A method for constructing a MRAP2 gene mutation severe early-onset obesity model pig nuclear transfer donor cell
The MRAP2 gene mutation was precisely edited in pig cells using the CRISPR/Cas9 system and ssODN homologous recombination technology. This solved the problem that animal models in existing technologies do not conform to human physiology and pathology, and established an efficient pig model of severe early-onset obesity, improving the efficiency and feasibility of research and drug development.
Patent Information
- Application Number
- CN202110784062.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-07-12
- Publication Date
- 2025-10-24
- Estimated Expiration
- 2041-07-12
AI Technical Summary
Existing animal models such as mice cannot truly simulate the physiological and pathological conditions of humans, making it difficult to effectively study severe early-onset obesity caused by MRAP2 gene mutations. In addition, the application of existing gene editing technology in large animal models has problems of low efficiency and high cost.
The CRISPR/Cas9 system was combined with ssODN homologous recombination technology to construct a kit for MRAP2-gRNA, MRAP2-mutant-ss130 and NCN protein for gene editing of pig cells. Recombinant cells were prepared by electroporation, and a severe early-onset obesity model pig was established using somatic cell nuclear transfer technology.
A highly efficient pig model of severe early-onset obesity was successfully constructed, achieving a single-cell cloning rate of up to 22% for site-directed deletion of the MRAP2 gene. This provides an effective tool for studying the pathogenesis of obesity and drug development, and reduces the cost and time of model establishment.
Smart Images

Figure BDA0003158078600000161 
Figure BDA0003158078600000171 
Figure BDA0003158078600000181
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biotechnology, specifically to the field of gene editing, and more particularly relates to a method for constructing a porcine nuclear transfer donor cell model of severe early-onset obesity caused by MRAP2 gene mutation, which is based on CRISPR / Cas9 system and ssODN homologous recombination technology. BACKGROUND
[0002] Obesity is a condition in which excess body fat accumulates to the extent that it can have a negative impact on health, potentially leading to reduced life expectancy and various health problems. Obesity is a leading preventable cause of death worldwide and one of the most important public health problems in the 21st century. The prevalence of obesity is increasing in both adults and children, and it is more common in women than in men. In 2013, several medical societies, including the American Medical Association and the American Heart Association, defined obesity as a disease, i.e., obesity. In 2015, there were 600 million adults (13%) and 42 million children under the age of five worldwide with obesity problems. The WHO warned that overweight and obesity were the fifth leading risk factor for death globally, with at least 2.8 million people dying from obesity each year. A study by McKinsey Global Institute showed that obesity had an annual impact of about $2 trillion on the global economy, equivalent to 2.8% of total GDP.
[0003] Previous studies have shown that obesity is usually influenced by both genetics and environment, but obesity is actually heritable and caused by multiple genes, with different people having different susceptibility. In some cases, genetic obesity is directly caused by pathogenic mutations that interfere with energy homeostasis or fat deposition, such as the occurrence of human monogenic obesity. Among them, mutations in the melanocortin 4 receptor (MC4R) gene have been confirmed to be associated with human obesity, and recent studies have revealed that mutations in melanocortin 2 receptor accessory protein 2 (MRAP2) can also cause obesity. MRAP2 directly interacts with MC4R and further enhances MC4R downstream signaling based on MC4R agonists, and loss of function of MRAP2 will lead to inhibition of MC4R signal transduction, thereby leading to an obesity phenotype. Loss-of-function mutations in the MRAP2 gene can cause metabolic syndrome in adults and children, manifested as hyperphagia obesity, hyperglycemia, and hypertension, but there is no hypothalamic-pituitary-adrenal axis dysfunction, unlike other monogenic obesity patients who rarely have obesity and are accompanied by symptoms of hyperglycemia and hypertension. MRAP2 not only regulates the activity of melanocortin receptors, but also participates in the regulation of other G protein-coupled receptors, and plays an important role in regulating appetite and energy homeostasis. Therefore, there is an urgent need to develop an animal model of severe early-onset obesity caused by MRAP2 mutation to quickly unravel the mystery of the pathogenesis and lay the foundation for further treatment.
[0004] The development of the mechanism of the occurrence and development of severe early-onset obesity caused by MRAP2 gene mutation and the development of the corresponding drugs need to be based on animal models, and the commonly used animal model is a mouse model, however, the mouse is greatly different from the human in terms of body size, organ size, physiology, pathology and the like, and cannot truly simulate the normal physiological and pathological state of the human. The pig, as a large animal, is a main meat supply animal for the human for a long time, the size and physiological function of which are similar to those of the human, is easy to breed on a large scale, and has lower requirements in terms of ethics, morality and animal protection, and is an ideal animal model for human diseases.
[0005] Gene editing is a biological technology that has made great progress in recent years, which includes gene editing based on homologous recombination to ZFN, TALEN, CRISPR / Cas9 editing technology based on nuclease, and the CRISPR / Cas9 technology is the most advanced gene editing technology at present. At present, gene editing technology is more and more applied to the production of animal models.
[0006] Homologous recombination (HDR) is to exchange DNA sequence information through sequence homology: that is, the repair template contains the desired insertion fragment, and the two ends of the repair template are the recombination arms with sequence homology near the insertion site. In the past, double-stranded DNA (dsDNA) was usually used as a repair template, but recent studies have revealed the superiority of single-stranded oligonucleotide deoxynucleotide (ssODN) as a HDR donor template. First, the insertion site specificity of ssODN as a donor template is higher than that of dsDNA template, and dsDNA template is easy to produce random insertion. Second, the length requirement of ssODN for homologous recombination arms is shorter than that of dsDNA template, and a single-sided 30-60 base recombination arm design can obtain efficient and stable HDR, which provides higher insertion efficiency than similar dsDNA templates. Third, dsDNA is easy to be combined by the NHEJ repair pathway, thereby causing the replication of the homologous arm or the partial integration of the dsDNA template, while ssODN is not easy to produce such phenomenon. In addition, dsDNAs are harmful to cultured cells, and linear or plasmid dsDNAs have low transfection efficiency and cause adverse reactions in cells, while ssODN templates have more advantages in these aspects. SUMMARY
[0007] The purpose of the present application is to provide a method for constructing a MRAP2 gene mutation severe early-onset obesity model pig nuclear transfer donor cell.
[0008] The present application provides a kit comprising MRAP2-gRNA2, MRAP2-gRNA3, MRAP2-mutant-ss130 and NCN protein.
[0009] The application further provides a kit comprising MRAP2-gRNA2, MRAP2-gRNA3, MRAP2-mutant-ss130 and PRONCN protein.
[0010] The application further provides a kit comprising MRAP2-gRNA2, MRAP2-gRNA3, MRAP2-mutant-ss130 and a specific plasmid.
[0011] The kit further comprises a pig cell.
[0012] The application further provides application of MRAP2-gRNA2, MRAP2-gRNA3, MRAP2-mutant-ss130 and NCN protein in preparation of a kit.
[0013] The application further provides application of MRAP2-gRNA2, MRAP2-gRNA3, MRAP2-mutant-ss130 and PRONCN protein in preparation of a kit.
[0014] The application further provides application of MRAP2-gRNA2, MRAP2-gRNA3, MRAP2-mutant-ss130 and a specific plasmid in preparation of a kit.
[0015] The kit is used in (a) or (b) or (c) as follows: (a) preparation of a recombinant cell; (b) preparation of an obesity model pig; (c) preparation of an obesity cell model or an obesity tissue model or an obesity organ model.
[0016] The application further provides a method for preparing a recombinant cell, comprising the following steps: replacing a DNA molecule shown in SEQ ID NO: 19 in chromosomal DNA of a pig cell with a DNA molecule shown in SEQ ID NO: 18 to obtain a recombinant cell.
[0017] The method for replacing the DNA molecule shown in SEQ ID NO: 19 in the chromosomal DNA of the pig cell with the DNA molecule shown in SEQ ID NO: 18 is that MRAP2-gRNA2, MRAP2-gRNA3, MRAP2-mutant-ss130 and NCN protein are co-transfected into the pig cell.
[0018] The co-transfection is specifically in the form of electroporation.
[0019] The parameters of the electroporation are specifically 1450V, 10ms and 3pulse.
[0020] The co-transfection can specifically use a mammalian nucleic transfection kit (Neon kit, Thermofisher) and a NeonTM transfection system electroporator.
[0021] The ratio of MRAP2-gRNA2, MRAP2-gRNA3, MRAP2-mutant-ss130 and NCN protein is 0.8-1.2 μg MRAP2-gRNA2: 0.8-1.2 μg MRAP2-gRNA3: 1.8-2.2 μg MRAP2-mutant-ss130: 3-5 μg NCN protein, respectively.
[0022] The ratio of MRAP2-gRNA2, MRAP2-gRNA3, MRAP2-mutant-ss130 and NCN protein is 1 μg MRAP2-gRNA2: 1 μg MRAP2-gRNA3: 2 μg MRAP2-mutant-ss130: 4 μg NCN protein, respectively.
[0023] The ratio of pig cells, MRAP2-gRNA2, MRAP2-gRNA3, MRAP2-mutant-ss130 and NCN protein is 100,000 pig cells: 0.8-1.2 μg MRAP2-gRNA2: 0.8-1.2 μg MRAP2-gRNA3: 1.8-2.2 μg MRAP2-mutant-ss130: 3-5 μg NCN protein, respectively.
[0024] The ratio of pig cells, MRAP2-gRNA2, MRAP2-gRNA3, MRAP2-mutant-ss130 and NCN protein is 100,000 pig cells: 1 μg MRAP2-gRNA2: 1 μg MRAP2-gRNA3: 2 μg MRAP2-mutant-ss130: 4 μg NCN protein, respectively.
[0025] The MRAP2-gRNA2 in any of the above is an sgRNA, and the target sequence binding region is as shown in SEQ ID NO: 16.
[0026] The MRAP2-gRNA3 in any of the above is an sgRNA, and the target sequence binding region is as shown in SEQ ID NO: 17.
[0027] The MRAP2-mutant-ss130 in any of the above is a single-stranded DNA molecule as shown in SEQ ID NO: 18.
[0028] The NCN protein is a Cas9 protein or a fusion protein having a Cas9 protein.
[0029] Specifically, the NCN protein is shown as SEQ ID NO: 3.
[0030] Specifically, the MRAP2-gRNA2 is shown as SEQ ID NO: 16.
[0031] Specifically, the MRAP2-gRNA3 is shown as SEQ ID NO: 17.
[0032] Specifically, the MRAP2-gRNA2 is shown as SEQ ID NO: 11.
[0033] Specifically, the MRAP2-gRNA3 is shown as SEQ ID NO: 12.
[0034] The pig cell is a pig fibroblast.
[0035] The pig cell is a pig primary fibroblast.
[0036] The preparation method of the NCN protein comprises the following steps:
[0037] (1) introducing the plasmid pKG-GE4 into E. coli BL21(DE3) to obtain a recombinant bacterium;
[0038] (2) culturing the recombinant bacterium in a liquid medium at 30°C, then adding IPTG and performing 25°C induction culture, and then collecting the bacterial body;
[0039] (3) performing bacterial body disruption on the collected bacterial body to collect a crude protein solution;
[0040] (4) purifying the fusion protein having a His6 tag from the crude protein solution by affinity chromatography;
[0041] (5) performing enterokinase enzyme cutting on the fusion protein having a His6 tag, and then removing the protein having a His6 tag by Ni-NTA resin to obtain the purified NCN protein;
[0042] The fusion gene shown as the nucleotides at positions 5209-9852 in SEQ ID NO: 1 is in the plasmid pKG-GE4.
[0043] The preparation method of the NCN protein specifically comprises the following steps:
[0044] (1) introducing the plasmid pKG-GE4 into E. coli BL21(DE3) to obtain a recombinant bacterium.
[0045] (2) The recombinant bacteria obtained in step (1) were inoculated into liquid LB medium containing ampicillin and cultured with shaking;
[0046] (3) The bacteria solution obtained in step (2) was inoculated into liquid LB medium and cultured with shaking at 30°C and 230 rpm until the OD 600nm value = 1.0, and then IPTG was added to a concentration of 0.5 mM in the system, and then cultured with shaking at 25°C and 230 rpm for 12 hours, and then the bacteria were collected by centrifugation;
[0047] (4) The bacteria obtained in step (3) were washed with PBS buffer;
[0048] (5) The bacteria obtained in step (4) were suspended in crude extraction buffer, and then the bacteria were disrupted, and then the supernatant was collected by centrifugation, filtered using a filter membrane with a pore size of 0.22 μm, and the filtrate was collected;
[0049] (6) The fusion protein (fusion protein shown in SEQ ID NO: 2) having a His6 tag was purified from the filtrate obtained in step (5) using affinity chromatography;
[0050] (7) The post-column solution collected in step (6) was concentrated using an ultrafiltration tube, and then diluted with 25 mM Tris-HCl (pH 8.0);
[0051] (8) The recombinant bovine entero kinase having a His6 tag was added to the solution obtained in step (7) and subjected to enzymatic cleavage;
[0052] (9) The solution on which step (8) was completed was mixed with Ni-NTA resin, incubated, and then the supernatant was collected by centrifugation;
[0053] (10) The supernatant obtained in step (9) was concentrated using an ultrafiltration tube, and then added to an enzyme storage solution, which is the NCN protein solution.
