Gene editing system for constructing a model pig for von willebrand disease by nuclear transfer donor cell of vwf gene mutation and application thereof

Abstract

This invention discloses a gene editing system for constructing porcine nuclear transfer donor cells for a vWF gene-mutated von Willebrand disease (VHD) model and its applications. The invention provides the application of gRNA-vWF-gU2 (SEQ ID NO: 15), gRNA-vWF-gD1 (SEQ ID NO: 16), and NCN protein in a preparation kit. The NCN protein is a Cas9 protein or a fusion protein containing Cas9. The kit is used for: preparing recombinant cells; preparing porcine VHD models; preparing VHD cell models, VHD tissue models, or VHD organ models. This invention also provides a method for preparing recombinant cells, comprising the following steps: co-transfecting porcine cells with gRNA-vWF-gU2, gRNA-vWF-gD1, and NCN protein to obtain recombinant cells. This invention has significant application value for the development of drugs for VHD and for elucidating the pathogenesis of this disease.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically to the field of gene editing technology, and more specifically relates to a gene editing system for constructing porcine nuclear transplantation donor cells for a vWF gene-mutated von Willebrand disease model and its application. Background Technology

[0002] Von Willebrand disease (vWD) is a common hereditary bleeding disorder. Its pathogenesis involves mutations in the von Willebrand factor (vWF) gene, leading to a decrease in the quantity or quality of vWF in plasma. Typically, one parent of a patient with von Willebrand disease has a history of bleeding disorders. Children with vWD are prone to bruising and excessive bleeding after cuts, tooth extractions, or surgery. Young women may experience heavy menstrual bleeding, which can sometimes worsen. On the other hand, hormonal changes, pregnancy, inflammation, and infection can stimulate the body to increase vWF production, temporarily improving platelet adhesion to blood vessel walls and hemostasis.

[0003] Von Willebrand factor (vWF) is a glycoprotein synthesized and secreted by vascular endothelial cells and megakaryocytes, found in plasma, on the surface of endothelial cells, and in platelet α-granules. In vivo, vWF mainly exists as a disulfide-linked dimer, but it can also polymerize into polymers with molecular weights ranging from millions to tens of millions. vWF plays two main roles in hemostasis: ① it binds to the platelet membrane GPⅠb-Ⅸ complex and subendothelial collagen, mediating platelet adhesion at the site of vascular injury; ② it binds to factor VIII, acting as a carrier to stabilize factor VIII. In addition, vWF can also bind to GPⅡb-Ⅲa, participating in platelet aggregation. The normal plasma vWF concentration in humans is approximately 10 mg / L. Plasma vWF levels increase when endothelial cells are stimulated or damaged, or when the body is under stress. vWF, along with certain hemostatic and fibrinolytic components, are independent risk factors for thrombotic diseases. Conversely, when the vWF gene is deleted, mutated at an insertion point, replaced at a splice point, or prematurely forms a transcription termination signal, resulting in a significant decrease or qualitative defect in plasma vWF levels, it cannot perform its normal hemostatic function, which is vWD. In addition, vWF can also bind to heparin, cultured endothelial cells, and smooth muscle cell matrix.

[0004] Since its first report in 1926, vWD has received widespread attention as a common clinical bleeding disorder. Currently, there is no data on the incidence of vWD in my country. Based on the reported incidence rate of 1 / 1000 in foreign countries, it is estimated that there are about 1.4 million people in my country suffering from this disease. However, the number of vWD cases registered in many hemorrhagic disease treatment centers across the country is relatively small. There are several reasons for this, such as the lack of characteristic clinical manifestations of this disease, which makes it easy to be masked by other diseases, as well as insufficient understanding of this disease and limitations in testing conditions, which make it easy to miss the diagnosis.

[0005] VWD can be caused by a decrease in the quantity of vWF or a qualitative abnormality, resulting in very different clinical manifestations and laboratory test results. The classification method proposed by the International Society for Thrombosis and Haemostasis's vWF Committee based on the pathogenesis and phenotype of vWD was adopted at the Sixth National Congress of Thrombosis and Haemostasis in my country. Types 1 and 3 are characterized by a decrease in quantity, while type 2 is characterized by a qualitative abnormality. Research into the pathogenesis and development of von Willebrand disease caused by vWF gene mutations and the development of corresponding drugs require animal models. Currently, the commonly used animal model is the mouse model. However, mice differ greatly from humans in terms of body size, organ size, physiology, and pathology, and cannot realistically simulate normal human physiological and pathological states. Pigs, as large animals, have long been a primary source of meat for humans. Their body size and physiological functions are similar to humans, making them easy to breed and raise on a large scale. Furthermore, they have lower ethical and animal protection requirements, making them ideal animal models for human diseases.

[0006] Gene editing is a biotechnology that has seen significant development in recent years. It encompasses everything from homologous recombination-based gene editing to nuclease-based technologies such as ZFN, TALEN, and CRISPR / Cas9, with CRISPR / Cas9 currently being the most advanced. Gene editing technology is increasingly being applied to the creation of animal models. Summary of the Invention

[0007] The purpose of this invention is to provide a gene editing system for constructing porcine nuclear transplantation donor cells for a von Willebrand disease model with vWF gene mutations and its applications.

[0008] This invention provides the application of gRNA-vWF-gU2, gRNA-vWF-gD1 and NCN proteins in the preparation of kits.

[0009] This invention also provides the application of gRNA-vWF-gU2, gRNA-vWF-gD1, and PRONCN proteins in the preparation kit.

[0010] This invention also provides the application of gRNA-vWF-gU2, gRNA-vWF-gD1, and specific plasmids in the preparation kit.

[0011] The present invention also provides a method for preparing recombinant cells, comprising the following steps: co-transfecting porcine cells with gRNA-vWF-gU2, gRNA-vWF-gD1 and NCN protein to obtain recombinant cells.

[0012] The recombinant cells are recombinant cells with a mutation in the vWF gene.

[0013] The mutation is the deletion and / or insertion and / or substitution of one or more nucleotides.

[0014] The recombinant cells are recombinant cells with mutations occurring in a specific region of the vWF gene. The specific region is the area (including the target region) between the target sequences of gRNA-vWF-gU2 and gRNA-vWF-gD1 in the vWF gene.

[0015] The recombinant cells can be any heterozygous monoclonal cells, bicelestem-different mutant monoclonal cells, or bicelestem-identical mutant monoclonal cells listed in Table 1.

[0016] The present invention also provides a kit comprising gRNA-vWF-gU2, gRNA-vWF-gD1 and NCN protein.

[0017] The present invention also provides a kit comprising gRNA-vWF-gU2, gRNA-vWF-gD1 and PRONCN protein.

[0018] The present invention also provides a kit comprising gRNA-vWF-gU2, gRNA-vWF-gD1 and a specific plasmid.

[0019] The kits described above also include porcine cells.

[0020] The above-described kits are intended for use as follows (a), (b), or (c): (a) to prepare recombinant cells; (b) to prepare von Willebrand disease (VHD) model pigs; (c) to prepare VHD cell models, VHD tissue models, or VHD organ models.

[0021] The co-transfection specifically employs an electroporation transfection method.

[0022] The specific parameter settings for electroporation transfection are: 1450V, 10ms, 3pulse.

[0023] The co-transfection can be specifically performed using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system electroporator.

[0024] The ratio of gRNA-vWF-gU2, gRNA-vWF-gD1 and NCN protein is as follows: 0.8-1.2 μg gRNA-vWF-gU2 : 0.8-1.2 μg gRNA-vWF-gD1 : 3-5 μg NCN protein.

[0025] The ratio of gRNA-vWF-gU2, gRNA-vWF-gD1 and NCN protein is as follows: 1 μg gRNA-vWF-gU2 : 1 μg gRNA-vWF-gD1 : 4 μg NCN protein.

[0026] The ratio of porcine cells, gRNA-vWF-gU2, gRNA-vWF-gD1, and NCN protein is as follows: 100,000 porcine cells: 0.8-1.2 μg gRNA-vWF-gU2: 0.8-1.2 μg gRNA-vWF-gD1: 3-5 μg NCN protein.

[0027] The ratio of porcine cells, gRNA-vWF-gU2, gRNA-vWF-gD1, and NCN protein was as follows: 100,000 porcine cells: 1 μg gRNA-vWF-gU2: 1 μg gRNA-vWF-gD1: 4 μg NCN protein.

[0028] The gRNA-vWF-gU2 mentioned above is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 15.

[0029] Specifically, the gRNA-vWF-gU2 is shown in SEQ ID NO: 15.

[0030] The gRNA-vWF-gD1 mentioned above is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 16.

[0031] Specifically, the gRNA-vWF-gD1 is shown in SEQ ID NO: 16.

[0032] Any of the NCN proteins mentioned above is a Cas9 protein or a fusion protein containing a Cas9 protein.

[0033] Specifically, the NCN protein is shown in SEQ ID NO: 3.

[0034] The porcine cells mentioned above are porcine fibroblasts.

[0035] The porcine cells mentioned above are primary porcine fibroblasts.

[0036] The method for preparing the NCN protein includes the following steps:

[0037] (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacteria;

[0038] (2) The recombinant bacteria were cultured in liquid culture medium at 30°C, then IPTG was added and induced at 25°C, and then the bacterial cells were collected.

[0039] (3) The collected bacterial cells were broken down to collect the crude protein solution;

[0040] (4) The His6-tagged fusion protein was purified from the crude protein solution by affinity chromatography;

[0041] (5) The His6-tagged fusion protein was digested with His6-tagged enterokinase, and then the His6-tagged protein was removed with Ni-NTA resin to obtain purified NCN protein.

[0042] The plasmid pKG-GE4 contains the fusion gene shown in nucleotides 5209-9852 of SEQ ID NO: 1.

[0043] The preparation method of the NCN protein specifically includes the following steps:

[0044] (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacteria.

[0045] (2) Inoculate the recombinant bacteria obtained in step (1) into liquid LB medium containing ampicillin and culture with shaking;

[0046] (3) Inoculate the bacterial culture obtained in step (2) into liquid LB medium and culture at 30°C with shaking at 230 rpm until OD. 600nm The value was 1.0, then IPTG was added to make the concentration in the system 0.5mM, and then the cells were cultured at 25℃ and 230rpm for 12 hours with shaking, and then the cells were collected by centrifugation.

[0047] (4) Take the bacterial cells obtained in step (3) and wash them with PBS buffer;

[0048] (5) Take the bacterial cells obtained in step (4), add crude extraction buffer and suspend the bacterial cells, then break the bacterial cells, then centrifuge and collect the supernatant, filter with a 0.22 μm pore size filter membrane and collect the filtrate;

[0049] (6) The His6-tagged fusion protein (the fusion protein shown in SEQ ID NO: 2) was purified from the filtrate obtained in step (5) by affinity chromatography;

[0050] (7) Take the column-passed solution collected in step (6), concentrate it using an ultrafiltration tube, and then dilute it with 25 mM Tris-HCl (pH 8.0);

[0051] (8) Add the recombinant bovine enterokinase with the His6 tag to the solution obtained in step (7) and digest it with enzymes;

[0052] (9) Mix the solution from step (8) with Ni-NTA resin, incubate, and then centrifuge to collect the supernatant.

[0053] (10) Take the supernatant obtained in step (9), concentrate it using an ultrafiltration tube, and then add it to the enzyme storage solution to obtain the NCN protein solution.

[0054] The specific method for purifying the His6-tagged fusion protein from the filtrate obtained in step (5) using affinity chromatography is as follows:

[0055] First, equilibrate the Ni-NTA agarose column with 5 column volumes of equilibration buffer (flow rate: 1 ml / min); then load 50 ml of the filtrate obtained in step (5) (flow rate: 0.5-1 ml / min); then wash the column with 5 column volumes of equilibration buffer (flow rate: 1 ml / min); then wash the column with 5 column volumes of buffer (flow rate: 1 ml / min) to remove contaminating proteins; then elute with 10 column volumes of elution buffer at a flow rate of 0.5-1 ml / min, and collect the post-column solution (90-100 ml).

[0056] The PRONCN protein described above comprises the following components from upstream to downstream: signal peptide, molecular chaperone protein, protein tag, protease cleavage site, nuclear localization signal, Cas9 protein, and nuclear localization signal.

[0057] The function of the signal peptide is to promote the secretory expression of a protein. The signal peptide can be selected from the Escherichia coli alkaline phosphatase (phoA) signal peptide, Staphylococcus aureus protein A signal peptide, Escherichia coli outer membrane protein (ompa) signal peptide, or any other prokaryotic gene signal peptide, preferably the alkaline phosphatase signal peptide (phoA signal peptide). The alkaline phosphatase signal peptide is used to guide the secretory expression of the target protein into the bacterial periplasmic lumen, thereby separating it from the intracellular protein. The target protein secreted into the bacterial periplasmic lumen is soluble and can be cleaved by the signal peptidase in the bacterial periplasmic lumen.

[0058] The function of the molecular chaperone protein is to increase the solubility of the protein. The molecular chaperone can be any protein that helps form disulfide bonds, preferably a thioreduction protein (TrxA protein). A thioreduction protein, acting as a molecular chaperone, helps the co-expressed target protein (e.g., Cas9 protein) form disulfide bonds, improving protein stability, correct folding, and increasing the solubility and activity of the target protein.

[0059] The protein tag is used for protein purification. The tag can be a His tag (His-Tag, His6 protein tag), GST tag, Flag tag, HA tag, c-Myc tag, or any other protein tag, with a His tag being more preferred. The His tag can bind to a Ni column, enabling one-step Ni column affinity chromatography to purify the target protein, greatly simplifying the purification process.

