaa cagatttctg aattttctaa acgtgtgatt 9540 ctggctgatg cgaatctgga taaagttctg tctgcctata acaagcatcg tgacaaaccg 9600 atccgcgaac aggctgagaa catcatccac ctgttcactc tgactaacct gggcgcgcca 9660 gcggctttca agtactttga taccaccatt gaccgcaagc gttacacctc cactaaagaa 9720 gtgctggacg cgactctgat ccaccagtcc atcaccggtc tgtacgagac ccgtatcgat 9780 ctgagccagc tgggcggtga caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa 9840 aagaaaaagt gacaaagccc gaaaggaagc tgagttggct gctgccaccg ctgagcaata 9900 actagcataa ccccttgggg cctctaaacg ggtcttgagg ggttttttgc tgaaaggagg 9960 aactatatcc ggat 9974 <210> 2 <211> 1547 <212> PRT <213> Artificial Sequence <400> 2 Met Lys Gln Ser Thr Ile Ala Leu Ala Leu Leu Pro Leu Leu Phe Thr 1 5 10 15 Pro Val Thr Lys Ala Met Ser Asp Lys Ile Ile His Leu Thr Asp Asp 20 25 30 Ser Phe Asp Thr Asp Val Leu Lys Ala Asp Gly Ala Ile Leu Val Asp 35 40 45 Phe Trp Ala Glu Trp Cys Gly Pro Cys Lys Met Ile Ala Pro Ile Leu 50 55 60 Asp Glu Ile Ala Asp Glu Tyr Gln Gly Lys Leu Thr Val Ala Lys Leu 65 70 75 80 Asn Ile Asp Gln Asn Pro Gly Thr Ala Pro Lys Tyr Gly Ile Arg Gly 85 90 95 Ile Pro Thr Leu Leu Leu Phe Lys Asn Gly Glu Val Ala Ala Thr Lys 100 105 110 Val Gly Ala Leu Ser Lys Gly Gln Leu Lys Glu Phe Leu Asp Ala Asn 115 120 125 Leu Ala Gly Ser Gly Ser Gly His Met His His His His His His Asp 130 135 140 Asp Asp Asp Lys Met Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly 145 150 155 160 Val Pro Ala Ala Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr 165 170 175 Asn Ser Val Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser 180 185 190 Lys Lys Phe Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys 195 200 205 Asn Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala 210 215 220 Thr Arg Leu Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn 225 230 235 240 Arg Ile Cys Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val 245 250 255 Asp Asp Ser Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu 260 265 270 Asp Lys Lys His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu 275 280 285 Val Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys 290 295 300 Leu Val Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala 305 310 315 320 Leu Ala His Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp 325 330 335 Leu Asn Pro Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val 340 345 350 Gln Thr Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly 355 360 365 Val Asp Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg 370 375 380 Leu Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu 385 390 395 400 Phe Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys 405 410 415 Ser Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp 420 425 430 Thr Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln 435 440 445 Tyr Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu 450 455 460 Leu Ser Asp Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu 465 470 475 480 Ser Ala Ser Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr 485 490 495 Leu Leu Lys Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu 500 505 510 Ile Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly 515 520 525 Gly Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu 530 535 540 Lys Met Asp Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp 545 550 555 560 Leu Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln 565 570 575 Ile His Leu Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe 580 585 590 Tyr Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr 595 600 605 Phe Arg Ile Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg 610 615 620 Phe Ala Trp Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn 625 630 635 640 Phe Glu Glu Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu 645 650 655 Arg Met Thr Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro 660 665 670 Lys His Ser Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr 675 680 685 Lys Val Lys Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser 690 695 700 Gly Glu Gln Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg 705 710 715 720 Lys Val Thr Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu 725 730 735 Cys Phe Asp Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala 740 745 750 Ser Leu Gly Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp 755 760 765 Phe Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu 770 775 780 Thr Leu Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys 785 790 795 800 Thr Tyr Ala His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg 805 810 815 Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly 820 825 830 Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser 835 840 845 Asp Gly Phe Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser 850 855 860 Leu Thr Phe Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly 865 870 875 880 Asp Ser Leu His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile 885 890 895 Lys Lys Gly Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys 900 905 910 Val Met Gly Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg 915 920 925 Glu Asn Gln Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met 930 935 940 Lys Arg Ile Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys 945 950 955 960 Glu His Pro Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu 965 970 975 Tyr Tyr Leu Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp 980 985 990 Ile Asn Arg Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser 995 1000 1005 Phe Leu Lys Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp 1010 1015 1020 Lys Asn Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys 1025 1030 1035 1040 Lys Met Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr 1045 1050 1055 Gln Arg Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser 1060 1065 1070 Glu Leu Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg 1075 1080 1085 Gln Ile Thr Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr 1090 1095 1100 Lys Tyr Asp Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr 1105 1110 1115 1120 Leu Lys Ser Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr 1125 1130 1135 Lys Val Arg Glu Ile Asn Asn Tyr His Ala His Asp Ala Tyr Leu 1140 1145 1150 Asn Ala Val Val Gly Thr Ala Leu Ile Lys Tyr Pro Lys Leu Glu 1155 1160 1165 Ser Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met 1170 1175 1180 Ile Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe 1185 1190 1195 1200 Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala 1205 1210 1215 Asn Gly Glu With Arg Lys Arg Pro Leu Glu Thr Asn Gly Glu Thr 1220 1225 1230 Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys 1235 1240 1245 Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln 1250 1255 1260 Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp 1265 1270 1275 1280 Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly 1285 1290 1295 Phe Asp Ser Pro Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val 1300 1305 1310 Glu Lys Gly Lys Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly 1315 1320 1325 Ile Thr Ile Met Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe 1330 1335 1340 Leu Glu Ala Lys Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys 1345 1350 1355 1360 Leu Pro Lys Tyr Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met 1365 1370 1375 Leu Ala Ser Ala Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro 1380 1385 1390 Ser Lys Tyr Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu 1395 1400 1405 Lys Gly Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln 1410 1415 1420 His Lys His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser 1425 1430 1435 1440 Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala 1445 1450 1455 Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile 1460 1465 1470 Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys 1475 1480 1485 Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu 1490 1495 1500 Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu 1505 1510 1515 1520 Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala 1525 1530 1535 Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys 1540 1545 <210> 3 <211> 1399 <212> PRT<000102​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr His 130 135 140 Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp Ser 145 150 155 160 Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His Met 165 170 175 Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro Asp 180 185 190 Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr Asn 195 200 205 Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala Lys 210 215 220 Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn Leu 225 230 235 240 Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn Leu 245 250 255 Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe Asp 260 265 270 Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp Asp 275 280 285 Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp Leu 290 295 300 Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp Ile 305 310 315 320 Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser Met 325 330 335 Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys Ala 340 345 350 Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe Asp 355 360 365 Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser Gln 370 375 380 Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp Gly 385 390 395 400 Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg Lys 405 410 415 Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu Gly 420 425 430 Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe Leu 435 440 445 Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile Pro 450 455 460 Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp Met 465 470 475 480 Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu Val 485 490 495 Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn 500 505 510 Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser Leu 515 520 525 Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr 530 535 540 Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys 545 550 555 560 Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val 565 570 575 Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp Ser 580 585 590 Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly Thr 595 600 605 Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp Asn 610 615 620 Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr Leu 625 630 635 640 Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala His 645 650 655 Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr Thr 660 665 670 Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp Lys 675 680 685 Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe Ala 690 695 700 Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe Lys 705 710 715 720 Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu His 725 730 735 Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly Ile 740 745 750 Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly Arg 755 760 765 His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln Thr 770 775 780 Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile Glu 785 790 795 800 Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro Val 805 810 815 Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu Gln 820 825 830 Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg Leu 835 840 845 Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu Lys Asp 850 855 860 Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg Gly 865 870 875 880 Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys Asn 885 890 895 Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys Phe 900 905 910 Asp Asn With Thr Lys Ala Glu Arg Gly Gly Ser Glu With Asp Lys 915,920,925 Only Gly Phe With Lys Arg Gln Leu Val Glu Thr Arg Gln With Thr Lys 930,935,940 His Gln Ile Leu Asp Ser Arg With Asn Thr Lys Tyr Asp Glu 945 950 955 960 Asn Asp Lys With Arg Glu Val Val Lys With Thr Lys Ser Ser Lys 965,970,975 Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg Glu 980,985,990 Ile Asn Asn Tyr His Ala His Asp Ala Tyr Leu Asn Ala Val Val 995 1000 1005 Gly Thr Ala Leu Ile Lys Tyr Pro Lys Leu Glu Ser Glu Phe Val 1010 1015 1020 Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys Ser 1025 1030 1035 1040 Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr Ser Asn 1045 1050 1055 Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala Asn Gly Glu Ile 1060 1065 1070 Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr Gly Glu Ile Val 1075 1080 1085 Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys Val Leu Ser Met 1090 1095 1100 Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln Thr Gly Gly Phe 1105 1110 1115 1120 Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala 1125 1130 1135 Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro 1140 1145 1150 Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val Glu Lys Gly Lys 1155 1160 1165 Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met 1170 1175 1180 Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys 1185 1190 1195 1200 Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr 1205 1210 1215 Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala 1220 1225 1230 Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val 1235 1240 1245 Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser Pro 1250 1255 1260 Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys His Tyr 1265 1270 1275 1280 Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg Val Ile 1285 1290 1295 Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala Tyr Asn Lys His 1300 1305 1310 Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile Ile His Leu Phe 1315 1320 1325 Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys Tyr Phe Asp Thr 1330 1335 1340 Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu Val Leu Asp Ala 1345 1350 1355 1360 Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu Thr Arg Ile Asp 1365 1370 1375 Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala Thr Lys Lys Ala 1380 1385 1390 Gly Gln Ala Lys Lys Lys Lys 1395 <210> 4 <211> 225 <212> DNA <213> Artificial Sequence <400> 4 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggagagc acagtcagcc tggcggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 5 <211> 225 <212> DNA <213> Artificial Sequence <400> 5 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggcttcc agaattggat ctccggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 6 <211> 225 <212> RNA <213> Artificial Sequence <400> 6 ggcuugucgg acucuucgcu auuacgccag cuggcgaagg gggaugugcu gcaaggcgau 60 uaaguugggu aacgccaggg uuuucccagu cacgacguua ggaaauuaau acgacucacu 120 auaggagagc acagucagcc uggcgguuuu agagcuagaa auagcaaguu aaaauaaggc 180 uaguccguua ucaacuugaa aaaguggcac cgagucggug cuuuu 225 <210> 7 <211> 225 <212> RNA <213> Artificial Sequence <400> 7 ggcuugucgg acucuucgcu auuacgccag cuggcgaagg gggaugugcu gcaaggcgau 60 uaaguugggu aacgccaggg uuuucccagu cacgacguua ggaaauuaau acgacucacu 120 auaggcuucc agaauuggau cuccgguuuu agagcuagaa auagcaaguu aaaauaaggc 180 uaguccguua ucaacuugaa aaaguggcac cgagucggug cuuuu 225 <210> 8 <211> 153 <212> PRT <213> Sus scrofa <400> 8 Met Ala Thr Lys Ala Val Cys Val Leu Lys Gly Asp Gly Pro Val Gln 1 5 10 15 Gly Thr Ile Tyr Phe Glu Leu Lys Gly Glu Lys Thr Val Leu Val Thr 20 25 30 Gly Thr Ile Lys Gly Leu Ala Glu Gly Asp His Gly Phe His Val His 35 40 45 Gln Phe Gly Asp Asn Thr Gln Gly Cys Thr Ser Ala Gly Pro His Phe 50 55 60 Asn Pro Glu Ser Lys Lys His Gly Gly Pro Lys Asp Gln Glu Arg His 65 70 75 80 Val Gly Asp Leu Gly Asn Val Thr Ala Gly Lys Asp Gly Val Ala Thr 85 90 95 Val Tyr Ile Glu Asp Ser Val Ile Ala Leu Ser Gly Asp His Ser Ile 100 105 110 Ile Gly Arg Thr Met Val Val His Glu Lys Pro Asp Asp Leu Gly Arg 115 120 125 Gly Gly Asn Glu Glu Ser Thr Lys Thr Gly Asn Ala Gly Ser Arg Leu 130 135 140 Ala Cys Gly Val Ile Gly Ile Thr Gln 145 150 <210> 9 <211> 1500 <212> DNA <213> On sow <400> 9 gctgtaccag tgcaggtcct cacttcaatc ctgaatccaa aaaacatggt gggccaaagg 60 atcaagagag gtgagtgatc taaggtcttt tgggaacagt agggaaattg catgctaaga 120 taattgtatc ttctgctctt aaagctgttg cccccatgta acccccttgc cccaactgct 180 agaatggctt actccctggg ctaaggactt gacaaatggg gacacgtaaa acgatttggt 240 tttgtagcat ttattgaata tagaactaat acaagtgcca gagggaactc atacaggaaa 300 tgtcatgagt aacagtattg ttaactgcta gcaaaataaa acactgtgaa acattagaag 360 ctttgtagat aaaaatttga tattggaaat tcagtgagat tccatttgta tgttttctga 420 gagccttca ggaacacatt acatttaagg acaaggatta ccttcctttt tatcagaggc 480 ctagaggcat agctctctta gccaggccag gaattggttt accccggtac ttgagctctg 540 aaattggaga tgcaccccca tcccacgcct ctgcctggag cattgcttta gagacgtgaa 600 accttgtttg aagccttatg tgtctagaac atcttagttac ttgtttta cttgcatatt 660 ttcagaatgt tgccgttctg gaaaagtggg ttctgttga tatagactcc gtcttcctct 720 tagcccagcc tagattatct gactcagtcc atttttaatt gagtttatga actgcagtta 780 aatggaaatc agtcctaatc ccgcgaatgc gtttcaccg tcaggcacgt tggactg 840 ggcaatgtga ctgctggcaa agatgtgtg gccactgtgt acatcgaaga ttctgtgatc 900 gccctctcgg gagaccattc catcattggc cgcacaatgg tgtacgtgt tcatataata 960 aggatgtgca tacatttct tctacacat ggtcatgttc tctttccta ttcatgctt 1020 attaatcctg gtttctaaag gtccccataa attgtacttt taatacagat taggaaagc 1080 cagttatttt actgaatgat tgtagcgag atgaatgat ctaggtcagt tagacact 1140 gttctgctgc gatgcagtag taagcagat gatttttat catattagat ctgtgttacg 1200 gaaacagacg cagtcttcat ctagtttta aatggccagg ttttctgcc actatggggt 1260 ctgtagttaa ccacacatt ttaatctaa aatctgggct ggacctcagt actaagaatt 1320 ccctcacgtc tgcaggttgt catcgtttca catgtgggat agttgcccta acttagtgtc 1380 gagctgcatc tggttcatac acgacagctg ttataggttc cctctgacct gccccagagg 1440 tcagttcaca ttcagtagac acttcctttc agttgactct ttttccttag aattttcttc 1500 <210> 10 <211> 100 <212> RNA <213> Artificial Sequence <400> 10 agaaucuucg auguacacag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 11 <211> 100 <212> RNA <213> Artificial Sequence <400> 11 gacugcuggc aaagauggug guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 12 <211> 100 <212> RNA <213> Artificial Sequence <400> 12 