[0054] The specific method for purifying the fusion protein having a His6 tag from the filtrate obtained in step (5) using affinity chromatography is as follows:
[0055] First, the Ni-NTA agarose column was equilibrated with 5 column volumes of equilibration buffer at a flow rate of 1 ml / min; then 50 ml of the filtrate obtained in step (5) was loaded (at a flow rate of 0.5-1 ml / min); then the column was washed with 5 column volumes of equilibration buffer (at a flow rate of 1 ml / min); then the column was washed with 5 column volumes of buffer (at a flow rate of 1 ml / min) to remove impure proteins; and then 10 column volumes of elution buffer were used to elute at a flow rate of 0.5-1 ml / min, and the post-column solution (90-100 ml) was collected.
[0056] Any of the above-mentioned PRONCN proteins comprises, from upstream to downstream, the following elements: a signal peptide, a chaperone protein, a protein tag, a protease cleavage site, a nuclear localization signal, a Cas9 protein, a nuclear localization signal.
[0057] The signal peptide functions to promote protein secretion expression. The signal peptide can be selected from an E. coli alkaline phosphatase (phoA) signal peptide, a Staphylococcus aureus protein A signal peptide, an E. coli outer membrane protein (ompa) signal peptide, or a signal peptide of any other prokaryotic gene, preferably a phoA signal peptide. The phoA signal peptide is used to guide the secretion expression of the target protein into the bacterial periplasmic cavity, so as to separate the intracellular protein from the bacteria, and the target protein secreted into the bacterial periplasmic cavity is soluble expression, which can be cleaved by the signal peptide enzyme in the bacterial periplasmic cavity.
[0058] The chaperone protein functions to increase the solubility of the protein. The chaperone can be any protein that helps form disulfide bonds, preferably a thioredoxin (TrxA protein). The thioredoxin can help the co-expressed target protein (such as the Cas9 protein) form disulfide bonds as a chaperone, improve the stability, folding accuracy of the protein, and increase the solubility and activity of the target protein.
[0059] The protein tag functions for protein purification. The tag can be a His tag (His-Tag, His6 protein tag), a GST tag, a Flag tag, an HA tag, a c-Myc tag, or any other protein tag, further preferably a His tag. The His tag can be combined with a Ni column, and the target protein can be purified by one-step Ni column affinity chromatography, which greatly simplifies the purification process of the target protein.
[0060] The protease cleavage site functions to remove the non-functional segment after purification to release the native form of the Cas9 protein. The protease can be selected from enterokinase, Factor Xa, Thrombin, TEV protease, HRV 3C protease, WELQut protease, or any other endoprotease, further preferably enterokinase. EK is an enterokinase cleavage site, which facilitates the removal of the fused TrxA-His segment using enterokinase to obtain the native form of the Cas9 protein. After the application uses commercial enterokinase with a His tag to cleave the fusion protein, the TrxA-His segment and the enterokinase with a His tag can be removed by one-step affinity chromatography to obtain the native form of the Cas9 protein, avoiding the damage and loss of the target protein caused by multiple purification and dialysis.
[0061] The nuclear localization signal can be any nuclear localization signal, preferably an SV40 nuclear localization signal and / or a nucleoplasmin nuclear localization signal. The NLS is a nuclear localization signal, and one NLS site is designed at the N-terminus and C-terminus of Cas9, respectively, so that Cas9 can more effectively enter the nucleus for gene editing.
[0062] The Cas9 protein can be a saCas9 or a spCas9, preferably a spCas9 protein.
[0063] The PRONCN protein is specifically shown in SEQ ID NO: 2.
[0064] The specific plasmid of any of the above includes the following elements from upstream to downstream: a promoter, an operator, a ribosome binding site, a coding gene of a PRONCN protein, and a terminator.
[0065] The promoter can be specifically a T7 promoter. The T7 promoter is a strong promoter for prokaryotic expression, which can efficiently drive the expression of an exogenous gene.
[0066] The operator can be specifically a Lac operator. The Lac operator is a regulatory element for lactose-induced expression, which can be used to induce the expression of the target protein at low temperature after the bacteria grow to a certain amount, thereby avoiding the influence of the early expression of the target protein on the growth of the host bacteria, and significantly improving the solubility of the expressed target protein.
[0067] The ribosome binding site is a ribosome binding site for protein translation, which is necessary for protein translation.
[0068] The terminator can be specifically a T7 terminator. The T7 terminator can effectively terminate the transcription of the target gene at the end of the target gene, thereby avoiding the transcription and translation of other downstream sequences other than the target gene.
[0069] For the codons of the spCas9 protein, the codons thereof are optimized in the present application to completely adapt to the codon bias of the selected E. coli high-efficiency expression strain E. coli BL21(DE3), thereby improving the expression level of the Cas9 protein.
[0070] The T7 promoter is shown in SEQ ID NO: 1 at positions 5121-5139 of the nucleotides.
[0071] The Lac operator is shown in SEQ ID NO: 1 at positions 5140-5164 of the nucleotides.
[0072] The ribosome binding site is shown in SEQ ID NO: 1 at positions 5178-5201 of the nucleotides.
[0073] The coding sequence of the alkaline phosphatase signal peptide is shown as nucleotides 5209-5271 in SEQ ID NO: 1.
[0074] The coding sequence of the TrxA protein is shown as nucleotides 5272-5598 in SEQ ID NO: 1.
[0075] The coding sequence of the His-Tag is shown as nucleotides 5620-5637 in SEQ ID NO: 1.
[0076] The coding sequence of the enterokinase cleavage site is shown as nucleotides 5638-5652 in SEQ ID NO: 1.
[0077] The coding sequence of the nuclear localization signal is shown as nucleotides 5656-5670 in SEQ ID NO: 1.
[0078] The coding sequence of the spCas9 protein is shown as nucleotides 5701-9801 in SEQ ID NO: 1.
[0079] The coding sequence of the nuclear localization signal is shown as nucleotides 9802-9849 in SEQ ID NO: 1.
[0080] The T7 terminator is shown as nucleotides 9902-9949 in SEQ ID NO: 1.
[0081] Specifically, the specific plasmid is plasmid pKG-GE4.
[0082] The DNA molecule in plasmid pKG-GE4 has nucleotides 5121-9949 in SEQ ID NO: 1.
[0083] Specifically, the above-mentioned plasmid pKG-GE4 is shown as SEQ ID NO: 1.
[0084] The present application also protects the recombinant cell prepared by the above-mentioned method.
[0085] The present application also protects the use of the recombinant cell in the preparation of an obesity model pig.
[0086] The somatic cell clone can be obtained by using the recombinant cell as a nuclear transfer donor cell, and the cloned pig is an obesity model pig.
[0087] The present application also protects the pig tissue of the model pig prepared by using the recombinant cell, i.e., an obesity tissue model.
[0088] The present application also protects the pig organ of the model pig prepared by using the recombinant cell, i.e., an obesity organ model.
[0089] The present application also protects a pig cell of a model pig prepared by the recombinant cell, i.e. an obesity cell model.
[0090] The present application also protects the use of the recombinant cell, the obesity tissue model, the obesity organ model, the obesity cell model or the obesity model pig for (d1) or (d2) or (d3) or (d4) as follows:
[0091] (d1) screening of drugs for treating obesity;
[0092] (d2) performing efficacy evaluation of obesity drugs;
[0093] (d3) performing efficacy evaluation of gene therapy and / or cell therapy for obesity;
[0094] (d4) studying the pathogenesis of obesity.
[0095] The pig can be specifically Jiangxiang pig.
[0096] The obesity can be specifically severe early-onset obesity.
[0097] The severe early-onset obesity is caused by MRAP2 gene mutation.
[0098] The MRAP2 gene mutation is the loss of the start codon and the surrounding nucleotides of the MRAP2 gene.
[0099] The MRAP2 gene mutation is the loss of the following segment of the MRAP2 gene: cggagATGtc.
[0100] Pig MRAP2 gene information: coding melanocortin 2 receptor auxiliary protein 2; located on chromosome 1; Gene ID is 100515980, Sus scrofa.
[0101] The amino acid sequence coded by the pig MRAP2 gene is shown in SEQ ID NO: 8.
[0102] The pig MRAP2 gene has a DNA segment shown in SEQ ID NO: 9.
[0103] Compared with the prior art, the present application has at least the following beneficial effects:
[0104] (1) The research object (pig) of the present application has better applicability than other animals (mice, primates).
[0105] Rodents such as mice and rats are very different from humans in terms of body size, organ size, physiology, pathology, and the like, and cannot truly simulate normal physiological and pathological states of humans. Studies have shown that more than 95% of drugs that are effective in mice and rats are ineffective in human clinical trials. As for large animals, primates are the closest animals to humans, but they are small in size, mature late (6-7 years old for mating), and are single-birth animals, with a very slow population expansion rate and a high cost of feeding. In addition, cloning of primates is low in efficiency, difficult, and high in cost.
[0106] Pigs, as model animals, do not have the above-mentioned shortcomings. Pigs are the closest animals to humans, except for primates, and are similar to humans in terms of body size, weight, organ size, and the like, and are very similar to humans in terms of anatomy, physiology, immunology, nutritional metabolism, disease pathogenesis, and the like. At the same time, pigs mature early (4-6 months old), have high reproductive capacity, and have multiple offspring per litter, and a large population can be formed within 2-3 years. In addition, the cloning technology of pigs is very mature, and the cloning and feeding costs are much lower than those of primates. Therefore, pigs are very suitable as animal models for human diseases.
[0107] (2) The vector constructed by the application uses the strong promoter T7-lac capable of efficiently expressing the target protein to express the target protein, and uses the signal peptide of the bacterial periplasmic alkaline phosphatase (phoA) to guide the secretory expression of the target protein into the bacterial periplasmic cavity, so as to separate the target protein from the intracellular protein of the bacterium, and the target protein secreted into the bacterial periplasmic cavity is soluble expression. Meanwhile, the Cas9 protein is expressed in fusion with the thioredoxin TrxA, and the TrxA can help the co-expressed target protein to form a disulfide bond, improve the stability and folding correctness of the protein, and increase the solubility and activity of the target protein. In order to facilitate the purification of the target protein, a His tag is designed, and the target protein can be purified by one-step Ni column affinity chromatography, greatly simplifying the purification process of the target protein. Meanwhile, an enterokinase cleavage site is designed after the His tag, so as to facilitate the removal of the fused TrxA-His polypeptide fragment, and obtain the natural form of the Cas9 protein. After the fusion protein is cleaved by the enterokinase with the His tag, the TrxA-His polypeptide fragment and the enterokinase with the His tag can be removed by one-step affinity chromatography, so as to obtain the natural form of the Cas9 protein, avoiding the damage and loss of the target protein caused by multiple purifications and dialysis. Meanwhile, an NLS site is designed at the N and C terminals of the Cas9, so that the Cas9 can more effectively enter the nucleus to perform gene editing. In addition, the E. coli BL21(DE3) strain is selected as the target protein expression strain, and the strain can efficiently express the foreign genes cloned in the expression vector (such as pET-32a) containing the bacteriophage T7 promoter. Meanwhile, the codon of the Cas9 protein is optimized, so that it is completely adapted to the codon bias of the expression strain, thereby improving the expression level of the target protein. In addition, the expression of the target protein is induced by IPTG at low temperature after the bacteria grow to a certain number, so as to avoid the influence of the early expression of the target protein on the growth of the host bacteria, and the induction of expression at low temperature also significantly improves the solubility of the expressed target protein. After the above optimization design and experimental implementation, the activity of the obtained Cas9 protein is significantly higher than that of the commercial Cas9 protein.
[0108] (3) The Cas9 high-efficiency protein complex constructed and expressed by the application is combined with the gRNA of in vitro transcription to perform gene editing, and the optimal dosage ratio of the Cas9 and the gRNA is optimized, and the synthesized ssODN is used as the Donor DNA, so that the single-cell clone rate of the target site deletion mutation is as high as 22%, which is much higher than the conventional site-directed modification efficiency (<5%).
[0109] (4) The target site deletion mutation single-cell clone strain obtained by the application is used for somatic cell nuclear transfer animal cloning, so that the cloned pig containing the target site deletion mutation can be directly obtained, and the mutation can be stably inherited.