[0060] The function of the protease cleavage site is to cleave the non-functional segment after purification to release the native form of Cas9 protein. The protease can be selected from enterokinase, factor Xa, thrombin, TEV protease, HRV 3C protease, WELQut protease, or any other endopeptide, with enterokinase being more preferred. EK is an enterokinase cleavage site, facilitating the cleavage of the fused TrxA-His segment using enterokinase to obtain the native form of Cas9 protein. In this application, after cleaving the fusion protein with a His-tagged commercial enterokinase, the TrxA-His segment and the His-tagged enterokinase can be removed by a single affinity chromatography to obtain the native form of Cas9 protein, avoiding the damage and loss of the target protein caused by multiple purification dialysis processes.

[0061] The nuclear localization signal can be any nuclear localization signal, preferably the SV40 nuclear localization signal and / or the nucleoplasmin nuclear localization signal. The NLS is the nuclear localization signal; an NLS site is designed at both the N-terminus and C-terminus of Cas9, enabling Cas9 to more effectively enter the cell nucleus for gene editing.

[0062] The Cas9 protein may be saCas9 or spCas9, preferably spCas9 protein.

[0063] The PRONCN protein is shown in SEQ ID NO: 2.

[0064] Each of the above-mentioned specific plasmids comprises the following elements from upstream to downstream: promoter, operon, ribosome binding site, gene encoding PRONCN protein, and terminator.

[0065] The promoter may specifically be the T7 promoter. The T7 promoter is a strong prokaryotic expression promoter that can efficiently drive the expression of exogenous genes.

[0066] The operon can specifically be the Lac operon. The Lac operon is a regulatory element for lactose-induced expression. After the bacteria have grown to a certain number, the expression of the target protein can be induced by IPTG at low temperature, which can avoid the impact of premature expression of the target protein on the growth of the host bacteria. Induction at low temperature also significantly improves the solubility of the expressed target protein.

[0067] The ribosome binding site is the ribosome binding site during protein translation, which is essential for protein translation.

[0068] The terminator can specifically be a T7 terminator. The T7 terminator can effectively terminate gene transcription at the end of the target gene, preventing other downstream sequences outside the target gene from being transcribed and translated.

[0069] For the codons of spCas9 protein, this application has optimized the codons to fully adapt to the codon preferences of the high-efficiency E. coli expression strain E. coli BL21(DE3) selected in this application, thereby improving the expression level of Cas9 protein.

[0070] The T7 promoter is shown as nucleotides 5121-5139 in SEQ ID NO: 1.

[0071] The Lac operon is shown as nucleotides 5140-5164 in SEQ ID NO: 1.

[0072] The ribosome binding site is shown as nucleotides 5178-5201 in SEQ ID NO: 1.

[0073] The coding sequence of the alkaline phosphatase signal peptide is shown as nucleotides 5209-5271 in SEQ ID NO: 1.

[0074] The coding sequence of the TrxA protein is shown as nucleotides 5272-5598 in SEQ ID NO: 1.

[0075] The coding sequence of His-Tag is shown as nucleotides 5620-5637 in SEQ ID NO: 1.

[0076] The coding sequence of the enterokinase cleavage site is shown as nucleotides 5638-5652 in SEQ ID NO: 1.

[0077] The coding sequence of the nuclear localization signal is shown as nucleotides 5656-5670 in SEQ ID NO: 1.

[0078] The coding sequence of the spCas9 protein is shown as nucleotides 5701-9801 in SEQ ID NO: 1.

[0079] The coding sequence of the nuclear localization signal is shown as nucleotides 9802-9849 in SEQ ID NO: 1.

[0080] The T7 terminator is nucleotides 9902-9949 in SEQ ID NO: 1.

[0081] Specifically, the specific plasmid is plasmid pKG-GE4.

[0082] The plasmid pKG-GE4 contains the DNA molecule represented by nucleotides 5121-9949 of SEQ ID NO: 1.

[0083] Specifically, any of the plasmids pKG-GE4 described above is shown in SEQ ID NO: 1.

[0084] This invention also protects recombinant cells prepared by any of the methods described above.

[0085] This invention also protects the use of the recombinant cells in the preparation of a pig model of von Willebrand disease.

[0086] Using the recombinant cells as nuclear transfer donor cells for somatic cell cloning, cloned pigs can be obtained, which are von Willebrand disease model pigs.

[0087] This invention also protects porcine tissues of model pigs prepared using the recombinant cells, namely, a von Willebrand disease tissue model.

[0088] This invention also protects porcine organs of model pigs prepared using the recombinant cells, namely, organ models of von Willebrand disease.

[0089] This invention also protects porcine cells of model pigs prepared using the recombinant cells, namely, von Willebrand disease cell models.

[0090] The present invention also protects the application of the recombinant cells, the von Willebrand disease tissue model, the von Willebrand disease organ model, the von Willebrand disease cell model, or the von Willebrand disease model pig, as follows (d1) or (d2) or (d3) or (d4):

[0091] (d1) Screening for drugs to treat von Willebrand disease;

[0092] (d2) Efficacy evaluation of drugs for von Willebrand disease;

[0093] (d3) Evaluate the efficacy of gene therapy and / or cell therapy for von Willebrand disease;

[0094] (d4) To study the pathogenesis of von Willebrand disease.

[0095] The pig mentioned above can specifically refer to the Congjiang Xiang pig.

[0096] Von von Willebrand disease is caused by mutations in the vWF gene.

[0097] Information on the porcine vWF gene: Encodes von Willebrand factor precursor; located on chromosome 5; GeneID is 399543, Sus scrofa.

[0098] The amino acid sequence encoded by the porcine vWF gene is shown in SEQ ID NO: 8.

[0099] The porcine vWF gene contains the DNA segment shown in SEQ ID NO: 9.

[0100] Compared with the prior art, the present invention has at least the following beneficial effects:

[0101] (1) The research object of this invention (pig) has better applicability than other animals (mice, mice, primates).

[0102] Rodents such as mice and rats differ greatly from humans in body size, organ size, physiology, and pathology, making it impossible to realistically simulate normal human physiological and pathological states. Studies have shown that over 95% of drugs proven effective in mice and rats are ineffective in human clinical trials. Among large animals, primates are the closest relatives to humans, but they are small, reach sexual maturity late (mating begins at 6-7 years old), and are single-birth animals, resulting in extremely slow population expansion and high rearing costs. Furthermore, primate cloning is inefficient, difficult, and costly.

[0103] Pigs, as model animals, do not have the aforementioned drawbacks. Pigs are the closest relatives to humans besides primates, and their body size, weight, and organ size are similar to humans. They are also remarkably similar to humans in anatomy, physiology, immunology, nutritional metabolism, and disease pathogenesis. Furthermore, pigs reach sexual maturity early (4-6 months), have high reproductive capacity, produce multiple offspring per litter, and can form a large herd within 2-3 years. In addition, pig cloning technology is very mature, and the costs of cloning and raising pigs are much lower than for primates. Therefore, pigs are very suitable animals to serve as human disease models.

[0104] (2) The vector constructed in this invention uses the strong promoter T7-lac, which can efficiently express the target protein, to express the target protein. The signal peptide of bacterial periplasmic protein alkaline phosphatase (phoA) guides the secretion of the target protein into the bacterial periplasmic lumen, thereby separating it from intracellular proteins. The target protein secreted into the bacterial periplasmic lumen is soluble. Simultaneously, the thioreduction protein TrxA is fused with the Cas9 protein for expression. TrxA helps the co-expressed target protein form disulfide bonds, improving protein stability, correct folding, and increasing the solubility and activity of the target protein. To facilitate the purification of the target protein, a His tag is designed, allowing for one-step Ni column affinity chromatography purification of the target protein, greatly simplifying the purification process. Furthermore, an enterokinase cleavage site is designed after the His tag to facilitate the removal of the fused TrxA-His polypeptide fragment, yielding the native form of the Cas9 protein. After cleaving the fusion protein with a His-tagged enterokinase, the TrxA-His polypeptide fragment and the His-tagged enterokinase can be removed by a single affinity chromatography step, yielding the native form of Cas9 protein. This avoids the damage and loss to the target protein caused by multiple purification dialysis steps. Furthermore, this invention also designs an NLS site at the N-terminus and C-terminus of Cas9, enabling Cas9 to more effectively enter the cell nucleus for gene editing. Additionally, this invention selects E. coli BL21(DE3) as the target protein expression strain, which can efficiently express exogenous genes cloned into expression vectors containing the phage T7 promoter (such as pET-32a). Moreover, this invention optimizes the codons for the Cas9 protein to perfectly suit the codon preferences of the expression strain, thereby improving the expression level of the target protein. Furthermore, this invention induces the expression of the target protein with IPTG at low temperature after the bacteria have grown to a certain quantity, avoiding the impact of premature expression on host bacterial growth. Low-temperature induction also significantly improves the solubility of the expressed target protein. After the above-mentioned optimization design and experimental implementation, the activity of the obtained Cas9 protein was significantly improved compared with that of the commercial Cas9 protein.

[0105] (3) Gene editing was performed using the Cas9 high-efficiency protein constructed and expressed in this invention in combination with in vitro transcribed gRNA, and the optimal ratio of Cas9 and gRNA was optimized. The final rate of gene-edited single-cell clones was as high as 93%, which is much higher than the conventional gene editing efficiency (10-30%).

[0106] (4) This invention uses a combination of two gRNAs for mutation, which effectively reduces the generation of non-frameshift mutations compared to using a single gRNA. If a single gRNA is used to mutate the target gene, there is a 1 / 3 probability of generating a non-frameshift mutation during the random repair of non-homologous end joining (NHEJ) of DNA. This non-frameshift mutation is unlikely to disrupt the function of the target gene and will not achieve the expected goal of inactivating the target gene. However, when a dual gRNA is used to cleave the target gene, a segment can be removed from the target gene. By designing to remove a segment that is not less than 3 times the number of bases, a segment deletion frameshift mutation of the target gene can be effectively generated. In addition, dual gRNAs can not only cause theoretical segment deletions, but also allow for the individual cleavage of single gRNAs, thereby greatly increasing the efficiency of gene mutation.

[0107] (5) Using the target gene knockout single-cell clone obtained by the present invention to perform somatic cell nuclear transfer animal cloning, the target gene knockout cloned pig can be directly obtained, and the gene mutation can be stably inherited.

[0108] The method of microinjecting gene-edited material into fertilized eggs followed by embryo transfer, used in mouse model creation, has a relatively low probability of directly obtaining gene-mutated offspring, requiring hybridization and selection of the offspring. This is not suitable for creating models of large animals (such as pigs) with long gestation periods. Therefore, this invention employs a technically challenging method of primary cell in vitro editing and double gRNA cutting followed by screening for positively edited single-cell clones. Subsequently, somatic cell nuclear transfer animal cloning technology is used to directly obtain pig models of the corresponding diseases, which can significantly shorten the pig model creation cycle and save manpower, material resources, and financial resources.

[0109] This invention utilizes CRISPR / Cas9 technology combined with dual gRNA editing to knock out the vWF gene, mimicking the natural pathogenesis and genetic characteristics of von Willebrand disease (VHD). Single-cell clones with the vWF gene knockout were obtained, laying the foundation for later development of pig models of VHD using somatic cell nuclear transfer animal cloning technology. This invention will contribute to the research and elucidation of the pathogenesis of VHD caused by vWF gene dysfunction. It can also be used for drug screening, efficacy evaluation, gene therapy, and cell therapy research, providing effective experimental data for further clinical applications and thus offering powerful experimental tools for the successful treatment of human VHD. This invention has significant application value for the development of drugs for VHD and for elucidating the pathogenesis of this disease. Attached Figure Description

[0110] Figure 1 This is a schematic diagram of the structure of plasmid pET-32a.

[0111] Figure 2 This is a schematic diagram of the structure of plasmid pKG-GE4.

[0112] Figure 3 This is an electrophoresis diagram showing the optimized ratio of gRNA to NCN protein in Example 3.

[0113] Figure 4 This is an electrophoresis diagram comparing the gene editing efficiency of NCN protein and commercial Cas9 protein in Example 3.

[0114] Figure 5 This is an electrophoresis image of PCR amplification performed using different primer pairs with genome extracted from ear tissue of pig No. 1 as a template in Example 4.

[0115] Figure 6 The image shows electrophoresis diagrams of PCR amplification performed in Example 4 using primer pairs composed of vWF-E29-F200 and vWF-E29-R703, with genomic DNA from 18 pigs as templates.

[0116] Figure 7 This is an electrophoresis diagram comparing the editing efficiency of different target combinations in Example 4.

[0117] Figure 8 This is a sequencing peak diagram comparing the editing efficiency of different target combinations in Example 4.

[0118] Figure 9 This is the result of reverse sequencing of single-cell clone number 10 and comparison with wild-type sequence.

[0119] Figure 10 This is the result of reverse sequencing of single-cell clone number 7 and comparison with wild-type sequence.

[0120] Figure 11 This is the result of forward and reverse sequencing of single-cell clone number 3, compared with the wild-type sequence.