ugccagcagu cacauugccc guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 13 <211> 100 <212> RNA <213> Artificial Sequence <400> 13 gacggggca augugacugc guuuugagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 14 <211> 100 <212> RNA <213> Artificial Sequence <400> 14 ugauggaaug gucucccgag guuuugagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 15 <211> 100 <212> RNA <213> Artificial Sequence <400> 15 guuuucaccg ucaggcacgu guuuugagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 16 <211> 225 <212> DNA <213> Artificial Sequence <400> 16 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggagaat cttcgatgta cacaggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 17 <211> 225 <212> DNA <213> Artificial Sequence <400> 17 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 atagggtttt caccgtcagg cacgtgtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 18 <211> 102 <212> RNA <213> Artificial Sequence <400> 18 ggagaaucuu cgauguacac agguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 19 <211> 102 <212> RNA <213> Artificial Sequence <400> 19 ggguuuucac cgucaggcac guguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 20 <211> 160 <212> DNA <213> Artificial Sequence <400> 20 gaactgcagt taaatggaaa tcagtcctaa tcccgcgaat gcgttttcac cgtcaggcat 60 gtcggagacc tgagaaatgt gactgctggc aaagatgcag tggctactgt gtacatcgaa 120 gattctgtga tcgccctctc gggagaccat tccatcattg 160 <210> 21 <211> 160 <212> DNA <213> On sow <400> 21 gaactgcagt taaatggaaa tcagtcctaa tcccgcgaat gcgttttcac cgtcaggcac 60 gttggagacc tgggcaatgt gactgctggc aaagatggtg tggccactgt gtacatcgaa 120 gattctgtga tcgccctctc gggagaccat tccatcattg 160

Claims

1. A method for preparing recombinant cells, comprising the following steps: replacing the DNA molecule shown in SEQ ID NO: 21 in the chromosomal DNA of pig cells with the DNA molecule shown in SEQ ID NO: 20 to obtain recombinant cells; The method for replacing the DNA molecule shown in SEQ ID NO: 21 in the chromosomal DNA of pig cells with the DNA molecule shown in SEQ ID NO: 20 is as follows: pig cells are co-transfected with SOD1-gRNA1, SOD1-gRNA6, SOD1-mutant-ss160 and NCN protein; SOD1-gRNA1 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 18; SOD1-gRNA6 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 19; SOD1-mutant-ss160 is the single-stranded DNA molecule shown in SEQ ID NO: 20; The NCN protein is shown in SEQ ID NO: 3; The method for preparing the NCN protein includes the following steps: (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacteria; (2) The recombinant bacteria were cultured in liquid medium at 37°C, then IPTG was added and the culture was induced at 25°C, and then the bacterial cells were collected. (3) The collected bacterial cells were broken down to collect the crude protein solution; (4) The His6-tagged fusion protein was purified from the crude protein solution by affinity chromatography; (5) The His6-tagged fusion protein was digested with His6-tagged enterokinase, and then the His6-tagged protein was removed with Ni-NTA resin to obtain purified NCN protein. The plasmid pKG-GE4 is shown in SEQ ID NO:

1.

2. The method as described in claim 1, characterized in that: The ratios of porcine cells, SOD1-gRNA1, SOD1-gRNA6, SOD1-mutant-ss160, and NCN protein are as follows: 100,000 primary porcine fibroblasts: 0.8-1.2 μg SOD1-gRNA1: 0.8-1.2 μg SOD1-gRNA6: 1.8-2.2 μg SOD1-mutant-ss160: 3-5 μg NCN protein.

3. A kit comprising SOD1-gRNA1, SOD1-gRNA6, SOD1-mutant-ss160 and NCN protein; SOD1-gRNA1 is the SOD1-gRNA1 described in claim 1; SOD1-gRNA6 is the SOD1-gRNA6 described in claim 1; SOD1-mutant-ss160 is the SOD1-mutant-ss160 described in claim 1; NCN protein is the NCN protein described in claim 1; The kit is intended for use as follows (a), (b), or (c): (a) to prepare recombinant cells; (b) to prepare a pig model of amyotrophic lateral sclerosis (ALS); (c) to prepare a cell model, tissue model, or organ model of ALS.

4. Application of SOD1-gRNA1, SOD1-gRNA6, SOD1-mutant-ss160 and NCN proteins in the preparation of the kit; SOD1-gRNA1 is the SOD1-gRNA1 described in claim 1; SOD1-gRNA6 is the SOD1-gRNA6 described in claim 1; SOD1-mutant-ss160 is the SOD1-mutant-ss160 described in claim 1; NCN protein is the NCN protein described in claim 1; The kit is intended for use as follows (a), (b), or (c): (a) to prepare recombinant cells; (b) to prepare a pig model of amyotrophic lateral sclerosis (ALS); (c) to prepare a cell model, tissue model, or organ model of ALS.

Images