[0110] The method of fertilized egg microinjection of gene editing material and then embryo transfer in the mouse model making has a very low probability (less than 1%) of directly obtaining a site-specific modified offspring, and needs hybrid breeding of the offspring, which is not suitable for long gestation period large animal (such as pig) model making. Therefore, the method of primary cell in vitro editing and ssODN homologous recombination and screening of positive editing single cell clone with high technical difficulty and high challenge is adopted, and then the corresponding disease model pig is directly obtained through somatic cell nuclear transfer animal cloning technology, so that the model pig making cycle can be greatly shortened and manpower, material resources and financial resources can be saved.
[0111] The CRISPR / Cas9 technology and ssODN homologous recombination technology are combined to carry out site-specific deletion of the MRAP2 gene, simulate the natural genetic characteristics of severe early-onset obesity, and obtain a single cell clone with site-specific deletion of the MRAP2 gene, which lays a foundation for cultivating a severe early-onset obesity disease model pig through somatic cell nuclear transfer animal cloning technology in the later stage. The model pig will provide a powerful experimental tool for studying the pathogenesis of severe early-onset obesity caused by deletion mutation of the MRAP2 gene and drug research and development.
[0112] The present application lays a solid foundation for obtaining a severe early-onset obesity model pig with site-specific deletion of the MRAP2 gene through gene editing means, which will help to study and reveal the pathogenesis of severe early-onset obesity caused by deletion of the MRAP2 gene, and can be used for drug screening, drug efficacy detection, gene therapy and cell therapy research, and can provide effective experimental data for further clinical application, and further provide a powerful experimental means for successfully treating human severe early-onset obesity. The present application has great application value for the research and development of obesity treatment drugs and the revelation of the pathogenesis of the disease. BRIEF DESCRIPTION OF DRAWINGS
[0113] Figure 1 It is a structural schematic diagram of plasmid pET-32a.
[0114] Figure 2 It is a structural schematic diagram of plasmid pKG-GE4.
[0115] Figure 3 It is an electrophoresis diagram of gRNA and NCN protein dosage ratio optimization in Example 3.
[0116] Figure 4 It is an electrophoresis diagram of gene editing efficiency comparison of NCN protein and commercial Cas9 protein in Example 3.
[0117] Figure 5 It is an electrophoresis diagram of PCR amplification using different primer pairs with the ear tissue of the pig named 1 as a template in Example 4.
[0118] Figure 6 Electrophoresis map for PCR amplification with primer pair composed of MRAP2-E4-F237 and MRAP2-E4-R606 as template of genomic DNA of 18 pigs respectively in Example 4.
[0119] Figure 7 Electrophoresis map for comparison of editing efficiency of different target sites in Example 4.
[0120] Figure 8 Electrophoresis map in Example 5.
[0121] Figure 9 Forward and reverse sequencing results of single cell clone numbered 6, and alignment results with wild type sequence of target site.
[0122] Figure 10 Forward and reverse sequencing results of single cell clone numbered 3, and alignment results with wild type sequence of target site.
[0123] Figure 11 Forward and reverse sequencing results of single cell clone numbered 1, and alignment results with wild type sequence of target site.
[0124] Figure 12 Forward and reverse sequencing results of single cell clone numbered 10, and alignment results with wild type sequence of target site.
[0125] Figure 13 Forward and reverse sequencing results of single cell clone numbered 18, and alignment results with wild type sequence of target site.
[0126] Figure 14 Forward and reverse sequencing results of single cell clone numbered 2, and alignment results with wild type sequence of target site. DETAILED DESCRIPTION
[0127] The application will be further described in conjunction with the specific embodiments, and the examples given are only for illustrating the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those skilled in the art, and do not constitute any limitation on the application in any way.
[0128] The experimental methods in the following examples are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified. The recombinant plasmids constructed in the examples have been sequenced and verified. The commercial Cas9-A protein is a commercially available Cas9 protein with good effect. The commercial Cas9-B protein is a commercially available Cas9 protein with good effect. Complete culture medium (% by volume): 15% fetal bovine serum (Gibco) + 83% DMEM medium (Gibco) + 1% Penicillin-Streptomycin (Gibco) + 1% HEPES (Solarbio). Cell culture conditions: 37°C, 5% CO2, 5% O2 in a constant temperature incubator.
[0129] The pig primary fibroblasts used in the examples were all prepared from the ear tissue of a newborn Jiangxiang pig. The method for preparing pig primary fibroblasts is as follows: ① Take 0.5 g of pig ear tissue, remove the hair and bone tissue, then soak in 75% alcohol for 30-40 s, then wash with PBS buffer containing 5% (by volume) Penicillin-Streptomycin (Gibco) for 5 times, then wash with PBS buffer once; ② Cut the tissue into small pieces with scissors, digest with 5 mL of 0.1% collagenase solution (Sigma) at 37°C for 1 h, then centrifuge at 500g for 5 min, discard the supernatant; ③ Resuspend the pellet with 1 mL of complete culture medium, then plate into a 10 cm diameter cell culture dish containing 10 mL of complete culture medium and sealed with 0.2% gelatin (VWR), culture until the cells cover about 60% of the bottom of the dish; ④ After completing step ③, digest the cells with trypsin and collect them, then resuspend in complete culture medium. Used for subsequent electroporation experiments.
[0130] Example 1, construction of a prokaryotic Cas9 high-efficiency expression vector
[0131] The structure of plasmid pET-32a is shown in Figure 1 .
[0132] Plasmid pKG-GE4 is obtained by modifying plasmid pET-32a. Plasmid pET32a-T7lac-phoA:SP-TrxA-His-EK-NLS-spCas9-NLS-T7ter (referred to as plasmid pKG-GE4) is shown in SEQ ID NO: 1, which is a circular plasmid, and the structure is shown in Figure 2 .
[0133] In SEQ ID NO: 1, nucleotides 5121-5139 constitute a T7 promoter, nucleotides 5140-5164 encode a Lac operator, nucleotides 5178-5201 constitute a ribosome binding site (RBS), nucleotides 5209-5271 encode a phoA signal peptide, nucleotides 5272-5598 encode a TrxA protein, nucleotides 5620-5637 encode a His-Tag, nucleotides 5638-5652 encode an enterokinase cleavage site (EK cleavage site), nucleotides 5656-5670 encode a nuclear localization signal, nucleotides 5701-9801 encode a spCas9 protein, nucleotides 9802-9849 encode a nuclear localization signal, and nucleotides 9902-9949 constitute a T7 terminator. The nucleotides encoding the spCas9 protein have been codon-optimized for the E. coli BL21 (DE3) strain.
[0134] The main modifications of the plasmid pKG-GE4 are as follows: 1) the coding region of the TrxA protein is retained, which can help the expressed target protein form disulfide bonds, increase the solubility and activity of the target protein; a coding sequence of a phoA signal peptide is added before the coding region of the TrxA protein, which can guide the expressed target protein to be secreted into the periplasmic cavity of the bacteria and can be cleaved by the prokaryotic periplasmic signal peptide enzyme; 2) a coding sequence of a His-Tag is added after the coding sequence of the TrxA protein, which can be used for enrichment of the expressed target protein; 3) a coding sequence of an enterokinase cleavage site DDDDK (Asp-Asp-Asp-Asp-Lys) is added downstream of the coding sequence of the His-Tag, and the purified protein will remove the His-Tag and the upstream fused TrxA protein under the action of enterokinase; 4) a codon-optimized Cas9 gene suitable for expression in the E. coli BL21 (DE3) strain is inserted, and a nuclear localization signal coding sequence is added upstream and downstream of the gene, which increases the nuclear localization ability of the purified Cas9 protein in the later stage.
[0135] The fusion gene in the plasmid pKG-GE4 is shown in nucleotides 5209-9852 of SEQ ID NO: 1, which encodes a fusion protein shown in SEQ ID NO: 2 (fusion protein TrxA-His-EK-NLS-spCas9-NLS, referred to as PRONCN protein for short). Due to the presence of the phoA signal peptide and the enterokinase cleavage site, the fusion protein is cleaved by enterokinase to form a protein shown in SEQ ID NO: 3, which is named NCN protein.
[0136] Example 2, Preparation and purification of NCN protein
[0137] I. Induction of expression
[0138] 1. Introduce plasmid pKG-GE4 into E. coli BL21(DE3) to obtain recombinant bacteria.
[0139] 2. Inoculate the recombinant bacteria obtained in step 1 into liquid LB medium containing 100 μg / ml ampicillin, and incubate at 37°C with 200 rpm shaking overnight.
[0140] 3. Inoculate the bacterial solution obtained in step 2 into liquid LB medium, and incubate at 30°C with 230 rpm shaking until the OD value = 1.0, then add isopropyl thiogalactoside (IPTG) to make its concentration in the system 0.5 mM, then incubate at 25°C with 230 rpm shaking for 12 hours, then centrifuge at 4°C at 10,000 g for 15 minutes to collect the bacterial bodies. 600nm
[0141] 4. Take the bacterial bodies obtained in step 3, and wash with PBS buffer.
[0142] II. Purification of the fusion protein TrxA-His-EK-NLS-spCas9-NLS
[0143] 1. Take the bacterial bodies obtained in step I, add crude extraction buffer and suspend the bacterial bodies, then use a homogenizer to break the bacterial bodies (1000 par cycles for three times), then centrifuge at 4°C at 15,000 g for 30 min to collect the supernatant, and filter the supernatant using a 0.22 μm pore size filter membrane to collect the filtrate. In this step, 10 ml of crude extraction buffer is added per g of wet bacterial bodies.
[0144] Crude extraction buffer: contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM imidazole, 1 mM PMSF, and the rest is ddH2O.
[0145] 2. Purify the fusion protein using affinity chromatography.
[0146] First, equilibrate the Ni-NTA agarose column with 5 column volumes of equilibration buffer (flow rate 1 ml / min); then load 50 ml of the filtrate obtained in step 1 (flow rate 0.5-1 ml / min); then wash the column with 5 column volumes of equilibration buffer (flow rate 1 ml / min); then wash the column with 5 column volumes of buffer to remove impurities (flow rate 1 ml / min); then elute with 10 column volumes of elution buffer at a flow rate of 0.5-1 ml / min, and collect the post-column solution (90-100 ml).
[0147] Ni-NTA agarose column: Kingsway, L00250 / L00250-C, 10 ml of packing.
[0148] Equilibration buffer: 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole, ddH2O to balance.
[0149] Buffer: 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 50 mM Imidazole, ddH2O to balance.
[0150] Elution buffer: 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 500 mM Imidazole, ddH2O to balance.
[0151] III. Enzymatic digestion of fusion protein TrxA-His-EK-NLS-spCas9-NLS and purification of NCN protein
[0152] 1. Take 15 ml of the solution collected after column chromatography in step two, concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, capacity 15 ml), then dilute it to 1 ml with 25 mM Tris-HCl (pH 8.0). Use 6 ultrafiltration tubes to obtain a total of 6 ml.
[0153] 2. Add commercially available recombinant bovine enterokinase with His6 tag (Shenguo Biotech, C620031, recombinant bovine enterokinase light chain with His6 tag, Recombinant Bovine Enterokinase Light Chain, His) to the solution obtained in step 1 (about 6 ml), and incubate at 25°C for 16 hours. Add 2 units of enterokinase for every 50 μg of protein.
[0154] 3. Take the solution after completing step 2 (about 6 ml), mix it with 480 μl of Ni-NTA resin (Kingsway, L00250 / L00250-C), rotate it at room temperature for 15 min, then centrifuge at 7000 g for 3 min to collect the supernatant (4-5.5 ml).
[0155] 4. Take the supernatant obtained in step 3, concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, capacity 15 ml), then add enzyme storage solution to adjust the protein concentration to 5 mg / ml, which is the NCN protein solution.
[0156] The protein in the NCN protein solution was sequenced, and the N-terminal 15 amino acid residues were as shown in SEQ ID NO: 3, i.e., the NCN protein.
[0157] The NCN protein used in the subsequent examples was provided by the NCN protein solution.
[0158] Enzyme stock solution (pH 7.4): containing 10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% (by volume) glycerol, and the balance being ddH2O.
[0159] Example 3, Performance of NCN protein
[0160] Two gRNA target sites targeting the TTN gene were selected as follows:
[0161] TTN-gRNA1: AGAGCACAGTCAGCCTGGCG;
[0162] TTN-gRNA2: CTTCCAGAATTGGATCTCCG.
[0163] Primers for identifying the target fragment containing the gRNA in the TTN gene are as follows:
[0164] TTN-F55: TACGGAATTGGGGAGCCAGCGGA;
[0165] TTN-R560: CAAAGTTAACTCTCTGTGTCT.
[0166] I. Preparation of gRNA
[0167] 1. Preparation of TTN-T7-gRNA1 transcription template and TTN-T7-gRNA2 transcription template
[0168] The TTN-T7-gRNA1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 4.
[0169] The TTN-T7-gRNA2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 5.