[0121] Figure 12 This is the result of reverse sequencing of single-cell clone number 2 and comparison with wild-type sequence. Detailed Implementation

[0122] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0123] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. The recombinant plasmids constructed in the examples have all been sequenced and verified. The commercially available Cas9-A protein is a commercially available, effective Cas9 protein. The commercially available Cas9-B protein is a commercially available, effective Cas9 protein. Complete culture medium (% by volume): 15% fetal bovine serum (Gibco) + 83% DMEM medium (Gibco) + 1% Penicillin-Streptomycin (Gibco) + 1% HEPES (Solarbio). Cell culture conditions: 37°C, incubator with 5% CO2 and 5% O2.

[0124] The primary porcine fibroblasts used in the examples were all prepared from newly formed ear tissue of Jiangxian pigs. The method for preparing primary porcine fibroblasts was as follows: ① Take 0.5g of pig ear tissue, remove hair and bone tissue, then soak in 75% alcohol for 30-40s, then wash 5 times with PBS buffer containing 5% (v / v) Penicillin-Streptomycin (Gibco), and then wash once with PBS buffer; ② Cut the tissue into small pieces with scissors, digest with 5mL of 0.1% collagenase solution (Sigma) at 37℃ for 1h, then centrifuge at 500g for 5min and discard the supernatant; ③ Resuspend the precipitate in 1mL of complete culture medium, then place it into a 10cm diameter cell culture dish containing 10mL of complete culture medium and sealed with 0.2% gelatin (VWR), and culture until the cells reach approximately 60% confluence with the bottom of the dish; ④ After completing step ③, digest with trypsin and collect the cells, then resuspend them in complete culture medium. These cells are then used for subsequent electroporation experiments.

[0125] Example 1: Construction of a high-efficiency prokaryotic Cas9 expression vector

[0126] A schematic diagram of the structure of plasmid pET-32a is shown below. Figure 1 .

[0127] Plasmid pKG-GE4 was obtained by modifying plasmid pET-32a. Plasmid pET32a-T7lac-phoA:SP-TrxA-His-EK-NLS-spCas9-NLS-T7ter (abbreviated as plasmid pKG-GE4), as shown in SEQ ID NO: 1, is a circular plasmid; its structural diagram is shown below. Figure 2 .

[0128] In SEQ ID NO: 1, nucleotides 5121-5139 form the T7 promoter, nucleotides 5140-5164 encode the Lac operator, nucleotides 5178-5201 form the ribosome binding site (RBS), nucleotides 5209-5271 encode the alkaline phosphatase signal peptide (phoA signal peptide), nucleotides 5272-5598 encode the TrxA protein, nucleotides 5620-5637 encode the His-Tag (also known as the His6 tag), nucleotides 5638-5652 encode the enterokinase cleavage site (EK cleavage site), nucleotides 5656-5670 encode the nuclear localization signal, nucleotides 5701-9801 encode the spCas9 protein, nucleotides 9802-9849 encode the nuclear localization signal, and nucleotides 9902-9949 form the T7 terminator. The nucleotides encoding the spCas9 protein have been codon-optimized for Escherichia coli BL21(DE3) strain.

[0129] The main modifications to plasmid pKG-GE4 are as follows: ① The coding region of the TrxA protein was retained. The TrxA protein can help the expressed target protein form disulfide bonds, increasing the solubility and activity of the target protein. An alkaline phosphatase signal peptide coding sequence was added before the TrxA protein coding region. The alkaline phosphatase signal peptide can guide the expressed target protein to be secreted into the bacterial periplasmic lumen and can be cleaved by prokaryotic periplasmic signal peptidase. ② A His-Tag coding sequence was added after the TrxA protein coding sequence. The His-Tag can be used for... Enrichment of the target protein; ③ Add the coding sequence of the enterokinase cleavage site DDDDK (Asp-Asp-Asp-Asp-Lys) downstream of the His-Tag coding sequence. The purified protein will remove His-Tag and the upstream fused TrxA protein under the action of enterokinase; ④ Insert the Cas9 gene of suitable Escherichia coli BL21(DE3) strain with optimized codons, and add nuclear localization signal coding sequences upstream and downstream of this gene to increase the nuclear localization ability of the purified Cas9 protein in the later stage.

[0130] The fusion gene in plasmid pKG-GE4, as shown in nucleotides 5209-9852 of SEQ ID NO: 1, encodes the fusion protein shown in SEQ ID NO: 2 (fusion protein TrxA-His-EK-NLS-spCas9-NLS, abbreviated as PRONCN protein). Due to the presence of alkaline phosphatase signal peptide and enterokinase cleavage site, the fusion protein is cleaved by enterokinase to form the protein shown in SEQ ID NO: 3. The protein shown in SEQ ID NO: 3 is named NCN protein.

[0131] Example 2: Preparation and purification of NCN protein

[0132] I. Induced Expression

[0133] 1. Plasmid pKG-GE4 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacteria.

[0134] 2. Inoculate the recombinant bacteria obtained in step 1 into liquid LB medium containing 100 μg / ml ampicillin and culture overnight at 37°C with shaking at 200 rpm.

[0135] 3. Inoculate the bacterial culture obtained in step 2 into liquid LB medium and incubate at 30°C with shaking at 230 rpm until OD reaches 100%. 600nm The concentration was set to 1.0, then isopropyl thiogalactoside (IPTG) was added to a concentration of 0.5 mM in the system. The mixture was then cultured at 25°C and 230 rpm for 12 hours with shaking. Finally, the cells were collected by centrifugation at 4°C and 10,000 g for 15 minutes.

[0136] 4. Take the bacterial cells obtained in step 3 and wash them with PBS buffer.

[0137] II. Purification of the fusion protein TrxA-His-EK-NLS-spCas9-NLS

[0138] 1. Take the bacterial cells obtained in step one, add crude extraction buffer and suspend the bacterial cells, then homogenize the bacterial cells using a homogenizer (1000 rpm for three cycles), then centrifuge at 4°C and 15000g for 30 min, collect the supernatant, filter the supernatant through a 0.22μm pore size filter membrane, and collect the filtrate. In this step, 10 ml of crude extraction buffer is prepared for every gram of wet bacterial cells.

[0139] Crude extraction buffer: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 5mM Imidazole, 1mM PMSF, with the balance being ddH2O.

[0140] 2. Affinity chromatography was used to purify the fusion protein.

[0141] First, equilibrate the Ni-NTA agarose column with 5 column volumes of equilibration buffer (flow rate: 1 ml / min); then load 50 ml of the filtrate obtained in step 1 (flow rate: 0.5-1 ml / min); then wash the column with 5 column volumes of equilibration buffer (flow rate: 1 ml / min); then wash the column with 5 column volumes of buffer (flow rate: 1 ml / min) to remove contaminating proteins; finally, elute with 10 column volumes of elution buffer at a flow rate of 0.5-1 ml / min, and collect the post-column solution (90-100 ml).

[0142] Ni-NTA agarose column: GenScript, L00250 / L00250-C, 10ml packing material.

[0143] Equilibrium solution: contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole, and the balance is ddH2O.

[0144] Buffer solution: containing 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 50 mM Imidazole, with the balance being ddH2O.

[0145] Eluent: Contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 500 mM Imidazole, and the balance is ddH2O.

[0146] III. Enzymatic digestion of the fusion protein TrxA-His-EK-NLS-spCas9-NLS and purification of the NCN protein

[0147] 1. Take 15 ml of the post-column solution collected in step 2, concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, 15 ml capacity), and then dilute it to 1 ml with 25 mM Tris-HCl (pH 8.0). Use 6 ultrafiltration tubes to obtain a total of 6 ml.

[0148] 2. Add the commercially available His6-tagged recombinant bovine enterokinase (Sangon Biotech, C620031, Recombinant Bovine Enterokinase Light Chain, His6-tagged) to the solution obtained in step 1 (approximately 6 ml), and digest at 25°C for 16 hours. Add 2 units of enterokinase per 50 μg of protein.

[0149] 3. Take the solution from step 2 (about 6 ml), mix it with 480 μl of Ni-NTA resin (GenScript, L00250 / L00250-C), mix by rotation at room temperature for 15 min, then centrifuge at 7000 g for 3 min, and collect the supernatant (4-5.5 ml).

[0150] 4. Take the supernatant obtained in step 3 and concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, capacity 15 ml). Then add it to the enzyme storage solution and adjust the protein concentration to 5 mg / ml to obtain the NCN protein solution.

[0151] Sequencing revealed that the N-terminal 15 amino acid residues in the NCN protein solution are as shown in positions 1 to 15 of SEQ ID NO: 3, which is the NCN protein.

[0152] The NCN protein used in subsequent embodiments was provided by an NCN protein solution.

[0153] Enzyme stock solution (pH 7.4): contains 10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% (v / v) glycerol, with the balance being ddH2O.

[0154] Example 3: Performance of NCN protein

[0155] The following two gRNA targets targeting the TTN gene were selected:

[0156] TTN-gRNA1: AGAGCACAGTCAGCCTGGCG;

[0157] TTN-gRNA2: CTTCCAGAATTGGATCTCCG.

[0158] The primers used to identify target fragments containing gRNA from the TTN gene are as follows:

[0159] TTN-F55: TACGGAATTGGGGAGCCAGCGGA;

[0160] TTN-R560: CAAAGTTAACTCTCTGTGTCT.

[0161] I. Preparation of gRNA

[0162] 1. Preparation of TTN-T7-gRNA1 and TTN-T7-gRNA2 transcription templates

[0163] The TTN-T7-gRNA1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 4.

[0164] The TTN-T7-gRNA2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 5.

[0165] 2. Obtain gRNA through in vitro transcription

[0166] Using TTN-T7-gRNA1 as a transcription template, in vitro transcription was performed using the Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), followed by MEGA clearing. TMThe TTN-gRNA1 was recovered and purified using a Transcription Clean-Up Kit (Thermo, AM1908). TTN-gRNA1 is a single-stranded RNA, as shown in SEQ ID NO: 6.

[0167] Using TTN-T7-gRNA2 as a transcription template, in vitro transcription was performed using the Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), followed by MEGA clearing. TM The TTN-gRNA2 was recovered and purified using the Transcription Clean-Up Kit (Thermo, AM1908). TTN-gRNA2 is a single-stranded RNA, as shown in SEQ ID NO: 7.

[0168] II. Optimization of the ratio of gRNA to NCN protein

[0169] 1. Co-transfection of porcine primary fibroblasts

[0170] Group 1: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was approximately 100,000 porcine primary fibroblasts: 0.5 μg TTN-gRNA1 : 0.5 μg TTN-gRNA2 : 4 μg NCN protein.

[0171] Group 2: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was approximately 100,000 porcine primary fibroblasts: 0.75 μg TTN-gRNA1 : 0.75 μg TTN-gRNA2 : 4 μg NCN protein.

[0172] Group 3: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2 : 4 μg NCN protein.

[0173] Group 4: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was approximately 100,000 porcine primary fibroblasts: 1.25 μg TTN-gRNA1 : 1.25 μg TTN-gRNA2 : 4 μg NCN protein.

[0174] Group 5: TTN-gRNA1 and TTN-gRNA2 were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.

[0175] Co-transfection was performed using electroporation with a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3 pulses).

[0176] 2. After completing step 1, incubate in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total incubation time after electroporation is 48 hours.

[0177] 3. After completing step 2, cells were digested and collected with trypsin, genomic DNA was extracted, and PCR amplification was performed using primers consisting of TTN-F55 and TTN-R560, followed by 1% agarose gel electrophoresis.

[0178] See electrophoresis image Figure 3 The 505bp band is the wild-type band (WT), and the band around 254bp (the wild-type band theoretically has a deletion of 251bp) is the deletion mutation band (MT).

[0179] Gene deletion mutation efficiency = (MT gray level / MT band bp) / (WT gray level / WT band bp + MT gray level / MT band bp) × 100%. The gene deletion mutation efficiency of the first group is 19.9%, the gene deletion mutation efficiency of the second group is 39.9%, the gene deletion mutation efficiency of the third group is 79.9%, and the gene deletion mutation efficiency of the fourth group is 44.3%. No mutation occurred in the fifth group.

[0180] The results showed that the gene editing efficiency was highest when the mass ratio of the two gRNAs to the NCN protein was 1:1:4, and the actual dosage was 1 μg:1 μg:4 μg. Therefore, the optimal dosage of the two gRNAs to the NCN protein was determined to be 1 μg:1 μg:4 μg.

[0181] III. Comparison of gene editing efficiency between NCN protein and commercial Cas9 protein

[0182] 1. Co-transfection of porcine primary fibroblasts

[0183] Cas9-A group: TTN-gRNA1, TTN-gRNA2, and commercial Cas9-A protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2 : 4 μg Cas9-A protein.

[0184] pKG-GE4 group: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2 : 4 μg NCN protein.

[0185] Cas9-B group: TTN-gRNA1, TTN-gRNA2, and commercial Cas9-B protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts : 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2 : 4 μg Cas9-B protein.

[0186] Control group: porcine primary fibroblasts were co-transfected with TTN-gRNA1 and TTN-gRNA2. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2.

[0187] Co-transfection was performed using electroporation with a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3 pulses).

[0188] 2. After completing step 1, incubate in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total incubation time after electroporation is 48 hours.

[0189] 3. After completing step 2, cells were digested and collected with trypsin, genomic DNA was extracted, and PCR amplification was performed using primers consisting of TTN-F55 and TTN-R560, followed by 1% agarose gel electrophoresis.

[0190] See electrophoresis image Figure 4 The gene deletion mutation efficiency using commercial Cas9-A protein was 28.5%, that using NCN protein was 85.6%, and that using commercial Cas9-B protein was 16.6%.

[0191] The results showed that, compared with commercially available Cas9 protein, the NCN protein prepared using this invention significantly improved gene editing efficiency.

[0192] Example 4: Screening of highly efficient gRNA target combinations for the vWF gene

[0193] Information on the porcine vWF gene: Encoding von Willebrand factor precursor; located on chromosome 5; GeneID 399543, Sus scrofa. The amino acid sequence of the protein encoded by the porcine vWF gene is shown in SEQ ID NO. 8. Gene editing was performed targeting exon 29 of the porcine vWF gene in the porcine genomic DNA. Exon 29 of the porcine vWF gene and its upstream 400 nucleotides are shown in SEQ ID NO. 9.

[0194] I. Conservation analysis of the pre-defined target region of the vWF gene and adjacent genomic sequences

[0195] Eighteen newborn Congjiang Xiang pigs were selected, including 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10) and 8 males (named A, B, C, D, E, F, G, and H).

[0196] vWF-E29-F200: CTAGGGCAGGTGAAAACTTTGGC;

[0197] vWF-E29-R684: GTTCCATCATGCCCACCACGAAG;

[0198] vWF-E29-F237: AGACTCAAGGGAAGTGCATGTGT;

[0199] vWF-E29-R703:TTCTGGGAGATGTGCAGGTGTTC.

[0200] Genomic DNA was extracted from ear tissue of pig '1' as a template, and PCR amplification was performed using different primer pairs, followed by 1% agarose gel electrophoresis. See the electrophoresis image below. Figure 5 . Figure 5 In the study, primer pairs were used in four groups: Group 1: vWF-E29-F200 and vWF-E29-R684; Group 2: vWF-E29-F200 and vWF-E29-R703; Group 3: vWF-E29-F237 and vWF-E29-R684; and Group 4: vWF-E29-F237 and vWF-E29-R703. The results showed that the primer pair using vWF-E29-F200 and vWF-E29-R703 was preferred for amplifying the target fragment.

[0201] Using genomic DNA from 18 pigs as templates, PCR amplification was performed using primer pairs consisting of vWF-E29-F200 and vWF-E29-R703, followed by 1% agarose gel electrophoresis. (See electrophoresis image below.) Figure 6 PCR amplification products were recovered and sequenced. The sequencing results were compared and analyzed with vWF gene sequences in public databases. Conserved regions common to 18 pigs were selected for gRNA target design.

[0202] II. Target Screening

[0203] Several targets were initially screened by NGG (avoiding possible mutation sites), and four targets were further screened out after preliminary experiments.

[0204] The four target points are as follows:

[0205] vWF-E29-gU1: ACCATCACAGTGACTGCAGG;

[0206] vWF-E29-gU2:GACACCATCACAGTGACTGC;

[0207] vWF-E29-gD1:GAACCGGTGCCCCCCACAGA;

[0208] vWF-E29-gD2: GGTGCCCCCCACAGAAGGCC.

[0209] III. Preparation of gRNA

[0210] 1. Preparation of transcription template

[0211] The vWF-E29-T7-gU1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO.10.

[0212] The vWF-E29-T7-gU2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO.11.

[0213] The vWF-E29-T7-gD1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO.12.

[0214] The vWF-E29-T7-gD2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO.13.

[0215] 2. Obtain gRNA through in vitro transcription

[0216] Transcription templates were obtained, and in vitro transcription was performed using the Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), followed by MEGA clearing. TM The gRNA was recovered and purified using the Transcription Clean-Up Kit (Thermo, AM1908).

[0217] When using vWF-E29-T7-gU1 as a transcription template, gRNA-vWF-gU1 was obtained. gRNA-vWF-gU1 is a single-stranded RNA, as shown in SEQ ID NO: 14.

[0218] gRNA-vWF-gU1 (SEQ ID NO.14):

[0219] GGACCAUCACAGUGACUGCAGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0220] When vWF-E29-T7-gU2 was used as the transcription template, gRNA-vWF-gU2 was obtained. gRNA-vWF-gU2 is a single-stranded RNA, as shown in SEQ ID NO: 15.

[0221] gRNA-vWF-gU2 (SEQ ID NO.15):

[0222] GGGACACCAUCACAGUGACUGCguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0223] When using vWF-E29-T7-gD1 as a transcription template, gRNA-vWF-gD1 was obtained. gRNA-vWF-gD1 is a single-stranded RNA, as shown in SEQ ID NO: 16.

[0224] gRNA-vWF-gD1 (SEQ ID NO.16):

[0225] GGGAACCGGUGCCCCCCACAGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0226] When vWF-E29-T7-gD2 was used as the transcription template, gRNA-vWF-gD2 was obtained. gRNA-vWF-gD2 is a single-stranded RNA, as shown in SEQ ID NO: 17.

[0227] gRNA-vWF-gD2 (SEQ ID NO.17):

[0228] GGGGUGCCCCCCACAGAAGGCCguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0229] IV. Comparison of editing efficiency for different target combinations

[0230] 1. Co-transfection

[0231] Group 1: Porcine primary fibroblasts were co-transfected with gRNA-vWF-gU1, gRNA-vWF-gD1, and NCN protein. The ratio was approximately 100,000 porcine primary fibroblasts: 1 μg gRNA-vWF-gU1 : 1 μg gRNA-vWF-gD1 : 4 μg NCN protein.

[0232] Group 2: porcine primary fibroblasts were co-transfected with gRNA-vWF-gU1, gRNA-vWF-gD2, and NCN protein. The ratio was approximately 100,000 porcine primary fibroblasts: 1 μg gRNA-vWF-gU1 : 1 μg gRNA-vWF-gD2 : 4 μg NCN protein.

[0233] Group 3: porcine primary fibroblasts were co-transfected with gRNA-vWF-gU2, gRNA-vWF-gD1, and NCN protein. The ratio was approximately 100,000 porcine primary fibroblasts: 1 μg gRNA-vWF-gU2 : 1 μg gRNA-vWF-gD1 : 4 μg NCN protein.

[0234] Group 4: Co-transfect porcine primary fibroblasts with gRNA-vWF-gU2, gRNA-vWF-gD2, and NCN protein. Ratio: Approximately 100,000 porcine primary fibroblasts: 1 μg gRNA-vWF-gU2 : 1 μg gRNA-vWF-gD2 : 4 μg NCN protein.

[0235] Group 5: Porcine primary fibroblasts were electroporated with the same electroporation parameters but without the addition of gRNA and NCN protein.

[0236] Co-transfection was performed using electroporation with a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3 pulses).

[0237] 2. After completing step 1, incubate in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total incubation time after electroporation is 48 hours.

[0238] 3. After completing step 2, cells were digested and collected using trypsin, lysed, and genomic DNA was extracted. PCR amplification was performed using primers consisting of vWF-E29-F200 and vWF-E29-R703, followed by 1% agarose gel electrophoresis. See the electrophoresis image below. Figure 7 .

[0239] After the target product was gel-extracted and recovered, it was sent to a sequencing company for sequencing. The sequencing results were then analyzed using the web-based Synthego ICE tool to determine the gene editing efficiency at different target sites. See the sequencing peak diagram below. Figure 8 The gene editing efficiencies of groups one through four were 82%, 51%, 84%, and 45%, respectively, while no gene editing occurred in group five. The results indicate that the combination of gRNA-vWF-gU2 and gRNA-vWF-gD1 exhibits higher editing efficiency.

[0240] Example 5: Preparation of a vWF gene knockout Congjiang Xiang pig single-cell clone

[0241] The highly efficient gRNA combination (gRNA-vWF-gU2 and gRNA-vWF-gD1 combination) screened in Example 4 was selected.

[0242] 1. Co-transfect porcine primary fibroblasts with gRNA-vWF-gU2, gRNA-vWF-gD1, and NCN protein. The ratio was approximately 100,000 porcine primary fibroblasts: 1 μg gRNA-vWF-gU2 : 1 μg gRNA-vWF-gD1 : 4 μg NCN protein. Co-transfection was performed using electroporation with a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3 pulses).

[0243] 2. After completing step 1, incubate in complete culture medium for 16-18 hours, then replace with fresh complete culture medium. The total incubation time after electroporation is 48 hours.

[0244] 3. After completing step 2, digest and collect cells with trypsin, wash with complete culture medium, resuspend in complete culture medium, and then pick each single clone and transfer it to a 96-well plate (1 cell per well, 100 μl of complete culture medium per well) and culture for 2 weeks (replace with fresh complete culture medium every 2-3 days).

[0245] 4. After completing step 3, digest the cells with trypsin and collect them (about 2 / 3 of the cells obtained from each well are seeded into a 6-well plate containing complete culture medium, and the remaining 1 / 3 are collected in a 1.5 mL centrifuge tube).

[0246] 5. Take the 6-well plate from step 4, culture until the cells reach 80% confluence, digest with trypsin and collect the cells, and freeze the cells using cell cryopreservation solution (90% complete culture medium + 10% DMSO, volume ratio).

[0247] 6. Take the centrifuge tube from step 4, collect the cells, lyse the cells and extract genomic DNA. Perform PCR amplification using primers vWF-E29-F200 and vWF-E29-R703, followed by electrophoresis. Use porcine primary fibroblasts as wild-type controls (WT).

[0248] 7. After completing step 6, recover the PCR amplification products and sequence them.

[0249] The sequencing results of primary porcine fibroblasts are singular, indicating a homozygous wild-type genotype. If a single-cell clone has two sequencing results, one consistent with the sequencing results of primary porcine fibroblasts and the other showing a mutation (including deletion, insertion, or substitution of one or more nucleotides), the genotype of this single-cell clone is heterozygous. If a single-cell clone has two sequencing results, both showing mutations (including deletion, insertion, or substitution of one or more nucleotides) compared to the sequencing results of primary porcine fibroblasts, the genotype of this single-cell clone is biallelic mutant. If a single-cell clone has one sequencing result and shows a mutation (including deletion, insertion, or substitution of one or more nucleotides) compared to the sequencing results of primary porcine fibroblasts, the genotype of this single-cell clone is biallelic mutant. If a single-cell clone has one sequencing result and is consistent with the sequencing results of primary porcine fibroblasts, the genotype of this single-cell clone is homozygous wild-type.

[0250] The results are shown in Table 1. The genotypes of single-cell clones numbered 10, 20, and 36 were homozygous wild-type. The genotypes of single-cell clones numbered 1, 4, 7, 11, 16, 18, 26, 30, 32, 38, and 43 were heterozygous. The genotypes of single-cell clones numbered 3, 5, 8, 12, 14, 17, 21, 23, 24, 25, 27, 28, 31, 33, 34, 35, 39, 40, 41, and 42 were biallelic mutants. The genotypes of single-cell clones numbered 2, 6, 9, 13, 15, 19, 22, 29, and 37 were biallelic mutants. The success rate of obtaining vWF gene-edited single-cell clones was 93%.

[0251] Example sequencing alignment results are as follows Figures 9 to 12 . Figure 9 The result is the result of the reverse sequencing of clone number 10 and the wild-type sequence, which indicates that it is homozygous wild-type. Figure 10 The result is the result of the reverse sequencing of clone number 7 and the comparison with the wild-type sequence, which indicates that it is heterozygous. Figure 11 The results are from the alignment of the forward and reverse sequencing of clone number 3 with the wild-type sequence, showing different mutant types of biallelic genes. Figure 12 The result is the result of reverse sequencing of clone number 2 and comparison with the wild-type sequence, which is a biallelic mutant.

[0252] Table 1. Genotyping results of vWF gene-edited single-cell clones

[0253]

[0254]

[0255]

[0256] The aforementioned heterozygous, biallelic mutant, and biallelic mutant monoclonal cells can all be used for subsequent cloned pig production. Using these cells as nuclear transfer donor cells for somatic cell cloning yields cloned pigs, specifically von Willebrand disease model pigs.