[0170] 2. In vitro transcription to obtain gRNA
[0171] The TTN-T7-gRNA1 transcription template was taken and subjected to in vitro transcription using Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), and then subjected to MEGA clear TMThe TTN-gRNA1 was recovered and purified by Transcription Clean-Up Kit (Thermo, AM1908) to obtain TTN-gRNA1. The TTN-gRNA1 was single-stranded RNA, as shown in SEQ ID NO: 6.
[0172] The TTN-T7-gRNA2 transcription template was taken, and in vitro transcription was performed by Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), and then MEGA clear TM The TTN-gRNA2 was recovered and purified by Transcription Clean-Up Kit (Thermo, AM1908) to obtain TTN-gRNA2. The TTN-gRNA2 was single-stranded RNA, as shown in SEQ ID NO: 7.
[0173] II. Optimization of the ratio of gRNA to NCN protein
[0174] 1. Co-transfection of porcine primary fibroblasts
[0175] The first group: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 0.5 μg TTN-gRNA1: 0.5 μg TTN-gRNA2: 4 μg NCN protein.
[0176] The second group: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 0.75 μg TTN-gRNA1: 0.75 μg TTN-gRNA2: 4 μg NCN protein.
[0177] The third group: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg NCN protein.
[0178] The fourth group: TTN-gRNA1, TTN-gRNA2 and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 1.25 μg TTN-gRNA1: 1.25 μg TTN-gRNA2: 4 μg NCN protein.
[0179] The fifth group: co-transfecting TTN-gRNA1 and TTN-gRNA2 into porcine primary fibroblasts. The ratio is about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.
[0180] Co-transfection is performed by electroporation, using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon TM transfection system electroporator (parameter settings: 1450V, 10ms, 3pulse).
[0181] 2. After completing step 1, use complete culture medium to culture for 12-18 hours, then replace the new complete culture medium for culture. The total culture time after electroporation is 48 hours.
[0182] 3. After completing step 2, use trypsin to digest and collect cells, extract genomic DNA, use primer pair TTN-F55 and TTN-R560 for PCR amplification, and then perform 1% agarose gel electrophoresis.
[0183] The electrophoretogram is shown in Figure 3 . The 505bp band is the wild type band (WT), and the 254bp band (251bp missing from the wild type band 505bp) is the deletion mutant band (MT).
[0184] The gene deletion mutation efficiency = (MT gray level / MT band bp number) / (WT gray level / WT band bp number + MT gray level / MT band bp number) x 100%. The gene deletion mutation efficiency of the first group is 19.9%, the gene deletion mutation efficiency of the second group is 39.9%, the gene deletion mutation efficiency of the third group is 79.9%, and the gene deletion mutation efficiency of the fourth group is 44.3%. The fifth group did not occur mutation.
[0185] The results show that when the mass ratio of two gRNAs to NCN protein is 1:1:4, the actual amount is 1 μg: 1 μg: 4 μg, the gene editing efficiency is the highest. Therefore, the optimal amount of two gRNAs and NCN protein is determined to be 1 μg: 1 μg: 4 μg.
[0186] III. Comparison of gene editing efficiency of NCN protein and commercial Cas9 protein
[0187] 1. Co-transfecting porcine primary fibroblasts
[0188] Cas9-A group: TTN-gRNA1, TTN-gRNA2 and commercial Cas9-A protein are co-transfected into porcine primary fibroblasts. The ratio is about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg Cas9-A protein.
[0189] pKG-GE4 group: TTN-gRNA1, TTN-gRNA2 and NCN protein are co-transfected into porcine primary fibroblasts. The ratio is about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg NCN protein.
[0190] Cas9-B group: TTN-gRNA1, TTN-gRNA2 and commercial Cas9-B protein are co-transfected into porcine primary fibroblasts. The ratio is about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2: 4 μg Cas9-B protein.
[0191] Control group: TTN-gRNA1, TTN-gRNA2 are co-transfected into porcine primary fibroblasts. The ratio is about 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.
[0192] Co-transfection is carried out by electroporation, and mammalian nuclear transfection kit (Neon kit, Thermofisher) and Neon TM transfection system electroporation instrument (parameter setting: 1450V, 10ms, 3pulse) are used.
[0193] 2. After completing step 1, use complete culture medium to culture for 12-18 hours, and then replace the new complete culture medium for culture. The total culture time after electroporation is 48 hours.
[0194] 3. After completing step 2, the cells are digested with trypsin and collected, genomic DNA is extracted, PCR amplification is carried out using a primer pair composed of TTN-F55 and TTN-R560, and then 1% agarose gel electrophoresis is carried out.
[0195] The electrophoretogram is shown in Figure 4 The gene deletion mutation efficiency using commercial Cas9-A protein is 28.5%, the gene deletion mutation efficiency using NCN protein is 85.6%, and the gene deletion mutation efficiency using commercial Cas9-B protein is 16.6%.
[0196] The results show that compared with the commercial Cas9 protein, the NCN protein prepared by the application can significantly improve the gene editing efficiency.
[0197] Example 4, Screening of high-efficiency gRNA target sites of MRAP2 gene
[0198] Pig MRAP2 gene information: encoding melanocortin 2 receptor accessory protein 2, located on chromosome 1, GeneID is 100515980, Sus scrofa. The amino acid sequence encoded by pig MRAP2 gene is shown as SEQ ID NO: 8 (there are many different intron splicing forms of pig MRAP2 gene, and the protein encoded by one of the splicing forms is shown as SEQ ID NO: 8). The pig MRAP2 gene has 8 exons in the genomic DNA. The MRAP2 gene mutation (deletion of the start codon ATG of the MRAP2 gene and 10 bp upstream and downstream, i.e. cggagATGtc) associated with human severe early-onset obesity corresponds to the 4th exon of the pig MRAP2 gene (the corresponding deletion is tggaaATGtc). The partial sequence of the MRAP2 gene (containing the 4th exon and 500 bp upstream and downstream) in pig genomic DNA is shown as SEQ ID NO: 9.
[0199] The plasmid pKG-GE3 is a circular plasmid, as shown in SEQ ID NO: 2 in the patent application 202010084343.6. In SEQ ID NO: 2 in the patent application 202010084343.6, the nucleotides 395-680 constitute a CMV enhancer, the nucleotides 682-890 constitute an EFla promoter, the nucleotides 986-1006 encode a nuclear localization signal (NLS), the nucleotides 1016-1036 encode a nuclear localization signal (NLS), the nucleotides 1037-5161 encode a Cas9 protein, the nucleotides 5162-5209 encode a nuclear localization signal (NLS), the nucleotides 5219-5266 encode a nuclear localization signal (NLS), the nucleotides 5276-5332 encode a self-cleavage polypeptide P2A (the amino acid sequence of the self-cleavage polypeptide P2A is “ATNFSLLKQAGDVEENPGP”, and the cleavage position for self-cleavage is between the first and second amino acid residues from the C-terminus), the nucleotides 5333-6046 encode an EGFP protein, the nucleotides 6056-6109 encode a self-cleavage polypeptide T2A (the amino acid sequence of the self-cleavage polypeptide T2A is “EGRGSLLTCGDVEENPGP”, and the cleavage position for self-cleavage is between the first and second amino acid residues from the C-terminus), the nucleotides 6110-6703 encode a Puromycin protein (referred to as Puro protein), the nucleotides 6722-7310 constitute a WPRE sequence element, the nucleotides 7382-7615 constitute a 3’LTR sequence element, and the nucleotides 7647-7871 constitute a bGH poly(A) signal sequence element. In SEQ ID NO: 2 in the patent application 202010084343.6, the nucleotides 911-6706 form a fusion gene, expressing a fusion protein. Due to the presence of the self-cleavage polypeptide P2A and the self-cleavage polypeptide T2A, the fusion protein spontaneously forms three proteins: a protein with the Cas9 protein, a protein with the EGFP protein, and a protein with the Puro protein.
[0200] The pKG-U6gRNA vector, i.e., the plasmid pKG-U6gRNA, is a circular plasmid, as shown in SEQ ID NO: 3 in the patent application 202010084343.6. In SEQ ID NO: 3 in the patent application 202010084343.6, the nucleotides 2280-2539 constitute a hU6 promoter, and the nucleotides 2558-2637 are used for transcription to form a gRNA backbone. When used, a DNA molecule with a length of about 20 bp (a target sequence binding region used for transcription to form a gRNA) is inserted into the plasmid pKG-U6gRNA to form a recombinant plasmid, and the recombinant plasmid is transcribed in cells to obtain a gRNA.
[0201] I. Analysis of the conservation of the preset deletion mutation site of exon 4 of MRAP2 gene and the adjacent genomic sequence
[0202] 18 newborn Jiangxiang pigs, including 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10, respectively) and 8 males (named A, B, C, D, E, F, G, and H, respectively).
[0203] MRAP2-E4-F237: TTGCTTGATGACCTCCTGAATGT;
[0204] MRAP2-E4-R606: ATACACCCCTGAGCAATGTG;
[0205] MRAP2-E4-F238: TGCTTGATGACCTCCTGAATGT;
[0206] MRAP2-E4-R646: CCCACTAAGGGACTCTCTCAA.
[0207] Genomic DNA was extracted from the ear tissue of the pig named 1 and used as a template for PCR amplification with different primer pairs, followed by 1% agarose gel electrophoresis. The electrophoresis map is shown in Figure 5 . Figure 5 Group 1: primer pair composed of MRAP2-E4-F237 and MRAP2-E4-R606; group 2: primer pair composed of MRAP2-E4-F237 and MRAP2-E4-R646; group 3: primer pair composed of MRAP2-E4-F238 and MRAP2-E4-R606; and group 4: primer pair composed of MRAP2-E4-F238 and MRAP2-E4-R646. The results show that the primer pair composed of MRAP2-E4-F237 and MRAP2-E4-R606 is preferably used for amplification of the target fragment.
[0208] The genomic DNA of 18 pigs was used as a template, and the primer pair composed of MRAP2-E4-F237 and MRAP2-E4-R606 was used for PCR amplification, followed by 1% agarose gel electrophoresis. The electrophoresis map is shown in Figure 6 . The PCR amplification product was recovered and sequenced, and the sequencing results were compared and analyzed with the MRAP2 gene sequence in the public database. The conserved region common to the 18 pigs was selected for gRNA target site design.
[0209] II. Screening of target sites
[0210] Several target sites were preliminarily screened by screening NGG (avoiding possible mutation sites), and 4 target sites were further screened through a pre-experiment.
[0211] 4 target sites are as follows:
[0212] MRAP2-E4-gRNA1: AGGTGGAAATGTCTTCCCAG;
[0213] MRAP2-E4-gRNA2: CCACCTGCAAAAACAGAGAG;
[0214] MRAP2-E4-gRNA3: TCTGTTAGAAATTAACCTCT;
[0215] MRAP2-E4-gRNA4: CCTCTCTCTGTTTTTGCAGG.
[0216] III. Preparation of recombinant plasmid
[0217] The plasmid pKG-U6gRNA was digested with restriction enzyme BbsI, and the vector skeleton (a linear large fragment of about 3 kb) was recovered.
[0218] MRAP2-E4-gRNA1-S and MRAP2-E4-gRNA1-A were synthesized respectively, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends and the vector skeleton were ligated to obtain the plasmid pKG-U6gRNA(MRAP2-E4-gRNA1). The plasmid pKG-U6gRNA(MRAP2-E4-gRNA1) expresses the sgRNA shown in SEQ ID NO: 10 MRAP2-E4-gRNA1 .
[0219] sgRNA MRAP2-E4-gRNA1 (SEQ ID NO: 10):
[0220] AGGUGGAAAUGUCUUCCCAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.
[0221] MRAP2-E4-gRNA2-S and MRAP2-E4-gRNA2-A were synthesized respectively, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The double-stranded DNA molecule with sticky ends and the vector skeleton were ligated to obtain the plasmid pKG-U6gRNA(MRAP2-E4-gRNA2). The plasmid pKG-U6gRNA(MRAP2-E4-gRNA2) expresses the sgRNA shown in SEQ ID NO: 11 MRAP2-E4-gRNA2 .
[0222] sgRNA MRAP2-E4-gRNA2 (SEQ ID NO: 11):
[0223] CCACCUGCAAAAACAGAGAGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.
[0224] MRAP2-E4-gRNA3-S and MRAP2-E4-gRNA3-A were synthesized, respectively, and then mixed and annealed to obtain a double-stranded DNA molecule having sticky ends. The double-stranded DNA molecule having sticky ends and a vector backbone were ligated to obtain a plasmid pKG-U6gRNA(MRAP2-E4-gRNA3). The plasmid pKG-U6gRNA(MRAP2-E4-gRNA3) expresses an sgRNA represented by SEQ ID NO: 12 MRAP2-E4-gRNA3 .