[0257] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims. sequence list <110> Nanjing Qizhen Gene Engineering Co., Ltd. <120> Gene editing system for constructing a porcine nuclear transfer donor cell model of von Willebrand disease with vWF gene mutation and its application <130> GNCYX212152 <160> 17 <170> SIPOSequenceListing 1.0 <210> 1 <211> 9974 <212> DNA <213> Artificial Sequence <400> 1 tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60 cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120 ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180 gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240 acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300 ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360 ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420 acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480 tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540 tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat 600 gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt 660 ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg 720 agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga 780 agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg 840 tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt 900 tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg 960 cagtgctgcc ataaccatga gtgataacac tgcggccaac ttacttctga caacgatcgg 1020 aggaccgaag gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga 1080 tcgttgggaa ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc 1140 tgcagcaatg gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc 1200 ccggcaacaa ttaatagact ggatggaggc ggataagtt gcaggaccac ttctgcgctc ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg cggtatcatt gcagcactgg ggccagatgg tagccctcc cgtatcgtag ttatctacac 1380 gacggggagt caggcaacta tggatgaacg aatagacag atcgctgaga taggtgcctc actgattaag cattggtaac tgtcagacca agtttactca fathercttt agttgattt aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac caaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 1680 accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 1740. aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga 1980 gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct 2040 tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 2100 cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca 2160 cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa 2220 cgccagcaac gcggccttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 2280 ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 2340 taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 2400 gcgcctgatg cggtattttc tccttacgca tctgtgcggt atttcacacc catatatgg 2460 tgcactctca gtacaatctg ctctgatgcc ccatagttaa gccagtatac actccgctat 2520 cgctacgtga ctgggtcatg gctgcgcccc gacacccgcc aacacccgct gacgcgccct 2580 gacgggcttg tctgctcccg gcatccgctt acagacaagc tgtgaccgtc tccgggagct 2640 gcatgtgtca gaggttttca ccgtcatcac cgaaacgcgc gaggcagctg cggtaaagct 2700 catcagcgtg gtcgtgaagc gattcacaga tgtctgcctg ttcatccgcg tccagctcgt 2760 tgagtttctc cagaagcgtt aatgtctggc ttctgataaa gcgggccatg ttaagggcgg 2820 ttttttcctg tttggtcact gatgcctccg tgtaaggggg atttctgttc atgggggtaa 2880 tgataccgat gaaacgagag aggatgctca cgatacgggt tactgatgat gaacatgccc 2940 ggttactgga acgttgtgag ggtaaacaac tggcggtatg gatgcggcgg gaccagagaa 3000 aaatcactca gggtcaatgc cagcgcttcg ttaatacaga tgtaggtgtt ccacagggta 3060 gccagcagca tcctgcgatg cagatccgga acataatggt gcagggcgct gacttccgcg 3120 tttccagact ttacgaaaca cggaaaccga agaccattca tgttgttgct caggtcgcag 3180 acgttttgca gcagcagtcg cttcacgttc gctcgcgtat cggtgattca ttctgctaac 3240 cagtaaggca accccgccag cctagccggg tcctcaacga caggagcacg atcatgcgca 3300 cccgtggggc cgccatgccg gcgataatgg cctgcttctc gccgaaacgt ttggtggcgg 3360 gaccagtgac gaaggcttga gcgagggcgt gcaagattcc gaataccgca agcgacaggc 3420 cgatcatcgt cgcgctccag cgaaagcggt cctcgccgaa aatgacccag agcgctgccg 3480 gcacctgtcc tacgagttgc atgataaaga agacagtcat aagtgcggcg acgatagtca 3540 tgccccgcgc ccaccggaag gagctgactg ggttgaaggc tctcaagggc atcggtcgag 3600 atcccggtgc ctaatgagtg agctaactta cattaattgc gttgcgctca ctgcccgctt 3660 tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag 3720 gcggtttgcg tattgggcgc cagggtggtt tttcttttca ccagtgagac gggcaacagc 3780 tgattgccct tcaccgcctg gccctgagag agttgcagca agcggtccac gctggtttgc 3840 cccagcaggc gaaaatcctg tttgatggtg gttaacggcg ggatataaca tgagctgtct 3900 tcggtatcgt cgtatcccac taccgagatg tccgcaccaa cgcgcagccc ggactcggta 3960 atggcgcgca ttgcgcccag cgccatctga tcgttggcaa ccagcatcgc agtgggaacg 4020 atgccctcat tcagcatttg catggtttgt tgaaaaccgg acatggcact ccagtcgcct 4080 tcccgttccg ctatcggctg aatttgattg cgagtgagat atttatgcca gccagccaga 4140 cgcagacgcg ccgagacaga acttaatggg cccgctaaca gcgcgatttg ctggtgaccc 4200 aatgcgacca gatgctccac gcccagtcgc gtaccgtctt catgggagaa aataatactg 4260 ttgatgggtg tctggtcaga gacatcaaga aataacgccg gaacattagt gcaggcagct 4320 tccacagcaa tggcatcctg gtcatccagc ggatagttaa tgatcagccc actgacgcgt 4380 tgcgcgagaa gattgtgcac cgccgcttta caggcttcga cgccgcttcg ttctaccatc 4440 gacaccacca cgctggcacc cagttgatcg gcgcgagatt taatcgccgc gacaatttgc 4500 gacggcgcgt gcagggccag actggaggtg gcaacgccaa tcagcaacga ctgtttgccc 4560 gccagttgtt gtgccacgcg gttgggaatg taattcagct ccgccatcgc cgcttccact 4620 ttttcccgcg ttttcgcaga aacgtggctg gcctggttca ccacgcggga aacggtctga 4680 taagagacac cggcatactc tgcgacatcg tataacgtta ctggtttcac attcaccacc 4740 ctgaattgac tctcttccgg gcgctatcat gccataccgc gaaaggtttt gcgccattcg 4800 atggtgtccg ggatctcgac gctctccctt atgcgactcc tgcattagga agcagcccag 4860 tagtagttg aggccgttga gcaccgccgc cgcaaggaat ggtgcatgca aggagatggc 4920 gcccaacagt cccccggcca cggggcctgc caccataccc acgccgaaac aagcgctcat 4980. gagcccgaag tggcgagccc gatcttcccc atcggtgatg tcggcgatat aggcgccagc 5040. aaccgcacct gtggcgccgg tgatgccggc cacgatgcgt ccggcgtaga ggatcgagat 5100 cgatctcgat cccgcgaat fathercgact cactataggg gaattgtgag cggataacaa ttcccctcta gaataattt tgtttaactt taagaaggag atatacatat gaaacaaagc actattgcac tggcactctt accgttactg tttacccctg tgacaaaagc catgagcgat aaaattattc acctgactga cgacagtttt gacacggatg tactcaaagc ggacggggcg atcctcgtcg atttctgggc agagtggtgc ggtccgtgca aaatgatcgc cccgattctg 5400. gatgaaatcg ctgacgaata tcagggcaaa ctgaccgttg caaaactgaa catcgatcaa aaccctggca ctgcgccgaa atatggcatc cgtggtatcc cgactctgct gctgttcaaa aacggtgaag tggcggcaac caaagtgggt gcactgtcta aaggtcagtt gaaagagttc 5580 ctcgacgcta acctggccgg ttctggttct ggccatatgc accatcatca tcatcatgac 5640 gatgacgata agatgcccaa aaagaaacga aaggtgggta tccacggagt cccagcagcc 5700 gacaaaaaat atagcatcgg cctggacatc ggtaccaaca gcgttggctg ggcagtgatc 5760 actgatgaat acaaagttcc atccaaaaaa tttaaagtac tgggcaacac cgaccgtcac 5820 tctatcaaaa aaaacctgat tggtgctctg ctgtttgaca gcggcgaaac tgctgaggct 5880 acccgtctga aacgtacggc tcgccgtcgc tacactcgtc gtaaaaaccg catctgttat 5940 ctgcaggaaa ttttctctaa cgaaatggca aaagttgatg atagcttctt tcatcgtctg 6000 gaagagagct tcctggtgga agaagataaa aaacacgaac gtcacccgat tttcggtaac 6060 attgtggatg aggttgccta ccacgagaaa tatccgacca tctaccatct gcgtaaaaaa 6120 ctggttgata gcactgacaa agcggatctg cgtctgatct acctggctct ggcacacatg 6180 atcaaattcc gtggtcactt cctgatcgaa ggtgatctga accctgataa ctccgacgtg 6240 gacaaactgt tcattcagct ggttcagacc tataaccagc tgttcgaaga aaacccgatc 6300 aacgcgtccg gtgtagacgc taaggcaatt ctgtctgcgc gtctgtctaa gtctcgtcgt 6360 ctggaaaacc tgattgcgca actgccaggt gaaaagaaaa acggcctgtt cggcaatctg 6420 atcgccctgt ccctgggtct gactccgaac tttaaatcca actttgacct ggcggaagat 6480 gccaagctgc agctgagcaa agatacctat gacgatgacc tggataacct gctggcacag 6540 atcggtgatc agtatgccga tctgttcctg gccgcgaaaa acctgtctga tgcgattctg 6600 ctgtctgata tcctgcgcgt taacactgaa attactaaag cgccgctgag cgcatccatg 6660 attaaacgtt acgatgaaca ccaccaggat ctgaccctgc tgaaagcgct ggtgcgtcag 6720 cagctgccgg aaaaatacaa ggagatcttc ttcgaccaga gcaaaaacgg ttacgcgggc 6780 tacattgatg gtggtgcatc tcaggaggaa ttctacaaat tcattaaacc gatcctggaa 6840 aaaatggatg gtactgaaga gctgctggtt aaactgaatc gtgaagatct gctgcgcaaa 6900 cagcgtacct tcgataacgg ttccatcccg catcagattc atctgggcga actgcacgct 6960 atcctgcgcc gtcaggaaga cttttatccg ttcctgaaag acaaccgtga gaaaattgaa 7020 aaaatcctga ccttccgtat tccgtactat gtaggtccgc tggcgcgtgg taactcccgt 7080 ttcgcttgga tgacccgcaa aagcgaagaa accatcaccc cgtggaattt cgaagaagtc 7140 gttgacaaag gcgcgtccgc gcagtctttc atcgaacgca tgacgaactt cgacaaaaac 7200 ctgccgaacg agaaagtgct gccgaaacac tctctgctgt acgagtactt cactgtgtac 7260 aacgaactga ccaaagtgaa atacgtcacc gaaggtatgc gtaaaccggc attcctgtcc 7320 ggtgagcaaa aaaaagcaat cgtggatctg ctgttcaaaa ccaaccgtaa agtaaccgtg 7380 aaacagctga aggaagacta tttcaagaaa atcgaatgtt ttgattctgt tgaaatctcc 7440 ggcgtggaag atcgcttcaa tgcgtccctg ggtacgtatc acgacctgct gaaaattatc 7500 aaagacaaag attttctgga caacgaggaa aacgaagaca tcctggagga tattgtactg 7560 accctgaccc tgttcgaaga ccgtgagatg atcgaagaac gcctgaaaac ctacgcccac 7620 ctgttcgatg acaaggtaat gaagcagctg aaacgtcgtc gttataccgg ctggggtcgt 7680 ctgtcccgta aactgatcaa tggcatccgt gataaacagt ctggcaaaac catcctggac 7740 ttcctgaaat ccgacggttt cgcgaatcgt aacttcatgc aactgattca tgacgattct 7800 ctgactttca aagaagacat ccagaaagca caggtttccg gccagggtga ctctctgcac 7860 gagcacattg ccaatctggc tggttctccg gctattaaaa agggtattct gcagactgtg 7920 aaagtagttg atgagctggt caaagtaatg ggccgtcaca agccggaaaa cattgtgatc 7980 gaaatggcac gtgaaaacca gacgacccag aaaggtcaga aaaactctcg tgaacgcatg 8040 aaacgtatcg aagaaggcat caaagaactg ggctctcaga tcctgaagga acaccctgta 8100 gaaaataccc agctgcagaa cgaaaagctg tatctgtatt acctgcagaa cggccgcgat 8160 atgtatgtgg accaggaact ggatatcaac cgcctgtccg attacgatgt agatcacatc 8220 gtgccgcaaa gcttcctgaa agacgacagc attgacaaca aagtactgac ccgttctgat 8280 aagaaccgtg gcaaatccga taacgtcccg tctgaagaag ttgttaaaaa aatgaaaaac 8340 tattggcgtc agctgctgaa cgcgaaactg atcacccagc gtaagttcga caatctgact 8400 aaagctgagc gcggtggtct gtccgaactg gataaagcgg gttttatcaa acgccagctg 8460 gttgaaaccc gtcagatcac gaagcacgtt gcgcagattc tggactctcg tatgaacacc 8520 aaatacgacg aaaacgacaa actgatccgc gaggttaagg ttatcaccct gaaaagcaaa 8580 ctggtatccg attttcgtaa agactttcag ttctacaaag tgcgcgaaat taacaactat 8640 caccacgctc acgatgcata tctgaatgca gttgttggca cggcgctgat caaaaagtat 8700 ccgaaactgg aatctgaatt cgtatacggc gattacaaag tgtatgacgt tcgtaagatg 8760 atcgcaaaat ccgagcagga aattggtaag gcgacggcga aatacttctt ttattccaat 8820 attatgaact ttttcaaaac cgaaatcacc ctggcgaatg gtgaaattcg taaacgcccg 8880 ctgatcgaaa ccaacggtga aactggtgaa atcgtttggg acaaaggccg cgacttcgcg 8940 accgtgcgta aagttctgtc tatgccgcaa gtgaacatcg tcaagaagac cgaagtacaa 9000 accggcggtt ttagcaaaga gagcattctg ccaaaacgta actccgacaa actgatcgcg 9060 cgcaagaaag actgggatcc gaaaaaatac ggtggtttcg attctccaac cgttgcttat 9120 tccgttctgg tggtagccaa agttgagaaa ggtaaaagca aaaaactgaa atccgtaaag 9180 gaactgctgg gtattactat catggagcgt agctccttcg aaaaaaaccc gatcgatttt 9240 ctggaagcga aaggctataa agaagtcaaa aaggacctga tcatcaaact gccaaaatac 9300 agcctgttcg agctggaaaa cggccgtaaa cgtatgctgg catctgcggg cgaactgcag 9360 aaaggcaacg agctggctct gccgtccaaa tacgtgaact ttctgtacct ggcctctcac 9420 tacgaaaaac tgaaaggttc cccggaagac aacgaacaga aacagctgtt cgtagagcag 9480 cacaaacact acctggacga gatcatcgaa cagatttctg aattttctaa acgtgtgatt 9540 ctggctgatg cgaatctgga taaagttctg tctgcctata acaagcatcg tgacaaaccg 9600 atccgcgaac aggctgagaa catcatccac ctgttcactc tgactaacct gggcgcgcca 9660 gcggctttca agtactttga taccaccatt gaccgcaagc gttacacctc cactaaagaa 9720 gtgctggacg cgactctgat ccaccagtcc atcaccggtc tgtacgagac ccgtatcgat 9780 ctgagccagc tgggcggtga caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa 9840 aagaaaaagt gacaaagccc gaaaggaagc tgagttggct gctgccaccg ctgagcaata 9900 actagcataa ccccttgggg cctctaaacg ggtcttgagg ggttttttgc tgaaaggagg 9960 aactatatcc ggat 9974 <210> 2 <211> 1547 <212> PRT <213> Artificial Sequence <400> 2 Met Lys Gln Ser Thr Ile Ala Leu Ala Leu Leu Pro Leu Leu Phe Thr 1 5 10 15 Pro Val Thr Lys Ala Met Ser Asp Lys Ile Ile His Leu Thr Asp Asp 20 25 30 Ser Phe Asp Thr Asp Val Leu Lys Ala Asp Gly Ala Ile Leu Val Asp 35 40 45 Phe Trp Ala Glu Trp Cys Gly Pro Cys Lys Met Ile Ala Pro Ile Leu 50 55 60 Asp Glu Ile Ala Asp Glu Tyr Gln Gly Lys Leu Thr Val Ala Lys Leu 65 70 75 80 Asn Ile Asp Gln Asn Pro Gly Thr Ala Pro Lys Tyr Gly Ile Arg Gly 85 90 95 Ile Pro Thr Leu Leu Leu Phe Lys Asn Gly Glu Val Ala Ala Thr Lys 100 105 110 Val Gly Ala Leu Ser Lys Gly Gln Leu Lys Glu Phe Leu Asp Ala Asn 115 120 125 Leu Ala Gly Ser Gly Ser Gly His Met His His His His His His Asp 130 135 140 Asp Asp Asp Lys Met Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly 145 150 155 160 Val Pro Ala Ala Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr 165 170 175 Asn Ser Val Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser 180 185 190 Lys Lys Phe Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys 195 200 205 Asn Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala 210 215 220 Thr Arg Leu Lys Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn 225 230 235 240 Arg Ile Cys Tyr Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val 245 250 255 Asp Asp Ser Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu 260 265 270 Asp Lys Lys His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu 275 280 285 Val Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys 290 295 300 Leu Val Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala 305 310 315 320 Leu Ala His Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp 325 330 335 Leu Asn Pro Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val 340 345 350 Gln Thr Tyr Asn Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly 355 360 365 Val Asp Ala Lys Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg 370 375 380 Leu Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu 385 390 395 400 Phe Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys 405 410 415 Ser Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp 420 425 430 Thr Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln 435 440 445 Tyr Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu 450 455 460 Leu Ser Asp Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu 465 470 475 480 Ser Ala Ser Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr 485 490 495 Leu Leu Lys Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu 500 505 510 Ile Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly 515 520 525 Gly Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu 530 535 540 Lys Met Asp Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp 545 550 555 560 Leu Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln 565 570 575 Ile His Leu Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe 580 585 590 Tyr Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr 595 600 605 Phe Arg Ile Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg 610 615 620 Phe Ala Trp Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn 625 630 635 640 Phe Glu Glu Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu 645 650 655 Arg Met Thr Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro 660 665 670 Lys His Ser Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr 675 680 685 Lys Val Lys Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser 690 695 700 Gly Glu Gln Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg 705 710 715 720 Lys Val Thr Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu 725 730 735 Cys Phe Asp Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala 740 745 750 Ser Leu Gly Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp 755 760 765 Phe Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu 770 775 780 Thr Leu Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys 785 790 795 800 Thr Tyr Ala His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg 805 810 815 Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly 820 825 830 Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser 835 840 845 Asp Gly Phe Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser 850 855 860 Leu Thr Phe Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly 865 870 875 880 Asp Ser Leu His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile 885 890 895 Lys Lys Gly Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys 900 905 910 Val Met Gly Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg 915 920 925 Glu Asn Gln Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met 930 935 940 Lys Arg Ile Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys 945 950 955 960 Glu His Pro Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu 965 970 975 Tyr Tyr Leu Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp 980 985 990 Ile Asn Arg Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser 995 1000 1005 Phe Leu Lys Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp 1010 1015 1020 Lys Asn Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys 1025 1030 1035 1040 Lys Met Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr 1045 1050 1055 Gln Arg Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser 1060 1065 1070 Glu Leu Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg 1075 1080 1085 Gln Ile Thr Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr 1090 1095 1100 Lys Tyr Asp Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr 1105 1110 1115 1120 Leu Lys Ser Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr 1125 1130 1135 Lys Val Arg Glu Ile Asn Asn Tyr His Ala His Asp Ala Tyr Leu 1140 1145 1150 Asn Ala Val Val Gly Thr Ala Leu Ile Lys Tyr Pro Lys Leu Glu 1155 1160 1165 Ser Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met 1170 1175 1180 Ile Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe 1185 1190 1195 1200 Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala 1205 1210 1215 Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr 1220 1225 1230 Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys 1235 1240 1245 Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln 1250 1255 1260 Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp 1265 1270 1275 1280 Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly 1285 1290 1295 Phe Asp Ser Pro Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val 1300 1305 1310 Glu Lys Gly Lys Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly 1315 1320 1325 Ile Thr Ile Met Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe 1330 1335 1340 Leu Glu Ala Lys Gly Tyr Glu Val Lys Asp Leu Ile Ile Lys 1345 1350 1355 1360 Leu Pro Lys Tyr Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met 1365 1370 1375 Leu Ala Ser Ala Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro 1380 1385 1390 Lys Tyr Val Is His Tyr Glu Lys Leu 1395 1400 1405 Lys Gly Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln 1410 1415 1420 His Lys His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser 1425 1430 1435 1440 Lys Arg Is The Asp Is The Asn Is The Asp Lys Is The Best 1445 1450 1455 Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile 1460 1465 1470 Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys 1475 1480 1485 Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Thr Thr Lys Glu 1490 1495 1500 Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu 1505 1510 1515 1520 Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala 1525 1530 1535 Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys 1540 1545 <210> 3 <211> 1399 <212> PRT <213> Artificial Sequence <400> 3 Met Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala Ala 1 5 10 15 Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser Val Gly 20 25 30 Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe Lys 35 40 45 Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile Gly 50 55 60 Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu Lys 65 70 75 80 Thr Wire Only Thr Wire Wire Tyr Wire Thr Wire Lys Asn Wire With Cys Tyr 85 90 95 Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Ser Phe 100 105 110 Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys His 115 120 125 Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr His 130 135 140 Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp Ser 145 150 155 160 Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His Met 165 170 175 Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro Asp 180 185 190 Asn Serves Asp Val Asp Lys Lew Phe Ile Gln Leu Val Gln Thr Tyr Asn 195 200 205 Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala Lys 210 215 220 Ala Ile Leu Ser Ala Arg Leu Ser Ala Arg Leu Glu Asn Leu 225 230 235 240 Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn Leu 245 250 255 Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe Asp 260 265 270 Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp Asp 275 280 285 Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp Leu 290 295 300 Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp Ile 305 310 315 320 Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser Met 325 330 335 Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys Ala 340 345 350 Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe Asp 355 360 365 Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser Gln 370 375 380 Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp Gly 385 390 395 400 Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg Lys 405 410 415 Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu Gly 420 425 430 Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe Leu 435 440 445 Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile Pro 450 455 460 Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp Met 465 470 475 480 Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu Val 485 490 495 Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn 500 505 510 Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser Leu 515 520 525 Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr 530 535 540 Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys 545 550 555 560 Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val 565 570 575 Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp Ser 580 585 590 Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly Thr 595 600 605 Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp Asn 610 615 620 Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr Leu 625 630 635 640 Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala His 645 650 655 Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr Thr 660 665 670 Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp Lys 675 680 685 Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe Ala 690 695 700 Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe Lys 705 710 715 720 Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu His 725 730 735 Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly Ile 740 745 750 Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly Arg 755 760 765 His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln Thr 770 775 780 Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile Glu 785 790 795 800 Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro Val 805 810 815 Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu Gln 820 825 830 Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg Leu 835 840 845 Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu Lys Asp 850 855 860 Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg Gly 865 870 875 880 Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys Asn 885 890 895 Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys Phe 900 905 910 Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp Lys 915 920 925 Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr Lys 930 935 940 His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp Glu 945 950 955 960 Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser Lys 965 970 975 Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg Glu 980 985 990 Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val Val 995 1000 1005 Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe Val 1010 1015 1020 Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys Ser 1025 1030 1035 1040 Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr Ser Asn 1045 1050 1055 Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala Asn Gly Glu Ile 1060 1065 1070 Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr Gly Glu Ile Val 1075 1080 1085 Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys Val Leu Ser Met 1090 1095 1100 Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln Thr Gly Gly Phe 1105 1110 1115 1120 Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala 1125 1130 1135 Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro 1140 1145 1150 Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val Glu Lys Gly Lys 1155 1160 1165 Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met 1170 1175 1180 Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys 1185 1190 1195 1200 Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr 1205 1210 1215 Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala 1220 1225 1230 Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val 1235 1240 1245 Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser Pro 1250 1255 1260 Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys His Tyr 1265 1270 1275 1280 Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg Val Ile 1285 1290 1295 Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala Tyr Asn Lys His 1300 1305 1310 Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile Ile His Leu Phe 1315 1320 1325 Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys Tyr Phe Asp Thr 1330 1335 1340 Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu Val Leu Asp Ala 1345 1350 1355 1360 Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu Thr Arg Ile Asp 1365 1370 1375 Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala Thr Lys Lys Ala 1380 1385 1390 Gly Gln Ala Lys Lys Lys Lys 1395 <210> 4 <211> 225 <212> DNA <213> Artificial Sequence <400> 4 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggagagc acagtcagcc tggcggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 5 <211> 225 <212> DNA <213> Artificial Sequence <400> 5 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggcttcc agaattggat ctccggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 6 <211> 102 <212> RNA <213> Artificial Sequence <400> 6 ggagagcaca gucagccugg cgguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 7 <211> 102 <212> RNA <213> Artificial Sequence <400> 7 ggcuuccaga auuggaucuc cgguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 8 <211> 2807 <212> PRT <213> Sus scrofa <400> 8 Met Val Pro Val Arg Leu Ala Arg Val Leu Leu Ala Leu Ala Leu Thr 1 5 10 15 Leu Pro Gly Ala Leu Cys Gly Glu Glu Thr Leu Gly Lys Ser Ser Met 20 25 30 Ala Arg Cys Ser Leu Phe Gly Ser Asn Phe Ile Asn Thr Phe Asp Gln 35 40 45 Ser Met Tyr Ser Phe Ala Gly Ser Cys Ser Tyr Leu Leu Ala Gly Asp 50 55 60 Cys Gln Lys His Ser Phe Ser Ile Ile Gly Asp Phe Gln Asp Gly Lys 65 70 75 80 Arg Val Gly Leu Ser Val Tyr Leu Gly Glu Phe Phe Asp Ile His Val 85 90 95 Phe Val Asn Gly Thr Val Leu Gln Gly Asp Gln Ser Ile Ser Thr Pro 100 105 110 Tyr Ala Ser Lys Gly Leu Tyr Leu Glu Ser Gln Ala Gly Tyr His Thr 115 120 125 Leu Ser Ser Glu Ala Tyr Gly Phe Val Ala Arg Ile Asp Gly Ser Gly 130 135 140 Asn Phe Gln Val Leu Leu Ser Asp Arg Tyr Phe Asn Lys Thr Cys Gly 145 150 155 160 Leu Cys Gly Asp Phe Asn Ile Phe Ser Glu Asp Asp Phe Lys Thr Gln 165 170 175 Glu Gly Thr Leu Thr Ser Asp Pro Tyr Ser Phe Ala Asn Ser Trp Ala 180 185 190 Leu Ser Ser Gly Glu Gln His Cys Gln Arg Ala Ala Pro Pro Ser Ile 195 200 205 Ser Cys Asn Ile Ser Ser Glu Met Gln Lys Gly Leu Trp Glu Gln Cys 210 215 220 Gln Leu Leu Lys Ser Ala Ser Val Phe Ala Arg Cys His Pro Leu Val 225 230 235 240 Asp Pro Glu Pro Phe Val Ala Leu Cys Glu Lys Met Leu Cys Pro Cys 245 250 255 Ala Gln Gly Leu Gln Cys Pro Cys Pro Ala Leu Leu Glu Tyr Ala Arg 260 265 270 Ala Cys Ala Gln Gln Gly Met Leu Leu Tyr Gly Trp Met Asp His Ser 275 280 285 Leu Cys Arg Pro Asp Cys Pro Ala Gly Met Glu Tyr Arg Glu Cys Val 290 295 300 Ser Pro Cys Thr Arg Thr Cys Gln Ser Leu His Ile Asn Glu Val Cys 305 310 315 320 Gln Glu Gln Cys Val Asp Gly Cys Ser Cys Pro Glu Gly Gln Leu Leu 325 330 335 Asp Asp Gly Arg Cys Val Glu Ser Ala Glu Cys Ser Cys Val His Ser 340 345 350 Gly Lys Arg Tyr Pro Pro Gly Ala Ser Leu Ser Arg Asp Cys Asn Thr 355 360 365 Cys Ile Cys Arg Asn Ser Leu Trp Val Cys Ser Asn Glu Asp Cys Pro 370 375 380 Gly Glu Cys Leu Val Thr Gly Gln Ser His Phe Lys Ser Phe Asp Asn 385 390 395 400 Arg His Phe Thr Phe Ser Gly Val Cys Gln Tyr Leu Leu Ala Arg Asp 405 410 415 Cys Gln Asp His Thr Phe Ser Val Ile Ile Glu Thr Val Gln Cys Ala 420 425 430 Asp Asp Pro Asp Ala Val Cys Thr Arg Ser Val Thr Val Arg Leu Pro 435 440 445 Ser Pro His Asn Ser Leu Val Lys Leu Lys His Gly Gly Gly Val Ala 450 455 460 Met Asp Gly Trp Asp Val Gln Ile Pro Phe Leu Gln Gly Asp Leu Arg 465 470 475 480 Ile Gln His Thr Val Met Ala Ser Val His Leu Ser Tyr Gly Glu Asp 485 490 495 Leu Gln Ile Asp Trp Asp Gly Arg Gly Arg Leu Leu Val Lys Leu Ser 500 505 510 Pro Val Tyr Ala Gly Arg Thr Cys Gly Leu Cys Gly Asn Tyr Asn Gly 515 520 525 Asn Gln Gly Asp Asp Phe Leu Thr Pro Ala Gly Leu Val Glu Pro Leu 530 535 540 Val Glu His Phe Gly Asn Ala Trp Lys Leu His Gly Asp Cys Glu Asp 545 550 555 560 Leu Arg Lys Gln Pro Thr Asp Pro Cys