[0225] sgRNA MRAP2-E4-gRNA3 (SEQ ID NO: 12):
[0226] UCUGUUAGAAAUUAACCUCUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.
[0227] MRAP2-E4-gRNA4-S and MRAP2-E4-gRNA4-A were synthesized, respectively, and then mixed and annealed to obtain a double-stranded DNA molecule having sticky ends. The double-stranded DNA molecule having sticky ends and a vector backbone were ligated to obtain a plasmid pKG-U6gRNA(MRAP2-E4-gRNA4). The plasmid pKG-U6gRNA(MRAP2-E4-gRNA4) expresses an sgRNA represented by SEQ ID NO: 13 MRAP2-E4-gRNA4 .
[0228] sgRNA MRAP2-E4-gRNA4 (SEQ ID NO: 13):
[0229] CCUCUCUCUGUUUUUGCAGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu.
[0230] MRAP2-E4-gRNA1-S: caccgAGGTGGAAATGTCTTCCCAG;
[0231] MRAP2-E4-gRNA1-A: aaacCTGGGAAGACATTTCCACCTc;
[0232] MRAP2-E4-gRNA2-S: caccgCCACCTGCAAAAACAGAGAG;
[0233] MRAP2-E4-gRNA2-A: aaacCTCTCTGTTTTTGCAGGTGGc;
[0234] MRAP2-E4-gRNA3-S: caccgTCTGTTAGAAATTAACCTCT;
[0235] MRAP2-E4-gRNA3-A: aaacAGAGGTTAATTTCTAACAGAc;
[0236] MRAP2-E4-gRNA4-S: caccgCCTCTCTCTGTTTTTGCAGG;
[0237] MRAP2-E4-gRNA4-A: aaacCCTGCAAAAACAGAGAGAGGc.
[0238] MRAP2-E4-gRNA1-S, MRAP2-E4-gRNA1-A, MRAP2-E4-gRNA2-S, MRAP2-E4-gRNA2-A, MRAP2-E4-gRNA3-S, MRAP2-E4-gRNA3-A, MRAP2-E4-gRNA4-S, MRAP2-E4-gRNA4-A are all single-stranded DNA molecules.
[0239] IV. Comparison of editing efficiency of different target sites
[0240] 1. Co-transfection
[0241] The first group: co-transfecting plasmid pKG-U6gRNA (MRAP2-E4-gRNA1) and plasmid pKG-GE3 into porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (MRAP2-E4-gRNA1): 1.08 μg of plasmid pKG-GE3.
[0242] The second group: the plasmid pKG-U6gRNA (MRAP2-E4-gRNA2) and the plasmid pKG-GE3 are co-transfected into the porcine primary fibroblast cells. The ratio is about 200,000 porcine primary fibroblast cells: 0.92 μg of the plasmid pKG-U6gRNA (MRAP2-E4-gRNA2): 1.08 μg of the plasmid pKG-GE3.
[0243] The third group: the plasmid pKG-U6gRNA (MRAP2-E4-gRNA3) and the plasmid pKG-GE3 are co-transfected into the porcine primary fibroblast cells. The ratio is about 200,000 porcine primary fibroblast cells: 0.92 μg of the plasmid pKG-U6gRNA (MRAP2-E4-gRNA3): 1.08 μg of the plasmid pKG-GE3.
[0244] The fourth group: the plasmid pKG-U6gRNA (MRAP2-E4-gRNA4) and the plasmid pKG-GE3 are co-transfected into the porcine primary fibroblast cells. The ratio is about 200,000 porcine primary fibroblast cells: 0.92 μg of the plasmid pKG-U6gRNA (MRAP2-E4-gRNA4): 1.08 μg of the plasmid pKG-GE3.
[0245] The fifth group: the porcine primary fibroblast cells are subjected to the electric conversion operation without the plasmid under the same electric conversion parameters.
[0246] The co-transfection is performed by the electric shock transfection, and the mammalian nuclear transfection kit (Neon kit, Thermofisher) and the Neon TM transfection system electric converter (the parameter setting is 1450V, 10ms, 3pulse) are used.
[0247] 2. After the completion of step 1, the complete culture solution is used for the culture for 12-18 hours, and then the new complete culture solution is used for the culture. The total culture time after the electric conversion is 48 hours.
[0248] 3. After the completion of step 2, the cells are collected by using the trypsin digestion and the cells are lysed, the genomic DNA is extracted, the primer pair composed of MRAP2-E4-F237 and MRAP2-E4-R606 is used for the PCR amplification, and then the 1% agarose gel electrophoresis is performed. The cell target gene mutation is detected, and the electrophoresis map is shown in Figure 7 .
[0249] The target product was cut and recovered, and then sent to a sequencing company for sequencing. The sequencing results were analyzed using the web-based Synthego ICE tool to analyze the sequencing peak chart to obtain the gene editing efficiency of different targets. The gene editing efficiency of the first to fourth groups was 32%, 63%, 46%, and 17%, respectively, and the fifth group did not occur gene editing. The results showed that the editing efficiency of MRAP2-E4-gRNA2 and MRAP2-E4-gRNA3 was higher.
[0250] Example 5, preparation of single cell clones of MRAP2 gene precise deletion mutation
[0251] Two high-efficiency gRNA target points (MRAP2-E4-gRNA2 and MRAP2-E4-gRNA3) screened in Example 4 were selected.
[0252] I. Preparation of gRNA
[0253] 1. Preparation of MRAP2-T7-gRNA2 transcription template and MRAP2-T7-gRNA3 transcription template
[0254] The MRAP2-T7-gRNA2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 14.
[0255] The MRAP2-T7-gRNA3 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 15.
[0256] 2. In vitro transcription of gRNA
[0257] Take the MRAP2-T7-gRNA2 transcription template, use Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) for in vitro transcription, then use MEGA clear TM TranscriptionClean-Up Kit (Thermo, AM1908) for recovery and purification to obtain MRAP2-gRNA2. MRAP2-gRNA2 is a single-stranded RNA, as shown in SEQ ID NO: 16.
[0258] Take the MRAP2-T7-gRNA3 transcription template, use Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441) for in vitro transcription, then use MEGA clear TMMRAP2-gRNA3 was recovered and purified by Transcription Clean-Up Kit (Thermo, AM1908) to obtain MRAP2-gRNA3. MRAP2-gRNA3 is single-stranded RNA, as shown in SEQ ID NO: 17.
[0259] MRAP2-gRNA2 (SEQ ID NO. 16):
[0260] GGCCACCUGCAAAAACAGAGAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU.
[0261] MRAP2-gRNA3 (SEQ ID NO. 17):
[0262] GGUCUGUUAGAAAUUAACCUCUGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU.
[0263] II. Synthesis of single-stranded Donor DNA with 10 nucleotide deletion at the target site of MRAP2 gene
[0264] The MRAP2 gene mutation (deletion of ATG and its 10 bp upstream and downstream, i.e. cgga gATGtc) associated with human severe early-onset obesity, corresponds to the 4th exon of the pig MRAP2 gene (the corresponding deletion is tggaaATGtc).
[0265] Synthesis of single-stranded Donor DNA, which contains synonymous mutation of 3' end sequence of PAM or adjacent PAM of MRAP2-E4-gRNA2 and MRAP2-E4-gRNA3 target site in addition to 10 nucleotide deletion at the target site. The single-stranded Donor DNA is named MRAP2-mutant-ss130.
[0266] MRAP2-mutant-ss130 is shown in SEQ ID NO: 18.
[0267] III. Transfection of porcine primary fibroblasts
[0268] 1. Co-transfect MRAP2-gRNA2, MRAP2-gRNA3, MRAP2-mutant-ss130 and NCN protein into porcine primary fibroblasts. The ratio is about 100,000 porcine primary fibroblasts: 1 μg MRAP2-gRNA2: 1 μg MRAP2-gRNA3: 2 μg MRAP2-mutant-ss130: 4 μg NCN protein. Co-transfection is performed by electroporation, using the mammalian nuclear transfection kit (Neon kit, Thermofisher) and the Neon TM transfection system electroporator (parameter settings: 1450V, 10ms, 3 pulses).
[0269] 2. After step 1 is completed, use complete culture medium to culture for 16-18 hours, then replace with new complete culture medium for culture. The total culture time after electroporation is 48 hours.
[0270] 3. After step 2 is completed, use trypsin to digest and collect cells, then wash with complete culture medium, then resuspend with complete culture medium, then pick each single clone and transfer to a 96-well plate (1 cell per well, each well contains 100 μl of complete culture medium), and culture for 2 weeks (replace with new complete culture medium every 2-3 days).
[0271] 4. After step 3 is completed, use trypsin to digest and collect cells (the cells obtained in each well, about 2 / 3 are inoculated into a 6-well plate containing complete culture medium, and the remaining 1 / 3 are collected in a 1.5 mL centrifuge tube).
[0272] 5. Take the 6-well plate of step 4, culture until the cells reach 80% confluence, use trypsin to digest and collect the cells, and use cell freezing solution (90% complete culture medium + 10% DMSO, by volume) to freeze the cells.
[0273] 6. Take the centrifuge tube of step 4, take the cells, perform cell lysis and extract genomic DNA, use the primer pair composed of MRAP2-E4-F237 and MRAP2-E4-R606 for PCR amplification, then perform electrophoresis. Porcine primary fibroblasts are used as wild type control (WT). The electrophoresis map is shown in Figure 8 . Figure 8 The lane numbers in the electrophoresis map are consistent with the cell numbers in Table 1.
[0274] 7. After step 6 is completed, recover the PCR amplification product and sequence.
[0275] If the sequencing result of a single cell clone is two, one of which is consistent with the sequencing result of the porcine primary fibroblast cells and the other is mutated (mutation includes deletion, insertion or substitution of one or more nucleotides) compared with the sequencing result of the porcine primary fibroblast cells, the genotype of the single cell clone is heterozygous; if the sequencing result of a single cell clone is two, both of which are mutated (mutation includes deletion, insertion or substitution of one or more nucleotides) compared with the sequencing result of the porcine primary fibroblast cells, the genotype of the single cell clone is double-allele different mutant; if the sequencing result of a single cell clone is one, and is mutated (mutation includes deletion, insertion or substitution of one or more nucleotides) compared with the sequencing result of the porcine primary fibroblast cells, the genotype of the single cell clone is double-allele same mutant; if the sequencing result of a single cell clone is one, and is consistent with the sequencing result of the porcine primary fibroblast cells, the genotype of the single cell clone is homozygous wild type.
[0276] The results are shown in Table 1.
[0277] The genotypes of the single cell clones numbered 6, 14, 22, 29, 41 are homozygous wild type. The genotypes of the single cell clones numbered 3, 4, 8, 9, 16, 17, 18, 23, 24, 26, 28, 30, 32, 33, 35, 38, 40, 42, 44, 46, 47, 50 are heterozygous. The genotypes of the single cell clones numbered 1, 11, 12, 21, 25, 27, 31, 34, 37, 39, 43, 45 are double-allele different mutant. The genotypes of the single cell clones numbered 2, 5, 7, 10, 13, 15, 19, 20, 36, 48, 49 are double-allele same mutant. The ratio of obtaining the single cell clones of MRAP2 gene exon 4 gene editing is 90%.
[0278] The single cell clones numbered 18, 44 are heterozygous mutant of target site deletion (i.e. one of the two homologous chromosomes completes the replacement of single-stranded Donor DNA). The single cell clones numbered 11, 25, 27, 31, 37, 39, 43 are double-allele different mutant of target site deletion (i.e. one of the two homologous chromosomes completes the replacement of single-stranded Donor DNA). The single cell clones numbered 2, 49 are double-allele same mutant of target site deletion (i.e. both of the two homologous chromosomes complete the replacement of single-stranded Donor DNA). The ratio of obtaining the single cell clones of target site deletion (i.e. the single cell clones numbered 2, 11, 18, 25, 27, 31, 37, 39, 43, 44, 49) is 22%.
[0279] An exemplary sequencing alignment result is as followsFigures 9 to 14 . Figure 9 is the alignment result of forward sequencing and reverse sequencing of single cell clone No. 6 with wild type sequence of target site, which is homozygous wild type. Figure 10 is the alignment result of forward sequencing and reverse sequencing of single cell clone No. 3 with wild type sequence of target site, which is heterozygous. Figure 11 is the alignment result of forward sequencing and reverse sequencing of single cell clone No. 1 with wild type sequence of target site, which is double allele different mutation type. Figure 12 is the alignment result of forward sequencing and reverse sequencing of single cell clone No. 10 with wild type sequence of target site, which is double allele same mutation type. Figure 13 is the alignment result of forward sequencing and reverse sequencing of single cell clone No. 18 with wild type sequence of target site, which is heterozygous deletion mutation type of target site. Figure 14 is the alignment result of forward sequencing and reverse sequencing of single cell clone No. 2 with wild type sequence of target site, which is double allele same mutation type of deletion mutation type of target site.