Ser Phe Asn Pro Arg Leu Thr 565 570 575 Arg Phe Ala Glu Glu Ala Cys Ala Ile Leu Thr Ser Pro Lys Phe Gln 580 585 590 Ala Cys His Asp Ala Val Gly Pro Leu Pro Tyr Leu Gln Asn Cys His 595 600 605 Tyr Asp Val Cys Ser Cys Ser Asp Gly Arg Asp Cys Leu Cys Asp Ala 610 615 620 Val Ala Thr Tyr Ala Ala Ala Cys Ala Arg Arg Gly Val His Ile Gly 625 630 635 640 Trp Arg Glu Pro Gly Phe Cys Ala Leu Ser Cys Pro Pro Gly Gln Val 645 650 655 Tyr Leu Gln Cys Gly Thr Pro Cys Asn Leu Thr Cys Arg Ser Leu Ser 660 665 670 Tyr Pro Asp Glu Glu Cys Ala Glu Asp Cys Leu Glu Gly Cys Phe Cys 675 680 685 Pro Pro Gly Leu Tyr Leu Asp Gly Ser Gly Asp Cys Val Pro Lys Ala 690 695 700 Gln Cys Pro Cys Tyr His Asp Gly Glu Ile Phe Gln Pro Glu Asp Ile 705 710 715 720 Phe Ser Asp His His Thr Met Cys Tyr Cys Glu Asp Gly Phe Met His 725 730 735 Cys Ser Arg Ala Gly Ala Pro Gly Ser Leu Gln Pro Glu Val Val Leu 740 745 750 Ser Ser Pro Leu Ser His Arg Ser Lys Arg Ser Leu Ser Cys Arg Pro 755 760 765 Pro Met Val Lys Leu Val Cys Pro Ala Asp Asn Pro Arg Ala Glu Gly 770 775 780 Leu Glu Cys Ala Lys Thr Cys Gln Asn Tyr Asp Leu Glu Cys Val Ser 785 790 795 800 Thr Gly Cys Val Ser Gly Cys Leu Cys Pro Pro Gly Met Val Arg His 805 810 815 Glu Asn Arg Cys Val Ala Leu Gln Arg Cys Pro Cys Phe His Gln Gly 820 825 830 Arg Glu Tyr Ala Pro Gly Glu Thr Val Lys Val Asp Cys Asn Thr Cys 835 840 845 Val Cys Arg Asp Arg Lys Trp Ser Cys Thr Asp His Val Cys Asp Ala 850 855 860 Ser Cys Ser Ala Leu Gly Leu Ala His Tyr Leu Thr Phe Asp Gly Leu 865 870 875 880 Lys Tyr Leu Phe Pro Gly Glu Cys Gln Tyr Val Leu Val Gln Asp Tyr 885 890 895 Cys Gly Ser Asn Pro Gly Thr Phe Arg Ile Leu Leu Gly Asn Glu Gly 900 905 910 Cys Gly Tyr Pro Ser Leu Lys Cys Arg Lys Arg Val Thr Ile Leu Val 915 920 925 Asp Gly Gly Glu Ile Glu Leu Phe Asp Gly Glu Val Met Val Lys Lys 930 935 940 Pro Leu Lys Asp Glu Thr His Phe Glu Val Val Glu Ser Gly Arg Phe 945 950 955 960 Ile Thr Val Leu Leu Gly Ser Gly Leu Ser Val Val Trp Asp Arg His 965 970 975 Leu Gly Ile Ser Val Phe Leu Lys Gln Thr Tyr Gln Glu Gln Val Cys 980 985 990 Gly Leu Cys Gly Asn Phe Asp Gly Val Gln Asn Asn Asp Leu Thr Gly 995 1000 1005 Ser Ser Leu Gln Val Glu Glu Asp Pro Val Asp Phe Gly Asn Ser Trp 1010 1015 1020 Lys Val Ser Pro Gln Cys Ala Asp Thr Arg Lys Val Pro Leu Asp Thr 1025 1030 1035 1040 Ser Pro Ala Thr Cys His Asn Asn Val Met Lys Gln Thr Met Val Asp 1045 1050 1055 Ser Ser Cys Arg Ile Leu Thr Ser Asp Ile Phe Gln Asp Cys Asn Lys 1060 1065 1070 Leu Val Asp Pro Glu Pro Tyr Leu Asp Val Cys Ile Tyr Asp Thr Cys 1075 1080 1085 Ser Cys Glu Ser Ile Gly Asp Cys Ala Cys Phe Cys Asp Thr Ile Ala 1090 1095 1100 Ala Tyr Ala Arg Val Cys Ala Gln His Gly Lys Val Val Thr Trp Arg 1105 1110 1115 1120 Thr Ala Thr Leu Cys Pro Gln Asn Cys Glu Glu Arg Asn Leu Arg Glu 1125 1130 1135 Asp Gly Tyr Gln Cys Glu Trp Arg Tyr Asn Ser Cys Ala Pro Ala Cys 1140 1145 1150 Pro Val Thr Cys Gln His Pro Glu Pro Leu Ala Cys Pro Val Ser Cys 1155 1160 1165 Val Glu Gly Cys His Ala His Cys Pro Pro Gly Lys Ile Leu Asp Glu 1170 1175 1180 Leu Leu Gln Thr Cys Val Ser Pro Glu Asp Cys Pro Val Cys Glu Ala 1185 1190 1195 1200 Ala Gly Arg Arg Leu Ala Pro Gly Lys Lys Ile Ile Leu Asn Pro Arg 1205 1210 1215 Asp Pro Ala His Cys Gln Ile Cys His Cys Asp Gly Val Asn Leu Thr 1220 1225 1230 Cys Glu Ala Cys Ala Glu Pro Val Pro Pro Thr Glu Gly Pro Val Ser 1235 1240 1245 Pro Thr Thr Pro Tyr Glu Glu Asp Thr Pro Glu Pro Pro Leu His Asp 1250 1255 1260 Phe Phe Cys Ser Lys Leu Leu Asp Leu Val Phe Leu Leu Asp Gly Ser 1265 1270 1275 1280 Asp Lys Leu Ser Glu Ala Asp Phe Glu Ala Leu Lys Val Phe Val Val 1285 1290 1295 Gly Met Met Glu His Leu His Ile Ser Gln Lys His Ile Arg Val Ala 1300 1305 1310 Val Val Glu Tyr His Asp Gly Ser His Ala Tyr Ile Ser Leu Gln Asp 1315 1320 1325 Arg Lys Arg Pro Ser Glu Leu Arg Arg Ile Ala Ser Gln Val Lys Tyr 1330 1335 1340 Ala Gly Ser Glu Val Ala Ser Ile Ser Glu Val Leu Lys Tyr Thr Leu 1345 1350 1355 1360 Phe Gln Ile Phe Gly Arg Val Asp Arg Pro Glu Ala Ser Arg Ile Ala 1365 1370 1375 Leu Leu Leu Met Ala Ser Gln Glu Pro Arg Arg Leu Ala Gln Asn Leu 1380 1385 1390 Ala Arg Tyr Leu Gln Gly Leu Lys Lys Lys Lys Val Thr Val Ile Pro 1395 1400 1405 Val Gly Ile Gly Pro His Val Ser Leu Lys Gln Ile Arg Leu Ile Glu 1410 1415 1420 Lys Gln Ala Pro Glu Asn Lys Ala Phe Val Val Ser Gly Val Asp Glu 1425 1430 1435 1440 Leu Glu Gln Arg Lys Asn Glu Ile Ile Ser Tyr Leu Cys Asp Leu Ala 1445 1450 1455 Pro Glu Val Pro Ala Pro Thr Arg Arg Pro Leu Val Ala Gln Val Thr 1460 1465 1470 Val Ala Pro Glu Leu Pro Gly Val Ser Thr Leu Glu Pro Lys Lys Arg 1475 1480 1485 Met Val Leu Asp Val Val Phe Val Leu Glu Gly Ser Asp Lys Val Gly 1490 1495 1500 Glu Ala Asn Phe Asn Arg Ser Thr Glu Phe Val Glu Glu Val Ile Arg 1505 1510 1515 1520 Arg Met Asp Val Gly Arg Asp Ser Val His Val Thr Val Leu Gln Tyr 1525 1530 1535 Ser Tyr Val Val Ala Val Glu His Ser Phe Arg Glu Ala Gln Ser Lys 1540 1545 1550 Gly Glu Val Leu Gln Arg Val Arg Glu Ile Arg Phe Gln Gly Gly Asn 1555 1560 1565 Arg Thr Asn Thr Gly Leu Ala Leu Gln Tyr Leu Ser Glu His Ser Phe 1570 1575 1580 Ser Ala Ser Gln Gly Asp Arg Glu Glu Ala Pro Asn Leu Val Tyr Met 1585 1590 1595 1600 Val Thr Gly Asn Pro Ala Ser Asp Glu Ile Lys Arg Met Pro Gly Asp 1605 1610 1615 Ile Gln Val Val Pro Ile Gly Val Gly Pro Asp Val Asp Met Gln Glu 1620 1625 1630 Leu Glu Arg Leu Ser Trp Pro Asn Ala Pro Ile Phe Ile Gln Asp Phe 1635 1640 1645 Glu Thr Leu Pro Arg Glu Ala Pro Asp Leu Val Leu Gln Arg Cys Cys 1650 1655 1660 Ser Gly Glu Gly Pro His Leu Pro Thr Gln Ala Pro Val Pro Asp Cys 1665 1670 1675 1680 Ser Gln Pro Leu Gly Val Val Leu Leu Leu Asp Gly Ser Ser Ser Leu 1685 1690 1695 Pro Ala Ser Tyr Phe Asp Glu Met Lys Ser Phe Thr Lys Ala Phe Ile 1700 1705 1710 Ser Lys Ala Asn Ile Gly Pro Gln Leu Thr Gln Val Ser Val Leu Gln 1715 1720 1725 Tyr Gly Ser Ile Thr Thr Ile Asp Leu Pro Trp Asn Met Pro Leu Glu 1730 1735 1740 Lys Ala His Leu Arg Gly Leu Val Asp Leu Met Gln Arg Glu Gly Gly 1745 1750 1755 1760 Pro Ser Gln Ile Gly Asp Ala Leu Gly Phe Ala Val Arg Tyr Val Met 1765 1770 1775 Ser Gln Val His Gly Ala Arg Pro Glu Ala Ser Lys Ala Val Val Ile 1780 1785 1790 Val Val Thr Asp Thr Ser Thr Asp Ser Val Asp Ala Ala Ala Ala Ala 1795 1800 1805 Ala Arg Ser Asn Arg Val Ala Val Phe Pro Ile Gly Ile Gly Asp Arg 1810 1815 1820 Tyr Asp Glu Ala Gln Leu Arg Thr Leu Ala Gly Pro Gly Ala Ser Ser 1825 1830 1835 1840 Asn Val Val Lys Leu Gln Arg Ile Glu Asp Leu Pro Thr Leu Val Thr 1845 1850 1855 Leu Gly Asn Ser Phe Leu His Lys Leu Cys Ser Gly Phe Val Arg Val 1860 1865 1870 Cys Ile Asp Glu Asp Gly Ser Glu Arg Lys Pro Gly Asp Val Trp Thr 1875 1880 1885 Leu Pro Asp Gln Cys His Thr Val Thr Cys Leu Pro Asp Gly Gln Thr 1890 1895 1900 Leu Leu Lys Ser His Arg Val Asn Cys Asp Gln Gly Leu Gln Pro Ser 1905 1910 1915 1920 Cys Pro Ser Asn Gln Pro Pro Ile Arg Val Glu Glu Ala Cys Gly Cys 1925 1930 1935 Arg Trp Thr Cys Pro Cys Val Cys Thr Gly Ser Ser Thr Arg His Ile 1940 1945 1950 Val Thr Phe Asp Gly Gln Asn Phe Lys Leu Met Gly Asn Cys Ser Tyr 1955 1960 1965 Val Leu Phe His Asn Lys Glu Gln Asp Leu Glu Val Ile Leu His Asn 1970 1975 1980 Gly Ala Cys Gly Ala Gly Ala Arg Gln Ala Cys Met Lys Ser Ile Glu 1985 1990 1995 2000 Val Lys His Asn Gly Leu Ser Val Glu Leu His Arg Asp Met Glu Val 2005 2010 2015 Val Val Asn Gly Arg Gln Val Ser Val Pro Tyr Val Gly Gly Asn Met 2020 2025 2030 Glu Val Gly Ile Tyr Gly Thr Ile Met Tyr Glu Val Arg Phe Asn His 2035 2040 2045 Leu Gly His Ile Leu Thr Phe Thr Pro Gln Asn Asn Glu Phe Gln Leu 2050 2055 2060 Gln Leu Ser Pro Lys Thr Phe Ala Ser Lys Met Tyr Gly Leu Cys Gly 2065 2070 2075 2080 Ile Cys Asp Glu Asn Gly Ala Asn Asp Phe Met Leu Arg Asp Gly Thr 2085 2090 2095 Val Thr Thr Asp Trp Lys Thr Met Val Gln Glu Trp Ala Val Gln Gln 2100 2105 2110 Pro Gly Gln Met Cys Gln Pro Val Pro Lys Glu Gln Cys Pro Val Ser 2115 2120 2125 Gly Gly Tyr Gln Cys Gln Val Leu Leu Ser Ala Leu Phe Ala Glu Cys 2130 2135 2140 His Lys Val Leu Ala Pro Ala Ala Tyr Phe Ala Ile Cys Gln Gln Asp 2145 2150 2155 2160 Ser Cys His Gln Glu Gln Val Cys Glu Ala Val Ala Ser Tyr Ala His 2165 2170 2175 Leu Cys Arg Thr Lys Gly Val Cys Val Asp Trp Arg Thr Pro Asp Phe 2180 2185 2190 Cys Ala Val Ser Cys Pro Pro Ser Leu Val Tyr Asn His Cys Glu His 2195 2200 2205 Gly Cys Pro Arg His Cys Glu Gly Asn Ser Ser Ser Cys Gly Asp His 2210 2215 2220 Pro Ser Glu Gly Cys Phe Cys Pro Pro His Gln Val Met Leu Gly Ser 2225 2230 2235 2240 Ser Cys Val Pro Glu Glu Ala Cys Thr Gln Cys Val Asp Asp Asp Gly 2245 2250 2255 Ile Arg His Gln Phe Leu Glu Thr Trp Val Pro Asp His Gln Pro Cys 2260 2265 2270 Gln Ile Cys Thr Cys Leu Ser Gly Arg Arg Val Asn Cys Thr Leu Gln 2275 2280 2285 Pro Cys Pro Thr Ala Arg Ala Pro Ala Cys Gly Leu Cys Glu Val Ala 2290 2295 2300 Arg Leu Arg Gln Glu Ala His Gln Cys Cys Pro Glu Tyr Glu Cys Val 2305 2310 2315 2320 Cys Asp Leu Val Ser Cys Asp Leu Pro Pro Val Pro His Cys Glu Gly 2325 2330 2335 Gly Leu Gln Pro Thr Leu Thr Asn Pro Gly Glu Cys Arg Pro Asn Phe 2340 2345 2350 Thr Cys Ala Cys Arg Lys Glu Glu Cys Pro Arg Gly Pro Leu Pro Ser 2355 2360 2365 Cys Pro Pro His Arg Thr Pro Ala Leu Arg Lys Thr Gln Cys Cys Asp 2370 2375 2380 Glu Tyr Glu Cys Ala Cys Asn Cys Val Asn Thr Thr Leu Ser Cys Pro 2385 2390 2395 2400 Leu Gly Tyr Leu Ala Ser Thr Val Thr Asn Asp Cys Gly Cys Thr Thr 2405 2410 2415 Thr Thr Cys Leu Pro Asp Lys Val Cys Val His Arg Gly Thr Val Tyr 2420 2425 2430 Pro Val Gly Gln Phe Trp Glu Glu Gly Cys Asp Val Cys Thr Cys Thr 2435 2440 2445 Asp Leu Glu Asp Ala Val Met Gly Leu Arg Val Ala Gln Cys Ala Gln 2450 2455 2460 Lys Pro Cys Glu Asp Ser Cys Arg Pro Gly Phe Thr Tyr Val Leu His 2465 2470 2475 2480 Glu Gly Glu Cys Cys Gly Lys Cys Leu Pro Ser Ala Cys Lys Val Val 2485 2490 2495 Ile Gly Ser Phe Arg Gly Asp Ser Val Ser Tyr Trp Lys Ser Val Gly 2500 2505 2510 Ser His Trp Ala Ser Pro Glu Asn Pro Cys Leu Ile Asn Glu Cys Val 2515 2520 2525 Arg Val Lys Glu Glu Val Phe Val Gln Gln Arg Asn Val Ser Cys Pro 2530 2535 2540 Met Leu Asp Val Pro Thr Cys Pro Val Gly Phe Gln Leu Ser Cys Lys 2545 2550 2555 2560 Thr Ser Gly Cys Cys Pro Thr Cys Arg Cys Glu Pro Val Glu Ala Cys 2565 2570 2575 Leu Leu Asn Gly Thr Ile Ile Gly Ala Gly Glu Ser Leu Met Ile Asp 2580 2585 2590 Val Cys Thr Thr Cys Arg Cys Met Leu Gln Glu Gly Val Val Phe Gly 2595 2600 2605 Phe Lys Leu Glu Cys Lys Lys Thr Thr Cys Glu Ala Cys Pro Leu Gly 2610 2615 2620 Tyr Lys Glu Glu Lys Met Pro Gly Glu Cys Cys Gly Arg Cys Leu Pro 2625 2630 2635 2640 Thr Ala Cys Thr Ile Gln Leu Arg Gly Gly Gln Ile Met Thr Leu Lys 2645 2650 2655 Arg Asp Glu Thr Leu Gln Asp Gly Cys Asp Ser His Phe Cys Arg Val 2660 2665 2670 Asn Glu Arg Gly Glu Tyr Ile Trp Glu Lys Arg Ile Thr Gly Cys Pro 2675 2680 2685 Pro Phe Asp Gln His Lys Cys Leu Ala Ala Gly Gly Lys Ile Met Lys 2690 2695 2700 Ile Pro Gly Thr Cys Cys Asp Thr Cys Glu Glu Pro Glu Cys Lys Asp 2705 2710 2715 2720 Met Thr Ala Arg Leu Gln Tyr Val Lys Val Gly Asn Cys Arg Ser Glu 2725 2730 2735 Glu Glu Val Asp Ile His Tyr Cys Gln Gly Lys Cys Thr Ser Lys Ala 2740 2745 2750 Val Tyr Ser Ile Asp Thr Glu Asp Val Glu Asp Gln Cys Ala Cys Cys 2755 2760 2765 Ser Pro Thr Arg Thr Glu Pro Met Gln Val Pro Leu Arg Cys Thr Asn 2770 2775 2780 Gly Ser Thr Ile Tyr His Glu Val Leu Asn Ala Ile Gln Cys Lys Cys 2785 2790 2795 2800 Ser Pro Arg Lys Cys Ser Lys 2805 <210> 9 <211> 1764 <212> DNA <213> Sus scrofa <400> 9 catggttctt agttggattt gttaaccact gcgccacgac gggaactccc gaaaatgaat 60 caactttgaa tgagtgggtg gatcgctgag aaagtcttct ttctcaaaaa aaggattcct 120 aaaaaaagga ttcttttttt aggtcctagg gcaggtgaaa actttggctt tcaaggggat 180 caagactcaa gggaagtgca tgtgtgtgtg cgtgtgtgtg tgtgtgtgtg tgtgtatgtg 240 agcgtgcaca ctgcactggc acacagtagg actatttggg gacgtaaatt aagaatggta 300 tctttctggt ggggagtgac ccctgggagg tcgggttcag tgggctggga aggggcccaga 360 ggctctccct gcaccgttct ggtctttcct cctcctgcag tcactgtgat ggtgtcaatc 420 tcacctgtga agcctgcgcg gaaccggtgc cccccacaga aggcccggtc agccccacca 480 caccctacga ggaggacacg ccagagccgc cgctgcacga cttcttctgc agcaaacttc 540 tggacctggt cttcctgctg gacggctctg acaagctgtc cgaggccgac ttcgaggccc 600 tgaaggtctt cgtggtgggc atgatggaac acctgcacat ctcccagaag cacatccgcg 660 tggcggtggt ggagtaccac gacggctccc acgcctacat ctcgctccag gaccgaaagc 720 ggccctcgga gctgcggcgc atcgccagcc aggtgaagta cgcgggcagc gaggtggctt 780 ccatcagcga ggttttgaag tacacgctct tccaaatctt tggcagggtc gaccggcccg 840 aagcctcccg tatagccctg ctgctcatgg ccagccagga gccacgccgg ctggcccaga 900 acttggcccg ctacctccag ggcctgaaga agaagaaggt caccgtgatt ccggtgggca 960 tcggacccca cgtcagcctc aagcagatcc gcctcatcga gaagcaggcc ccggagaaca 1020 aagcctttgt ggtcagcggt gtggacgagc tggagcagcg caagaacgag atcatcagct 1080 acctctgcga cctcgccccg gaagtgcccg cccctacgcg gcgcccccta gtggcccaag 1140 tcactgtggc gcctgagctc cccggggttt caacgctcga acccaagaag agaatggtct 1200 tggatgtggt gtttgtgctg gaagggtccg acaaggtcgg cgaggccaac ttcaacagga 1260 gcacggagtt tgtggaggaa gtgatccggc ggatggacgt gggccgggac agtgtccacg 1320 tcacggtgct gcagtactcg tatgtggtgg ccgtggagca ctccttcagg gaggcgcagt 1380 ccaaggggga agtcctgcag cgggtgcggg agatccgctt ccagggtggc aacaggacca 1440 acactgggct ggccctgcag tacctctcgg agcacagctt ctcagccagc cagggggacc 1500 gggaggaggc gcccaacctg gtctacatgg tcacaggaaa ccctgcctcg gatgagatca 1560 agcggatgcc gggagacatc caggtggtgc ccatcggggt gggccccgac gtggacatgc 1620 aggagctaga gcgcctcagc tggcccaatg cccccatctt catccaggac tttgagaccc 1680 tcccgcgaga ggcccctgat ctggtgctgc agagatgctg ctcgggggag gggccgcacc 1740 tcccaaccca agcccctgtg ccag 1764 <210> 10 <211> 225 <212> DNA <213> Artificial Sequence <400> 10 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggaccat cacagtgact gcagggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 11 <211> 225 <212> DNA <213> Artificial Sequence <400> 11 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 atagggacac catcacagtg actgcgtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 12 <211> 225 <212> DNA <213> Artificial Sequence <400> 12 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 atagggaacc ggtgcccccc acagagtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 13 <211> 225 <212> DNA <213> Artificial Sequence <400> 13 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggggtgc cccccacaga aggccgtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 14 <211> 102 <212> RNA <213> Artificial Sequence <400> 14 ggaccaucac agugacugca ggguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 15 <211> 102 <212> RNA <213> Artificial Sequence <400> 15 gggacaccau cacagugacu gcguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 16 <211> 102 <212> RNA <213> Artificial Sequence <400> 16 gggaaccggu gccccccaca gaguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 17 <211> 102 <212> RNA <213> Artificial Sequence <400> 17 ggggugcccc ccacagaagg ccguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102

Claims

1. Application of gRNA-vWF-gU2, gRNA-vWF-gD1 and NCN proteins in the preparation of the kit; The gRNA-vWF-gU2 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 15; the gRNA-vWF-gD1 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 16; the NCN protein is shown as in SEQ ID NO: 3; The method for preparing the NCN protein includes the following steps: (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacteria; (2) The recombinant bacteria were cultured in liquid culture medium at 30°C, then IPTG was added and the culture was induced at 25°C, and then the bacterial cells were collected. (3) The collected bacterial cells were broken down to collect the crude protein solution; (4) The His6-tagged fusion protein was purified from the crude protein solution by affinity chromatography; (5) The His6-tagged fusion protein was digested with His6-tagged enterokinase, and then the His6-tagged protein was removed with Ni-NTA resin to obtain purified NCN protein. The plasmid pKG-GE4 is shown in SEQ ID NO: 1; The kit is intended for use as follows (a), (b), or (c): (a) to prepare recombinant porcine fibroblasts; (b) to prepare von Willebrand disease (VHD) model pigs; (c) to prepare VHD cell models, VHD tissue models, or VHD organ models.

2. A method for preparing recombinant cells, comprising the following steps: co-transfecting porcine fibroblasts with gRNA-vWF-gU2, gRNA-vWF-gD1 and NCN protein to obtain recombinant cells; gRNA-vWF-gU2 is the gRNA-vWF-gU2 described in claim 1; gRNA-vWF-gD1 is the gRNA-vWF-gD1 described in claim 1; and NCN protein is the NCN protein described in claim 1.

3. The method as described in claim 2, characterized in that: The ratio of porcine fibroblasts, gRNA-vWF-gU2, gRNA-vWF-gD1, and NCN protein is as follows: 100,000 porcine fibroblasts: 0.8-1.2 μg gRNA-vWF-gU2: 0.8-1.2 μg gRNA-vWF-gD1: 3-5 μg NCN protein.

4. A kit comprising gRNA-vWF-gU2, gRNA-vWF-gD1, and NCN protein; gRNA-vWF-gU2 is the gRNA-vWF-gU2 described in claim 1; gRNA-vWF-gD1 is the gRNA-vWF-gD1 described in claim 1; NCN protein is the NCN protein described in claim 1; The kit is intended for use as follows (a), (b), or (c): (a) to prepare recombinant porcine fibroblasts; (b) to prepare von Willebrand disease (VHD) model pigs; (c) to prepare VHD cell models, VHD tissue models, or VHD organ models.

Images