[0280] Table 1 Genotype determination results of single cell clones of MRAP2 gene exon 4 deletion mutation
[0281]
[0282]
[0283]
[0284] Note: Deletion mutation of target site refers to the replacement of single-stranded Donor DNA; replacement of single-stranded Donor DNA refers to replacing the DNA molecule shown in SEQ ID NO: 19 in the chromosomal DNA with the DNA molecule shown in SEQ ID NO: 18.
[0285] Single cell clones No. 2 and 49 are double allele same mutation type of deletion mutation of target site (i.e. both homologous chromosomes have completed the replacement of single-stranded Donor DNA). Double allele same mutation type of deletion mutation of target site cells can be used for subsequent cloning of pigs. Cells can be used as donor cells for nuclear transfer for somatic cell cloning, and cloned pigs can be obtained, which are model pigs of severe early-onset obesity.
[0286] The application has been described in detail. For those skilled in the art, the application can be implemented in a wider range under the same parameters, concentrations and conditions without departing from the spirit and scope of the application and without unnecessary experiments. Although the application gives a specific example, it should be understood that the application can be further improved. In summary, according to the principle of the application, the present application is intended to include any changes, uses or improvements of the application, including changes made by conventional techniques known in the art, which are outside the scope disclosed in the present application. Some basic features can be applied within the scope of the following attached claims. SEQUENCE LISTING <110> Nanjing Qizhen Gene Engineering Co., Ltd. <120> A method for constructing a model pig for severe early-onset obesity with MRAP2 gene mutation by nuclear transfer of donor cells <130> GNCYX212111 <160> 19 <170> SIPOSequenceListing 1.0 <210> 1 <211> 9974 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 1 tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60 cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120 ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180 gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240 acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300 ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360 ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420 acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480 tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540 tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat 600 gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt 660 ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg 720 agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga 780 agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg 840 tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt 900 tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg 960 cagtgctgcc ataaccatga gtgataacac tgcggccaac ttacttctga caacgatcgg 1020 aggaccgaag gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga 1080 tcgttgggaa ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc 1140 tgcagcaatg gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc 1200 ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc 1260 ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg 1320 cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac 1380 gacggggagt caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc 1440 actgattaag cattggtaac tgtcagacca agtttactca tatatacttt agattgattt 1500 aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac 1560 caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa 1620 aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 1680 accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 1740 aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg 1800 ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc 1860 agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt 1920 accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga 1980 gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct 2040 tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 2100 cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca 2160 cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa 2220 cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 2280 ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 2340 taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 2400 gcgcctgatg cggtattttc tccttacgca tctgtgcggt atttcacacc gcatatatgg 2460 tgcactctca gtacaatctg ctctgatgcc gcatagttaa gccagtatac actccgctat 2520 cgctacgtga ctgggtcatg gctgcgcccc gacacccgcc aacacccgct gacgcgccct 2580 gacgggcttg tctgctcccg gcatccgctt acagacaagc tgtgaccgtc tccgggagct 2640 gcatgtgtca gaggttttca ccgtcatcac cgaaacgcgc gaggcagctg cggtaaagct 2700 catcagcgtg gtcgtgaagc gattcacaga tgtctgcctg ttcatccgcg tccagctcgt 2760 tgagtttctc cagaagcgtt aatgtctggc ttctgataaa gcgggccatg ttaagggcgg 2820 ttttttcctg tttggtcact gatgcctccg tgtaaggggg atttctgttc atgggggtaa 2880 tgataccgat gaaacgagag aggatgctca cgatacgggt tactgatgat gaacatgccc 2940 ggttactgga acgttgtgag ggtaaacaac tggcggtatg gatgcggcgg gaccagagaa 3000 aaatcactca gggtcaatgc cagcgcttcg ttaatacaga tgtaggtgtt ccacagggta 3060 gccagcagca tcctgcgatg cagatccgga acataatggt gcagggcgct gacttccgcg 3120 tttccagact ttacgaaaca cggaaaccga agaccattca tgttgttgct caggtcgcag 3180 GAGAATAGTA ATAGTAATAG TAATAGTAAT AGTAATAGTA ATAGTAATAG TAATAGTATG TATAGTA 60 CCTGGAGGAG CTGTTTTCAC CTGGTTTGTA GCGGAGCGGA GCGGAGCGGA GCGGAGCGGA 60 CCTGGAGGAG CTGTTTTCAC CTGGTTTGTA GCGGAGCGGA GCGGAGCGGA GCGGAGCGGA 60 CCTGGAGGAG CTGTTTTCAC CTGGTTTGTA GCGGAGCGGA GCGGAGCGGA GCGGAGCGGA 60 CCTGGAGGAG CTGTTTTCAC CTGGTTTGTA GCGGAGCGGA GCGGAGCGGA GCGGAGCGGA 60 CCTGGAGGAG CTGTTTTCAC CTGGTTTGTA GCGGAGCGGA GCGGAGCGGA GCGGAGCGGA 60 CCTGGAGGAG CTGTTTTCAC CTGGTTTGTA GCGGAGCGGA GCGGAGCGGA GCGGAGCGGA 60 CCTGGAGGAG CTGTTTTCAC CTGGTTTGTA GCGGAGCGGA GCGGAGCGGA GCGGAGCGGA 60 CCTGGAGGAG CTGTTTTCAC CTGGTTTGTA GCGGAGCGGA GCGGAGCGGA GCGGAGCGGA 60 CCTGGAGGAG CTGTTTTCAC CTGGTTTGTA GCGGAGCGGA GCGGAGCGGA GCGGAGCGGA 60 CCTGGAGGAG CTGTTTTCAC CTGGTTTGTA GCGGAGCGGA GCGGAGCGGA GCGGAGCGGA 60 CCTGGAGGAG CTGTTTTCAC CTGGTTTGTA GCGGAGCGGA GCGGAGCGGA GCGGAGCGGA 60 TCTGGAGCCTGGAGTATTCGGAGGAGTGGATTCACC ATCGATTTCGGCGCGCC 60 TCTGGAGCCTGGAGTATTCGGAGGAGTGGATTCACC ATCGATTTCGGCGCGCC 60 TCTGGAGCCTGGAGTATTCGGAGGAGTGGATTCACC ATCGATTTCGGCGCGCC 60 TCTGGAGCCTGGAGTATTCGGAGGAGTGGATTCACC ATCGATTTCGGCGCGCC 60 TCTGGAGCCTGGAGTATTCGGAGGAGTGGATTCACC ATCGATTTCGGCGCGCC 60 TCTGGAGCCTGGAGTATTCGGAGGAGTGGATTCACC ATCGATTTCGGCGCGCC 60 TCTGGAGCCTGGAGTATTCGGAGGAGTGGATTCACC ATCGATTTCGGCGCGCC 60 TCTGGAGCCTGGAGTATTCGGAGGAGTGGATTCACC ATCGATTTCGGCGCGCC 60 TCTGGAGCCTGGAGTATTCGGAGGAGTGGATTCACC ATCGATTTCGGCGCGCC 60 TCTGGAGCCTGGAGTATTCGGAGGAGTGGATTCACC ATCGATTTCGGCGCGCC 60 TCTGGAGCCTGGAGTATTCGGAGGAGTGGATTCACC ATCGATTTCGGCGCGCC 60 TCTGGAGCCTGGAGTATTCGGAGGAGTGGATTCACC ATCGATTTCGGCGCGCC 60 ttttcccgcg ttttcgcaga aacgtggctg gcctggttca ccacgcggga aacggtctga 4680 taagagacac cggcatactc tgcgacatcg tataacgtta ctggtttcac attcaccacc 4740 ctgaattgac tctcttccgg gcgctatcat gccataccgc gaaaggtttt gcgccattcg 4800 atggtgtccg ggatctcgac gctctccctt atgcgactcc tgcattagga agcagcccag 4860 tagtaggttg aggccgttga gcaccgccgc cgcaaggaat ggtgcatgca aggagatggc 4920 gcccaacagt cccccggcca cggggcctgc caccataccc acgccgaaac aagcgctcat 4980 gagcccgaag tggcgagccc gatcttcccc atcggtgatg tcggcgatat aggcgccagc 5040 aaccgcacct gtggcgccgg tgatgccggc cacgatgcgt ccggcgtaga ggatcgagat 5100 cgatctcgat cccgcgaaat taatacgact cactataggg gaattgtgag cggataacaa 5160 ttcccctcta gaaataattt tgtttaactt taagaaggag atatacatat gaaacaaagc 5220 actattgcac tggcactctt accgttactg tttacccctg tgacaaaagc catgagcgat 5280 aaaattattc acctgactga cgacagtttt gacacggatg tactcaaagc ggacggggcg 5340 atcctcgtcg atttctgggc agagtggtgc ggtccgtgca aaatgatcgc cccgattctg 5400 gatgaaatcg ctgacgaata tcagggcaaa ctgaccgttg caaaactgaa catcgatcaa 5460 aaccctggca ctgcgccgaa atatggcatc cgtggtatcc cgactctgct gctgttcaaa 5520 aacggtgaag tggcggcaac caaagtgggt gcactgtcta aaggtcagtt gaaagagttc 5580 ctcgacgcta acctggccgg ttctggttct ggccatatgc accatcatca tcatcatgac 5640 gatgacgata agatgcccaa aaagaaacga aaggtgggta tccacggagt cccagcagcc 5700 gacaaaaaat atagcatcgg cctggacatc ggtaccaaca gcgttggctg ggcagtgatc 5760 actgatgaat acaaagttcc atccaaaaaa tttaaagtac tgggcaacac cgaccgtcac 5820 tctatcaaaa aaaacctgat tggtgctctg ctgtttgaca gcggcgaaac tgctgaggct 5880 acccgtctga aacgtacggc tcgccgtcgc tacactcgtc gtaaaaaccg catctgttat 5940 ctgcaggaaa ttttctctaa cgaaatggca aaagttgatg atagcttctt tcatcgtctg 6000 gaagagagct tcctggtgga agaagataaa aaacacgaac gtcacccgat tttcggtaac 6060 attgtggatg aggttgccta ccacgagaaa tatccgacca tctaccatct gcgtaaaaaa 6120 ctggttgata gcactgacaa agcggatctg cgtctgatct acctggctct ggcacacatg 6180 atcaaattcc gtggtcactt cctgatcgaa ggtgatctga accctgataa ctccgacgtg 6240 gacaaactgt tcattcagct ggttcagacc tataaccagc tgttcgaaga aaacccgatc 6300 aacgcgtccg gtgtagacgc taaggcaatt ctgtctgcgc gtctgtctaa gtctcgtcgt 6360 ctggaaaacc tgattgcgca actgccaggt gaaaagaaaa acggcctgtt cggcaatctg 6420 atcgccctgt ccctgggtct gactccgaac tttaaatcca actttgacct ggcggaagat 6480 gccaagctgc agctgagcaa agatacctat gacgatgacc tggataacct gctggcacag 6540 atcggtgatc agtatgccga tctgttcctg gccgcgaaaa acctgtctga tgcgattctg 6600 ctgtctgata tcctgcgcgt taacactgaa attactaaag cgccgctgag cgcatccatg 6660 attaaacgtt acgatgaaca ccaccaggat ctgaccctgc tgaaagcgct ggtgcgtcag 6720 cagctgccgg aaaaatacaa ggagatcttc ttcgaccaga gcaaaaacgg ttacgcgggc 6780 tacattgatg gtggtgcatc tcaggaggaa ttctacaaat tcattaaacc gatcctggaa 6840 aaaatggatg gtactgaaga gctgctggtt aaactgaatc gtgaagatct gctgcgcaaa 6900 cagcgtacct tcgataacgg ttccatcccg catcagattc atctgggcga actgcacgct 6960 atcctgcgcc gtcaggaaga cttttatccg ttcctgaaag acaaccgtga gaaaattgaa 7020 aaaatcctga ccttccgtat tccgtactat gtaggtccgc tggcgcgtgg taactcccgt 7080 ttcgcttgga tgacccgcaa aagcgaagaa accatcaccc cgtggaattt cgaagaagtc 7140 gttgacaaag gcgcgtccgc gcagtctttc atcgaacgca tgacgaactt cgacaaaaac 7200 ctgccgaacg agaaagtgct gccgaaacac tctctgctgt acgagtactt cactgtgtac 7260 aacgaactga ccaaagtgaa atacgtcacc gaaggtatgc gtaaaccggc attcctgtcc 7320 ggtgagcaaa aaaaagcaat cgtggatctg ctgttcaaaa ccaaccgtaa agtaaccgtg 7380 aaacagctga aggaagacta tttcaagaaa atcgaatgtt ttgattctgt tgaaatctcc 7440 ggcgtggaag atcgcttcaa tgcgtccctg ggtacgtatc acgacctgct gaaaattatc 7500 aaagacaaag attttctgga caacgaggaa aacgaagaca tcctggagga tattgtactg 7560 accctgaccc tgttcgaaga ccgtgagatg atcgaagaac gcctgaaaac ctacgcccac 7620 ctgttcgatg acaaggtaat gaagcagctg aaacgtcgtc gttataccgg ctggggtcgt 7680 ctgtcccgta aactgatcaa tggcatccgt gataaacagt ctggcaaaac catcctggac 7740 ttcctgaaat ccgacggttt cgcgaatcgt aacttcatgc aactgattca tgacgattct 7800 ctgactttca aagaagacat ccagaaagca caggtttccg gccagggtga ctctctgcac 7860 gagcacattg ccaatctggc tggttctccg gctattaaaa agggtattct gcagactgtg 7920 aaagtagttg atgagctggt caaagtaatg ggccgtcaca agccggaaaa cattgtgatc 7980 gaaatggcac gtgaaaacca gacgacccag aaaggtcaga aaaactctcg tgaacgcatg 8040 aaacgtatcg aagaaggcat caaagaactg ggctctcaga tcctgaagga acaccctgta 8100 gaaaataccc agctgcagaa cgaaaagctg tatctgtatt acctgcagaa cggccgcgat 8160 atgtatgtgg accaggaact ggatatcaac cgcctgtccg attacgatgt agatcacatc 8220 gtgccgcaaa gcttcctgaa agacgacagc attgacaaca aagtactgac ccgttctgat 8280 aagaaccgtg gcaaatccga taacgtcccg tctgaagaag ttgttaaaaa aatgaaaaac 8340 tattggcgtc agctgctgaa cgcgaaactg atcacccagc gtaagttcga caatctgact 8400 aaagctgagc gcggtggtct gtccgaactg gataaagcgg gttttatcaa acgccagctg 8460 gttgaaaccc gtcagatcac gaagcacgtt gcgcagattc tggactctcg tatgaacacc 8520 aaatacgacg aaaacgacaa actgatccgc gaggttaagg ttatcaccct gaaaagcaaa 8580 ctggtatccg attttcgtaa agactttcag ttctacaaag tgcgcgaaat taacaactat 8640 caccacgctc acgatgcata tctgaatgca gttgttggca cggcgctgat caaaaagtat 8700 ccgaaactgg aatctgaatt cgtatacggc gattacaaag tgtatgacgt tcgtaagatg 8760 atcgcaaaat ccgagcagga aattggtaag gcgacggcga aatacttctt ttattccaat 8820 attatgaact ttttcaaaac cgaaatcacc ctggcgaatg gtgaaattcg taaacgcccg 8880 ctgatcgaaa ccaacggtga aactggtgaa atcgtttggg acaaaggccg cgacttcgcg 8940 accgtgcgta aagttctgtc tatgccgcaa gtgaacatcg tcaagaagac cgaagtacaa 9000 accggcggtt ttagcaaaga gagcattctg ccaaaacgta actccgacaa actgatcgcg 9060 cgcaagaaag actgggatcc gaaaaaatac ggtggtttcg attctccaac cgttgcttat 9120 tccgttctgg tggtagccaa agttgagaaa ggtaaaagca aaaaactgaa atccgtaaag 9180 gaactgctgg gtattactat catggagcgt agctccttcg aaaaaaaccc gatcgatttt 9240 ctggaagcga aaggctataa agaagtcaaa aaggacctga tcatcaaact gccaaaatac 9300 agcctgttcg agctggaaaa cggccgtaaa cgtatgctgg catctgcggg cgaactgcag 9360 aaaggcaacg agctggctct gccgtccaaa tacgtgaact ttctgtacct ggcctctcac 9420 tacgaaaaac tgaaaggttc cccggaagac aacgaacaga aacagctgtt cgtagagcag 9480 cacaaacact acctggacga gatcatcgaa cagatttctg aattttctaa acgtgtgatt 9540 ctggctgatg cgaatctgga taaagttctg tctgcctata acaagcatcg tgacaaaccg 9600 atccgcgaac aggctgagaa catcatccac ctgttcactc tgactaacct gggcgcgcca 9660 GCGGCTTTCA AGTACTTTGA TACCACCAT T GACCgCAAGC GTTACACCTC CACTAAAGAA 9720 GTGCTGGACG CGACTCTGAT CCACCAGTCC ATCACCgGTc TGTACGAGAC CCgtATCGAT 9780 CTGAGCCAGC TGGGCGGTGA CAAAGGCCGG CGGCCACGAA AAAGGCCGGC CAGGC AAAA 9840 AAGAAAAAGT GACAAAGCCC GAAAGGAAGC TGAGTTGGCT GCTGCCACCG CTGAGCAATA 9900 ACTAGCATAA CCCCTTGGGG CCTCTAAACG GGTCTTGAGG GGTttttTGC TGAAAGGAAG 9960 AAGAAAAAGT GACAAAGCCC GAAAGGAAGC TGAGTTGGCT GCTGCCACCG CTGAGCAATA 9900 <210> 2 <211> 1547 <212> PRT <213> Artificial Sequence <400> 2 Met Lys Gin Ser Thr He Ala Leu Ala Leu Leu Pro Leu Leu Phe Thr 1 5 10 15 Pro Val Thr Lys Ala Met Ser Asp Lys He He His Leu Thr Asp Asp 20 25 30 Ser Phe Asp Thr Asp Val Leu Lys Ala Asp Gly Ala He Leu Val Asp 35 40 45 Phe Trp Ala Glu Trp Cys Gly Pro Cys Lys Met He Ala Pro He Leu 50 55 60 Asp Glu Ile Ala Asp Glu Tyr Gin Gly Lys Leu Thr Val Ala Lys Leu 65 70 75 80 Asn Ile Asp Gin Asn Pro Gly Thr Ala Pro Lys Tyr Gly Ile Arg Gly 85 90 95 Ile Pro Thr Leu Leu Leu Phe Lys Asn Gly Glu Val Ala Ala Thr Lys 100 105 110 Val Gly Ala Leu Ser Lys Gly Gin Leu Lys Glu Phe Leu Asp Ala Asn 115 120 125 Leu Ala Gly Ser Gly Ser Gly His Met His His His His His His Asp 130 135 140 Asp Asp Asp Lys Met Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly 145 150 155 160 Val Pro Ala Ala Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr 165 170 175 Asn Ser Val Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser 180 185 190 Lys Lys Phe Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys 195 200 205 Asn Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala 210 215 220 Thr Arg Leu Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn 225 230 235 240 Arg Ile Cys Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val 245 250 255 Asp Asp Ser Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu 260 265 270 Asp Lys Lys His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu 275 280 285 Val Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys 290 295 300 Leu Val Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala 305 310 315 320 Leu Ala His Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp 325 330 335 Leu Asn Pro Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val 340 345 350 Gln Thr Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly 355 360 365 Val Asp Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg 370 375 380 Leu Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu 385 390 395 400 Phe Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys 405 410 415 Ser Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp 420 425 430 Thr Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln 435 440 445 Tyr Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu 450 455 460 Leu Ser Asp Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu 465 470 475 480 Ser Ala Ser Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr 485 490 495 Leu Leu Lys Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu 500 505 510 Ile Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly 515 520 525 Gly Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu 530 535 540 Lys Met Asp Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp 545 550 555 560 Leu Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln 565 570 575 Ile His Leu Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe 580 585 590 Tyr Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr 595 600 605 Phe Arg Ile Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg 610 615 620 Phe Ala Trp Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn 625 630 635 640 Phe Glu Glu Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu 645 650 655 Arg Met Thr Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro 660 665 670 Lys His Ser Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr 675 680 685 Lys Val Lys Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser 690 695 700 Gly Glu Gln Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg 705 710 715 720 Lys Val Thr Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu 725 730 735 Cys Phe Asp Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala 740 745 750 Ser Leu Gly Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp 755 760 765 Phe Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu 770 775 780 Thr Leu Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys 785 790 795 800 Thr Tyr Ala His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg 805 810 815 Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly 820 825 830 Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser 835 840 845 Asp Gly Phe Ala Asn Arg Asn Phe Met Gin Leu lie His Asp Asp Ser 850 855 860 Leu Thr Phe Lys Glu Asp lie Gin Lys Ala Gin Val Ser Gly Gin Gly 865 870 875 880 Asp Ser Leu His Glu His lie Ala Asn Leu Ala Gly Ser Pro Ala lie 885 890 895 Lys Lys Gly lie Leu Gin Thr Val Lys Val Val Asp Glu Leu Val Lys 900 905 910 Val Met Gly Arg His Lys Pro Glu Asn lie Val lie Glu Met Ala Arg 915 920 925 Glu Asn Gin Thr Thr Gin Lys Gly Gin Lys Asn Ser Arg Glu Arg Met 930 935 940 Lys Arg lie Glu Glu Gly lie Lys Glu Leu Gly Ser Gin lie Leu Lys 945 950 955 960 Glu His Pro Val Glu Asn Thr Gin Leu Gin Asn Glu Lys Leu Tyr Leu 965 970 975 Tyr Tyr Leu Gin Asn Gly Arg Asp Met Tyr Val Asp Gin Glu Leu Asp 980 985 990 lie Asn Arg Leu Ser Asp Tyr Asp Val Asp His lie Val Pro Gin Ser 995 1000 1005 Phe Leu Lys Asp Asp Ser lie Asp Asn Lys Val Leu Thr Arg Ser Asp 1010 1015 1020 Lys Asn Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys 1025 1030 1035 1040 Lys Met Lys Asn Tyr Trp Arg Gin Leu Leu Asn Ala Lys Leu lie Thr 1045 1050 1055 Gln Arg Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser 1060 1065 1070 Glu Leu Asp Lys Ala Gly Phe lie Lys Arg Gin Leu Val Glu Thr Arg 1075 1080 1085 Gln lie Thr Lys His Val Ala Gin lie Leu Asp Ser Arg Met Asn Thr 1090 1095 1100 Lys Tyr Asp Glu Asn Asp Lys Leu lie Arg Glu Val Lys Val lie Thr 1105 1110 1115 1120 Leu Lys Ser Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gin Phe Tyr 1125 1130 1135 Lys Val Arg Glu lie Asn Asn Tyr His His Ala His Asp Ala Tyr Leu 1140 1145 1150 Asn Ala Val Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu 1155 1160 1165 Ser Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met 1170 1175 1180 Ile Ala Lys Ser Glu Gin Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe 1185 1190 1195 1200 Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala 1205 1210 1215 Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr 1220 1225 1230 Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys 1235 1240 1245 Val Leu Ser Met Pro Gin Val Asn Ile Val Lys Lys Thr Glu Val Gin 1250 1255 1260 Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp 1265 1270 1275 1280 Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly 1285 1290 1295 Phe Asp Ser Pro Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val 1300 1305 1310 Glu Lys Gly Lys Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly 1315 1320 1325 Ile Thr Ile Met Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe 1330 1335 1340 Leu Glu Ala Lys Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys 1345 1350 1355 1360 Leu Pro Lys Tyr Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met 1365 1370 1375 Leu Ala Ser Ala Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro 1380 1385 1390 Ser Lys Tyr Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu 1395 1400 1405 Lys Gly Ser Pro Glu Asp Asn Glu Gin Lys Gin Leu Phe Val Glu Gin 1410 1415 1420 His Lys His Tyr Leu Asp Glu Ile Ile Glu Gin Ile Ser Glu Phe Ser 1425 1430 1435 1440 Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala 1445 1450 1455 Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile 1460 1465 1470 Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys 1475 1480 1485 Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu 1490 1495 1500 Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu 1505 1510 1515 1520 Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala 1525 1530 1535 Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys 1540 1545 <210> 3 <211> 1399 <212> PRT <213> Artificial Sequence <400> 3 Met Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala Ala 1 5 10 15 Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser Val Gly 20 25 30 Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe Lys 35 40 45 Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile Gly 50 55 60 Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu Lys 65 70 75 80 Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys Tyr 85 90 95 Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser Phe 100 105 110 Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys His 115 120 125 Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr His 130 135 140 Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp Ser 145 150 155 160 Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His Met 165 170 175 Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro Asp 180 185 190 Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr Asn 195 200 205 Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala Lys 210 215 220 Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn Leu 225 230 235 240 Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn Leu 245 250 255 Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe Asp 260 265 270 Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp Asp 275 280 285 Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp Leu 290 295 300 Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp Ile 305 310 315 320 Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser Met 325 330 335 Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys Ala 340 345 350 Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe Asp 355 360 365 Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser Gln 370 375 380 Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp Gly 385 390 395 400 Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg Lys 405 410 415 Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu Gly 420 425 430 Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe Leu 435 440 445 Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile Pro 450 455 460 Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp Met 465 470 475 480 Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu Val 485 490 495 Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn 500 505 510 Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser Leu 515 520 525 Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr 530 535 540 Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys 545 550 555 560 Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val 565 570 575 Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp Ser 580 585 590 Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly Thr 595 600 605 Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp Asn 610 615 620 Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr Leu 625 630 635 640 Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala His 645 650 655 Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr Thr 660 665 670 Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp Lys 675 680 685 Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe Ala 690 695 700 Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe Lys 705 710 715 720 Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu His 725 730 735 Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly Ile 740 745 750 Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly Arg 755 760 765 His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln Thr 770 775 780 Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile Glu 785 790 795 800 Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro Val 805 810 815 Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu Gln 820 825 830 Asn Gly Arg Asp Met Tyr Val Asp Gin Glu Leu Asp He Asn Arg Leu 835 840 845 Ser Asp Tyr Asp Val Asp His He Val Pro Gin Ser Phe Leu Lys Asp 850 855 860 Asp Ser He Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg Gly 865 870 875 880 Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys Asn 885 890 895 Tyr Trp Arg Gin Leu Leu Asn Ala Lys Leu He Thr Gin Arg Lys Phe 900 905 910 Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp Lys 915 920 925 Ala Gly Phe He Lys Arg Gin Leu Val Glu Thr Arg Gin He Thr Lys 930 935 940 His Val Ala Gin He Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp Glu 945 950 955 960 Asn Asp Lys Leu He Arg Glu Val Lys Val He Thr Leu Lys Ser Lys 965 970 975 Leu Val Ser Asp Phe Arg Lys Asp Phe Gin Phe Tyr Lys Val Arg Glu 980 985 990 Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val Val 995 1000 1005 Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe Val 1010 1015 1020 Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys Ser 1025 1030 1035 1040 Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr Ser Asn 1045 1050 1055 Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala Asn Gly Glu Ile 1060 1065 1070 Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr Gly Glu Ile Val 1075 1080 1085 Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys Val Leu Ser Met 1090 1095 1100 Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln Thr Gly Gly Phe 1105 1110 1115 1120 Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala 1125 1130 1135 Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro 1140 1145 1150 Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val Glu Lys Gly Lys 1155 1160 1165 Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met 1170 1175 1180 Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys 1185 1190 1195 1200 Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr 1205 1210 1215 Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala 1220 1225 1230 Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val 1235 1240 1245 Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser Pro 1250 1255 1260 Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys His Tyr 1265 1270 1275 1280 Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg Val Ile 1285 1290 1295 Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala Tyr Asn Lys His 1300 1305 1310 Arg Asp Lys Pro Ile Arg Glu Gin Ala Glu Asn Ile Ile His Leu Phe 1315 1320 1325 Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys Tyr Phe Asp Thr 1330 1335 1340 Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu Val Leu Asp Ala 1345 1350 1355 1360 Thr Leu Ile His Gin Ser Ile Thr Gly Leu Tyr Glu Thr Arg Ile Asp 1365 1370 1375 Leu Ser Gin Leu Gly Gly Asp Lys Arg Pro Ala Ala Thr Lys Lys Ala 1380 1385 1390 Gly Gin Ala Lys Lys Lys Lys 1395 <210> 4 <211> 225 <212> DNA <213> Artificial Sequence <400> 4 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggagagc acagtcagcc tggcggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 5 <211> 225 <212> DNA <213> Artificial Sequence <400> 5 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggcttcc agaattggat ctccggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 6 <211> 102 <212> RNA <213> Artificial Sequence <400> 6 ggagagcaca gucagccugg cgguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 7 <211> 102 <212> RNA <213> Artificial Sequence <400> 7 GAGAUGGCUUCCAGAUGGCUCCGGUUUAGAGCUAGAAAUAGCAAGUUA AAAUAAGGCUAG 60 UCCGUUAUCAACUUGAAAAAGUGGCACC GAGUCGGUGCUUUU 102 <210> 8 <211> 206 <212> PRT <213> Sus scrofa <400> 8 Met Ser Ser Gln Arg Leu Ile Ser Asn Arg Thr Ser Gln Gln Ser Thr 1 5 10 15 Ser Asn Ser Asp Tyr Thr Trp Glu Tyr Glu His Tyr Glu Ile Gly Pro 20 25 30 Val Ser Phe Glu Gly Leu Lys Ala His Lys Tyr Ser Ile Val Ile Gly 35 40 45 Phe Trp Val Gly Leu Ala Val Phe Val Ile Phe Met Phe Phe Val Leu 50 55 60 Thr Leu Leu Thr Lys Thr Gly Ala Pro His Gln Asp Asn Ala Glu Ser 65 70 75 80 Ser Glu Lys Arg Phe Arg Met Asn Ser Phe Val Ser Asp Phe Gly Arg 85 90 95 Pro Leu Glu Pro Asp Lys Val Phe Ser Arg Gln Gly Asn Glu Glu Ser 100 105 110 Arg Ser Leu Phe His Cys Tyr Ile Asn Glu Val Asp Gln Leu Asp Lys 115 120 125 Ala Lys Ala Cys Phe Gln Thr Thr Ala Leu Asp Ser Asn Val Gln Leu 130 135 140 Gln Glu Ala Ile Arg Arg Ser Gly Gln Pro Glu Glu Glu Leu Asn Arg 145 150 155 160 Leu Met Lys Phe Asp Ile Pro Asn Phe Val Asn Thr Asp Gln Asn Ser 165 170 175 Ser Phe Gly Glu Asp Asp Leu Leu Ile Ser Glu Pro Pro Ile Val Leu 180 185 190 Glu Asn Lys Pro Val Ala Gln Thr Pro His Lys Asp Leu Asp 195 200 205 <210> 9 <211> 1127 <212> DNA <213> Sus scrofa <400> 9 caggtccttt ctctcttctt ctgggacctc tatattgaga atgttggtac atctaatgtt 60 atcccagaga tctctgagag tgtcctcatt tctttccttt ctttccatct ctgaaactgt 120 tctcattctt ttttcttttt tctgttccat ggtagtaatt tccagcattc tatcttccag 180 cctccttatt catttttttg cctcatttat tccgatattg attccttcta gtgtattttt 240 cattttagtt attgtattgt tcatctctgt ttggtcttta aatcttctaa ctctttgtta 300 aacattttct tgtattggtc ttttcattct ttttcttaaa tttggataat gtttaccatc 360 attactctga attctgtccc tggcctgatg gataagactg ccctgagggc tttgcttgat 420 gacctcctga atgtggtcaa tgacaatgtg tatgagttaa caggctctac acttgcctct 480 ctctgttttt gcaggtggaa atgtcttccc agaggttaat ttctaacaga acatcccagc 540 aatctacatc taattctgat tacacctggg aatatgagca ttatgagatt ggacctgttt 600 cctttgaagg actaaaggct cacaaatgta agtcttatgc cattcctcat tgtaaacatg 660 atgtgtgttt gccttaatct gtgaaatccc ctttgtttac ttttcctgaa cattctatct 720 ttttatagaa ctctttcctc taccccataa acccaagaag acacattgct caggggtgta 780 taacaagaat gatgaagaac ttgagagagt cccttagtgg gagaacatga atcaatgtca 840 ttatcaaatt gagatttaaa aaattgatga ttccaaatct ctaaaactgt gtgaacattt 900 ggatgatcta aaatgtgtac acaaatagaa tctttttttg tgatgcatgg tggtccccta 960 gagatcttta ttttttttaa ttaaaaaaaa attttttttt gtctttttag gccgcacctg 1020 tggtctatgg aggttcctag gctaggggtc taatcagagc tgcagccgct ggcctatgcc 1080 tgagccacag caatgctaga tctgagccac gtctgtgacc tatacca 1127 <210> 10 <211> 100 <212> RNA <213> Artificial Sequence <400> 10 agguggaaau gucuucccag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 11 <211> 100 <212> RNA <213> Artificial Sequence <400> 11 ccaccugcaa aaacagagag guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 12 <211> 100 <212> RNA <213> Artificial Sequence <400> 12 ucuguuagaa auuaaccucu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 13 <211> 100 <212> RNA <213> Artificial Sequence <400> 13 ccucucucug uuuuugcagg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 14 <211> 225 <212> DNA <213> Artificial Sequence <400> 14 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggccacc tgcaaaaaca gagaggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 15 <211> 225 <212> DNA <213> Artificial Sequence <400> 15 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggtctgt tagaaattaa cctctgtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 16 <211> 102 <212> RNA <213> Artificial Sequence <400> 16 ggccaccugc aaaaacagag agguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 17 <211> 102 <212> RNA <213> Artificial Sequence <400> 17 ggucuguuag aaauuaaccu cuguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 18 <211> 130 <212> DNA <213> Artificial Sequence <400> 18 cctgaatgtg gtcaatgaca atgtgtatga gttaacaggc tctacactlg cctctctctg 60 tttttgcagg ttccccgcgg ttaatttcta acagaacatc ccagcaatct acatctaatt 120 ctgattacac 130 <210> 19 <211> 140 <212> DNA <213> Sus scrofa <400> 19 cctgaatgtg gtcaatgaca atgtgtatga gttaacaggc tctacactlg cctctctctg 60 tttttgcagg ttccccgcgg ttaatttcta acagaacatc ccagcaatct acatctaatt 120 ctgattacac 130
Claims
1. A kit comprising MRAP2-gRNA2, MRAP2-gRNA3, MRAP2-mutant-ss130 and NCN protein; The MRAP2-gRNA2 is sgRNA, and the target sequence binding region is as shown in SEQ ID NO: 16; the MRAP2-gRNA3 is sgRNA, and the target sequence binding region is as shown in SEQ ID NO: 17; the MRAP2-mutant-ss130 is a single-stranded DNA molecule as shown in SEQ ID NO: 18; and the NCN protein is as shown in SEQ ID NO: 3; The preparation method of the NCN protein comprises the following steps: (1) introducing a plasmid pKG-GE4 into E. coli BL21 (DE3) to obtain a recombinant bacterium; (2) culturing the recombinant bacterium in a liquid medium at 30℃, then adding IPTG and inducing culture at 25℃, and then collecting the bacterial bodies; (3) crushing the collected bacterial bodies to obtain a crude protein solution; (4) purifying the fusion protein with His6 tag from the crude protein solution by affinity chromatography; (5) using enterokinase with His6 tag to cut the fusion protein with His6 tag, and then removing the protein with His6 tag by Ni-NTA resin to obtain the purified NCN protein; The plasmid pKG-GE4 is as shown in SEQ ID NO: 1; The kit is used for the following (a) or (b) or (c): (a) preparing a recombinant cell; (b) preparing an obesity model pig; (c) preparing an obesity cell model or an obesity tissue model or an obesity organ model. 2.Use of MRAP2-gRNA2, MRAP2-gRNA3, MRAP2-mutant-ss130 and NCN protein in the preparation of a kit; The MRAP2-gRNA2 is the MRAP2-gRNA2 as defined in claim 1; the MRAP2-gRNA3 is the MRAP2-gRNA3 as defined in claim 1; the MRAP2-mutant-ss130 is the MRAP2-mutant-ss130 as defined in claim 1; and the NCN protein is the NCN protein as defined in claim 1; The kit is used for the following (a) or (b) or (c): (a) preparing a recombinant cell; (b) preparing an obesity model pig; (c) preparing an obesity cell model or an obesity tissue model or an obesity organ model. 3.A method for preparing a recombinant cell, comprising the following steps: replacing a DNA molecule as shown in SEQ ID NO: 19 in the chromosomal DNA of a pig cell with a DNA molecule as shown in SEQ ID NO: 18 to obtain a recombinant cell. The implementation of substituting the DNA molecule shown as SEQ ID NO: 18 for the DNA molecule shown as SEQ ID NO: 19 in the chromosomal DNA of the pig cell is as follows: co-transfecting MRAP2-gRNA2, MRAP2-gRNA3, MRAP2-mutant-ss130 and NCN protein into the pig cell; the MRAP2-gRNA2 is the MRAP2-gRNA2 as claimed in claim 1; the MRAP2-gRNA3 is the MRAP2-gRNA3 as claimed in claim 1; the MRAP2-mutant-ss130 is the MRAP2-mutant-ss130 as claimed in claim 1; and the NCN protein is the NCN protein as claimed in claim 1.
4. The method of claim 3, wherein: The ratio of the pig cell, MRAP2-gRNA2, MRAP2-gRNA3, MRAP2-mutant-ss130 and NCN protein is as follows: 100,000 pig cells: 0.8-1.2 μg MRAP2-gRNA2: 0.8-1.2 μg MRAP2-gRNA3: 1.8-2.2 μg MRAP2-mutant-ss130: 3-5 μg NCN protein.
Citation Information
Patent Citations
CRISPR / Cas9 system and application thereof in construction of swine-derived recombinant cells with insulin receptor substrate gene defects
CN112522255A
sgRNA for preparing skeletal dysplasia swine model and application thereof
CN110272900A
Application of gRNA target combinations in construction of hemophilia model pig cell line
CN112442515A